Clone Name | bart49a06 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_483227.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1320 Score = 468 bits (236), Expect = e-128 Identities = 416/476 (87%) Strand = Plus / Plus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 87 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 146 Query: 171 tccaccatcatctgccacggtatgccctacccgaagaacctgcagacggccatggaggtg 230 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct: 147 tccaccatcatctgccacggtatgccctacccgaagaatctccagaccgccatggaggtg 206 Query: 231 gaggccatcgtcagggagaacggcgcggttcctgccaccatagccattctggatggtgta 290 |||||| |||| ||||||||||| ||||||||||||||||||||||||||| | || || Sbjct: 207 gaggccgtcgtgagggagaacggggcggttcctgccaccatagccattctgaacggcgtg 266 Query: 291 ccacatgttgggcttaacagtgaacagctgaagaacttggctataagtggaagtcagttt 350 ||||||||||| |||| | | || || |||||| ||||||| |||||||||| |||||| Sbjct: 267 ccacatgttggccttagcggcgagcaattgaagagcttggctgtaagtggaagacagttt 326 Query: 351 cagaagacagctagaagagatatcgcacaagttgttgcttcgggcggcaatggtgctacg 410 |||||||| |||||||| ||||| ||||| ||||| || || || || |||||||| || Sbjct: 327 cagaagacggctagaagggatattgcacatgttgtggcctctggtggtaatggtgcaaca 386 Query: 411 acggtctctgccaccatgttttttgctcacaaggttggtataccaatttttgtgactggg 470 || || |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 387 acagtttctgccactatgtttttcgctcataaggttggcataccaattttcgtaactgga 446 Query: 471 ggaattggaggcgtacacagatatggtgaaaaaaccatggacatctcctctgacttaact 530 || |||||||| || || ||| |||||||| | ||||||||||||||||| ||||||||| Sbjct: 447 gggattggaggtgttcatagaaatggtgaacagaccatggacatctcctcagacttaact 506 Query: 531 gaacttggaaagactcctgtggctgttatttcagccggtgtgaagtccattttgga 586 |||||||||||||||||||| ||||||||||||| |||||||| || |||||||| Sbjct: 507 gaacttggaaagactcctgtcactgttatttcagctggtgtgaaatctattttgga 562
>ref|XM_483226.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1256 Score = 468 bits (236), Expect = e-128 Identities = 416/476 (87%) Strand = Plus / Plus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 51 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 110 Query: 171 tccaccatcatctgccacggtatgccctacccgaagaacctgcagacggccatggaggtg 230 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct: 111 tccaccatcatctgccacggtatgccctacccgaagaatctccagaccgccatggaggtg 170 Query: 231 gaggccatcgtcagggagaacggcgcggttcctgccaccatagccattctggatggtgta 290 |||||| |||| ||||||||||| ||||||||||||||||||||||||||| | || || Sbjct: 171 gaggccgtcgtgagggagaacggggcggttcctgccaccatagccattctgaacggcgtg 230 Query: 291 ccacatgttgggcttaacagtgaacagctgaagaacttggctataagtggaagtcagttt 350 ||||||||||| |||| | | || || |||||| ||||||| |||||||||| |||||| Sbjct: 231 ccacatgttggccttagcggcgagcaattgaagagcttggctgtaagtggaagacagttt 290 Query: 351 cagaagacagctagaagagatatcgcacaagttgttgcttcgggcggcaatggtgctacg 410 |||||||| |||||||| ||||| ||||| ||||| || || || || |||||||| || Sbjct: 291 cagaagacggctagaagggatattgcacatgttgtggcctctggtggtaatggtgcaaca 350 Query: 411 acggtctctgccaccatgttttttgctcacaaggttggtataccaatttttgtgactggg 470 || || |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 351 acagtttctgccactatgtttttcgctcataaggttggcataccaattttcgtaactgga 410 Query: 471 ggaattggaggcgtacacagatatggtgaaaaaaccatggacatctcctctgacttaact 530 || |||||||| || || ||| |||||||| | ||||||||||||||||| ||||||||| Sbjct: 411 gggattggaggtgttcatagaaatggtgaacagaccatggacatctcctcagacttaact 470 Query: 531 gaacttggaaagactcctgtggctgttatttcagccggtgtgaagtccattttgga 586 |||||||||||||||||||| ||||||||||||| |||||||| || |||||||| Sbjct: 471 gaacttggaaagactcctgtcactgttatttcagctggtgtgaaatctattttgga 526
