Clone Name	bart48g02
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY103872.1| Zea mays PCO139073 mRNA sequence	299	5e-78
2	dbj|AK122050.1| Oryza sativa (japonica cultivar-group) cDNA clon...	228	2e-56
3	dbj|AK067431.1| Oryza sativa (japonica cultivar-group) cDNA clon...	226	7e-56
4	gb|AY111309.1| Zea mays CL2925_2 mRNA sequence	176	5e-41
5	ref|NM_121155.1| Arabidopsis thaliana ATP binding / ATP-dependen...	143	8e-31
6	gb|BT001052.1| Arabidopsis thaliana At5g11170/F2I11_60 mRNA, com...	143	8e-31
7	emb|AJ010466.1|ATH010466 Arabidopsis thaliana mRNA for DEAD box ...	143	8e-31
8	gb|AY052303.1| Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, com...	143	8e-31
9	ref|NM_180476.1| Arabidopsis thaliana ATP binding / ATP-dependen...	139	1e-29
10	emb|AL360314.1|ATF2I11 Arabidopsis thaliana DNA chromosome 5, BA...	133	7e-28
11	dbj|AK221708.1| Arabidopsis thaliana mRNA for DEAD BOX RNA helic...	131	3e-27
12	ref|NM_121158.2| Arabidopsis thaliana ATP binding / ATP-dependen...	127	5e-26
13	gb|AY059168.1| Arabidopsis thaliana AT5g11200/F2I11_90 mRNA, com...	127	5e-26
14	gb|AF378868.1|AF378868 Arabidopsis thaliana AT5g11200/F2I11_90 m...	127	5e-26
15	emb|BX830512.1|CNS0A08M Arabidopsis thaliana Full-length cDNA Co...	127	5e-26
16	emb|BX831239.1|CNS09YQC Arabidopsis thaliana Full-length cDNA Co...	123	7e-25
17	ref|NM_193392.1| Oryza sativa (japonica cultivar-group), predic...	121	3e-24
18	ref|NM_193389.1| Oryza sativa (japonica cultivar-group), predic...	119	1e-23
19	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	109	1e-20
20	dbj|AP004258.3| Oryza sativa (japonica cultivar-group) genomic D...	109	1e-20
21	dbj|AP004225.2| Oryza sativa (japonica cultivar-group) genomic D...	109	1e-20
22	gb|AC150787.15| Medicago truncatula clone mth2-171n13, complete ...	100	1e-17
23	ref|NM_001016000.2| Xenopus tropicalis hypothetical protein LOC5...	90	1e-14
24	emb|CR848287.2| Xenopus tropicalis finished cDNA, clone TNeu067f07	90	1e-14
25	emb|CR848283.2| Xenopus tropicalis finished cDNA, clone TNeu097p06	90	1e-14
26	emb|CR848282.2| Xenopus tropicalis finished cDNA, clone TNeu081j17	90	1e-14
27	ref|XM_512442.1| PREDICTED: Pan troglodytes similar to DEAD (Asp...	84	6e-13
28	gb|BC010455.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti...	84	6e-13
29	ref|NM_005804.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypep...	84	6e-13
30	gb|BC032128.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti...	84	6e-13
31	gb|AC145331.19| Medicago truncatula clone mth2-8o7, complete seq...	84	6e-13
32	gb|AC147471.14| Medicago truncatula clone mth2-7a7, complete seq...	84	6e-13
33	emb|AJ720994.1| Gallus gallus mRNA for hypothetical protein, clo...	84	6e-13
34	gb|BC001009.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti...	84	6e-13
35	emb|CR609572.1| full-length cDNA clone CS0DI081YC08 of Placenta ...	84	6e-13
36	emb|CR606167.1| full-length cDNA clone CS0DJ011YN14 of T cells (...	84	6e-13
37	emb|CR600064.1| full-length cDNA clone CS0DH004YC03 of T cells (...	84	6e-13
38	emb|CR599681.1| full-length cDNA clone CL0BB014ZF04 of Neuroblas...	84	6e-13
39	emb|CR599572.1| full-length cDNA clone CS0DA009YC18 of Neuroblas...	84	6e-13
40	emb|CR597385.1| full-length cDNA clone CS0DL004YD13 of B cells (...	84	6e-13
41	emb|CR592759.1| full-length cDNA clone CS0DF033YF12 of Fetal bra...	84	6e-13
42	emb|CR590674.1| full-length cDNA clone CS0DH002YN06 of T cells (...	84	6e-13
43	dbj|AK026614.1| Homo sapiens cDNA: FLJ22961 fis, clone KAT10214	84	6e-13
44	gb|U90426.1|HSU90426 Human nuclear RNA helicase, complete cds	84	6e-13
45	gb|BC044169.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid...	78	4e-11
46	gb|BC067555.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid...	78	4e-11
47	ref|NM_212977.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypept...	78	4e-11
48	ref|XM_518349.1| PREDICTED: Pan troglodytes similar to HLA-B ass...	76	1e-10
49	gb|BC000361.2| Homo sapiens HLA-B associated transcript 1, trans...	76	1e-10
50	gb|BC013006.2| Homo sapiens HLA-B associated transcript 1, trans...	76	1e-10
51	ref|NM_004640.5| Homo sapiens HLA-B associated transcript 1 (BAT...	76	1e-10
52	ref|NM_080598.4| Homo sapiens HLA-B associated transcript 1 (BAT...	76	1e-10
53	gb|BC004350.1| Homo sapiens cDNA clone IMAGE:3536103, **** WARNI...	76	1e-10
54	gb|BT009909.1| Homo sapiens HLA-B associated transcript 1 mRNA, ...	76	1e-10
55	emb|Z37166.1|HSBAT1MR H.sapiens BAT1 mRNA for nuclear RNA helica...	76	1e-10
56	gb|BT008096.1| Synthetic construct Homo sapiens HLA-B associated...	76	1e-10
57	dbj|AK127767.1| Homo sapiens cDNA FLJ45868 fis, clone OCBBF30044...	76	1e-10
58	emb|CR625065.1| full-length cDNA clone CS0DC019YE12 of Neuroblas...	76	1e-10
59	emb|CR623314.1| full-length cDNA clone CS0DE001YF24 of Placenta ...	76	1e-10
60	emb|CR620111.1| full-length cDNA clone CS0DC027YP22 of Neuroblas...	76	1e-10
61	emb|CR618145.1| full-length cDNA clone CS0DF037YN16 of Fetal bra...	76	1e-10
62	emb|CR614717.1| full-length cDNA clone CS0DI004YG11 of Placenta ...	76	1e-10
63	emb|CR612476.1| full-length cDNA clone CS0DE005YD10 of Placenta ...	76	1e-10
64	emb|CR612427.1| full-length cDNA clone CS0DG006YD05 of B cells (...	76	1e-10
65	emb|CR608752.1| full-length cDNA clone CS0DI039YK14 of Placenta ...	76	1e-10
66	emb|CR606599.1| full-length cDNA clone CS0DI053YJ09 of Placenta ...	76	1e-10
67	emb|CR601722.1| full-length cDNA clone CS0DF037YE15 of Fetal bra...	76	1e-10
68	emb|CR600093.1| full-length cDNA clone CS0DF025YD14 of Fetal bra...	76	1e-10
69	emb|CR596330.1| full-length cDNA clone CS0DE004YJ13 of Placenta ...	76	1e-10
70	emb|CR591582.1| full-length cDNA clone CS0DI066YK10 of Placenta ...	76	1e-10
71	emb|CR590279.1| full-length cDNA clone CS0DE011YJ14 of Placenta ...	76	1e-10
72	dbj|AK222912.1| Homo sapiens mRNA for HLA-B associated transcrip...	76	1e-10
73	gb|AY892786.1| Synthetic construct Homo sapiens clone FLH024340....	76	1e-10
74	gb|AY892785.1| Synthetic construct Homo sapiens clone FLH024339....	76	1e-10
75	gb|AY890316.1| Synthetic construct Homo sapiens clone FLH024344....	76	1e-10
76	gb|AY890315.1| Synthetic construct Homo sapiens clone FLH024343....	76	1e-10
77	dbj|AB209217.1| Homo sapiens mRNA for HLA-B associated transcrip...	76	1e-10
78	emb|CR859800.1| Pongo pygmaeus mRNA; cDNA DKFZp469F1834 (from cl...	74	6e-10
79	emb|CR857691.1| Pongo pygmaeus mRNA; cDNA DKFZp468K0120 (from cl...	74	6e-10
80	ref|NM_001005157.1| Sus scrofa HLA-B associated transcript 1 (BA...	74	6e-10
81	emb|Z54327.1|CEC26D10 Caenorhabditis elegans Cosmid C26D10, comp...	72	2e-09
82	gb|BC045125.1| Xenopus laevis nuclear RNA helicase, mRNA (cDNA c...	72	2e-09
83	ref|NM_001026815.1| Caenorhabditis elegans HELicase family membe...	72	2e-09
84	ref|NM_001026814.2| Caenorhabditis elegans HELicase family membe...	72	2e-09
85	gb|AF549950.1| Xenopus laevis clone S10-54-G3 mRNA sequence	72	2e-09
86	gb|U08102.1|CEU08102 Caenorhabditis elegans putative RNA helicas...	72	2e-09
87	gb|BC024859.1| Mus musculus HLA-B-associated transcript 1A, mRNA...	68	4e-08
88	dbj|AK171507.1| Mus musculus B6-derived CD11 +ve dendritic cells...	68	4e-08
89	dbj|AK088867.1| Mus musculus 2 days neonate thymus thymic cells ...	68	4e-08
90	dbj|AK051034.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	68	4e-08
91	ref|NM_001014377.1| Canis familiaris HLA-B associated transcript...	68	4e-08
92	gb|AF118128.1|AF118128 Mus musculus nuclear RNA helicase Bat1 mR...	68	4e-08
93	ref|NM_019693.2| Mus musculus HLA-B-associated transcript 1A (Ba...	68	4e-08
94	gb|BC071505.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid...	66	1e-07
95	ref|XM_968952.1| PREDICTED: Tribolium castaneum similar to CG726...	64	6e-07
96	gb|AC007080.2|AC007080 Mus musculus chromosome 17 clone BAC 205A...	62	2e-06
97	emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chr...	62	2e-06
98	gb|AY255787.1| Mus musculus strain BALB/c HLA-B associated trans...	60	9e-06
99	gb|AY255786.1| Mus musculus strain B10.D2 HLA-B associated trans...	60	9e-06
100	ref|XM_691844.1| PREDICTED: Danio rerio similar to DEAD (Asp-Glu...	60	9e-06
101	dbj|AB169496.1| Macaca fascicularis brain cDNA, clone: QccE-1126...	60	9e-06
102	emb|BX248081.12| Zebrafish DNA sequence from clone CH211-106H11 ...	60	9e-06
103	gb|BC011067.1| Mus musculus HLA-B-associated transcript 1A, mRNA...	60	9e-06
104	gb|BC102131.1| Bos taurus similar to HLA-B associated transcript...	58	3e-05
105	ref|NM_001033629.1| Bos taurus similar to HLA-B associated trans...	58	3e-05
106	gb|AF391287.1| Branchiostoma floridae cosmid MPMGc117C0356, part...	56	1e-04
107	gb|AY423389.1| Canis familiaris BAC 231G24 MHC class I locus, pa...	54	5e-04
108	ref|XM_533895.2| PREDICTED: Canis familiaris similar to DEAD (As...	52	0.002
109	ref|XM_755994.1| Ustilago maydis 521 hypothetical protein (UM049...	52	0.002
110	gb|BC072526.1| Rattus norvegicus cDNA clone IMAGE:7097268, conta...	50	0.008
111	emb|AJ251914.1|SSC251914 Sus scrofa MHC class I SLA genes, haplo...	50	0.008
112	gb|BC086328.1| Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box poly...	50	0.008
113	ref|NM_053563.2| Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box po...	50	0.008
114	emb|BX001040.14| Human DNA sequence from clone DAQB-72H16 on chr...	50	0.008
115	emb|BX248516.6| Human DNA sequence from clone DASS-161H22 on chr...	50	0.008
116	emb|AL662801.7| Human DNA sequence from clone XXbac-296P20 on ch...	50	0.008
117	emb|AL662847.6| Human DNA sequence from clone XXbac-270M2 on chr...	50	0.008
118	emb|Z34846.1|SSBAT1G S.scrofa BAT1 gene	50	0.008
119	emb|CR753820.15| Human DNA sequence from clone DADB-26I14 on chr...	50	0.008
120	emb|CR753864.4| Human DNA sequence from clone DAMA-BMC190B12 on ...	50	0.008
121	dbj|AB210170.1| Pan troglodytes NFKBIL1, ATP6V1G2, BAT1 genes fo...	50	0.008
122	dbj|AB210169.1| Pan troglodytes NFKBIL1, ATP6V1G2, BAT1 genes fo...	50	0.008
123	dbj|AB202112.1| Homo sapiens NFKBIL1, ATP6V1G2, BAT1 genes for n...	50	0.008
124	dbj|AK016960.1| Mus musculus adult male testis cDNA, RIKEN full-...	50	0.008
125	gb|AC148679.1| Macaca mulatta Major Histocompatibility Complex B...	50	0.008
126	emb|BX927320.5| Human DNA sequence from clone DAMA-25N12 on chro...	50	0.008
127	dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia...	50	0.008
128	dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA...	50	0.008
129	dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co...	50	0.008
130	emb|AL953855.9| Zebrafish DNA sequence from clone CH211-239F4 in...	50	0.008
131	dbj|AB054536.1| Pan troglodytes LTB, TNF alpha, LTA, IKBL, ATP6G...	50	0.008
132	emb|CR925799.3| Wallaby DNA sequence from clone GRWB-66O5, compl...	50	0.008
133	dbj|AB088115.1| Homo sapiens IKBL, ATP6G, BAT1 genes for nuclear...	50	0.008
134	gb|AC004181.1|AC004181 Homo sapiens clone UWGC:m9a from 6p21, co...	50	0.008
135	gb|AF063447.1|AF063447 Rattus norvegicus nuclear RNA helicase mR...	50	0.008
136	emb|CT033635.1| Platynereis dumerilii EST IB0AAA17AE03EM1	50	0.008
137	emb|CT033441.1| Platynereis dumerilii EST IB0AAA20BC01EM1	50	0.008
138	emb|CT033309.1| Platynereis dumerilii EST IB0AAA22DB06EM1	50	0.008
139	emb|CT033123.1| Platynereis dumerilii EST IB0AAA26BF04EM1	50	0.008
140	emb|CT033090.1| Platynereis dumerilii EST IB0AAA27AA10EM1	50	0.008
141	emb|CT033006.1| Platynereis dumerilii EST IB0AAA28AF08EM1	50	0.008
142	emb|CT032528.1| Platynereis dumerilii EST IB0AAA36DE03EM1	50	0.008
143	emb|Y14768.1|HSY14768 Homo sapiens DNA, cosmid clones TN62 and TN82	50	0.008
144	dbj|AB000882.1| Homo sapiens genomic DNA for centromeric end of ...	50	0.008
145	dbj|AB000876.1| Homo sapiens genomic DNA for centromeric end of ...	50	0.008
146	gb|AY223417.1| Schistosoma japonicum clone ZZZ368 mRNA sequence	48	0.033
147	gb|AC008569.7| Homo sapiens chromosome 19 clone CTC-548K16, comp...	48	0.033
148	gb|AY815776.1| Schistosoma japonicum clone SJCHGC00402 unknown mRNA	48	0.033
149	gb|AY815994.1| Schistosoma japonicum clone SJCHGC00403 unknown mRNA	48	0.033
150	gb|BC106294.1| Xenopus laevis similar to nuclear RNA helicase, m...	46	0.13
151	gb|BC042330.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptid...	46	0.13
152	ref|NM_199721.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypept...	46	0.13
153	gb|BC045239.1| Xenopus laevis similar to nuclear RNA helicase, m...	46	0.13
154	gb|AY298950.1| Xenopus laevis DECD-box RNA helicase (DDX39) mRNA...	46	0.13
155	ref|NM_203720.1| Xenopus tropicalis ubiquitin-conjugating enzyme...	46	0.13
156	emb|CR762313.2| Xenopus tropicalis finished cDNA, clone TGas109f01	46	0.13
157	gb|BC061341.1| Xenopus tropicalis ubiquitin-conjugating enzyme E...	46	0.13
158	dbj|AB008925.1| Secale cereale gene, repeat sequence, clone pScJNK4	46	0.13
159	dbj|AB008922.1| Secale cereale gene for repeat sequence	46	0.13
160	ref|XM_366730.1| Magnaporthe grisea 70-15 chromosome VII hypothe...	44	0.52
161	ref|XM_499972.1| Yarrowia lipolytica CLIB122, YALI0A11157g predi...	44	0.52
162	emb|AL031863.1|DMCEG0003 Drosophila melanogaster cosmid EG0003	44	0.52
163	ref|NM_080069.3| Drosophila melanogaster Elongation factor 1 CG6...	44	0.52
164	dbj|AK146294.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	44	0.52
165	gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53...	44	0.52
166	gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53...	44	0.52
167	gb|AF172636.1| Drosophila melanogaster LD24492 full insert cDNA	44	0.52
168	gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45...	44	0.52
169	gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s...	44	0.52
170	emb|CT033113.1| Platynereis dumerilii EST IB0AAA26CA01EM1	44	0.52
171	emb|CT033026.1| Platynereis dumerilii EST IB0AAA27DB01EM1	44	0.52
172	emb|CT032448.1| Platynereis dumerilii EST IB0AAA38AE03EM1	44	0.52
173	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	44	0.52
174	ref|NM_133300.2| Rattus norvegicus HLA-B-associated transcript 1...	42	2.1
175	ref|NM_197982.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypep...	42	2.1
176	gb|AC005011.2| Homo sapiens BAC clone GS1-111G14 from 7, complet...	42	2.1
177	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	42	2.1
178	emb|AL161940.6| Human DNA sequence from clone RP11-459I16 on chr...	42	2.1
179	emb|BX883046.1| Rattus norvegicus chromosome 20, major histocomp...	42	2.1
180	gb|AC164432.3| Mus musculus BAC clone RP23-394G23 from chromosom...	42	2.1
181	emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom...	42	2.1
182	emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete ...	42	2.1
183	emb|AL662986.3|OSJN00187 Oryza sativa genomic DNA, chromosome 4,...	42	2.1
184	emb|AJ428513.1|CTE428513 Chironomus tentans mRNA for HEL protein	42	2.1
185	emb|AJ314857.1|RNO314857 Rattus norvegicus Nfkbil1 gene (partial...	42	2.1
186	gb|AC091714.3| Papio anubis clone RP41-93A16, complete sequence	42	2.1
187	emb|CR627388.1| Homo sapiens mRNA; cDNA DKFZp781L1171 (from clon...	42	2.1
188	gb|AF387339.1| Rattus norvegicus IkBL, vacuolar ATPase NG38, Bat...	42	2.1
189	dbj|AK137114.1| Mus musculus 12 days embryo embryonic body betwe...	42	2.1
190	dbj|AK150997.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	2.1
191	dbj|AK145927.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu...	42	2.1
192	dbj|AK149475.1| Mus musculus adult male liver tumor cDNA, RIKEN ...	42	2.1
193	dbj|AK152394.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	2.1
194	dbj|AK151395.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	42	2.1
195	dbj|AK164289.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	42	2.1
196	dbj|AK168079.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	42	2.1
197	dbj|AK162752.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	42	2.1
198	dbj|AK167890.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	42	2.1
199	dbj|AK172448.1| Mus musculus activated spleen cDNA, RIKEN full-l...	42	2.1
200	dbj|AK012002.1| Mus musculus 10 days embryo whole body cDNA, RIK...	42	2.1
201	dbj|AK011285.1| Mus musculus 10 days embryo whole body cDNA, RIK...	42	2.1
202	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
203	gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot...	42	2.1
204	gb|AC010899.8| Homo sapiens BAC clone RP11-543K1 from 2, complet...	42	2.1
205	gb|AC138982.2| Homo sapiens chromosome 5 clone RP13-284O6, compl...	42	2.1
206	gb|AF293977.1|AF293977 Aeromonas hydrophila htrA-like serine pro...	42	2.1
207	gb|AC091658.3| Papio anubis clone RP41-353N1, complete sequence	42	2.1
208	gb|AF245690.1|AF245690 Streptomyces verticillus putative N-acety...	42	2.1
209	gb|BC080243.1| Rattus norvegicus HLA-B-associated transcript 1A,...	42	2.1
210	gb|BC020134.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti...	42	2.1
211	gb|AC134525.5| Mus musculus BAC clone RP24-496F7 from 8, complet...	42	2.1
212	gb|AC092266.4| Homo sapiens chromosome 5 clone RP11-24P24, compl...	42	2.1
213	emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chro...	42	2.1
214	emb|AL805950.11| Mouse DNA sequence from clone RP23-134I15 on ch...	42	2.1
215	gb|M75168.1|RATP49A Rattus norvegicus liver nuclear protein p47 ...	42	2.1
216	dbj|AP003778.3| Homo sapiens genomic DNA, chromosome 11q clone:R...	42	2.1
217	dbj|AP002780.3| Homo sapiens genomic DNA, chromosome 11q, clone:...	42	2.1
218	ref|XM_516634.1| PREDICTED: Pan troglodytes similar to MEMD prot...	40	8.2
219	gb|BC082368.1| Xenopus laevis MGC81606 protein, mRNA (cDNA clone...	40	8.2
220	ref|XM_956777.1| Neurospora crassa OR74A hypothetical protein (N...	40	8.2
221	gb|AC117780.5| Mus musculus chromosome 16, clone RP24-540H15, co...	40	8.2
222	gb|DQ486140.1| Homo sapiens activated leukocyte cell adhesion mo...	40	8.2
223	gb|DQ486139.1| Homo sapiens activated leukocyte cell adhesion mo...	40	8.2
224	ref|XM_324522.1| Neurospora crassa OR74A hypothetical protein (N...	40	8.2
225	ref|XM_603932.2| PREDICTED: Bos taurus similar to zinc finger pr...	40	8.2
226	ref|NM_009655.1| Mus musculus activated leukocyte cell adhesion ...	40	8.2
227	gb|AF431414.1| Uncultured Acidobacterium group bacterium clone C...	40	8.2
228	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	8.2
229	gb|AC119219.6| Mus musculus chromosome 12, clone RP24-201C18, co...	40	8.2
230	gb|AC129561.13| Mus musculus chromosome 1, clone RP23-192P10, co...	40	8.2
231	emb|Z81545.1|CEF49H6 Caenorhabditis elegans Cosmid F49H6, comple...	40	8.2
232	gb|AC131748.3| Mus musculus BAC clone RP23-42A17 from 12, comple...	40	8.2
233	gb|BC047985.1| Xenopus laevis ubiquitin-conjugating enzyme E2G 1...	40	8.2
234	gb|BC029639.1| Homo sapiens cDNA clone IMAGE:4931979, containing...	40	8.2
235	emb|AL683842.11| Human DNA sequence from clone RP11-47G11 on chr...	40	8.2
236	emb|AL354853.12| Human DNA sequence from clone RP11-555F9 on chr...	40	8.2
237	emb|AL138769.7| Human DNA sequence from clone RP1-33E13 on chrom...	40	8.2
238	emb|BX054630.1|CNS09EBE Single read from an extremity of a full-...	40	8.2
239	gb|AC023602.5| Homo sapiens 3 BAC RP11-16N5 (Roswell Park Cancer...	40	8.2
240	ref|XM_793966.1| PREDICTED: Strongylocentrotus purpuratus simila...	40	8.2
241	emb|CR860656.1| Pongo pygmaeus mRNA; cDNA DKFZp459H0124 (from cl...	40	8.2
242	emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete ...	40	8.2
243	emb|BX842687.13| Zebrafish DNA sequence from clone DKEY-97L11 in...	40	8.2
244	dbj|AK054632.1| Homo sapiens cDNA FLJ30070 fis, clone ASTRO20000...	40	8.2
245	dbj|AB228010.1| Aspergillus oryzae cDNA, contig sequence: AoEST4883	40	8.2
246	dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113	40	8.2
247	dbj|AK139073.1| Mus musculus 7 days neonate cerebellum cDNA, RIK...	40	8.2
248	gb|AC022447.6| Homo sapiens chromosome 5 clone RP11-5N11, comple...	40	8.2
249	gb|U95030.1|MMU95030 Mus musculus activated leukocyte cell adhes...	40	8.2
250	gb|BC085301.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti...	40	8.2
251	dbj|AB169388.1| Macaca fascicularis testis cDNA, clone: QtsA-195...	40	8.2
252	gb|AF145785.1|SBVP1S1 Sorghum bicolor genomic sequence similar t...	40	8.2
253	dbj|AK031391.1| Mus musculus 13 days embryo male testis cDNA, RI...	40	8.2
254	gb|AC010469.7|AC010469 Homo sapiens chromosome 5 clone CTD-2290C...	40	8.2
255	dbj|AK030851.1| Mus musculus adult male thymus cDNA, RIKEN full-...	40	8.2
256	ref|XM_624891.1| PREDICTED: Apis mellifera similar to ENSANGP000...	40	8.2
257	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
258	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
259	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
260	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
261	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
262	gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot...	40	8.2
263	gb|AF148558.1|SBISVP1 Sorghum bicolor insertion sequence IS9530 ...	40	8.2
264	gb|AC154629.2| Mus musculus BAC clone RP23-313M15 from chromosom...	40	8.2
265	gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome...	40	8.2
266	dbj|AP005303.3| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
267	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	8.2
268	dbj|AP005735.3| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
269	dbj|AB003026.1| Mus musculus mRNA for MuSC, complete cds	40	8.2
270	dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
271	emb|AJ428493.1|OSA428493 Oryza sativa ccr gene for cinnamoyl CoA...	40	8.2
272	gb|AC008109.6|AC008109 Homo sapiens chromosome 18, clone RP11-47...	40	8.2
273	gb|BC027280.1| Mus musculus activated leukocyte cell adhesion mo...	40	8.2
274	gb|AY105015.1| Zea mays PCO137646 mRNA sequence	40	8.2
275	gb|AF067776.1|AF067776 Abiotrophia defectiva extracellular matri...	40	8.2
276	ref|NM_001627.2| Homo sapiens activated leukocyte cell adhesion ...	40	8.2
277	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	40	8.2
278	emb|AL954871.5|CNS08CDA Oryza sativa chromosome 12, . BAC OSJNBb...	40	8.2
279	emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa...	40	8.2
280	ref|NM_001024922.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box poly...	40	8.2
281	gb|BC099554.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypepti...	40	8.2
282	gb|AC122908.4| Mus musculus BAC clone RP23-51D10 from 1, complet...	40	8.2
283	emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chr...	40	8.2
284	gb|L38608.1|HUMALCAM Homo sapiens CD6 ligand (ALCAM) mRNA, compl...	40	8.2
285	emb|AL583892.13| Mouse DNA sequence from clone RP23-32G7 on chro...	40	8.2
286	emb|Y10183.1|HSMEMD H.sapiens mRNA for MEMD protein	40	8.2
287	emb|AL833702.1|HSM805015 Homo sapiens mRNA; cDNA DKFZp667I089 (f...	40	8.2
288	gb|L25274.1|MUSDMGRASP Mus musculus transmembrane glycoprotein (...	40	8.2
289	dbj|AB008924.1| Secale cereale gene, repeat sequence, clone pScJNK3	40	8.2

