ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart48c09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY109840.1| Zea mays CL5708_1 mRNA sequence 56 1e-04
2gb|BT016438.1| Zea mays clone Contig271 mRNA sequence 54 4e-04
3ref|XM_473282.1| Oryza sativa (japonica cultivar-group), predic... 52 0.002
4emb|AL662984.3|OSJN00183 Oryza sativa genomic DNA, chromosome 4,... 52 0.002
5dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
6dbj|AK119481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
7ref|XM_473283.1| Oryza sativa (japonica cultivar-group), predic... 50 0.007
8ref|XM_473289.1| Oryza sativa (japonica cultivar-group), predic... 44 0.41
9emb|CR652655.2|CNS0F2K5 Tetraodon nigroviridis full-length cDNA 44 0.41
10emb|CR636393.1|CNS0EQ0F Tetraodon nigroviridis full-length cDNA 44 0.41
11emb|AL663006.3|OSJN00204 Oryza sativa genomic DNA, chromosome 4,... 44 0.41
12ref|XM_473287.1| Oryza sativa (japonica cultivar-group), predic... 42 1.6
13gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 1.6
14gb|AC084387.1| Mus musculus BAC clone RP23-93H2 from 7, complete... 42 1.6
15dbj|AK109281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
16gb|AC158570.5| Mus musculus chromosome 7, clone RP24-62O14, comp... 42 1.6
17gb|AF225656.1| Uncultured archaeon clone AS08-27 16S ribosomal R... 40 6.3
18gb|AF225641.1| Uncultured archaeon clone AS08-09 16S ribosomal R... 40 6.3
19gb|AF225627.1| Uncultured archaeon clone AS01-25 16S ribosomal R... 40 6.3
20gb|AY063610.1| Uncultured archaeon clone RST-15 16S ribosomal RN... 40 6.3
21gb|AY063604.1| Uncultured archaeon clone RST-9 16S ribosomal RNA... 40 6.3
22gb|AY386265.1| Bovine papular stomatitis virus strain BV-AR02, c... 40 6.3
23emb|AL691426.9| Human DNA sequence from clone RP11-787B4 on chro... 40 6.3
24emb|Y19177.1|SAN19177 Streptomyces antibioticus polyketide biosy... 40 6.3
25emb|AL939132.1|SCO939132 Streptomyces coelicolor A3(2) complete ... 40 6.3
26gb|DQ397551.1| Cenarchaeum symbiosum clone C05D09, complete sequ... 40 6.3
27gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 6.3
28gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 6.3
29gb|AC007086.10|AC007086 Drosophila melanogaster, chromosome 2R, ... 40 6.3
30ref|XM_578714.1| PREDICTED: Rattus norvegicus similar to photore... 40 6.3
31emb|Y15398.1|UEY15398 Unidentified archaeon 16S rRNA gene, parti... 40 6.3
32emb|Y15396.1|UEY15396 Unidentified archaeon 16S rRNA gene, parti... 40 6.3
33emb|Y15393.1|UEY15393 Unidentified archaeon 16S rRNA gene, parti... 40 6.3
34emb|Y15392.1|UEY15392 Unidentified archaeon 16S rRNA gene, parti... 40 6.3
35emb|Y15391.1|UEY15391 Unidentified archaeon 16S rRNA gene, parti... 40 6.3
36emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 6.3
37gb|AE003833.4| Drosophila melanogaster chromosome 2R, section 17... 40 6.3
38gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 6.3
39dbj|AP006254.1| Homo sapiens genomic DNA, chromosome 9, clone:RP... 40 6.3
40emb|AJ556410.1|UAR556410 Uncultured archaeon partial 16S rRNA ge... 40 6.3
41emb|AJ556407.1|UAR556407 Uncultured archaeon partial 16S rRNA ge... 40 6.3
42emb|AJ556405.1|UAR556405 Uncultured archaeon partial 16S rRNA ge... 40 6.3
43emb|AJ556404.1|UAR556404 Uncultured archaeon partial 16S rRNA ge... 40 6.3
44emb|AJ556258.1|UAR556258 Uncultured archaeon partial 16S rRNA ge... 40 6.3
45dbj|AB020876.1| Homo sapiens genomic DNA of 9q32 anti-oncogene o... 40 6.3 
>gb|AY109840.1| Zea mays CL5708_1 mRNA sequence
          Length = 1284