>dbj|AK072089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116B08, full insert sequence Length = 1320 Score = 468 bits (236), Expect = e-128 Identities = 416/476 (87%) Strand = Plus / Plus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 87 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 146 Query: 171 tccaccatcatctgccacggtatgccctacccgaagaacctgcagacggccatggaggtg 230 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct: 147 tccaccatcatctgccacggtatgccctacccgaagaatctccagaccgccatggaggtg 206 Query: 231 gaggccatcgtcagggagaacggcgcggttcctgccaccatagccattctggatggtgta 290 |||||| |||| ||||||||||| ||||||||||||||||||||||||||| | || || Sbjct: 207 gaggccgtcgtgagggagaacggggcggttcctgccaccatagccattctgaacggcgtg 266 Query: 291 ccacatgttgggcttaacagtgaacagctgaagaacttggctataagtggaagtcagttt 350 ||||||||||| |||| | | || || |||||| ||||||| |||||||||| |||||| Sbjct: 267 ccacatgttggccttagcggcgagcaattgaagagcttggctgtaagtggaagacagttt 326 Query: 351 cagaagacagctagaagagatatcgcacaagttgttgcttcgggcggcaatggtgctacg 410 |||||||| |||||||| ||||| ||||| ||||| || || || || |||||||| || Sbjct: 327 cagaagacggctagaagggatattgcacatgttgtggcctctggtggtaatggtgcaaca 386 Query: 411 acggtctctgccaccatgttttttgctcacaaggttggtataccaatttttgtgactggg 470 || || |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 387 acagtttctgccactatgtttttcgctcataaggttggcataccaattttcgtaactgga 446 Query: 471 ggaattggaggcgtacacagatatggtgaaaaaaccatggacatctcctctgacttaact 530 || |||||||| || || ||| |||||||| | ||||||||||||||||| ||||||||| Sbjct: 447 gggattggaggtgttcatagaaatggtgaacagaccatggacatctcctcagacttaact 506 Query: 531 gaacttggaaagactcctgtggctgttatttcagccggtgtgaagtccattttgga 586 |||||||||||||||||||| ||||||||||||| |||||||| || |||||||| Sbjct: 507 gaacttggaaagactcctgtcactgttatttcagctggtgtgaaatctattttgga 562
>dbj|AK069190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023006O19, full insert sequence Length = 1254 Score = 460 bits (232), Expect = e-126 Identities = 406/464 (87%) Strand = Plus / Plus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 51 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 110 Query: 171 tccaccatcatctgccacggtatgccctacccgaagaacctgcagacggccatggaggtg 230 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct: 111 tccaccatcatctgccacggtatgccctacccgaagaatctccagaccgccatggaggtg 170 Query: 231 gaggccatcgtcagggagaacggcgcggttcctgccaccatagccattctggatggtgta 290 |||||| |||| ||||||||||| ||||||||||||||||||||||||||| | || || Sbjct: 171 gaggccgtcgtgagggagaacggggcggttcctgccaccatagccattctgaacggcgtg 230 Query: 291 ccacatgttgggcttaacagtgaacagctgaagaacttggctataagtggaagtcagttt 350 ||||||||||| |||| | | || || |||||| ||||||| |||||||||| |||||| Sbjct: 231 ccacatgttggccttagcggcgagcaattgaagagcttggctgtaagtggaagacagttt 290 Query: 351 cagaagacagctagaagagatatcgcacaagttgttgcttcgggcggcaatggtgctacg 410 |||||||| |||||||| ||||| ||||| ||||| || || || || |||||||| || Sbjct: 291 cagaagacggctagaagggatattgcacatgttgtggcctctggtggtaatggtgcaaca 350 Query: 411 acggtctctgccaccatgttttttgctcacaaggttggtataccaatttttgtgactggg 470 || || |||||||| |||||||| ||||| |||||||| ||||||||||| || ||||| Sbjct: 351 acagtttctgccactatgtttttcgctcataaggttggcataccaattttcgtaactgga 410 Query: 471 ggaattggaggcgtacacagatatggtgaaaaaaccatggacatctcctctgacttaact 530 || |||||||| || || ||| |||||||| | ||||||||||||||||| ||||||||| Sbjct: 411 gggattggaggtgttcatagaaatggtgaacagaccatggacatctcctcagacttaact 470 Query: 531 gaacttggaaagactcctgtggctgttatttcagccggtgtgaa 574 |||||||||||||||||||| ||||||||||||| |||||||| Sbjct: 471 gaacttggaaagactcctgtcactgttatttcagctggtgtgaa 514