---

>gb|AY103872.1| Zea mays PCO139073 mRNA sequence
          Length = 1785

 Score =  299 bits (151), Expect = 5e-78
 Identities = 377/451 (83%), Gaps = 6/451 (1%)
 Strand = Plus / Plus

                                                                       
Query: 152 ggagaacgacgtgtacgaggatgagctgctcgactacgaggaggacgacgacaaggtggt 211
           |||||||||||| || ||||| ||||| || ||||||||||||||||||||||||  |||
Sbjct: 220 ggagaacgacgtttatgaggaggagctcctggactacgaggaggacgacgacaagacggt 279

                                                                       
Query: 212 cctcgaagcctccgctgccaagcccgccgccga---cgccaagaagggctacgtcggcat 268
           |   || | ||||||||| |||||| |||  ||   ||| ||||||||||||||||| ||
Sbjct: 280 c---gatggctccgctgctaagcccaccggagaggtcgcaaagaagggctacgtcgggat 336

                                                                       
Query: 269 ccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatccagga 328
           |||||| ||||| ||| | |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 337 ccacagttccggtttcagagacttcctgctcaagccagagctgctccgtgctatccagga 396

                                                                       
Query: 329 ctgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctcgg 388
            || || || ||||| ||||||||||||||||| ||||| ||||||||||| || || ||
Sbjct: 397 ttgtggttttgagcatccttccgaagtgcaacacgagtgtatccctcaagccattcttgg 456

                                                                       
Query: 389 aatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcctgtc 448
           ||||||||||||||| ||||| ||||| |||||||| || |||||||| |||||||| ||
Sbjct: 457 aatggatgtcatctgtcaagctaaatctgggatggggaaaactgctgtttttgtcctttc 516

                                                                       
Query: 449 ttctctccagcagatcgatcctactgctggtcaggtggcagcacttgtattgtgccacac 508
            || ||||| || || || |||  ||| |||||||| |||||||||||| ||||||||||
Sbjct: 517 atccctccaacaaattgaccctgttgcgggtcaggtagcagcacttgtactgtgccacac 576

                                                                       
Query: 509 cagagagctggcttaccagatttgcagcgagttcgagaggttcagcagatttctgcctga 568
            || || |||||||| ||||| |||  ||| || ||||||||||||| || |||  ||||
Sbjct: 577 aagggaactggcttatcagatatgccacgaatttgagaggttcagcaaatatcttactga 636

                                          
Query: 569 aattaaggttgctgtattctatggaggtgtt 599
           | |||| |||||||| |||||||||||||||
Sbjct: 637 agttaaagttgctgtcttctatggaggtgtt 667

---

>dbj|AK122050.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033114G10, full
           insert sequence
          Length = 1731

 Score =  228 bits (115), Expect = 2e-56
 Identities = 253/299 (84%)
 Strand = Plus / Plus

                                                                       
Query: 235 ccgccgccgacgccaagaagggctacgtcggcatccacagctccggattccgcgacttcc 294
           |||||| || || ||||||||| ||||| || ||||||||||| || ||| | |||||||
Sbjct: 198 ccgccgacgtcgtcaagaaggggtacgtggggatccacagctcggggttcagagacttcc 257

                                                                       
Query: 295 tcctcaagcccgagctgctacgggccatccaggactgcggattcgagcacccttccgaag 354
           | |||||||| |||||||| || ||||||||||||||||| || ||||||||||||||||
Sbjct: 258 tgctcaagccggagctgcttcgcgccatccaggactgcgggtttgagcacccttccgaag 317

                                                                       
Query: 355 tgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaat 414
           ||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||||
Sbjct: 318 tgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaaat 377

                                                                       
Query: 415 ccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctactg 474
           | |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  ||
Sbjct: 378 ctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgttg 437

                                                                      
Query: 475 ctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttgc 533
           ||||||| || |  ||||||||  | || ||||| || ||||| |||||||||||||||
Sbjct: 438 ctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccagatttgc 496



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 156 aacgacgtgtacgaggatgagctgctcgactacgaggagga 196
           ||||| ||||||||||| || ||  ||||||||||||||||
Sbjct: 113 aacgaggtgtacgaggaggatctcgtcgactacgaggagga 153

---

>dbj|AK067431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013107H03, full
           insert sequence
          Length = 1866

 Score =  226 bits (114), Expect = 7e-56
 Identities = 243/286 (84%)
 Strand = Plus / Plus