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 134 aacagagggatcgggctggaggtatgcaggcagctcgcgtccagcggagcgacggtcgtc 193
           |||| |||||||||||||||||| ||||||||||| ||   || |||    || ||||||
Sbjct: 222 aacaaagggatcgggctggaggtgtgcaggcagctggccagcaacggcatcaccgtcgtc 281

                                           
Query: 194 ctgacggcaagggacgagaagaggggcgccgc 225
           ||||| || || ||||||||| ||||||||||
Sbjct: 282 ctgacagccagagacgagaagcggggcgccgc 313
to top
>gb|BT016438.1| Zea mays clone Contig271 mRNA sequence
          Length = 1127

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 134 aacagagggatcgggctggaggtatgcaggcagct 168
           |||| |||||||||||||||||| |||||||||||
Sbjct: 27  aacaaagggatcgggctggaggtgtgcaggcagct 61



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 188 gtcgtcctgacggcaagggacgagaagaggggcgccgc 225
           ||||||||||| || || ||||||||| ||||||||||
Sbjct: 81  gtcgtcctgacagccagagacgagaagcggggcgccgc 118
to top
>ref|XM_473282.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 933

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 114 tcgccctggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgt 173
           |||| ||||| ||||| | ||||| |||| |||||||||||   ||||||||||||||||
Sbjct: 41  tcgcgctggttaccgggggcaacaaaggggtcgggctggagacctgcaggcagctcgcgt 100

             
Query: 174 cc 175
           ||
Sbjct: 101 cc 102
to top
>emb|AL662984.3|OSJN00183 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081C01,
             complete sequence
          Length = 140454

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                         
Query: 114   tcgccctggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgt 173
             |||| ||||| ||||| | ||||| |||| |||||||||||   ||||||||||||||||
Sbjct: 90819 tcgcgctggttaccgggggcaacaaaggggtcgggctggagacctgcaggcagctcgcgt 90878

               
Query: 174   cc 175
             ||
Sbjct: 90879 cc 90880



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 120   tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagct 168
             |||| ||||| | ||||| |||||||||||||||||| ||| |||||||
Sbjct: 94032 tggtcaccggcggcaacaaagggatcgggctggaggtgtgccggcagct 94080



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                          
Query: 120    tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgtccagcg 179
              |||| ||||| | ||||| || ||||||||||||||| ||| ||||||| ||  ||  ||
Sbjct: 128011 tggtcaccggcggcaacaaagagatcgggctggaggtgtgccggcagctggccgccgacg 128070

                                                        
Query: 180    gagcgacggtcgtcctgacggcaagggacgagaagaggggcg 221
              |    ||||| || |||||||| |||||||||| ||||||||
Sbjct: 128071 gcatcacggttgttctgacggccagggacgagacgaggggcg 128112



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 140    gggatcgggctggaggtatgcaggcagct 168
              ||||||||||||||||| ||| |||||||
Sbjct: 123582 gggatcgggctggaggtgtgccggcagct 123554
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                            
Query: 114      tcgccctggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgt 173
                |||| ||||| ||||| | ||||| |||| |||||||||||   ||||||||||||||||
Sbjct: 26553933 tcgcgctggttaccgggggcaacaaaggggtcgggctggagacctgcaggcagctcgcgt 26553992

                  
Query: 174      cc 175
                ||
Sbjct: 26553993 cc 26553994



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                                 
Query: 120      tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagct 168
                |||| ||||| | ||||| |||||||||||||||||| ||| |||||||
Sbjct: 26557146 tggtcaccggcggcaacaaagggatcgggctggaggtgtgccggcagct 26557194



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                            
Query: 120      tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgtccagcg 179
                |||| ||||| | ||||| || ||||||||||||||| ||| ||||||| ||  ||  ||
Sbjct: 26591125 tggtcaccggcggcaacaaagagatcgggctggaggtgtgccggcagctggccgccgacg 26591184