>gb|BT018093.1| Zea mays clone EL01N0552E08.c mRNA sequence Length = 1162 Score = 329 bits (166), Expect = 6e-87 Identities = 391/466 (83%) Strand = Plus / Plus Query: 121 cggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgagtccaccatca 180 ||||||||| | | || |||||||| |||| |||||||||||||||||||||||||||| Sbjct: 91 cggaggtcgcgactgctctcgcgagccgcggcgcggtcgtcgccctcgagtccaccatca 150 Query: 181 tctgccacggtatgccctacccgaagaacctgcagacggccatggaggtggaggccatcg 240 |||||||||||||||| ||||||||||| || |||| |||||||||||||||||||||| Sbjct: 151 tctgccacggtatgccgtacccgaagaatctccagatggccatggaggtggaggccatca 210 Query: 241 tcagggagaacggcgcggttcctgccaccatagccattctggatggtgtaccacatgttg 300 ||||||| ||||| || | ||||| ||||||||| | || || || || || || || | Sbjct: 211 tcagggacaacggggctatccctgcaaccatagccgtcctagacggagtccctcacgtcg 270 Query: 301 ggcttaacagtgaacagctgaagaacttggctataagtggaagtcagtttcagaagacag 360 | ||||||| ||||| |||||| ||||||||||||||||| || ||||||||||| | Sbjct: 271 gccttaacaacgaacaattgaagaggttggctataagtggaaggcaatttcagaagacgg 330 Query: 361 ctagaagagatatcgcacaagttgttgcttcgggcggcaatggtgctacgacggtctctg 420 ||||||| ||||| | || || | || || || ||||| || || || || || || | Sbjct: 331 ctagaagggatattgtccatgtcatcgcatctggtggcaacggcgcaacaacagtttcgg 390 Query: 421 ccaccatgttttttgctcacaaggttggtataccaatttttgtgactgggggaattggag 480 |||| ||||| ||||||||||||||||| |||||| ||||||| |||||||| ||||||| Sbjct: 391 ccactatgttctttgctcacaaggttggcataccagtttttgttactgggggcattggag 450 Query: 481 gcgtacacagatatggtgaaaaaaccatggacatctcctctgacttaactgaacttggaa 540 | || || ||| |||||||| |||| ||||| ||||||| ||||||||||||||||||| Sbjct: 451 gtgtgcatagacatggtgaacaaactatggatgtctcctcagacttaactgaacttggaa 510 Query: 541 agactcctgtggctgttatttcagccggtgtgaagtccattttgga 586 |||||||||| |||||| | || || |||||||||||||||||||| Sbjct: 511 agactcctgtagctgttgtatcggcaggtgtgaagtccattttgga 556
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 145 bits (73), Expect = 2e-31 Identities = 103/113 (91%) Strand = Plus / Minus Query: 189 ggtatgccctacccgaagaacctgcagacggccatggaggtggaggccatcgtcagggag 248 |||||||||||||||||||| || ||||| |||||||||||||||||| |||| |||||| Sbjct: 24927260 ggtatgccctacccgaagaatctccagaccgccatggaggtggaggccgtcgtgagggag 24927201 Query: 249 aacggcgcggttcctgccaccatagccattctggatggtgtaccacatgttgg 301 ||||| ||||||||||||||||||||||||||| | || || ||||||||||| Sbjct: 24927200 aacggggcggttcctgccaccatagccattctgaacggcgtgccacatgttgg 24927148 Score = 115 bits (58), Expect = 2e-22 Identities = 76/82 (92%) Strand = Plus / Minus Query: 505 ccatggacatctcctctgacttaactgaacttggaaagactcctgtggctgttatttcag 564 |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct: 24925367 ccatggacatctcctcagacttaactgaacttggaaagactcctgtcactgttatttcag 24925308 Query: 565 ccggtgtgaagtccattttgga 586 | |||||||| || |||||||| Sbjct: 24925307 ctggtgtgaaatctattttgga 24925286 Score = 107 bits (54), Expect = 4e-20 Identities = 75/82 (91%) Strand = Plus / Minus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 24927454 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 24927395 Query: 171 tccaccatcatctgccacggta 192 |||||||||||||||||||||| Sbjct: 24927394 tccaccatcatctgccacggta 24927373 