                                                                       
Query: 248 caagaagggctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccga 307
           ||||||||| ||||| || ||||||||||| || ||| | |||||||| |||||||| ||
Sbjct: 316 caagaaggggtacgtggggatccacagctcagggttcagagacttcctgctcaagccgga 375

                                                                       
Query: 308 gctgctacgggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtg 367
           |||||| || ||||||||||||||||| || ||||||||||||||||||||||| || ||
Sbjct: 376 gctgcttcgcgccatccaggactgcgggtttgagcacccttccgaagtgcaacacgaatg 435

                                                                       
Query: 368 catccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccgggatgggcaa 427
           |||||| ||||| || || ||||||||||||||||||||||||||||| |||||||| ||
Sbjct: 436 catcccacaagccattcttggaatggatgtcatctgccaagcaaaatctgggatggggaa 495

                                                                       
Query: 428 gactgctgtctttgtcctgtcttctctccagcagatcgatcctactgctggtcaggtggc 487
           ||||||||| ||||| || ||   ||| ||||| || ||||||  ||||||||| || | 
Sbjct: 496 gactgctgtttttgttctctcaagtcttcagcaaattgatcctgttgctggtcaagttgg 555

                                                         
Query: 488 agcacttgtattgtgccacaccagagagctggcttaccagatttgc 533
            ||||||||  | || ||||| || ||||| |||||||||||||||
Sbjct: 556 tgcacttgtgctatgtcacacaagggagctagcttaccagatttgc 601

---

>gb|AY111309.1| Zea mays CL2925_2 mRNA sequence
          Length = 1457

 Score =  176 bits (89), Expect = 5e-41
 Identities = 245/296 (82%), Gaps = 2/296 (0%)
 Strand = Plus / Plus

                                                                       
Query: 305 cgagctgctacgggccatccaggactgcggattcgagcacccttccgaagtgcaacatga 364
           |||||| || || ||||| ||||| ||||| || ||||| ||||| ||||||||||||||
Sbjct: 2   cgagcttcttcgcgccattcaggattgcgggtttgagcatccttctgaagtgcaacatga 61

                                                                       
Query: 365 gtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccgggatggg 424
           ||||||||||||||| || || ||||||||||||||||| ||||||||||| || |||||
Sbjct: 62  gtgcatccctcaagctattcttggaatggatgtcatctgtcaagcaaaatctggaatggg 121

                                                                       
Query: 425 caagactgctgtctttgtcctgtcttctctccagcagatcgatcctactgctggtcaggt 484
            |||||||| |     ||||||||  |||| |||||||| ||||||  |||||| || ||
Sbjct: 122 taagactgcagnnnnngtcctgtcaactcttcagcagattgatcctgttgctggccaagt 181

                                                                       
Query: 485 ggcagcacttgtattgtgccacaccagagagctggcttaccagatttgcagcgagttcga 544
            || |||||||| ||||||||||| |||||  | |||||||||||||||   || || ||
Sbjct: 182 agctgcacttgtgttgtgccacacaagagaattagcttaccagatttgccatgaatttga 241

                                                                   
Query: 545 gaggttcagcagatttctgcctgaaattaag-gttgctgtattctatggaggtgtt 599
           |||||| |||| ||  ||||||| ||||||| || ||||| |||||||| ||||||
Sbjct: 242 gaggtttagcaaatacctgcctg-aattaagagtagctgttttctatggtggtgtt 296

---

>ref|NM_121155.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G11170 transcript
           variant AT5G11170.1 mRNA, complete cds
          Length = 1693

 Score =  143 bits (72), Expect = 8e-31
 Identities = 156/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           |||||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||
Sbjct: 306 gaagtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagca 365

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 366 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 425

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 426 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 485

               
Query: 531 tgca 534
           ||||
Sbjct: 486 tgca 489

---

>gb|BT001052.1| Arabidopsis thaliana At5g11170/F2I11_60 mRNA, complete cds
          Length = 1284

 Score =  143 bits (72), Expect = 8e-31
 Identities = 156/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           |||||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||
Sbjct: 211 gaagtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagca 270

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 271 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 330

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 331 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 390

               
Query: 531 tgca 534
           ||||
Sbjct: 391 tgca 394

---

>emb|AJ010466.1|ATH010466 Arabidopsis thaliana mRNA for DEAD box RNA helicase, RH15
          Length = 1635

 Score =  143 bits (72), Expect = 8e-31
 Identities = 156/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           |||||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||
Sbjct: 285 gaagtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagca 344

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 345 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 404

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 405 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 464

               
Query: 531 tgca 534
           ||||
Sbjct: 465 tgca 468

---

>gb|AY052303.1| Arabidopsis thaliana AT5g11170/F2I11_60 mRNA, complete cds
          Length = 1693

 Score =  143 bits (72), Expect = 8e-31
 Identities = 156/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           |||||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||
Sbjct: 306 gaagtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagca 365

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 366 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 425

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 426 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 485

               
Query: 531 tgca 534
           ||||
Sbjct: 486 tgca 489

---

>ref|NM_180476.1| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G11170 transcript
           variant AT5G11170.2 mRNA, complete cds
          Length = 1438

 Score =  139 bits (70), Expect = 1e-29
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 353 agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
           |||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||||
Sbjct: 53  agtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagcaaa 112

                                                                       
Query: 413 atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
            || || ||||| ||||||||||| |||||||||||| |||| || ||||| || ||  |
Sbjct: 113 gtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaaccatc 172

                                                                       
Query: 473 tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttg 532
           | |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| ||
Sbjct: 173 tcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatctg 232

             
Query: 533 ca 534
           ||
Sbjct: 233 ca 234

---

>emb|AL360314.1|ATF2I11 Arabidopsis thaliana DNA chromosome 5, BAC clone F2I11 (ESSA project)
          Length = 110992

 Score =  133 bits (67), Expect = 7e-28
 Identities = 148/175 (84%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             |||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||||
Sbjct: 16996 agtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagcaaa 17055

                                                                         
Query: 413   atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
              || || ||||| ||||||||||| |||||||||||| |||| || ||||| || ||  |
Sbjct: 17056 gtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaaccatc 17115

                                                                    
Query: 473   tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
             | |||| |||||  | |||||||| |||||||| || |||||||| |||||||||
Sbjct: 17116 tcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccag 17170



 Score =  117 bits (59), Expect = 4e-23
 Identities = 146/175 (83%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             ||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||||
Sbjct: 31037 agtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagcaaa 31096

                                                                         
Query: 413   atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
              || || ||||| ||||||||||| |||||||||||| |||| || ||||| || ||  |
Sbjct: 31097 gtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaaccatc 31156

                                                                    
Query: 473   tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
             | |||| |||||  | |||||||| |||||||| || |||||||| |||||||||
Sbjct: 31157 tcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccag 31211

---

>dbj|AK221708.1| Arabidopsis thaliana mRNA for DEAD BOX RNA helicase RH15 - like
           protein, complete cds, clone: RAFL16-54-J17
          Length = 1641

 Score =  131 bits (66), Expect = 3e-27
 Identities = 153/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 353 agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
           |||||||||||| || ||||||||||| ||| | || |||||||||||||||||||||||
Sbjct: 439 agtgcaacatgaatgtatccctcaagctatcttgggcatggatgtcatctgccaagcaaa 498

                                                                       
Query: 413 atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
            || || ||||| ||||||||||| |||||||||||| |||| || ||| | || ||  |
Sbjct: 499 gtctggtatggggaagactgctgtgtttgtcctgtctactctacaacaggttgaaccatc 558

                                                                       
Query: 473 tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttg 532
           | |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| ||
Sbjct: 559 tcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatctg 618

             
Query: 533 ca 534
           ||
Sbjct: 619 ca 620

---

>ref|NM_121158.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/
           helicase/ nucleic acid binding AT5G11200 mRNA, complete
           cds
          Length = 1659

 Score =  127 bits (64), Expect = 5e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||
Sbjct: 309 gaagtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagca 368

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 369 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 428

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 429 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 488

               
Query: 531 tgca 534
           ||||
Sbjct: 489 tgca 492

---

>gb|AY059168.1| Arabidopsis thaliana AT5g11200/F2I11_90 mRNA, complete cds
          Length = 1284

 Score =  127 bits (64), Expect = 5e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||
Sbjct: 211 gaagtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagca 270

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 271 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 330

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 331 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 390

               
Query: 531 tgca 534
           ||||
Sbjct: 391 tgca 394

---

>gb|AF378868.1|AF378868 Arabidopsis thaliana AT5g11200/F2I11_90 mRNA, complete cds
          Length = 1654

 Score =  127 bits (64), Expect = 5e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||
Sbjct: 308 gaagtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagca 367

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 368 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 427

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 428 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 487

               
Query: 531 tgca 534
           ||||
Sbjct: 488 tgca 491

---

>emb|BX830512.1|CNS0A08M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZC04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1555

 Score =  127 bits (64), Expect = 5e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||
Sbjct: 270 gaagtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagca 329

                                                                       
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcct 470
           || || || ||||| ||||||||||| |||||||||||| |||| || ||||| || || 
Sbjct: 330 aagtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgaacca 389

                                                                       
Query: 471 actgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatt 530
            || |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| 
Sbjct: 390 tctcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatc 449

               
Query: 531 tgca 534
           ||||
Sbjct: 450 tgca 453

---

>emb|BX831239.1|CNS09YQC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS70ZE11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1723

 Score =  123 bits (62), Expect = 7e-25
 Identities = 152/182 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
           ||||||||| || || ||||||||||| ||| | || |||||||| ||||||||||||||
Sbjct: 419 agtgcaacacgaatgtatccctcaagctatcttgggtatggatgttatctgccaagcaaa 478

                                                                       
Query: 413 atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
            || || ||||| ||||||||||| |||||||||||| |||| || ||||| || ||  |
Sbjct: 479 gtctggtatggggaagactgctgtgtttgtcctgtctactctacaacagattgagccatc 538

                                                                       
Query: 473 tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttg 532
           | |||| |||||  | |||||||| |||||||| || |||||||| ||||||||||| ||
Sbjct: 539 tcctggccaggtttctgcacttgtcttgtgccatacaagagagctagcttaccagatctg 598

             
Query: 533 ca 534
           ||
Sbjct: 599 ca 600

---

>ref|NM_193392.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1365

 Score =  121 bits (61), Expect = 3e-24
 Identities = 151/181 (83%)
 Strand = Plus / Plus

                                                                       
Query: 353 agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
           ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 264 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 323

                                                                       
Query: 413 atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
           ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 324 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 383

                                                                       
Query: 473 tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttg 532
           ||||||||| || |  ||||||||  | || ||||| || ||||| ||||||||||||||
Sbjct: 384 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccagatttg 443

            
Query: 533 c 533
           |
Sbjct: 444 c 444



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 235 ccgccgccgacgccaagaagggctacgtcggcatccacagctccggattccgcgacttcc 294
           |||||| || || ||||||||| ||||| || ||||||||||| || ||| | |||||||
Sbjct: 110 ccgccgacgtcgtcaagaaggggtacgtggggatccacagctcggggttcagagacttcc 169

                                                   
Query: 295 tcctcaagcccgagctgctacgggccatccaggactgcgg 334
           | |||||||| |||||||| || |||||||||||||||||
Sbjct: 170 tgctcaagccggagctgcttcgcgccatccaggactgcgg 209



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 156 aacgacgtgtacgaggatgagctgctcgactacgaggagga 196
           ||||| ||||||||||| || ||  ||||||||||||||||
Sbjct: 25  aacgaggtgtacgaggaggatctcgtcgactacgaggagga 65

---

>ref|NM_193389.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1296

 Score =  119 bits (60), Expect = 1e-23
 Identities = 150/180 (83%)
 Strand = Plus / Plus

                                                                       
Query: 354 gtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaa 413
           |||||||| || |||||||| ||||| || || |||||||||||||||||||||||||||
Sbjct: 226 gtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaaa 285

                                                                       
Query: 414 tccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctact 473
           || |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  |
Sbjct: 286 tctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgtt 345

                                                                       
Query: 474 gctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccagatttgc 533
           |||||||| || |  ||||||||  | || ||||| || ||||| |||||||||||||||
Sbjct: 346 gctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccagatttgc 405



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 258 tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
           ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 150 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 209

                            
Query: 318 gccatccaggactgcgg 334
           |||||||||||||||||
Sbjct: 210 gccatccaggactgcgg 226

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                            
Query: 353      agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
                ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 20568949 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 20569008

                                                                            
Query: 413      atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
                ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 20569009 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 20569068

                                                                       
Query: 473      tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
                ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 20569069 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 20569123



 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                            
Query: 353      agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
                ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 20539109 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 20539168

                                                                            
Query: 413      atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
                ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 20539169 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 20539228

                                                                       
Query: 473      tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
                ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 20539229 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 20539283



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                            
Query: 258      tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
                ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 20567494 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 20567553

                                                     
Query: 318      gccatccaggactgcggattcgagcacccttccgaag 354
                ||||||||||||||||| || ||||||||||||||||
Sbjct: 20567554 gccatccaggactgcgggtttgagcacccttccgaag 20567590



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                            
Query: 258      tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
                ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 20537384 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 20537443

                                                     
Query: 318      gccatccaggactgcggattcgagcacccttccgaag 354
                ||||||||||||||||| || ||||||||||||||||
Sbjct: 20537444 gccatccaggactgcgggtttgagcacccttccgaag 20537480



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                         
Query: 156      aacgacgtgtacgaggatgagctgctcgactacgaggagga 196
                ||||| ||||||||||| || ||  ||||||||||||||||
Sbjct: 20567283 aacgaggtgtacgaggaggatctcgtcgactacgaggagga 20567323

---

>dbj|AP004258.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0024F24
          Length = 172642

 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 30925 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 30984

                                                                         
Query: 413   atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
             ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 30985 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 31044

                                                                    
Query: 473   tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
             ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 31045 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 31099



 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                        
Query: 353  agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
            ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 1085 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 1144

                                                                        
Query: 413  atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
            ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 1145 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 1204

                                                                   
Query: 473  tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
            ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 1205 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 1259



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                         
Query: 258   tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
             ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 29470 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 29529

                                                  
Query: 318   gccatccaggactgcggattcgagcacccttccgaag 354
             ||||||||||||||||| || ||||||||||||||||
Sbjct: 29530 gccatccaggactgcgggtttgagcacccttccgaag 29566



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 156   aacgacgtgtacgaggatgagctgctcgactacgaggagga 196
             ||||| ||||||||||| || ||  ||||||||||||||||
Sbjct: 29259 aacgaggtgtacgaggaggatctcgtcgactacgaggagga 29299

---

>dbj|AP004225.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1156H12
          Length = 159509

 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 92771 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 92830

                                                                         
Query: 413   atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
             ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 92831 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 92890

                                                                    
Query: 473   tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
             ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 92891 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 92945



 Score =  109 bits (55), Expect = 1e-20
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             ||||||||| || |||||||| ||||| || || ||||||||||||||||||||||||||
Sbjct: 62931 agtgcaacacgaatgcatcccacaagccattcttggaatggatgtcatctgccaagcaaa 62990

                                                                         
Query: 413   atccgggatgggcaagactgctgtctttgtcctgtcttctctccagcagatcgatcctac 472
             ||| |||||||| ||||||||||| ||||| || ||   ||| ||||| || ||||||  
Sbjct: 62991 atctgggatggggaagactgctgtttttgttctctcaagtcttcagcaaattgatcctgt 63050

                                                                    
Query: 473   tgctggtcaggtggcagcacttgtattgtgccacaccagagagctggcttaccag 527
             ||||||||| || |  ||||||||  | || ||||| || ||||| |||||||||
Sbjct: 63051 tgctggtcaagttggtgcacttgtgctatgtcacacaagggagctagcttaccag 63105



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                         
Query: 258   tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
             ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 91316 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 91375

                                                  
Query: 318   gccatccaggactgcggattcgagcacccttccgaag 354
             ||||||||||||||||| || ||||||||||||||||
Sbjct: 91376 gccatccaggactgcgggtttgagcacccttccgaag 91412