                                                          
Query: 180      gagcgacggtcgtcctgacggcaagggacgagaagaggggcg 221
                |    ||||| || |||||||| |||||||||| ||||||||
Sbjct: 26591185 gcatcacggttgttctgacggccagggacgagacgaggggcg 26591226



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 140      gggatcgggctggaggtatgcaggcagct 168
                ||||||||||||||||| ||| |||||||
Sbjct: 26586696 gggatcgggctggaggtgtgccggcagct 26586668
to top
>dbj|AK119481.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-134-C01, full
           insert sequence
          Length = 1866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 114 tcgccctggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgt 173
           |||| ||||| ||||| | ||||| |||| |||||||||||   ||||||||||||||||
Sbjct: 238 tcgcgctggttaccgggggcaacaaaggggtcgggctggagacctgcaggcagctcgcgt 297

             
Query: 174 cc 175
           ||
Sbjct: 298 cc 299
to top
>ref|XM_473283.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 930

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 120 tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagct 168
           |||| ||||| | ||||| |||||||||||||||||| ||| |||||||
Sbjct: 44  tggtcaccggcggcaacaaagggatcgggctggaggtgtgccggcagct 92



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 335 tttggcaggctggacatactggtgaataacgc 366
           ||||||| ||| || |||||||||||||||||
Sbjct: 259 tttggcaagctagaaatactggtgaataacgc 290
to top
>ref|XM_473289.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 924

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 120 tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgtccagcg 179
           |||| ||||| | ||||| || ||||||||||||||| ||| ||||||| ||  ||  ||
Sbjct: 50  tggtcaccggcggcaacaaagagatcgggctggaggtgtgccggcagctggccgccgacg 109

                                                     
Query: 180 gagcgacggtcgtcctgacggcaagggacgagaagaggggcg 221
           |    ||||| || |||||||| |||||||||| ||||||||
Sbjct: 110 gcatcacggttgttctgacggccagggacgagacgaggggcg 151



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 335 tttggcaggctggacatactggtgaataa 363
           ||||||| ||| |||||||||||||||||
Sbjct: 265 tttggcaagctagacatactggtgaataa 293
to top
>emb|CR652655.2|CNS0F2K5 Tetraodon nigroviridis full-length cDNA
          Length = 1267

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 338 ggcaggctggacatactggtgaataacgcg 367
           |||||||||||||| |||||||| ||||||
Sbjct: 358 ggcaggctggacatgctggtgaacaacgcg 387
to top
>emb|CR636393.1|CNS0EQ0F Tetraodon nigroviridis full-length cDNA
          Length = 1234

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 338 ggcaggctggacatactggtgaataacgcg 367
           |||||||||||||| |||||||| ||||||
Sbjct: 352 ggcaggctggacatgctggtgaacaacgcg 381
to top
>emb|AL663006.3|OSJN00204 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24,
             complete sequence
          Length = 121056

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                         
Query: 120   tggtgaccggagccaacagagggatcgggctggaggtatgcaggcagctcgcgtccagcg 179
             |||| ||||| | ||||| || ||||||||||||||| ||| ||||||| ||  ||  ||
Sbjct: 30683 tggtcaccggcggcaacaaagagatcgggctggaggtgtgccggcagctggccgccgacg 30742

                                                       
Query: 180   gagcgacggtcgtcctgacggcaagggacgagaagaggggcg 221
             |    ||||| || |||||||| |||||||||| ||||||||
Sbjct: 30743 gcatcacggttgttctgacggccagggacgagacgaggggcg 30784



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 140   gggatcgggctggaggtatgcaggcagct 168
             ||||||||||||||||| ||| |||||||
Sbjct: 26254 gggatcgggctggaggtgtgccggcagct 26226
to top
>ref|XM_473287.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 930

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 335 tttggcaggctggacatactggtgaataa 363
           ||||| ||||||||||| |||||||||||
Sbjct: 259 tttgggaggctggacatcctggtgaataa 287