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 319 tgaagaacttggctataagtggaagtcagtttcagaagacagctagaagagatatcgcac 378 |||||| ||||||| |||||||||| |||||||||||||| |||||||| ||||| |||| Sbjct: 24926992 tgaagagcttggctgtaagtggaagacagtttcagaagacggctagaagggatattgcac 24926933 Query: 379 aagttgt 385 | ||||| Sbjct: 24926932 atgttgt 24926926 Score = 46.1 bits (23), Expect = 0.13 Identities = 50/59 (84%) Strand = Plus / Minus Query: 442 aggttggtataccaatttttgtgactgggggaattggaggcgtacacagatatggtgaa 500 ||||||| ||||||||||| || ||||| || |||||||| || || ||| |||||||| Sbjct: 24926587 aggttggcataccaattttcgtaactggagggattggaggtgttcatagaaatggtgaa 24926529
>dbj|AP003883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1134_H03 Length = 135914 Score = 145 bits (73), Expect = 2e-31 Identities = 103/113 (91%) Strand = Plus / Minus Query: 189 ggtatgccctacccgaagaacctgcagacggccatggaggtggaggccatcgtcagggag 248 |||||||||||||||||||| || ||||| |||||||||||||||||| |||| |||||| Sbjct: 28975 ggtatgccctacccgaagaatctccagaccgccatggaggtggaggccgtcgtgagggag 28916 Query: 249 aacggcgcggttcctgccaccatagccattctggatggtgtaccacatgttgg 301 ||||| ||||||||||||||||||||||||||| | || || ||||||||||| Sbjct: 28915 aacggggcggttcctgccaccatagccattctgaacggcgtgccacatgttgg 28863 Score = 115 bits (58), Expect = 2e-22 Identities = 76/82 (92%) Strand = Plus / Minus Query: 505 ccatggacatctcctctgacttaactgaacttggaaagactcctgtggctgttatttcag 564 |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct: 27082 ccatggacatctcctcagacttaactgaacttggaaagactcctgtcactgttatttcag 27023 Query: 565 ccggtgtgaagtccattttgga 586 | |||||||| || |||||||| Sbjct: 27022 ctggtgtgaaatctattttgga 27001 Score = 107 bits (54), Expect = 4e-20 Identities = 75/82 (91%) Strand = Plus / Minus Query: 111 gcggtgtcgccggaggtcgaggccgcgctcgcgagaggcggggcggtcgtcgccctcgag 170 ||||||||||||||||| || || ||||| ||| | ||||| |||||||||||||||||| Sbjct: 29169 gcggtgtcgccggaggtggaagcggcgctggcgcgcggcggcgcggtcgtcgccctcgag 29110 Query: 171 tccaccatcatctgccacggta 192 |||||||||||||||||||||| Sbjct: 29109 tccaccatcatctgccacggta 29088 Score = 77.8 bits (39), Expect = 4e-11 Identities = 60/67 (89%) Strand = Plus / Minus Query: 319 tgaagaacttggctataagtggaagtcagtttcagaagacagctagaagagatatcgcac 378 |||||| ||||||| |||||||||| |||||||||||||| |||||||| ||||| |||| Sbjct: 28707 tgaagagcttggctgtaagtggaagacagtttcagaagacggctagaagggatattgcac 28648 Query: 379 aagttgt 385 | ||||| Sbjct: 28647 atgttgt 28641 Score = 46.1 bits (23), Expect = 0.13 Identities = 50/59 (84%) Strand = Plus / Minus Query: 442 aggttggtataccaatttttgtgactgggggaattggaggcgtacacagatatggtgaa 500 ||||||| ||||||||||| || ||||| || |||||||| || || ||| |||||||| Sbjct: 28302 aggttggcataccaattttcgtaactggagggattggaggtgttcatagaaatggtgaa 28244
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 50.1 bits (25), Expect = 0.008 Identities = 61/73 (83%) Strand = Plus / Minus Query: 162 gccctcgagtccaccatcatctgccacggtatgccctacccgaagaacctgcagacggcc 221 ||||| ||||| ||||||||| ||||||| ||||| ||||| ||||||||| || ||| Sbjct: 2089136 gccctggagtcgaccatcatcagccacggcatgccgtaccccgagaacctgcgcaccgcc 2089077 Query: 222 atggaggtggagg 234 ||||||||||| Sbjct: 2089076 cgggaggtggagg 2089064 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 111 gcggtgtcgccggaggtcgaggc 133 ||||||||||||||||||||||| Sbjct: 957709 gcggtgtcgccggaggtcgaggc 957687