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                         
Query: 258   tacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacgg 317
             ||||| || ||||||||||| || ||| | |||||||| |||||||| |||||||| || 
Sbjct: 61206 tacgtggggatccacagctcggggttcagagacttcctgctcaagccggagctgcttcgc 61265

                                                  
Query: 318   gccatccaggactgcggattcgagcacccttccgaag 354
             ||||||||||||||||| || ||||||||||||||||
Sbjct: 61266 gccatccaggactgcgggtttgagcacccttccgaag 61302



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 156   aacgacgtgtacgaggatgagctgctcgactacgaggagga 196
             ||||| ||||||||||| || ||  ||||||||||||||||
Sbjct: 91105 aacgaggtgtacgaggaggatctcgtcgactacgaggagga 91145

---

>gb|AC150787.15| Medicago truncatula clone mth2-171n13, complete sequence
          Length = 82665

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 80/90 (88%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             |||||||||||||||||| ||||||||||| || ||||||||||| || || ||||| ||
Sbjct: 17087 agtgcaacatgagtgcatacctcaagcaattctaggaatggatgtaatttgtcaagctaa 17146

                                           
Query: 413   atccgggatgggcaagactgctgtctttgt 442
             ||| || ||||| |||||||||||||||||
Sbjct: 17147 atctggaatgggaaagactgctgtctttgt 17176

---

>ref|NM_001016000.2| Xenopus tropicalis hypothetical protein LOC548754 (LOC548754), mRNA
          Length = 1665

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 147/181 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||||| |||||| | || || ||||| || || ||  |||||  
Sbjct: 299 catccacagctccggcttccgagacttcttgctgaaacccgaactcctccgatccatcgt 358

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            |||||||| || || || || || || || ||||||||||| |||||||| || |||||
Sbjct: 359 agactgcggttttgaacatccctctgaggtccaacatgagtgtatccctcaggctatcct 418

                                                                       
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcct 445
            || |||||  || | |||||||||||||| || ||||| ||||||||||||||||||||
Sbjct: 419 gggcatggacatcctttgccaagcaaaatctggtatggggaagactgctgtctttgtcct 478

            
Query: 446 g 446
           |
Sbjct: 479 g 479

---

>emb|CR848287.2| Xenopus tropicalis finished cDNA, clone TNeu067f07
          Length = 1566

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 147/181 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||||| |||||| | || || ||||| || || ||  |||||  
Sbjct: 200 catccacagctccggcttccgagacttcttgctgaaacccgaactcctccgatccatcgt 259

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            |||||||| || || || || || || || ||||||||||| |||||||| || |||||
Sbjct: 260 agactgcggttttgaacatccctctgaggtccaacatgagtgtatccctcaggctatcct 319

                                                                       
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcct 445
            || |||||  || | |||||||||||||| || ||||| ||||||||||||||||||||
Sbjct: 320 gggcatggacatcctttgccaagcaaaatctggtatggggaagactgctgtctttgtcct 379

            
Query: 446 g 446
           |
Sbjct: 380 g 380

---

>emb|CR848283.2| Xenopus tropicalis finished cDNA, clone TNeu097p06
          Length = 1665

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 147/181 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||||| |||||| | || || ||||| || || ||  |||||  
Sbjct: 299 catccacagctccggcttccgagacttcttgctgaaacccgaactcctccgatccatcgt 358

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            |||||||| || || || || || || || ||||||||||| |||||||| || |||||
Sbjct: 359 agactgcggttttgaacatccctctgaggtccaacatgagtgtatccctcaggctatcct 418

                                                                       
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcct 445
            || |||||  || | |||||||||||||| || ||||| ||||||||||||||||||||
Sbjct: 419 gggcatggacatcctttgccaagcaaaatctggtatggggaagactgctgtctttgtcct 478

            
Query: 446 g 446
           |
Sbjct: 479 g 479

---

>emb|CR848282.2| Xenopus tropicalis finished cDNA, clone TNeu081j17
          Length = 1621

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 147/181 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||||| |||||| | || || ||||| || || ||  |||||  
Sbjct: 254 catccacagctccggcttccgagacttcttgctgaaacccgaactcctccgatccatcgt 313

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            |||||||| || || || || || || || ||||||||||| |||||||| || |||||
Sbjct: 314 agactgcggttttgaacatccctctgaggtccaacatgagtgtatccctcaggctatcct 373

                                                                       
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcct 445
            || |||||  || | |||||||||||||| || ||||| ||||||||||||||||||||
Sbjct: 374 gggcatggacatcctttgccaagcaaaatctggtatggggaagactgctgtctttgtcct 433

            
Query: 446 g 446
           |
Sbjct: 434 g 434

---

>ref|XM_512442.1| PREDICTED: Pan troglodytes similar to DEAD (Asp-Glu-Ala-Asp) box
           polypeptide 39; UAP56-related helicase, 49 kDa; DEAD/H
           (Asp-Glu-Ala-Asp/His) box polypeptide 39 (LOC455784),
           mRNA
          Length = 1245

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 717 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 776

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 777 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 836

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 837 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 890

---

>gb|BC010455.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 39, transcript
           variant 2, mRNA (cDNA clone MGC:18203 IMAGE:4155840),
           complete cds
          Length = 1931

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 207 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 266

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 267 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 326

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 327 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 380

---

>ref|NM_005804.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 (DDX39),
           mRNA
          Length = 1534

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 214 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 273

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 274 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 333

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 334 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 387

---

>gb|BC032128.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 39, mRNA (cDNA
           clone MGC:29546 IMAGE:5017293), complete cds
          Length = 1399

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 184 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 243

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 244 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 303

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 304 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 357

---

>gb|AC145331.19| Medicago truncatula clone mth2-8o7, complete sequence
          Length = 115348

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Minus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             |||||||||||||||||| || ||||||||||| |||||||||||  | ||||| |||||
Sbjct: 31903 agtgcaacatgagtgcataccacaagcaatccttggaatggatgtattatgccaggcaaa 31844

                                           
Query: 413   atccgggatgggcaagactgctgtctttgt 442
             ||| || ||||| || |||||||| |||||
Sbjct: 31843 atcgggaatgggaaaaactgctgtttttgt 31814

---

>gb|AC147471.14| Medicago truncatula clone mth2-7a7, complete sequence
          Length = 139792

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 78/90 (86%)
 Strand = Plus / Plus

                                                                         
Query: 353   agtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaa 412
             |||||||||||||||||| || ||||||||||| |||||||||||  | ||||| |||||
Sbjct: 53192 agtgcaacatgagtgcataccacaagcaatccttggaatggatgtattatgccaggcaaa 53251

                                           
Query: 413   atccgggatgggcaagactgctgtctttgt 442
             ||| || ||||| || |||||||| |||||
Sbjct: 53252 atcgggaatgggaaaaactgctgtttttgt 53281

---

>emb|AJ720994.1| Gallus gallus mRNA for hypothetical protein, clone 32b9
          Length = 1365

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||| | |||||||| ||||| || || ||||| || ||||||  
Sbjct: 177 catccacagctccggcttcagggacttcctgctcaaaccagaactgctgcgcgccatcgt 236

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           ||||||||| |||||||||||   ||||||||| || ||||||||||| || || |||||
Sbjct: 237 ggactgcggcttcgagcaccccagcgaagtgcagcacgagtgcatcccgcaggccatcct 296

                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaa 427
            || ||||| ||  | ||||| || || ||||| ||||||||
Sbjct: 297 gggcatggacgtgctgtgccaggccaagtccggcatgggcaa 338

---

>gb|BC001009.2| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 39, transcript
           variant 1, mRNA (cDNA clone MGC:8417 IMAGE:2820926),
           complete cds
          Length = 1495

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 175 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 234

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 235 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 294

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 295 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 348

---

>emb|CR609572.1| full-length cDNA clone CS0DI081YC08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1432

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 182 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 241

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 242 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 301

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 302 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 355

---

>emb|CR606167.1| full-length cDNA clone CS0DJ011YN14 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1471

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 222 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 281

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 282 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 341

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 342 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 395

---

>emb|CR600064.1| full-length cDNA clone CS0DH004YC03 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1377

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 181 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 240

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 241 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 300

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 301 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 354

---

>emb|CR599681.1| full-length cDNA clone CL0BB014ZF04 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1470

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 194 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 253

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 254 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 313

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 314 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 367

---

>emb|CR599572.1| full-length cDNA clone CS0DA009YC18 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1444

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 181 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 240

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 241 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 300

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 301 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 354

---

>emb|CR597385.1| full-length cDNA clone CS0DL004YD13 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1370

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 127 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 186

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 187 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 246

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 247 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 300

---

>emb|CR592759.1| full-length cDNA clone CS0DF033YF12 of Fetal brain of Homo sapiens
           (human)
          Length = 1951

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 182 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 241

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 242 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 301

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 302 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 355

---

>emb|CR590674.1| full-length cDNA clone CS0DH002YN06 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1433

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 182 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 241

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 242 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 301

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 302 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 355

---

>dbj|AK026614.1| Homo sapiens cDNA: FLJ22961 fis, clone KAT10214
          Length = 1934

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 638 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 697

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 698 ggactgtggctttgagcatccttctgaggtccagcatgagtgcattccccaggccatcct 757

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 758 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 811

---

>gb|U90426.1|HSU90426 Human nuclear RNA helicase, complete cds
          Length = 1512

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 215 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 274

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| ||||| || || || ||||||||||| || || || |||||
Sbjct: 275 ggactgtggcttggagcatccttctgaggtccagcatgagtgcattccccaggccatcct 334

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || ||||||||||||||||| || |||||
Sbjct: 335 gggcatggacgtcctgtgccaggccaagtccgggatgggcaagacagcggtctt 388

---

>gb|BC044169.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39b, mRNA (cDNA
           clone MGC:55433 IMAGE:2639515), complete cds
          Length = 1603

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 138/171 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||| | ||||| || |||||||| ||||||||  | ||||||  
Sbjct: 221 catccacagctccggcttcagagactttctgctcaagccagagctgctgagagccatcgt 280

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           ||||||||| |||||||| || || |||||||| || ||||| ||||| || || |||||
Sbjct: 281 ggactgcgggttcgagcatccctctgaagtgcagcacgagtgtatcccgcaggccatcct 340

                                                              
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgt 436
            || |||||| || |||| || || || || || ||||| ||||| |||||
Sbjct: 341 gggcatggatatcctctgtcaggctaagtctggtatggggaagacggctgt 391

---

>gb|BC067555.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39b, mRNA (cDNA
           clone MGC:85646 IMAGE:6805653), complete cds
          Length = 1575

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 138/171 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||| | ||||| || |||||||| ||||||||  | ||||||  
Sbjct: 191 catccacagctccggcttcagagactttctgctcaagccagagctgctgagagccatcgt 250

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           ||||||||| |||||||| || || |||||||| || ||||| ||||| || || |||||
Sbjct: 251 ggactgcgggttcgagcatccctctgaagtgcagcacgagtgtatcccgcaggccatcct 310

                                                              
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgt 436
            || |||||| || |||| || || || || || ||||| ||||| |||||
Sbjct: 311 gggcatggatatcctctgtcaggctaagtctggtatggggaagacggctgt 361

---

>ref|NM_212977.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39b (ddx39b),
           mRNA
          Length = 1603

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 138/171 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||| | ||||| || |||||||| ||||||||  | ||||||  
Sbjct: 221 catccacagctccggcttcagagactttctgctcaagccagagctgctgagagccatcgt 280

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           ||||||||| |||||||| || || |||||||| || ||||| ||||| || || |||||
Sbjct: 281 ggactgcgggttcgagcatccctctgaagtgcagcacgagtgtatcccgcaggccatcct 340

                                                              
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgt 436
            || |||||| || |||| || || || || || ||||| ||||| |||||
Sbjct: 341 gggcatggatatcctctgtcaggctaagtctggtatggggaagacggctgt 391

---

>ref|XM_518349.1| PREDICTED: Pan troglodytes similar to HLA-B associated transcript 1;
            HLA-B associated transcript-1; DEAD-box protein; nuclear
            RNA helicase (DEAD family) (LOC462557), mRNA
          Length = 1449

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                        
Query: 266  catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
            |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 864  catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 923

                                                                        
Query: 326  ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
             ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 924  cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 983

                                                                      
Query: 386  cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
             |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 984  gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 1041

---

>gb|BC000361.2| Homo sapiens HLA-B associated transcript 1, transcript variant 2,
           mRNA (cDNA clone MGC:8674 IMAGE:2964517), complete cds
          Length = 1533

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 162 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 221

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 222 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 281

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 282 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 339

---

>gb|BC013006.2| Homo sapiens HLA-B associated transcript 1, transcript variant 1,
           mRNA (cDNA clone MGC:3991 IMAGE:3010263), complete cds
          Length = 1638

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 255 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 314

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 315 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 374

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 375 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 432

---

>ref|NM_004640.5| Homo sapiens HLA-B associated transcript 1 (BAT1), transcript
           variant 1, mRNA
          Length = 2133

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 754 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 813

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 814 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 873

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 874 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 931

---

>ref|NM_080598.4| Homo sapiens HLA-B associated transcript 1 (BAT1), transcript
           variant 2, mRNA
          Length = 2003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 624 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 683

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 684 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 743

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 744 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 801

---

>gb|BC004350.1| Homo sapiens cDNA clone IMAGE:3536103, **** WARNING: chimeric clone
           ****
          Length = 2060

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 660 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 719

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 720 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 779

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 780 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 837

---

>gb|BT009909.1| Homo sapiens HLA-B associated transcript 1 mRNA, complete cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>emb|Z37166.1|HSBAT1MR H.sapiens BAT1 mRNA for nuclear RNA helicase (DEAD family)
          Length = 1658

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 291 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 350

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 351 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 410

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 411 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 468

---

>gb|BT008096.1| Synthetic construct Homo sapiens HLA-B associated transcript 1
           mRNA, partial cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>dbj|AK127767.1| Homo sapiens cDNA FLJ45868 fis, clone OCBBF3004487, highly  similar
            to Probable ATP-dependent RNA helicase p47
          Length = 5157

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                        
Query: 266  catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
            |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 1594 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 1653

                                                                        
Query: 326  ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
             ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 1654 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 1713

                                                                      
Query: 386  cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
             |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 1714 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 1771

---

>emb|CR625065.1| full-length cDNA clone CS0DC019YE12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1632

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 287 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 346

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 347 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 406

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 407 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 464

---

>emb|CR623314.1| full-length cDNA clone CS0DE001YF24 of Placenta of Homo sapiens
           (human)
          Length = 1624

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 283 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 342

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 343 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 402

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 403 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 460

---

>emb|CR620111.1| full-length cDNA clone CS0DC027YP22 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1483

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 159 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 218

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 219 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 278

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 279 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 336

---

>emb|CR618145.1| full-length cDNA clone CS0DF037YN16 of Fetal brain of Homo sapiens
           (human)
          Length = 1420

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 127 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 186

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 187 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 246

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 247 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 304

---

>emb|CR614717.1| full-length cDNA clone CS0DI004YG11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1450

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 127 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 186

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 187 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 246

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 247 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 304

---

>emb|CR612476.1| full-length cDNA clone CS0DE005YD10 of Placenta of Homo sapiens
           (human)
          Length = 1578

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 257 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 316

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 317 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 376

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 377 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 434

---

>emb|CR612427.1| full-length cDNA clone CS0DG006YD05 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1526

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 150 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 209

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 210 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 269

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 270 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 327

---

>emb|CR608752.1| full-length cDNA clone CS0DI039YK14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1444

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 127 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 186

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 187 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 246

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 247 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 304

---

>emb|CR606599.1| full-length cDNA clone CS0DI053YJ09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1584

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 257 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 316

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 317 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 376

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 377 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 434

---

>emb|CR601722.1| full-length cDNA clone CS0DF037YE15 of Fetal brain of Homo sapiens
           (human)
          Length = 1459

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 154 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 213

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 214 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 273

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 274 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 331

---

>emb|CR600093.1| full-length cDNA clone CS0DF025YD14 of Fetal brain of Homo sapiens
           (human)
          Length = 1615