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 140 gggatcgggctggaggtatgcaggcagct 168
           ||||||||||||||||| ||| |||||||
Sbjct: 64  gggatcgggctggaggtgtgccggcagct 92
to top
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 221     gccgcggcggtcgatgcgctc 241
               |||||||||||||||||||||
Sbjct: 2620503 gccgcggcggtcgatgcgctc 2620523
to top
>gb|AC084387.1| Mus musculus BAC clone RP23-93H2 from 7, complete sequence
          Length = 175948

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 62    acatcttcccccatggaagga 82
             |||||||||||||||||||||
Sbjct: 74530 acatcttcccccatggaagga 74510
to top
>dbj|AK109281.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-B09, full
           insert sequence
          Length = 1245

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 335 tttggcaggctggacatactggtgaataa 363
           ||||| ||||||||||| |||||||||||
Sbjct: 318 tttgggaggctggacatcctggtgaataa 346



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 140 gggatcgggctggaggtatgcaggcagct 168
           ||||||||||||||||| ||| |||||||
Sbjct: 123 gggatcgggctggaggtgtgccggcagct 151
to top
>gb|AC158570.5| Mus musculus chromosome 7, clone RP24-62O14, complete sequence
          Length = 184623

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 62     acatcttcccccatggaagga 82
              |||||||||||||||||||||
Sbjct: 178352 acatcttcccccatggaagga 178372
to top
>gb|AF225656.1| Uncultured archaeon clone AS08-27 16S ribosomal RNA gene, partial
           sequence
          Length = 737

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 574 gtcctgacggcaagggacga 593
to top
>gb|AF225641.1| Uncultured archaeon clone AS08-09 16S ribosomal RNA gene, partial
           sequence
          Length = 735

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 574 gtcctgacggcaagggacga 593
to top
>gb|AF225627.1| Uncultured archaeon clone AS01-25 16S ribosomal RNA gene, partial
           sequence
          Length = 731

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 580 gtcctgacggcaagggacga 599
to top
>gb|AY063610.1| Uncultured archaeon clone RST-15 16S ribosomal RNA gene, partial
           sequence
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>gb|AY063604.1| Uncultured archaeon clone RST-9 16S ribosomal RNA gene, partial
           sequence
          Length = 757

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>gb|AY386265.1| Bovine papular stomatitis virus strain BV-AR02, complete genome
          Length = 134431

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    ccagctcaagctcgccgccg 35
             ||||||||||||||||||||
Sbjct: 61908 ccagctcaagctcgccgccg 61889
to top
>emb|AL691426.9| Human DNA sequence from clone RP11-787B4 on chromosome 9 Contains the
            5' end of the PAPPA gene for pregnancy-associated plasma
            protein A, a novel gene and a CpG island, complete
            sequence
          Length = 182777

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 344  ctggacatactggtgaataa 363
            ||||||||||||||||||||
Sbjct: 5420 ctggacatactggtgaataa 5401
to top
>emb|Y19177.1|SAN19177 Streptomyces antibioticus polyketide biosynthetic gene cluster
          Length = 7482

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 112  ggtcgccctggtgaccggagccaacagagggatcgg 147
            |||||||||||| || ||||||| ||| ||||||||
Sbjct: 7184 ggtcgccctggtcacgggagccaccagcgggatcgg 7149
to top
>emb|AL939132.1|SCO939132 Streptomyces coelicolor A3(2) complete genome; segment 29/29
          Length = 302007

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   agctggacgtcggcgagccg 295
             ||||||||||||||||||||
Sbjct: 23548 agctggacgtcggcgagccg 23529
to top
>gb|DQ397551.1| Cenarchaeum symbiosum clone C05D09, complete sequence
          Length = 43893

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 350   atactggtgaataacgcggg 369
             ||||||||||||||||||||
Sbjct: 18056 atactggtgaataacgcggg 18075
to top
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 218    ggcgccgcggcggtcgatgc 237
              ||||||||||||||||||||
Sbjct: 390814 ggcgccgcggcggtcgatgc 390833
to top
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 283     cgtcggcgagccgtcgagcgccgc 306
               ||||||||||||| ||||||||||
Sbjct: 1337650 cgtcggcgagccgacgagcgccgc 1337627
to top
>gb|AC007086.10|AC007086 Drosophila melanogaster, chromosome 2R, region 45A-46A, BAC clone
              BACR14J24, complete sequence
          Length = 186241