>gb|AC144932.6| Mus musculus BAC clone RP24-462H2 from chromosome 6, complete sequence Length = 140840 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 418 ctgccaccatgttttttgctcac 440 ||||||||||||||||||||||| Sbjct: 75763 ctgccaccatgttttttgctcac 75785
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 173 caccatcatctgccacggtatgccctacccg 203 |||||||||| ||||||| |||||||||||| Sbjct: 2311575 caccatcatcagccacgggatgccctacccg 2311545
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gaggtcgaggccgcgctcgcg 143 ||||||||||||||||||||| Sbjct: 3241423 gaggtcgaggccgcgctcgcg 3241403
>gb|BT012730.1| Lycopersicon esculentum clone 113658R, mRNA sequence Length = 1360 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 528 actgaacttggaaagactcctgtggctgt 556 ||||| |||||||| |||||||||||||| Sbjct: 623 actgagcttggaaatactcctgtggctgt 651
>emb|AL590406.6| Human DNA sequence from clone RP11-418P12 on chromosome 6, complete sequence Length = 164831 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 gaagtcagtttcagaagacag 360 ||||||||||||||||||||| Sbjct: 38238 gaagtcagtttcagaagacag 38258
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 74 ggcgccgccgcgggaagacccgtcgccga 102 ||||||||||||||| ||||||| ||||| Sbjct: 1606553 ggcgccgccgcgggacgacccgtggccga 1606525
>gb|AC018517.7| Homo sapiens, clone RP11-115N12, complete sequence Length = 180917 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 22 gtctccggagaaatcagtcaaggaa 46 ||||| ||||||||||||||||||| Sbjct: 22518 gtctcaggagaaatcagtcaaggaa 22494
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 60 ccggggatgtcgaaggcgccg 80 ||||||||||||||||||||| Sbjct: 5942636 ccggggatgtcgaaggcgccg 5942616
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 122 ggaggtcgaggccgcgctcgc 142 ||||||||||||||||||||| Sbjct: 1852393 ggaggtcgaggccgcgctcgc 1852373
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 aggtcgaggccgcgctcgcg 143 |||||||||||||||||||| Sbjct: 1202034 aggtcgaggccgcgctcgcg 1202053
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 145 gaggcggggcggtcgtcgccctcg 168 ||||||||||||||| |||||||| Sbjct: 2310875 gaggcggggcggtcgccgccctcg 2310898
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 gtcgaaggcgccgccgcggg 87 |||||||||||||||||||| Sbjct: 1895197 gtcgaaggcgccgccgcggg 1895216
>ref|XM_591639.2| PREDICTED: Bos taurus similar to phosphofurin acidic cluster sorting protein 1 (LOC513882), partial mRNA Length = 1599 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 231 gacggccatggaggtggagg 212
>gb|AC118637.18| Mus musculus chromosome 8, clone RP24-107N18, complete sequence Length = 181693 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 514 tctcctctgacttaactgaacttg 537 |||||||| ||||||||||||||| Sbjct: 42917 tctcctctaacttaactgaacttg 42894
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 68 gtcgaaggcgccgccgcggg 87 |||||||||||||||||||| Sbjct: 1534699 gtcgaaggcgccgccgcggg 1534680
>ref|NM_008794.1| Mus musculus proprotein convertase subtilisin/kexin type 7 (Pcsk7), mRNA Length = 3390 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 495 gccatggaggtggaggccat 514
>gb|AF106564.3| Homo sapiens chromosome 8 clone GS1-72M22 map p21.2, complete sequence Length = 143212 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ttaacagtgaacagctgaag 323 |||||||||||||||||||| Sbjct: 79148 ttaacagtgaacagctgaag 79129
>ref|XM_752536.1| Ustilago maydis 521 hypothetical protein (UM01482.1) partial mRNA Length = 3066 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 gcggtcgtcgccctcgagtc 172 |||||||||||||||||||| Sbjct: 1485 gcggtcgtcgccctcgagtc 1466