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 280 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 339

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 340 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 399

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 400 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 457

---

>emb|CR596330.1| full-length cDNA clone CS0DE004YJ13 of Placenta of Homo sapiens
           (human)
          Length = 1593

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 257 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 316

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 317 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 376

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 377 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 434

---

>emb|CR591582.1| full-length cDNA clone CS0DI066YK10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1413

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 117 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 176

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 177 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 236

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 237 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 294

---

>emb|CR590279.1| full-length cDNA clone CS0DE011YJ14 of Placenta of Homo sapiens
           (human)
          Length = 1489

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 163 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 222

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 223 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 282

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 283 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 340

---

>dbj|AK222912.1| Homo sapiens mRNA for HLA-B associated transcript 1 variant, clone:
           HRC02604
          Length = 1664

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 276 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 335

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 336 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 395

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 396 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 453

---

>gb|AY892786.1| Synthetic construct Homo sapiens clone FLH024340.01L HLA-B
           associated transcript 1 (BAT1) mRNA, partial cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>gb|AY892785.1| Synthetic construct Homo sapiens clone FLH024339.01L HLA-B
           associated transcript 1 (BAT1) mRNA, partial cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>gb|AY890316.1| Synthetic construct Homo sapiens clone FLH024344.01X HLA-B
           associated transcript 1 (BAT1) mRNA, complete cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>gb|AY890315.1| Synthetic construct Homo sapiens clone FLH024343.01X HLA-B
           associated transcript 1 (BAT1) mRNA, complete cds
          Length = 1287

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 183 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 242

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 243 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 300

---

>dbj|AB209217.1| Homo sapiens mRNA for HLA-B associated transcript 1 variant protein
          Length = 4300

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 193 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 252

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 253 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 312

                                                                     
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtc 443
            |||||||||||| | ||||| || || || || ||||| ||||| || || ||||||
Sbjct: 313 gggaatggatgtcctgtgccaggccaagtcgggcatgggaaagacagcagtgtttgtc 370

---

>emb|CR859800.1| Pongo pygmaeus mRNA; cDNA DKFZp469F1834 (from clone DKFZp469F1834)
          Length = 1702

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 314 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 373

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 374 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 433

                        
Query: 386 cggaatggatgtc 398
            ||||||||||||
Sbjct: 434 gggaatggatgtc 446

---

>emb|CR857691.1| Pongo pygmaeus mRNA; cDNA DKFZp468K0120 (from clone DKFZp468K0120)
          Length = 1544

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 184 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 243

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||||||||||||||| || || ||
Sbjct: 244 cgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattct 303

                        
Query: 386 cggaatggatgtc 398
            ||||||||||||
Sbjct: 304 gggaatggatgtc 316

---

>ref|NM_001005157.1| Sus scrofa HLA-B associated transcript 1 (BAT1), mRNA
          Length = 1287

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 109/133 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||   
Sbjct: 123 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccattgt 182

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || ||||| ||||||||||| || |||||
Sbjct: 183 tgactgtggctttgagcatccatcagaagttcagcatgaatgcatccctcaggccatcct 242

                        
Query: 386 cggaatggatgtc 398
            ||||||||||||
Sbjct: 243 gggaatggatgtc 255

---

>emb|Z54327.1|CEC26D10 Caenorhabditis elegans Cosmid C26D10, complete sequence
          Length = 32551

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                        
Query: 327  gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctc 386
            |||||||| ||||| || || || ||||| |||||||||||||| |||||||| || || 
Sbjct: 9539 gactgcggtttcgaacatccatcggaagtacaacatgagtgcattcctcaagccattctt 9480

                                                                    
Query: 387  ggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
            |||||||| ||  |||||||||| || ||||| ||||| || || ||||| |||||
Sbjct: 9479 ggaatggacgttgtctgccaagcgaagtccggtatgggtaaaaccgctgtttttgt 9424

---

>gb|BC045125.1| Xenopus laevis nuclear RNA helicase, mRNA (cDNA clone MGC:53944
           IMAGE:5570363), complete cds
          Length = 1522

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||| ||||||||||| ||||| || || ||||| || |||||  || | |||||||| 
Sbjct: 231 gaagtccaacatgagtgtatcccgcaggccatcctgggtatggacatcctttgccaagcg 290

                                               
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctg 446
           ||||| || ||||||||||| |||||||||||||||
Sbjct: 291 aaatctggtatgggcaagaccgctgtctttgtcctg 326

---

>ref|NM_001026815.1| Caenorhabditis elegans HELicase family member (hel-1) (hel-1) mRNA,
           complete cds
          Length = 1022

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctc 386
           |||||||| ||||| || || || ||||| |||||||||||||| |||||||| || || 
Sbjct: 180 gactgcggtttcgaacatccatcggaagtacaacatgagtgcattcctcaagccattctt 239

                                                                   
Query: 387 ggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           |||||||| ||  |||||||||| || ||||| ||||| || || ||||| |||||
Sbjct: 240 ggaatggacgttgtctgccaagcgaagtccggtatgggtaaaaccgctgtttttgt 295

---

>ref|NM_001026814.2| Caenorhabditis elegans HELicase family member (hel-1) (hel-1) mRNA,
           complete cds
          Length = 1522

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctc 386
           |||||||| ||||| || || || ||||| |||||||||||||| |||||||| || || 
Sbjct: 173 gactgcggtttcgaacatccatcggaagtacaacatgagtgcattcctcaagccattctt 232

                                                                   
Query: 387 ggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           |||||||| ||  |||||||||| || ||||| ||||| || || ||||| |||||
Sbjct: 233 ggaatggacgttgtctgccaagcgaagtccggtatgggtaaaaccgctgtttttgt 288

---

>gb|AF549950.1| Xenopus laevis clone S10-54-G3 mRNA sequence
          Length = 735

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||| ||||||||||| ||||| || || ||||| || |||||  || | |||||||| 
Sbjct: 213 gaagtccaacatgagtgtatcccgcaggccatcctgggtatggacatcctttgccaagcg 272

                                               
Query: 411 aaatccgggatgggcaagactgctgtctttgtcctg 446
           ||||| || ||||||||||| |||||||||||||||
Sbjct: 273 aaatctggtatgggcaagaccgctgtctttgtcctg 308

---

>gb|U08102.1|CEU08102 Caenorhabditis elegans putative RNA helicase (hel) mRNA, partial
           cds
          Length = 1439

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctc 386
           |||||||| ||||| || || || ||||| |||||||||||||| |||||||| || || 
Sbjct: 169 gactgcggtttcgaacatccatcggaagtacaacatgagtgcattcctcaagccattctt 228

                                                                   
Query: 387 ggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           |||||||| ||  |||||||||| || ||||| ||||| || || ||||| |||||
Sbjct: 229 ggaatggacgttgtctgccaagcgaagtccggtatgggtaaaaccgctgtttttgt 284

---

>gb|BC024859.1| Mus musculus HLA-B-associated transcript 1A, mRNA (cDNA clone
            MGC:38799 IMAGE:5359825), complete cds
          Length = 2863

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                        
Query: 257  ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
            |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 1484 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 1543

                                                                        
Query: 317  ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
            |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 1544 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 1603

                                  
Query: 377  agcaatcctcggaatggatgtc 398
             || || || || |||||||||
Sbjct: 1604 ggccattctggggatggatgtc 1625

---

>dbj|AK171507.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730223O22
           product:HLA-B-associated transcript 1A, full insert
           sequence
          Length = 1712

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 290 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 349

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 350 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 409

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 410 ggccattctggggatggatgtc 431

---

>dbj|AK088867.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430029G07
           product:HLA-B-associated transcript 1A, full insert
           sequence
          Length = 1626

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 266 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 325

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 326 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 385

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 386 ggccattctggggatggatgtc 407

---

>dbj|AK051034.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030057O22 product:HLA-B
           ASSOCIATED TRANSCRIPT-1 homolog [Homo sapiens], full
           insert sequence
          Length = 1645

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 281 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 340

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 341 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 400

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 401 ggccattctggggatggatgtc 422

---

>ref|NM_001014377.1| Canis familiaris HLA-B associated transcript 1 (BAT1), mRNA
          Length = 1287

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 139/174 (79%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  |||||||||||| || || || |||||||| || ||||| ||| |||| ||
Sbjct: 114 ctacgtctccatccacagctctggctttcgtgacttcctgctgaagccagagttgctccg 173

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           ||||||    ||||| || || || || || || ||||| || |||||||||||||||||
Sbjct: 174 ggccattgttgactgtggctttgaacatccatcagaagtccagcatgagtgcatccctca 233

                                                                 
Query: 377 agcaatcctcggaatggatgtcatctgccaagcaaaatccgggatgggcaagac 430
            || || || |||||||||||| | ||||| || || || |||||||| |||||
Sbjct: 234 ggccattctgggaatggatgtcctatgccaggccaagtcagggatgggaaagac 287

---

>gb|AF118128.1|AF118128 Mus musculus nuclear RNA helicase Bat1 mRNA, complete cds
          Length = 1297

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 114 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 173

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 174 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 233

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 234 ggccattctggggatggatgtc 255

---

>ref|NM_019693.2| Mus musculus HLA-B-associated transcript 1A (Bat1a), mRNA
          Length = 2863

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 115/142 (80%)
 Strand = Plus / Plus

                                                                        
Query: 257  ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
            |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 1484 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 1543

                                                                        
Query: 317  ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
            |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 1544 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 1603

                                  
Query: 377  agcaatcctcggaatggatgtc 398
             || || || || |||||||||
Sbjct: 1604 ggccattctggggatggatgtc 1625

---

>gb|BC071505.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39a, mRNA (cDNA
           clone MGC:86865 IMAGE:6903439), complete cds
          Length = 1638

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 141/177 (79%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||||||||| || |||||||| || || ||| |||| || || |||  
Sbjct: 202 catccacagctccggattccgagatttcctcctgaaaccagagttgctccgcgctatcgt 261

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || || || ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 262 tgactgtggctttgaacatccttctgaggtccagcatgagtgcatcccacaagccatcct 321

                                                                    
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
            || |||||  || | ||||| ||||| || || ||||| |||||||| || |||||
Sbjct: 322 gggcatggacatcctgtgccaggcaaagtctggaatgggaaagactgccgtgtttgt 378

---

>ref|XM_968952.1| PREDICTED: Tribolium castaneum similar to CG7269-PA, isoform A
           (LOC662877), mRNA
          Length = 1416

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcctc 386
           |||||||| || |||||||| || ||||||||||| || |||||||| || ||| | || 
Sbjct: 316 gactgcggttttgagcacccgtctgaagtgcaacacgaatgcatcccacaggcagttctt 375

                                                                       
Query: 387 ggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcctg 446
           || |||||  || | |||||||| || ||||| |||||||||||||| || || ||||||
Sbjct: 376 ggtatggacatcttgtgccaagccaagtccggtatgggcaagactgcagtgttcgtcctg 435

---

>gb|AC007080.2|AC007080 Mus musculus chromosome 17 clone BAC 205A4, complete sequence
          Length = 39909

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 257   ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
             |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 11748 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 11807

                    
Query: 317   ggccatc 323
             |||||||
Sbjct: 11808 ggccatc 11814

---

>emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chromosome 17, complete
              sequence
          Length = 190041

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 257    ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
              |||||||  ||||||||||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 179348 ctacgtctccatccacagctccggcttccgagattttctactcaagccagagctgctccg 179407

                     
Query: 317    ggccatc 323
              |||||||
Sbjct: 179408 ggccatc 179414

---

>gb|AY255787.1| Mus musculus strain BALB/c HLA-B associated transcript 1 (Bat1a)
           mRNA, complete cds
          Length = 1423

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 114/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  |||||| |||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 240 ctacgtctccatccatagctccggcttccgagattttctactcaagccagagctgctccg 299

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 300 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 359

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 360 ggccattctggggatggatgtc 381

---

>gb|AY255786.1| Mus musculus strain B10.D2 HLA-B associated transcript 1 (Bat1a)
           mRNA, complete cds
          Length = 1423

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 114/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  |||||| |||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 240 ctacgtctccatccatagctccggcttccgagattttctactcaagccagagctgctccg 299

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 300 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 359

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 360 ggccattctggggatggatgtc 381

---

>ref|XM_691844.1| PREDICTED: Danio rerio similar to DEAD (Asp-Glu-Ala-Asp) box
           polypeptide 39 (LOC568511), mRNA
          Length = 381

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           ||||||||||||||| ||| | ||||| || |||||||| ||||||||  | ||||||  
Sbjct: 279 catccacagctccggcttcagagactttctgctcaagccagagctgctgagagccatcgt 338

                             
Query: 326 ggactgcggattcgagca 343
           ||||||||| ||||||||
Sbjct: 339 ggactgcgggttcgagca 356

---

>dbj|AB169496.1| Macaca fascicularis brain cDNA, clone: QccE-11261, similar to human
           HLA-B associated transcript 1 (BAT1), transcript
           variant1, mRNA, RefSeq: NM_004640.4
          Length = 1712

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 109/134 (81%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacggg-ccatcc 324
           |||||||||||| || || || |||||||| |||||||| ||| |||| |||| ||||  
Sbjct: 341 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccggggccattg 400

                                                                       
Query: 325 aggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcc 384
             ||||| || || ||||| || || ||||| || ||||||||||||||||| || || |
Sbjct: 401 tcgactgtggctttgagcatccgtcagaagtccagcatgagtgcatccctcaggccattc 460

                         
Query: 385 tcggaatggatgtc 398
           | ||||||||||||
Sbjct: 461 tgggaatggatgtc 474

---

>emb|BX248081.12| Zebrafish DNA sequence from clone CH211-106H11 in linkage group 16,
             complete sequence
          Length = 174325

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                         
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
             ||||||||||||||| ||| | ||||| || |||||||| ||||||||  | ||||||  
Sbjct: 34329 catccacagctccggcttcagagactttctgctcaagccagagctgctgagagccatcgt 34388

                               
Query: 326   ggactgcggattcgagca 343
             ||||||||| ||||||||
Sbjct: 34389 ggactgcgggttcgagca 34406

---

>gb|BC011067.1| Mus musculus HLA-B-associated transcript 1A, mRNA (cDNA clone
           MGC:19235 IMAGE:3498520), complete cds
          Length = 1634

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 114/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
           |||||||  |||||| |||||||| ||||| || || || |||||||| |||||||| ||
Sbjct: 256 ctacgtctccatccatagctccggcttccgagattttctactcaagccagagctgctccg 315

                                                                       
Query: 317 ggccatccaggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctca 376
           |||||||   ||||| || || ||||| || || || || || |||||||||||||| ||
Sbjct: 316 ggccatcgttgactgtggctttgagcatccatcagaggtccagcatgagtgcatcccgca 375

                                 
Query: 377 agcaatcctcggaatggatgtc 398
            || || || || |||||||||
Sbjct: 376 ggccattctggggatggatgtc 397

---

>gb|BC102131.1| Bos taurus similar to HLA-B associated transcript 1, mRNA (cDNA
           clone MGC:127051 IMAGE:7942842), complete cds
          Length = 1673

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 104/129 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||| | |||||||| ||| |||| ||||||||   
Sbjct: 290 catccacagctctggctttcgtgacttcttgctcaagccagagttgctccgggccattgt 349

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || |||||||| |||||||| || |||||
Sbjct: 350 tgactgtggctttgagcatccatcagaagtccagcatgagtgtatccctcaggccatcct 409

                    
Query: 386 cggaatgga 394
            ||||||||
Sbjct: 410 gggaatgga 418

---

>ref|NM_001033629.1| Bos taurus similar to HLA-B associated transcript 1 (BAT1), mRNA
          Length = 1673

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 104/129 (80%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || || || |||||| | |||||||| ||| |||| ||||||||   
Sbjct: 290 catccacagctctggctttcgtgacttcttgctcaagccagagttgctccgggccattgt 349

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
            ||||| || || ||||| || || ||||| || |||||||| |||||||| || |||||
Sbjct: 350 tgactgtggctttgagcatccatcagaagtccagcatgagtgtatccctcaggccatcct 409