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ccgtcagctggacgtcggcg 290
              ||||||||||||||||||||
Sbjct: 122234 ccgtcagctggacgtcggcg 122215
to top
>ref|XM_578714.1| PREDICTED: Rattus norvegicus similar to photoreceptor outer segment
           all-trans retinol dehydrogenase (LOC503191), mRNA
          Length = 1659

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 345 tggacatactggtgaataacgcgggagt 372
           |||||||||||||||| ||||| |||||
Sbjct: 254 tggacatactggtgaacaacgcaggagt 281
to top
>emb|Y15398.1|UEY15398 Unidentified archaeon 16S rRNA gene, partial, clone A5.1-A
          Length = 727

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 556 gtcctgacggcaagggacga 575
to top
>emb|Y15396.1|UEY15396 Unidentified archaeon 16S rRNA gene, partial, environmental clone
           ABS21
          Length = 723

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 574 gtcctgacggcaagggacga 593
to top
>emb|Y15393.1|UEY15393 Unidentified archaeon 16S rRNA gene, partial, environmental clone
           ABS18
          Length = 740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 574 gtcctgacggcaagggacga 593
to top
>emb|Y15392.1|UEY15392 Unidentified archaeon 16S rRNA gene, partial, environmental clone
           ABS14
          Length = 745

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 574 gtcctgacggcaagggacga 593
to top
>emb|Y15391.1|UEY15391 Unidentified archaeon 16S rRNA gene, partial, environmental clone
           ABS11
          Length = 709

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 561 gtcctgacggcaagggacga 580
to top
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 217     gggcgccgcggcggtcgatgcgct 240
               ||||||||| ||||||||||||||
Sbjct: 5500800 gggcgccgctgcggtcgatgcgct 5500823
to top
>gb|AE003833.4| Drosophila melanogaster chromosome 2R, section 17 of 73 of the complete
              sequence
          Length = 297107

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ccgtcagctggacgtcggcg 290
              ||||||||||||||||||||
Sbjct: 136917 ccgtcagctggacgtcggcg 136936
to top
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 217    gggcgccgcggcggtcgatgcgct 240
              ||||||||| ||||||||||||||
Sbjct: 374904 gggcgccgctgcggtcgatgcgct 374881
to top
>dbj|AP006254.1| Homo sapiens genomic DNA, chromosome 9, clone:RP11-145L23, complete
             sequence
          Length = 194718

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 344   ctggacatactggtgaataa 363
             ||||||||||||||||||||
Sbjct: 79879 ctggacatactggtgaataa 79860
to top
>emb|AJ556410.1|UAR556410 Uncultured archaeon partial 16S rRNA gene, clone OiI-26
          Length = 756

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>emb|AJ556407.1|UAR556407 Uncultured archaeon partial 16S rRNA gene, clone OiI-22
          Length = 756

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>emb|AJ556405.1|UAR556405 Uncultured archaeon partial 16S rRNA gene, clone OiI-13
          Length = 756

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>emb|AJ556404.1|UAR556404 Uncultured archaeon partial 16S rRNA gene, clone OiI-12
          Length = 758

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 587 gtcctgacggcaagggacga 606
to top
>emb|AJ556258.1|UAR556258 Uncultured archaeon partial 16S rRNA gene, clone BGO-40
          Length = 756

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 191 gtcctgacggcaagggacga 210
           ||||||||||||||||||||
Sbjct: 585 gtcctgacggcaagggacga 604
to top
>dbj|AB020876.1| Homo sapiens genomic DNA of 9q32 anti-oncogene of flat epitherium
             cancer , segment 8/10
          Length = 100000

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 344   ctggacatactggtgaataa 363
             ||||||||||||||||||||
Sbjct: 38054 ctggacatactggtgaataa 38035


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,552,326
Number of Sequences: 3902068
Number of extensions: 2552326
Number of successful extensions: 50195
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49829
Number of HSP's gapped (non-prelim): 366
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top