>ref|XM_859198.1| PREDICTED: Canis familiaris hypothetical protein LOC609386 (LOC609386), mRNA Length = 462 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 67 tgtcgaaggcgccgccgcgggaag 90 |||||| ||||||||||||||||| Sbjct: 365 tgtcgacggcgccgccgcgggaag 342
>gb|BC007322.1| Mus musculus proprotein convertase subtilisin/kexin type 7, mRNA (cDNA clone IMAGE:3979585), containing frame-shift errors Length = 3637 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 786 gccatggaggtggaggccat 805
>gb|BC056456.1| Mus musculus proprotein convertase subtilisin/kexin type 7, mRNA (cDNA clone IMAGE:5715740), containing frame-shift errors Length = 3908 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 923 gccatggaggtggaggccat 942
>gb|AC129301.3| Mus musculus BAC clone RP24-434C14 from chromosome 8, complete sequence Length = 181111 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 514 tctcctctgacttaactgaacttg 537 |||||||| ||||||||||||||| Sbjct: 49831 tctcctctaacttaactgaacttg 49854
>gb|AC125059.4| Mus musculus BAC clone RP23-404P13 from chromosome 19, complete sequence Length = 189613 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 35699 gacggccatggaggtggagg 35680
>gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complete sequence Length = 196627 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 171430 gccatggaggtggaggccat 171411
>ref|XM_505275.1| Yarrowia lipolytica CLIB122, YALI0F11165g predicted mRNA Length = 1875 Score = 40.1 bits (20), Expect = 8.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 221 catggaggtggaggccatcgtcagggag 248 ||||||||||||||||| ||||| |||| Sbjct: 180 catggaggtggaggccagcgtcaaggag 207
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gaggtcgaggccgcgctcgc 142 |||||||||||||||||||| Sbjct: 1424397 gaggtcgaggccgcgctcgc 1424416
>gb|AC166343.1| Mus musculus BAC clone RP23-470N9 from chromosome 9, complete sequence Length = 191957 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 271 tagccattctggatggtgta 290 |||||||||||||||||||| Sbjct: 142517 tagccattctggatggtgta 142536
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 68 gtcgaaggcgccgccgcggg 87 |||||||||||||||||||| Sbjct: 1421787 gtcgaaggcgccgccgcggg 1421768
>emb|AL939127.1|SCO939127 Streptomyces coelicolor A3(2) complete genome; segment 24/29 Length = 290850 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 cggggcggtcgtcgccctcg 168 |||||||||||||||||||| Sbjct: 264668 cggggcggtcgtcgccctcg 264649
>emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on chromosome 11 Contains a ribosomal protein L7a (Rpl7a) pseudogene and the 3' end of the gene for a novel protein similar to Tensin Tns, complete sequence Length = 223491 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 485 acacagatatggtgaaaaaaccat 508 |||||||||||||| ||||||||| Sbjct: 136018 acacagatatggtggaaaaaccat 135995
>gb|AC009377.7| Drosophila melanogaster 3L BAC RP98-26P20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194308 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 450 ataccaatttttgtgactggggga 473 |||||| ||||||||||||||||| Sbjct: 94695 ataccattttttgtgactggggga 94718
>gb|AC009367.9| Drosophila melanogaster 3L BAC RP98-48B15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178239 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 450 ataccaatttttgtgactggggga 473 |||||| ||||||||||||||||| Sbjct: 143090 ataccattttttgtgactggggga 143113