                    
Query: 386 cggaatgga 394
            ||||||||
Sbjct: 410 gggaatgga 418

---

>gb|AF391287.1| Branchiostoma floridae cosmid MPMGc117C0356, partial sequence
          Length = 38554

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 390  atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcct 445
            ||||||||| ||||||| || || || || |||||||||||||| |||||||||||
Sbjct: 4972 atggatgtcctctgccaggccaagtctggtatgggcaagactgccgtctttgtcct 5027



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                        
Query: 266  catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
            ||||||||||||||| ||||| || ||||| || || |||||||| || || ||||||  
Sbjct: 3347 catccacagctccggtttccgggatttcctgctgaaacccgagctccttcgcgccatcgt 3406

                                    
Query: 326  ggactgcggattcgagcacccttc 349
             |||||||| || ||||| |||||
Sbjct: 3407 tgactgcggttttgagcatccttc 3430



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 499  tgtgccacaccagagagctggcttaccagatt 530
            ||||||||||||| |||||||| | |||||||
Sbjct: 5534 tgtgccacaccagggagctggccttccagatt 5565

---

>gb|AY423389.1| Canis familiaris BAC 231G24 MHC class I locus, partial sequence
          Length = 150102

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                          
Query: 360    catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
              ||||||||||||||||| || || || |||||||||||| | ||||| || || || |||
Sbjct: 113546 catgagtgcatccctcaggccattctgggaatggatgtcctatgccaggccaagtcaggg 113487

                         
Query: 420    atgggcaagac 430
              ||||| |||||
Sbjct: 113486 atgggaaagac 113476



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                          
Query: 257    ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagctgctacg 316
              |||||||  |||||||||||| || || || |||||||| || ||||| ||| |||| ||
Sbjct: 114451 ctacgtctccatccacagctctggctttcgtgacttcctgctgaagccagagttgctccg 114392

                    
Query: 317    ggccat 322
              ||||||
Sbjct: 114391 ggccat 114386

---

>ref|XM_533895.2| PREDICTED: Canis familiaris similar to DEAD (Asp-Glu-Ala-Asp) box
           polypeptide 39 isoform 1 (LOC476689), mRNA
          Length = 1448

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 137/174 (78%)
 Strand = Plus / Plus

                                                                       
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
           |||||||||||| || ||||| ||||| || || ||||| ||||| ||  |||||||   
Sbjct: 153 catccacagctctggcttccgggactttctgctgaagccggagctcctgagggccatagt 212

                                                                       
Query: 326 ggactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagcaatcct 385
           |||||| || || ||||| || || || || || || ||||| || || ||||| |||||
Sbjct: 213 ggactgtggctttgagcatccatctgaggtccagcacgagtgtattccccaagccatcct 272

                                                                 
Query: 386 cggaatggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctt 439
            || ||||| ||| | ||||| || || || ||||||||||||||||| |||||
Sbjct: 273 gggcatggacgtcctgtgccaggccaagtctgggatgggcaagactgcggtctt 326

---

>ref|XM_755994.1| Ustilago maydis 521 hypothetical protein (UM04940.1) partial mRNA
          Length = 1629

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 282 ttccgcgacttcctcctcaagcccgagctgctacgggccatc 323
           |||||||| |||||||||||||||||||| || || ||||||
Sbjct: 397 ttccgcgatttcctcctcaagcccgagcttctccgagccatc 438

---

>gb|BC072526.1| Rattus norvegicus cDNA clone IMAGE:7097268, containing frame-shift
           errors
          Length = 1925

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | |||||||| || || |||||||||||||| ||||| |||||
Sbjct: 283 atggatgtcctgtgccaagccaagtctgggatgggcaagacagctgtgtttgt 335

---

>emb|AJ251914.1|SSC251914 Sus scrofa MHC class I SLA genes, haplotype H01, clone BAC 493A6
          Length = 158063

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 38704 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 38760



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtc 398
             ||||| ||||||||||| || ||||| ||||||||||||
Sbjct: 39576 catgaatgcatccctcaggccatcctgggaatggatgtc 39614

---

>gb|BC086328.1| Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box polypeptide 39, mRNA
           (cDNA clone MGC:105369 IMAGE:7132938), complete cds
          Length = 1740

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | |||||||| || || |||||||||||||| ||||| |||||
Sbjct: 547 atggatgtcctgtgccaagccaagtctgggatgggcaagacagctgtgtttgt 599

---

>ref|NM_053563.2| Rattus norvegicus DEAD (Asp-Glu-Ala-Asp) box polypeptide 39
           (Ddx39), mRNA
          Length = 1740

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | |||||||| || || |||||||||||||| ||||| |||||
Sbjct: 547 atggatgtcctgtgccaagccaagtctgggatgggcaagacagctgtgtttgt 599

---

>emb|BX001040.14| Human DNA sequence from clone DAQB-72H16 on chromosome 6 Contains
             HCG26, the gene coding for a transcript for an MHC class I
             fragment (clone 3.8-1), the MICB gene for MHC class I
             polypeptide-related sequence B, the PPIP9 peptidylprolyl
             isomerase (cyclophilin) pseudogene 9, the RPL15P4
             ribosomal protein L15 pseudogene 4, the BAT1 gene for
             HLA-B associated transcript 1, the ATP6V1G2 gene for
             ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G
             isoform 2, the 5' end of the NFKBIL1 gene for nuclear
             factor of kappa light polypeptide gene enhancer in B-cells
             inhibitor-like 1 and two CpG islands, complete sequence
          Length = 83520

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 69799 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 69743



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 68660 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 68601

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 68600 atgggaaagacagcagtgtttgtc 68577

---

>emb|BX248516.6| Human DNA sequence from clone DASS-161H22 on chromosome 6 Contains the
             BAT1 gene for HLA-B associated transcript 1, the ATP6V1G2
             gene for ATPase, H+ transporting, lysosomal 13kDa, V1
             subunit G isoform 2, the NFKBIL1 gene for nuclear factor
             of kappa light polypeptide gene enhancer in B-cells
             inhibitor-like 1 and no CpG islands, complete sequence
          Length = 42438

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 13246 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 13190



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 12105 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 12046

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 12045 atgggaaagacagcagtgtttgtc 12022

---

>emb|AL662801.7| Human DNA sequence from clone XXbac-296P20 on chromosome 6 contains a
             ribosomal protein L15 (RPL15) pseudogene, the BAT1 gene
             for HLA-B associated transcript 1, the ATP6V1G gene for
             ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G,
             the NFKBIL1 gene for nuclear factor of kappa light
             polypeptide gene enhancer in B-cells inhibitor-like 1, the
             LTA gene for lymphotoxin alpha, the TNF gene for tumour
             necrosis factor, the LTB gene for lymphotoxin beta, the
             LST1 gene for leukocyte specific transcript 1, the LY117
             gene for lymphocyte antigen 117, the AIF1 gene for
             alograft imflammatory factor 1, the BAT2 gene for HLA-B
             associated transcript 2, the BAT3 gene for HLA-B
             associated transcript 3, the APOM gene for apolipoprotein
             M, the 3' end of the gene for chromosome 6, open reading
             frame 47 and four CpG islands, complete sequence
          Length = 132330

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 13081 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 13025



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 11940 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 11881

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 11880 atgggaaagacagcagtgtttgtc 11857

---

>emb|AL662847.6| Human DNA sequence from clone XXbac-270M2 on chromosome 6 contains the
             gene for a novel protein similar to similar to
             peptidyl-prolyl cis-trans isomerase A (PPIase), a
             ribosomal protein L15 (RPL15) pseudogene, the BAT1 gene
             for HLA-B associated transcript 1, the ATP6V1G gene for
             ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G,
             the NFKBIL1 gene for nuclear factor of kappa light
             polypeptide gene enhancer in B-cells inhibitor-like 1, the
             LTA gene for lymphotoxin alpha, the TNF gene for tumour
             necrosis factor, the LTB gene for lymphotoxin beta, the
             LST1 gene for leukocyte specific transcript 1, the LY117
             gene for lymphocyte antigen 117, the AIF1 gene for
             alograft imflammatory factor 1, the BAT2 gene for HLA-B
             associated transcript 2, the 3' end of the BAT3 gene for
             HLA-B associated transcript 3 and two CpG islands,
             complete sequence
          Length = 135784

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 26891 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 26835



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 25752 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 25693

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 25692 atgggaaagacagcagtgtttgtc 25669

---

>emb|Z34846.1|SSBAT1G S.scrofa BAT1 gene
          Length = 10674

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 266  catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
            |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 1227 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 1283



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 360  catgagtgcatccctcaagcaatcctcggaatggatgtc 398
            ||||| ||||||||||| || ||||| ||||||||||||
Sbjct: 2092 catgaatgcatccctcaggccatcctgggaatggatgtc 2130

---

>emb|CR753820.15| Human DNA sequence from clone DADB-26I14 on chromosome 6, complete
             sequence
          Length = 74851

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 70150 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 70094



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 69011 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 68952

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 68951 atgggaaagacagcagtgtttgtc 68928

---

>emb|CR753864.4| Human DNA sequence from clone DAMA-BMC190B12 on chromosome 6, complete
             sequence
          Length = 82192

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 76032 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 75976



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 74893 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 74834

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 74833 atgggaaagacagcagtgtttgtc 74810

---

>dbj|AB210170.1| Pan troglodytes NFKBIL1, ATP6V1G2, BAT1 genes for nuclear factor of
             kappa light polypeptide gene enhancer in B-cells
             inhibitor-like 1, ATPase, H+ transporting, lysosomal, V1
             subunit G2, isoform a, nuclear RNA helicase, complete cds,
             cell_line: Ericka
          Length = 34055

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 19435 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 19491



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 20577 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 20636

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 20637 atgggaaagacagcagtgtttgtc 20660

---

>dbj|AB210169.1| Pan troglodytes NFKBIL1, ATP6V1G2, BAT1 genes for nuclear factor of
             kappa light polypeptide gene enhancer in B-cells
             inhibitor-like 1, ATPase, H+ transporting, lysosomal, V1
             subunit G2, isoform a, nuclear RNA helicase, complete cds,
             cell_line: Borie
          Length = 34055

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 19435 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 19491



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 20577 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 20636

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 20637 atgggaaagacagcagtgtttgtc 20660

---

>dbj|AB202112.1| Homo sapiens NFKBIL1, ATP6V1G2, BAT1 genes for nuclear factor of kappa
             light polypeptide gene enhancer, ATPase, H+ transporting,
             lysosomal 13kDa, V1 subunit G isoform 2, HLA-B associated
             transcript 1, complete cds
          Length = 34035

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 19432 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 19488



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 20571 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 20630

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 20631 atgggaaagacagcagtgtttgtc 20654

---

>dbj|AK016960.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4933428C17 product:nuclear RNA helicase,
           DECD variant of DEAD box family, full insert sequence
          Length = 1497

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| ||||||| || || || |||||||||||||| ||||| |||||
Sbjct: 319 atggatgtcctctgccaggccaagtctgggatgggcaagacagctgtgtttgt 371

---

>gb|AC148679.1| Macaca mulatta Major Histocompatibility Complex BAC MMU125K24, complete
              sequence
          Length = 181659

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                       
Query: 266    catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
              |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 134195 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 134139



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                     
Query: 360    catgagtgcatccctcaagcaatcctcggaatggatgtc 398
              ||||||||||||||||| || || || ||||||||||||
Sbjct: 132751 catgagtgcatccctcaggccattctgggaatggatgtc 132713

---

>emb|BX927320.5| Human DNA sequence from clone DAMA-25N12 on chromosome 6, complete
             sequence
          Length = 100409

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 40146 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 40090



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 39007 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 38948

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 38947 atgggaaagacagcagtgtttgtc 38924

---

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266    catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
              |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 110002 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 110058



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 360    catgagtgcatccctcaagcaatcctcggaatggatgtc 398
              ||||||||||||||||| || || || ||||||||||||
Sbjct: 111445 catgagtgcatccctcaggccattctgggaatggatgtc 111483

---

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266    catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
              |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 403599 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 403655



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                          
Query: 360    catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
              ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 404738 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 404797

                                      
Query: 420    atgggcaagactgctgtctttgtc 443
              ||||| ||||| || || ||||||
Sbjct: 404798 atgggaaagacagcagtgtttgtc 404821

---

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 44745 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 44801



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 45888 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 45947

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 45948 atgggaaagacagcagtgtttgtc 45971

---

>emb|AL953855.9| Zebrafish DNA sequence from clone CH211-239F4 in linkage group 1,
             complete sequence
          Length = 146080

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 266   catccacagctccggattccgcgacttcctcct 298
             ||||||||||||||||||||| || ||||||||
Sbjct: 52026 catccacagctccggattccgagatttcctcct 52058



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             |||||||||||||| ||||| ||||| || |||||  || | ||||| ||||| || || 
Sbjct: 53164 catgagtgcatcccacaagccatcctgggcatggacatcctgtgccaggcaaagtctgga 53223

                                    
Query: 420   atgggcaagactgctgtctttgt 442
             ||||| |||||||| || |||||
Sbjct: 53224 atgggaaagactgccgtgtttgt 53246

---

>dbj|AB054536.1| Pan troglodytes LTB, TNF alpha, LTA, IKBL, ATP6G, BAT1, Patr-MIC and
             Patr-B genes, complete cds
          Length = 176284

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 44745 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 44801



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 45888 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 45947

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 45948 atgggaaagacagcagtgtttgtc 45971

---

>emb|CR925799.3| Wallaby DNA sequence from clone GRWB-66O5, complete sequence
          Length = 165490

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| |||||||| ||||| || || ||||| ||| |||| ||||||||
Sbjct: 56906 catccacagctctggattccgagactttctacttaagccagagttgctccgggccat 56850

---

>dbj|AB088115.1| Homo sapiens IKBL, ATP6G, BAT1 genes for nuclear factor of kappa light
             polypeptide gene enhancer in B-cells inhibitor-like 1,
             putative vacuolar ATPase G subunit, HLA-B associated
             transcript 1, complete cds
          Length = 34044

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 19440 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 19496



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 20579 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 20638

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 20639 atgggaaagacagcagtgtttgtc 20662

---

>gb|AC004181.1|AC004181 Homo sapiens clone UWGC:m9a from 6p21, complete sequence
          Length = 35569

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 28813 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 28869



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 29952 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 30011

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 30012 atgggaaagacagcagtgtttgtc 30035

---

>gb|AF063447.1|AF063447 Rattus norvegicus nuclear RNA helicase mRNA, complete cds
          Length = 1511

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | |||||||| || || |||||||||||||| ||||| |||||
Sbjct: 343 atggatgtcctgtgccaagccaagtctgggatgggcaagacagctgtgtttgt 395

---

>emb|CT033635.1| Platynereis dumerilii EST IB0AAA17AE03EM1
          Length = 866

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 212 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 264



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 386 tgccacaccagagaactggctttccagat 414

---

>emb|CT033441.1| Platynereis dumerilii EST IB0AAA20BC01EM1
          Length = 904

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 223 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 275



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 397 tgccacaccagagaactggctttccagat 425

---

>emb|CT033309.1| Platynereis dumerilii EST IB0AAA22DB06EM1
          Length = 920

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 223 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 275



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 397 tgccacaccagagaactggctttccagat 425

---

>emb|CT033123.1| Platynereis dumerilii EST IB0AAA26BF04EM1
          Length = 942

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 213 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 265



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 387 tgccacaccagagaactggctttccagat 415

---

>emb|CT033090.1| Platynereis dumerilii EST IB0AAA27AA10EM1
          Length = 884

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 223 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 275



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 397 tgccacaccagagaactggctttccagat 425

---

>emb|CT033006.1| Platynereis dumerilii EST IB0AAA28AF08EM1
          Length = 886

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 223 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 275



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 397 tgccacaccagagaactggctttccagat 425

---

>emb|CT032528.1| Platynereis dumerilii EST IB0AAA36DE03EM1
          Length = 853

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 327 gactgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           |||||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 223 gactgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 275