>gb|AC091576.11| Homo sapiens chromosome 18, clone RP11-711I10, complete sequence Length = 162600 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 337 gtggaagtcagtttcagaag 356 |||||||||||||||||||| Sbjct: 46864 gtggaagtcagtttcagaag 46845
>dbj|AK151980.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830044H16 product:proprotein convertase subtilisin/kexin type 7, full insert sequence Length = 3399 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 510 gccatggaggtggaggccat 529
>gb|AC105359.3| Homo sapiens chromosome 8, clone XX-224N20, complete sequence Length = 122274 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 ttaacagtgaacagctgaag 323 |||||||||||||||||||| Sbjct: 26356 ttaacagtgaacagctgaag 26337
>dbj|AK154563.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630047J06 product:phosphofurin acidic cluster sorting protein 1, full insert sequence Length = 4735 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 332 gacggccatggaggtggagg 313
>dbj|AK148416.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370140D16 product:proprotein convertase subtilisin/kexin type 7, full insert sequence Length = 3397 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 508 gccatggaggtggaggccat 527
>dbj|AK165389.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched library, clone:F430213O08 product:proprotein convertase subtilisin/kexin type 7, full insert sequence Length = 3355 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 529 gccatggaggtggaggccat 548
>dbj|AK164770.1| Mus musculus 10 days lactation, adult female mammary gland cDNA, RIKEN full-length enriched library, clone:D730019A18 product:phosphofurin acidic cluster sorting protein 1, full insert sequence Length = 2848 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 369 gacggccatggaggtggagg 350
>dbj|AK171969.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830023A05 product:phosphofurin acidic cluster sorting protein 1, full insert sequence Length = 3090 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 442 gacggccatggaggtggagg 423
>ref|NM_153129.2| Mus musculus phosphofurin acidic cluster sorting protein 1 (Pacs1), mRNA Length = 4361 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 459 gacggccatggaggtggagg 440
>ref|NM_134406.1| Rattus norvegicus phosphofurin acidic cluster sorting protein 1 (Pacs1), mRNA Length = 4198 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 328 gacggccatggaggtggagg 309
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 gaggtcgaggccgcgctcgc 142 |||||||||||||||||||| Sbjct: 4515037 gaggtcgaggccgcgctcgc 4515018
>gb|AF246310.1|AF246310 Acidithiobacillus ferroxidans argininosuccinate lyase gene, partial sequence Length = 1789 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 ggaggtggaggccatcgtca 243 |||||||||||||||||||| Sbjct: 365 ggaggtggaggccatcgtca 384
>gb|BC062886.1| Mus musculus phosphofurin acidic cluster sorting protein 1, mRNA (cDNA clone MGC:86018 IMAGE:5706409), complete cds Length = 4361 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 459 gacggccatggaggtggagg 440
>gb|BC006730.1| Mus musculus proprotein convertase subtilisin/kexin type 7, mRNA (cDNA clone MGC:11587 IMAGE:3962441), complete cds Length = 3267 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 424 gccatggaggtggaggccat 443