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 397 tgccacaccagagaactggctttccagat 425

---

>emb|Y14768.1|HSY14768 Homo sapiens DNA, cosmid clones TN62 and TN82
          Length = 81800

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 79200 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 79256



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 80341 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 80400

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 80401 atgggaaagacagcagtgtttgtc 80424

---

>dbj|AB000882.1| Homo sapiens genomic DNA for centromeric end of MHC class I region on
             chromosome 6, complete sequence
          Length = 148960

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 23580 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 23636



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 24719 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 24778

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 24779 atgggaaagacagcagtgtttgtc 24802

---

>dbj|AB000876.1| Homo sapiens genomic DNA for centromeric end of MHC class I region on
             chromosome 6, cosmid clone:TY1F9, complete sequence
          Length = 32317

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             |||||||||||| || || || |||||||| |||||||| ||| |||| ||||||||
Sbjct: 23580 catccacagctctggctttcgtgacttcctgctcaagccagagttgctccgggccat 23636



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                         
Query: 360   catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
             ||||||||||||||||| || || || |||||||||||| | ||||| || || || || 
Sbjct: 24719 catgagtgcatccctcaggccattctgggaatggatgtcctgtgccaggccaagtcgggc 24778

                                     
Query: 420   atgggcaagactgctgtctttgtc 443
             ||||| ||||| || || ||||||
Sbjct: 24779 atgggaaagacagcagtgtttgtc 24802

---

>gb|AY223417.1| Schistosoma japonicum clone ZZZ368 mRNA sequence
          Length = 1423

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 402 tgccaagcaaaatccgggatgggcaagactgc 433
           |||||||| |||||||||||||| ||||||||
Sbjct: 290 tgccaagcgaaatccgggatgggaaagactgc 321

---

>gb|AC008569.7| Homo sapiens chromosome 19 clone CTC-548K16, complete sequence
          Length = 227245

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                          
Query: 266    catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccatcca 325
              |||||||||||| || ||||| ||||| || || ||||| ||||| || |||||||||  
Sbjct: 147710 catccacagctctggcttccgggactttctgctgaagccggagctcctgcgggccatcgt 147651

                                      
Query: 326    ggactgcggattcgagcacccttc 349
              |||||| || || ||||| |||||
Sbjct: 147650 ggactgtggctttgagcatccttc 147627



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 360    catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
              ||||||||||| || || || ||||| || ||||| ||| | ||||| || || ||||||
Sbjct: 147282 catgagtgcattccccaggccatcctgggcatggacgtcctgtgccaggccaagtccggg 147223

                                  
Query: 420    atgggcaagactgctgtctt 439
              ||||||||||| || |||||
Sbjct: 147222 atgggcaagacagcggtctt 147203

---

>gb|AY815776.1| Schistosoma japonicum clone SJCHGC00402 unknown mRNA
          Length = 685

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 402 tgccaagcaaaatccgggatgggcaagactgc 433
           |||||||| |||||||||||||| ||||||||
Sbjct: 266 tgccaagcgaaatccgggatgggaaagactgc 297

---

>gb|AY815994.1| Schistosoma japonicum clone SJCHGC00403 unknown mRNA
          Length = 857

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 402 tgccaagcaaaatccgggatgggcaagactgc 433
           |||||||| |||||||||||||| ||||||||
Sbjct: 283 tgccaagcgaaatccgggatgggaaagactgc 314

---

>gb|BC106294.1| Xenopus laevis similar to nuclear RNA helicase, mRNA (cDNA clone
           MGC:130793 IMAGE:7974282), complete cds
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||| ||||| ||||| || ||||| || |||||||| |||||  |  | ||||| || 
Sbjct: 377 gaagtccaacacgagtgtattcctcaggccatcctcggtatggacattctttgccaggct 436

                                              
Query: 411 aaatccgggatgggcaagactgctgtctttgtcct 445
           ||||| || ||||| ||||||||||| ||||||||
Sbjct: 437 aaatctggtatgggaaagactgctgtgtttgtcct 471

---

>gb|BC042330.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39a, mRNA (cDNA
           clone MGC:55881 IMAGE:3818646), complete cds
          Length = 1539

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
           |||||||||||||| ||||| ||||| || |||||  || | ||||| ||||| || || 
Sbjct: 208 catgagtgcatcccacaagccatcctgggcatggacatcctgtgccaggcaaagtctgga 267

                                  
Query: 420 atgggcaagactgctgtctttgt 442
           ||||| |||||||| || |||||
Sbjct: 268 atgggaaagactgccgtgtttgt 290

---

>ref|NM_199721.1| Danio rerio DEAD (Asp-Glu-Ala-Asp) box polypeptide 39a (ddx39a),
           mRNA
          Length = 1539

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 catgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagcaaaatccggg 419
           |||||||||||||| ||||| ||||| || |||||  || | ||||| ||||| || || 
Sbjct: 208 catgagtgcatcccacaagccatcctgggcatggacatcctgtgccaggcaaagtctgga 267

                                  
Query: 420 atgggcaagactgctgtctttgt 442
           ||||| |||||||| || |||||
Sbjct: 268 atgggaaagactgccgtgtttgt 290

---

>gb|BC045239.1| Xenopus laevis similar to nuclear RNA helicase, mRNA (cDNA clone
           MGC:53693 IMAGE:4889168), complete cds
          Length = 1518

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||| ||||| ||||| || ||||| || |||||||| |||||  |  | ||||| || 
Sbjct: 245 gaagtccaacacgagtgtattcctcaggccatcctcggtatggacattctttgccaggct 304

                                              
Query: 411 aaatccgggatgggcaagactgctgtctttgtcct 445
           ||||| || ||||| ||||||||||| ||||||||
Sbjct: 305 aaatctggtatgggaaagactgctgtgtttgtcct 339

---

>gb|AY298950.1| Xenopus laevis DECD-box RNA helicase (DDX39) mRNA, complete cds
          Length = 1653

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                       
Query: 351 gaagtgcaacatgagtgcatccctcaagcaatcctcggaatggatgtcatctgccaagca 410
           ||||| ||||| ||||| || ||||| || |||||||| |||||  |  | ||||| || 
Sbjct: 362 gaagtccaacacgagtgtattcctcaggccatcctcggtatggacattctttgccaggct 421

                                              
Query: 411 aaatccgggatgggcaagactgctgtctttgtcct 445
           ||||| || ||||| ||||||||||| ||||||||
Sbjct: 422 aaatctggtatgggaaagactgctgtgtttgtcct 456

---

>ref|NM_203720.1| Xenopus tropicalis ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog,
            yeast) (ube2g1), mRNA
          Length = 2136

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 442  tcctgtcttctctccagcagatc 464
            |||||||||||||||||||||||
Sbjct: 1084 tcctgtcttctctccagcagatc 1106

---

>emb|CR762313.2| Xenopus tropicalis finished cDNA, clone TGas109f01
          Length = 2010

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 442 tcctgtcttctctccagcagatc 464
           |||||||||||||||||||||||
Sbjct: 976 tcctgtcttctctccagcagatc 998

---

>gb|BC061341.1| Xenopus tropicalis ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog,
            yeast), mRNA (cDNA clone MGC:75869 IMAGE:5382941),
            complete cds
          Length = 2136

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 442  tcctgtcttctctccagcagatc 464
            |||||||||||||||||||||||
Sbjct: 1084 tcctgtcttctctccagcagatc 1106

---

>dbj|AB008925.1| Secale cereale gene, repeat sequence, clone pScJNK4
          Length = 1232

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 254 gggctacgtcggcatccacagctccgg 280
           |||| ||||||||||||||||||||||
Sbjct: 836 gggcaacgtcggcatccacagctccgg 862

---

>dbj|AB008922.1| Secale cereale gene for repeat sequence
          Length = 1192

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 254 gggctacgtcggcatccacagctccgg 280
           |||| ||||||||||||||||||||||
Sbjct: 809 gggcaacgtcggcatccacagctccgg 835

---

>ref|XM_366730.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02806.4) partial mRNA
          Length = 1353

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccggattccgcgacttcctcctcaagcccgagctgctacgggccatccaggactgcggat 336
           |||| |||||||||||||| || ||||| ||||| || || || |||   |||||||| |
Sbjct: 155 ccggcttccgcgacttcctgctgaagccggagctcctccgcgcgatcggtgactgcggtt 214

                     
Query: 337 tcgagcaccc 346
           ||||||||||
Sbjct: 215 tcgagcaccc 224

---

>ref|XM_499972.1| Yarrowia lipolytica CLIB122, YALI0A11157g predicted mRNA
          Length = 534

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 257 ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagct 310
           ||||||||| ||||||  | |||| ||||| |||||| | ||||||||||||||
Sbjct: 411 ctacgtcggaatccactccaccggtttccgagacttcttgctcaagcccgagct 464

---

>emb|AL031863.1|DMCEG0003 Drosophila melanogaster cosmid EG0003
          Length = 37688

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 225   gctgccaagcccgccgccgacg 246
             ||||||||||||||||||||||
Sbjct: 11251 gctgccaagcccgccgccgacg 11230

---

>ref|NM_080069.3| Drosophila melanogaster Elongation factor 1 CG6341-RA (Ef1beta),
           mRNA
          Length = 885

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 225 gctgccaagcccgccgccgacg 246
           ||||||||||||||||||||||
Sbjct: 381 gctgccaagcccgccgccgacg 402

---

>dbj|AK146294.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730047P12 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 39, full insert sequence
          Length = 1528

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgtcctgtct 449
           ||||||||| | ||||| || || || |||||||||||||| ||||| ||||| ||| | 
Sbjct: 354 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgtgctggcc 413

                         
Query: 450 tctctccagcagat 463
            |||| ||||||||
Sbjct: 414 actctgcagcagat 427

---

>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone
             BACR09M08, complete sequence
          Length = 179283

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 225   gctgccaagcccgccgccgacg 246
             ||||||||||||||||||||||
Sbjct: 17848 gctgccaagcccgccgccgacg 17869

---

>gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53E-54X, BAC clone
              BACR03E17, complete sequence
          Length = 160338

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 225    gctgccaagcccgccgccgacg 246
              ||||||||||||||||||||||
Sbjct: 122497 gctgccaagcccgccgccgacg 122518

---

>gb|AF172636.1| Drosophila melanogaster LD24492 full insert cDNA
          Length = 804

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 225 gctgccaagcccgccgccgacg 246
           ||||||||||||||||||||||
Sbjct: 329 gctgccaagcccgccgccgacg 350

---

>gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45 of 73 of the complete
              sequence
          Length = 272948

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 225    gctgccaagcccgccgccgacg 246
              ||||||||||||||||||||||
Sbjct: 136345 gctgccaagcccgccgccgacg 136366

---

>gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s DS07321 (D175), DS05993
             (D241), and DS06306 (D173)), complete sequence
          Length = 154985

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 225   gctgccaagcccgccgccgacg 246
             ||||||||||||||||||||||
Sbjct: 87949 gctgccaagcccgccgccgacg 87928

---

>emb|CT033113.1| Platynereis dumerilii EST IB0AAA26CA01EM1
          Length = 869

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 330 tgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           ||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 227 tgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 276



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 398 tgccacaccagagaactggctttccagat 426

---

>emb|CT033026.1| Platynereis dumerilii EST IB0AAA27DB01EM1
          Length = 925

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 330 tgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           ||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 238 tgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 287



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 409 tgccacaccagagaactggctttccagat 437

---

>emb|CT032448.1| Platynereis dumerilii EST IB0AAA38AE03EM1
          Length = 944

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 330 tgcggattcgagcacccttccgaagtgcaacatgagtgcatccctcaagc 379
           ||||| || ||||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 227 tgcggttttgagcatccttctgaagtgcaacacgagtgtattcctcaagc 276



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 501 tgccacaccagagagctggcttaccagat 529
           |||||||||||||| ||||||| ||||||
Sbjct: 398 tgccacaccagagaactggctttccagat 426

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                     
Query: 257     ctacgtcggcatccacagctccggattccgcgacttcctcctcaagcccgagct 310
               ||||||||| ||||||  | |||| ||||| |||||| | ||||||||||||||
Sbjct: 1167008 ctacgtcggaatccactccaccggtttccgagacttcttgctcaagcccgagct 1167061

---

>ref|NM_133300.2| Rattus norvegicus HLA-B-associated transcript 1A (Bat1a), mRNA
          Length = 1660

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
           ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 266 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 322

---

>ref|NM_197982.2| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 (Ddx39),
           mRNA
          Length = 1634

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 387 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 439

---

>gb|AC005011.2| Homo sapiens BAC clone GS1-111G14 from 7, complete sequence
          Length = 166069

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    ctggtttggttggtttctact 118
             |||||||||||||||||||||
Sbjct: 61299 ctggtttggttggtttctact 61319

---

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 222     tccgctgccaagcccgccgcc 242
               |||||||||||||||||||||
Sbjct: 4826048 tccgctgccaagcccgccgcc 4826028

---

>emb|AL161940.6| Human DNA sequence from clone RP11-459I16 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 98221

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 508   ccagagagctggcttaccaga 528
             |||||||||||||||||||||
Sbjct: 79552 ccagagagctggcttaccaga 79532

---

>emb|BX883046.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
             assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
             RT1n haplotype; segment 5/11
          Length = 349047

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 90951 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 91007

---

>gb|AC164432.3| Mus musculus BAC clone RP23-394G23 from chromosome 8, complete sequence
          Length = 220224

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 390   atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
             ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 48682 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 48630

---

>emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genome; segment 11/16
          Length = 349635

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 236    cgccgccgacgccaagaaggg 256
              |||||||||||||||||||||
Sbjct: 158169 cgccgccgacgccaagaaggg 158149

---

>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29
          Length = 309050

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 195   gacgacgacaaggtggtcctc 215
             |||||||||||||||||||||
Sbjct: 89600 gacgacgacaaggtggtcctc 89580

---

>emb|AL662986.3|OSJN00187 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0087H01,
              complete sequence
          Length = 166906

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 182    cgactacgaggaggacgacgacaaggtgg 210
              |||| ||||||| ||||||||||||||||
Sbjct: 139169 cgacgacgaggacgacgacgacaaggtgg 139141

---

>emb|AJ428513.1|CTE428513 Chironomus tentans mRNA for HEL protein
          Length = 1643

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 402 tgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           |||||||||||||| || ||||| ||||| ||||| |||||
Sbjct: 292 tgccaagcaaaatctggtatgggaaagacagctgtgtttgt 332

---

>emb|AJ314857.1|RNO314857 Rattus norvegicus Nfkbil1 gene (partial), Atp6G, Bat1, RT1-C/E1,
            RT1-C/E2, RT1-C/E3, RT1-C/E4, RT1-C/E5, RT1-C/E7 genes
            and RT1-C/E6, RT1-C/E8, RT1-C/E9 pseudogenes
          Length = 198911

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                     
Query: 266  catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
            ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 8767 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 8823

---

>gb|AC091714.3| Papio anubis clone RP41-93A16, complete sequence
          Length = 135851

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 291   ttcctcctcaagcccgagctg 311
             |||||||||||||||||||||
Sbjct: 21272 ttcctcctcaagcccgagctg 21252

---

>emb|CR627388.1| Homo sapiens mRNA; cDNA DKFZp781L1171 (from clone DKFZp781L1171)
          Length = 3280

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 508  ccagagagctggcttaccaga 528
            |||||||||||||||||||||
Sbjct: 1466 ccagagagctggcttaccaga 1446

---

>gb|AF387339.1| Rattus norvegicus IkBL, vacuolar ATPase NG38, Bat1, and MHC class I
             antigen (RT1.46) genes, complete cds
          Length = 36516

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 266   catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
             ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 10631 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 10687

---

>dbj|AK137114.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430085I15 product:Nuclear RNA helicase, DECD
           variant of DEAD box family, full insert sequence
          Length = 3852

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 315 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 367

---

>dbj|AK150997.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830019L16 product:Nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 1517

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 338 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 390

---

>dbj|AK145927.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I530016E16 product:Nuclear RNA helicase,
           DECD variant of DEAD box family, full insert sequence
          Length = 1602

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 352 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 404

---

>dbj|AK149475.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length
           enriched library, clone:C730023D16 product:similar to
           Nuclear RNA helicase, DECD variant of DEAD box family
           [Mus musculus], full insert sequence
          Length = 1924

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 315 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 367

---

>dbj|AK152394.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067O14 product:Nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 1498

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 319 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 371

---

>dbj|AK151395.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830028P17 product:Nuclear RNA
           helicase, DECD variant of DEAD box family homolog [Mus
           musculus], full insert sequence
          Length = 1552

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 319 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 371

---

>dbj|AK164289.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030070E09 product:Nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 1453

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 279 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 331

---

>dbj|AK168079.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730056H06 product:Nuclear RNA helicase, DECD
           variant of DEAD box family, full insert sequence
          Length = 1452

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 278 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 330

---

>dbj|AK162752.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length
           enriched library, clone:A130024M12 product:Nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 2057

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 877 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 929

---

>dbj|AK167890.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730035H04 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 39, full insert sequence
          Length = 1452

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 279 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 331

---

>dbj|AK172448.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830208A11 product:DEAD (Asp-Glu-Ala-Asp)
           box polypeptide 39, full insert sequence
          Length = 1512

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 338 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 390

---

>dbj|AK012002.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610307C23 product:nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 1563

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 319 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 371

---

>dbj|AK011285.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610002F14 product:nuclear RNA
           helicase, DECD variant of DEAD box family, full insert
           sequence
          Length = 1422

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 249 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 301

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 182      cgactacgaggaggacgacgacaaggtgg 210
                |||| ||||||| ||||||||||||||||
Sbjct: 14406250 cgacgacgaggacgacgacgacaaggtgg 14406222

---

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 235 ccgccgccgacgccaagaagggctacgtcggca 267
           ||||||||||| |||||||||||| | ||||||
Sbjct: 546 ccgccgccgaccccaagaagggctccctcggca 578

---

>gb|AC010899.8| Homo sapiens BAC clone RP11-543K1 from 2, complete sequence
          Length = 210232

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    ccagcagccgcccaaaaccct 75
             |||||||||||||||||||||
Sbjct: 76084 ccagcagccgcccaaaaccct 76104

---

>gb|AC138982.2| Homo sapiens chromosome 5 clone RP13-284O6, complete sequence
          Length = 110563

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    caagctctatcctcccttccc 38
             |||||||||||||||||||||
Sbjct: 23840 caagctctatcctcccttccc 23860

---

>gb|AF293977.1|AF293977 Aeromonas hydrophila htrA-like serine protease (prtS1) gene,
           complete cds
          Length = 1362

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 242 cgacgccaagaagggctacgt 262
           |||||||||||||||||||||
Sbjct: 294 cgacgccaagaagggctacgt 314

---

>gb|AC091658.3| Papio anubis clone RP41-353N1, complete sequence
          Length = 113053

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 291    ttcctcctcaagcccgagctg 311
              |||||||||||||||||||||
Sbjct: 110701 ttcctcctcaagcccgagctg 110681

---

>gb|AF245690.1|AF245690 Streptomyces verticillus putative N-acetyl-glucosamine transferase
            gene, partial cds; and putative N-acetyl-glucosamine
            2-epimerase and hypothetical protein genes, complete cds
          Length = 5222

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 228  gccaagcccgccgccgacgcc 248
            |||||||||||||||||||||
Sbjct: 4796 gccaagcccgccgccgacgcc 4816

---

>gb|BC080243.1| Rattus norvegicus HLA-B-associated transcript 1A, mRNA (cDNA clone
           MGC:91440 IMAGE:7100155), complete cds
          Length = 1660

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
           ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 266 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 322

---

>gb|BC020134.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 39, mRNA (cDNA
           clone MGC:28113 IMAGE:3969048), complete cds
          Length = 1497

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 390 atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
           ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 297 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 349

---

>gb|AC134525.5| Mus musculus BAC clone RP24-496F7 from 8, complete sequence
          Length = 215900

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 390    atggatgtcatctgccaagcaaaatccgggatgggcaagactgctgtctttgt 442
              ||||||||| | ||||| || || || |||||||||||||| ||||| |||||
Sbjct: 152770 atggatgtcctgtgccaggccaagtctgggatgggcaagacagctgtgtttgt 152718

---

>gb|AC092266.4| Homo sapiens chromosome 5 clone RP11-24P24, complete sequence
          Length = 171601

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    caagctctatcctcccttccc 38
             |||||||||||||||||||||
Sbjct: 41101 caagctctatcctcccttccc 41081

---

>emb|AL805969.13| Mouse DNA sequence from clone RP23-40L1 on chromosome 4, complete
              sequence
          Length = 252953

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 28     cctcccttcccttcatcctct 48
              |||||||||||||||||||||
Sbjct: 235158 cctcccttcccttcatcctct 235138

---

>emb|AL805950.11| Mouse DNA sequence from clone RP23-134I15 on chromosome 2, complete
             sequence
          Length = 237337

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 27    tcctcccttcccttcatcctcttcc 51
             ||||||||||||||| |||||||||
Sbjct: 60931 tcctcccttcccttcctcctcttcc 60907

---

>gb|M75168.1|RATP49A Rattus norvegicus liver nuclear protein p47 mRNA,
          Length = 1643

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 266 catccacagctccggattccgcgacttcctcctcaagcccgagctgctacgggccat 322
           ||||||||||||||| || || || ||||| || ||||| ||| |||| ||||||||
Sbjct: 222 catccacagctccggctttcgagatttcctacttaagccagagttgctccgggccat 278

---

>dbj|AP003778.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-384C21, complete
             sequences
          Length = 183146

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 566   tgaaattaaggttgctgtatt 586
             |||||||||||||||||||||
Sbjct: 46802 tgaaattaaggttgctgtatt 46822

---

>dbj|AP002780.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-648G9, complete
             sequence
          Length = 73990

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 566   tgaaattaaggttgctgtatt 586
             |||||||||||||||||||||
Sbjct: 66825 tgaaattaaggttgctgtatt 66845

---

>ref|XM_516634.1| PREDICTED: Pan troglodytes similar to MEMD protein (LOC460565), mRNA
          Length = 2820

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 482  ggtggcagcacttgtattgt 501
            ||||||||||||||||||||
Sbjct: 1697 ggtggcagcacttgtattgt 1678

---

>gb|BC082368.1| Xenopus laevis MGC81606 protein, mRNA (cDNA clone MGC:81606
           IMAGE:6863791), complete cds
          Length = 1921

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 351 gaagtgcaacatgagtgcatccctcaagcaat 382
           |||||||||||||| ||||| ||||| |||||
Sbjct: 369 gaagtgcaacatgaatgcattcctcaggcaat 400

---

>ref|XM_956777.1| Neurospora crassa OR74A hypothetical protein (NCU05166.1) partial
           mRNA
          Length = 822

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 agtccaggacgggggagaacgacg 162
           |||||||||||| |||||||||||
Sbjct: 367 agtccaggacggcggagaacgacg 344

---

>gb|AC117780.5| Mus musculus chromosome 16, clone RP24-540H15, complete sequence
          Length = 153703

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 482    ggtggcagcacttgtattgt 501
              ||||||||||||||||||||
Sbjct: 117255 ggtggcagcacttgtattgt 117274

---

>gb|DQ486140.1| Homo sapiens activated leukocyte cell adhesion molecule variant 2
           mRNA, complete cds, alternatively spliced
          Length = 2647

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 482 ggtggcagcacttgtattgt 501
           ||||||||||||||||||||
Sbjct: 829 ggtggcagcacttgtattgt 810

---

>gb|DQ486139.1| Homo sapiens activated leukocyte cell adhesion molecule variant 1
           mRNA, complete cds, alternatively spliced
          Length = 4185

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 482 ggtggcagcacttgtattgt 501
           ||||||||||||||||||||
Sbjct: 829 ggtggcagcacttgtattgt 810

---

>ref|XM_324522.1| Neurospora crassa OR74A hypothetical protein (NCU05166.1) partial
           mRNA
          Length = 822

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 139 agtccaggacgggggagaacgacg 162
           |||||||||||| |||||||||||
Sbjct: 367 agtccaggacggcggagaacgacg 344

---

>ref|XM_603932.2| PREDICTED: Bos taurus similar to zinc finger protein Cezanne
           (LOC525579), mRNA
          Length = 3627

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 27  tcctcccttcccttcatcct 46
           ||||||||||||||||||||
Sbjct: 291 tcctcccttcccttcatcct 272

---

>ref|NM_009655.1| Mus musculus activated leukocyte cell adhesion molecule (Alcam), mRNA
          Length = 4118

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 482  ggtggcagcacttgtattgt 501
            ||||||||||||||||||||
Sbjct: 2375 ggtggcagcacttgtattgt 2356

---

>gb|AF431414.1| Uncultured Acidobacterium group bacterium clone C16.27WL 16S
           ribosomal RNA gene, partial sequence
          Length = 576

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 ccgcgacttcctcctcaagc 303
           ||||||||||||||||||||
Sbjct: 200 ccgcgacttcctcctcaagc 181

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 28     cctcccttcccttcatcctcttcc 51
              |||||||||||||| |||||||||
Sbjct: 676264 cctcccttcccttcctcctcttcc 676287

---

>gb|AC119219.6| Mus musculus chromosome 12, clone RP24-201C18, complete sequence
          Length = 187098

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 437    ctttgtcctgtcttctctcc 456
              ||||||||||||||||||||
Sbjct: 174595 ctttgtcctgtcttctctcc 174576

---

>gb|AC129561.13| Mus musculus chromosome 1, clone RP23-192P10, complete sequence
          Length = 217279

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 565  ctgaaattaaggttgctgta 584
            ||||||||||||||||||||
Sbjct: 6760 ctgaaattaaggttgctgta 6741

---

>emb|Z81545.1|CEF49H6 Caenorhabditis elegans Cosmid F49H6, complete sequence
          Length = 30315

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   ttggttggtttctactaggg 122
             ||||||||||||||||||||
Sbjct: 22955 ttggttggtttctactaggg 22974

---

>gb|AC131748.3| Mus musculus BAC clone RP23-42A17 from 12, complete sequence
          Length = 215972

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 437   ctttgtcctgtcttctctcc 456
             ||||||||||||||||||||
Sbjct: 97155 ctttgtcctgtcttctctcc 97174

---

>gb|BC047985.1| Xenopus laevis ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C.
            elegans), mRNA (cDNA clone MGC:53896 IMAGE:5543414),
            complete cds
          Length = 2077

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 442  tcctgtcttctctccagcag 461
            ||||||||||||||||||||
Sbjct: 1042 tcctgtcttctctccagcag 1061

---

>gb|BC029639.1| Homo sapiens cDNA clone IMAGE:4931979, containing frame-shift
           errors
          Length = 3778

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 482 ggtggcagcacttgtattgt 501
           ||||||||||||||||||||
Sbjct: 861 ggtggcagcacttgtattgt 842

---

>emb|AL683842.11| Human DNA sequence from clone RP11-47G11 on chromosome 10 Contains the
             gene for B cell RAG associated protein (GALNAC4S-6ST)
             (BRAG, KIAA0598), a novel pseudogene and three CpG
             islands, complete sequence
          Length = 149244

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 432   gctgtctttgtcctgtcttc 451
             ||||||||||||||||||||
Sbjct: 94754 gctgtctttgtcctgtcttc 94773

---

>emb|AL354853.12| Human DNA sequence from clone RP11-555F9 on chromosome 9q22.1-22.33
             Contains the 5' end of a novel gene and the 3' end of a
             novel gene, complete sequence
          Length = 176422

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 509   cagagagctggcttaccaga 528
             ||||||||||||||||||||
Sbjct: 80008 cagagagctggcttaccaga 79989

---

>emb|AL138769.7| Human DNA sequence from clone RP1-33E13 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 100499

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 426   aagactgctgtctttgtcct 445
             ||||||||||||||||||||
Sbjct: 41189 aagactgctgtctttgtcct 41170

---

>emb|BX054630.1|CNS09EBE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 606

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 cgctgccaagcccgccgccg 243
           ||||||||||||||||||||
Sbjct: 150 cgctgccaagcccgccgccg 169

---

>gb|AC023602.5| Homo sapiens 3 BAC RP11-16N5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 96959

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 482   ggtggcagcacttgtattgt 501
             ||||||||||||||||||||
Sbjct: 45526 ggtggcagcacttgtattgt 45545

---

>ref|XM_793966.1| PREDICTED: Strongylocentrotus purpuratus similar to coagulation
           factor XIII, A1 subunit (LOC594530), mRNA
          Length = 765

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 56  cagcagccgcccaaaaccct 75
           ||||||||||||||||||||
Sbjct: 501 cagcagccgcccaaaaccct 520

---

>emb|CR860656.1| Pongo pygmaeus mRNA; cDNA DKFZp459H0124 (from clone DKFZp459H0124)
          Length = 3902

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 482  ggtggcagcacttgtattgt 501
            ||||||||||||||||||||
Sbjct: 1259 ggtggcagcacttgtattgt 1240

---

>emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete genome; segment 9/29
          Length = 300800

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 236    cgccgccgacgccaagaagg 255
              ||||||||||||||||||||
Sbjct: 131779 cgccgccgacgccaagaagg 131798

---

>emb|BX842687.13| Zebrafish DNA sequence from clone DKEY-97L11 in linkage group 7, complete
              sequence
          Length = 218252

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     cctcccttcccttcatcctc 47
              ||||||||||||||||||||
Sbjct: 160505 cctcccttcccttcatcctc 160486

---

>dbj|AK054632.1| Homo sapiens cDNA FLJ30070 fis, clone ASTRO2000046, highly similar to
            CD166 ANTIGEN PRECURSOR
          Length = 2560

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 482  ggtggcagcacttgtattgt 501
            ||||||||||||||||||||
Sbjct: 1416 ggtggcagcacttgtattgt 1397

---

>dbj|AB228010.1| Aspergillus oryzae cDNA, contig sequence: AoEST4883
          Length = 720

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 499 tgtgccacaccagagagctggcttaccagatt 530
           ||||||||||| | ||| ||||||||||||||
Sbjct: 611 tgtgccacacccgtgagttggcttaccagatt 642

---

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 499    tgtgccacaccagagagctggcttaccagatt 530
              ||||||||||| | ||| ||||||||||||||
Sbjct: 359024 tgtgccacacccgtgagttggcttaccagatt 358993

---

>dbj|AK139073.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730013J18 product:hypothetical
           DEAD/DEAH box helicase/ATP-dependent helicase, DEAD-box
           containing protein, full insert sequence
          Length = 1442

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 506 caccagagagctggcttaccagat 529
           ||||||||||||||| ||||||||
Sbjct: 261 caccagagagctggcctaccagat 284

---

>gb|AC022447.6| Homo sapiens chromosome 5 clone RP11-5N11, complete sequence
          Length = 143009

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 316   gggccatccaggactgcgga 335
             ||||||||||||||||||||
Sbjct: 14609 gggccatccaggactgcgga 14590

---

>gb|U95030.1|MMU95030 Mus musculus activated leukocyte cell adhesion molecule CD166
           (ALCAM) mRNA, complete cds
          Length = 1858

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 482 ggtggcagcacttgtattgt 501
           ||||||||||||||||||||
Sbjct: 767 ggtggcagcacttgtattgt 748

---

>gb|BC085301.1| Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 49, mRNA (cDNA
           clone IMAGE:5400586)
          Length = 2218

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 506 caccagagagctggcttaccagat 529
           ||||||||||||||| ||||||||
Sbjct: 249 caccagagagctggcctaccagat 272


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,771,461
Number of Sequences: 3902068
Number of extensions: 4771461
Number of successful extensions: 168263
Number of sequences better than 10.0: 289
Number of HSP's better than 10.0 without gapping: 284
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 166916
Number of HSP's gapped (non-prelim): 1307
length of query: 599
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 576
effective length of database: 17,143,297,704
effective search space: 9874539477504
effective search space used: 9874539477504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---