>gb|AE003517.3| Drosophila melanogaster chromosome 3L, section 68 of 83 of the complete sequence Length = 257692 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 450 ataccaatttttgtgactggggga 473 |||||| ||||||||||||||||| Sbjct: 153824 ataccattttttgtgactggggga 153847
>gb|AF076184.1|AF076184 Rattus norvegicus cytosolic sorting protein PACS-1b (PACS-1) mRNA, complete cds Length = 2480 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 328 gacggccatggaggtggagg 309
>gb|AF076183.1|AF076183 Rattus norvegicus cytosolic sorting protein PACS-1a (PACS-1) mRNA, complete cds Length = 4198 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 328 gacggccatggaggtggagg 309
>emb|AL844560.5| Mouse DNA sequence from clone RP23-334M9 on chromosome 2, complete sequence Length = 185066 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 347 gtttcagaagacagctagaa 366 |||||||||||||||||||| Sbjct: 83896 gtttcagaagacagctagaa 83877
>gb|AC126804.3| Mus musculus BAC clone RP23-3F1 from 9, complete sequence Length = 223991 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 217742 gccatggaggtggaggccat 217761
>gb|AC122861.4| Mus musculus BAC clone RP23-140G16 from 19, complete sequence Length = 205150 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 gacggccatggaggtggagg 234 |||||||||||||||||||| Sbjct: 7166 gacggccatggaggtggagg 7185
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 40.1 bits (20), Expect = 8.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 221 catggaggtggaggccatcgtcagggag 248 ||||||||||||||||| ||||| |||| Sbjct: 1480434 catggaggtggaggccagcgtcaaggag 1480461
>gb|U75902.1|MMU75902 Mus musculus subtilisin-like serine protease LPC (PC7) gene, exons 1 to 9, partial cds Length = 10162 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 3157 gccatggaggtggaggccat 3176
>gb|U48830.1|MMU48830 Mus musculus subtilisin-like proprotein convertase-7 mRNA, complete cds Length = 3390 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 219 gccatggaggtggaggccat 238 |||||||||||||||||||| Sbjct: 495 gccatggaggtggaggccat 514
>emb|AL591488.7| Mouse DNA sequence from clone RP23-36P22 on chromosome 2, complete sequence Length = 191494 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 463 tgactgggggaattggaggc 482 |||||||||||||||||||| Sbjct: 170839 tgactgggggaattggaggc 170858
>emb|AL662893.12| Mouse DNA sequence from clone RP23-202G21 on chromosome 11, complete sequence Length = 205405 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 agaagacagctagaagagat 371 |||||||||||||||||||| Sbjct: 18399 agaagacagctagaagagat 18418
>dbj|AB070951.1| Streptomyces avermitilis peptide-2 biosynthetic gene cluster Length = 32748 Score = 40.1 bits (20), Expect = 8.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 gaggtcgaggccgcgctcgc 142 |||||||||||||||||||| Sbjct: 5823 gaggtcgaggccgcgctcgc 5842 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,092,962 Number of Sequences: 3902068 Number of extensions: 5092962 Number of successful extensions: 124859 Number of sequences better than 10.0: 66 Number of HSP's better than 10.0 without gapping: 66 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 123742 Number of HSP's gapped (non-prelim): 1112 length of query: 597 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 574 effective length of database: 17,143,297,704 effective search space: 9840252882096 effective search space used: 9840252882096 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)