Clone Name | bart46d11 |
---|---|
Clone Library Name | barley_pub |
>gb|AF475125.1| Triticum aestivum enoyl-Acp reductase mRNA, partial cds Length = 453 Score = 188 bits (95), Expect = 1e-44 Identities = 134/147 (91%) Strand = Plus / Plus Query: 346 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 405 ||||| ||||| ||||| |||||||||||||||||||| || ||||||||||| || ||| Sbjct: 238 cccattgatctcagaggtaaaagagcatttattgctggagtcgctgatgataatggttat 297 Query: 406 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 465 ||||||||||| || ||||||||||| |||||||| |||||||||||||||||||||||| Sbjct: 298 ggctgggcaatagccaaggctcttgctgcagctggtgctgaaattcttgttggtacatgg 357 Query: 466 gtgcctgcacttaacatattcgagaca 492 ||||||||||| |||||||| |||||| Sbjct: 358 gtgcctgcactgaacatatttgagaca 384
>ref|XM_481639.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1647 Score = 184 bits (93), Expect = 2e-43 Identities = 129/141 (91%) Strand = Plus / Plus Query: 352 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 411 ||||||||||| ||||| || || |||||||| ||||||||||| || |||||||||||| Sbjct: 440 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 499 Query: 412 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcct 471 |||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| Sbjct: 500 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatgggtgcct 559 Query: 472 gcacttaacatattcgagaca 492 ||||| |||||||| |||||| Sbjct: 560 gcactaaacatatttgagaca 580 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 226 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 285 Query: 213 ggccgtct 220 ||| |||| Sbjct: 286 ggcggtct 293
>emb|AJ003025.1|OSENOYLAC Oryza sativa mRNA for enoyl-ACP reductase Length = 1520 Score = 184 bits (93), Expect = 2e-43 Identities = 129/141 (91%) Strand = Plus / Plus Query: 352 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 411 ||||||||||| ||||| || || |||||||| ||||||||||| || |||||||||||| Sbjct: 253 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 312 Query: 412 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcct 471 |||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| Sbjct: 313 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatgggtgcct 372 Query: 472 gcacttaacatattcgagaca 492 ||||| |||||||| |||||| Sbjct: 373 gcactaaacatatttgagaca 393 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 39 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 98 Query: 213 ggccgtct 220 ||| |||| Sbjct: 99 ggcggtct 106
>dbj|AK070992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023077K10, full insert sequence Length = 1647 Score = 184 bits (93), Expect = 2e-43 Identities = 129/141 (91%) Strand = Plus / Plus Query: 352 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 411 ||||||||||| ||||| || || |||||||| ||||||||||| || |||||||||||| Sbjct: 440 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 499 Query: 412 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcct 471 |||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| Sbjct: 500 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatgggtgcct 559 Query: 472 gcacttaacatattcgagaca 492 ||||| |||||||| |||||| Sbjct: 560 gcactaaacatatttgagaca 580 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 226 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 285 Query: 213 ggccgtct 220 ||| |||| Sbjct: 286 ggcggtct 293
>ref|XM_450461.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1652 Score = 180 bits (91), Expect = 3e-42 Identities = 133/147 (90%) Strand = Plus / Plus Query: 346 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 405 ||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |||||| Sbjct: 350 cccattgatctcagaggtaaaagagcatttattgctggagttgctgatgataatggctat 409 Query: 406 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 465 ||||||||||| ||||| |||||||| |||||||| || || |||||||||||||||||| Sbjct: 410 ggctgggcaatagcaaaagctcttgctgcagctggtgccgagattcttgttggtacatgg 469 Query: 466 gtgcctgcacttaacatattcgagaca 492 || |||||||| |||||||| |||||| Sbjct: 470 gtacctgcactgaacatatttgagaca 496
>dbj|AK103141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033120G12, full insert sequence Length = 1652 Score = 180 bits (91), Expect = 3e-42 Identities = 133/147 (90%) Strand = Plus / Plus Query: 346 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 405 ||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |||||| Sbjct: 350 cccattgatctcagaggtaaaagagcatttattgctggagttgctgatgataatggctat 409 Query: 406 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 465 ||||||||||| ||||| |||||||| |||||||| || || |||||||||||||||||| Sbjct: 410 ggctgggcaatagcaaaagctcttgctgcagctggtgccgagattcttgttggtacatgg 469 Query: 466 gtgcctgcacttaacatattcgagaca 492 || |||||||| |||||||| |||||| Sbjct: 470 gtacctgcactgaacatatttgagaca 496
>gb|BT016571.1| Zea mays clone Contig404 mRNA sequence Length = 1517 Score = 168 bits (85), Expect = 1e-38 Identities = 136/153 (88%) Strand = Plus / Plus Query: 340 gggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataac 399 ||||| ||||| ||||| ||||| ||||| ||||| |||||||| |||||||||||||| Sbjct: 295 gggcttcccattgatctcagaggtaaaagggcattcattgctggagttgctgatgataat 354 Query: 400 ggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggt 459 |||||||| ||||||||||| ||||| ||||| || ||||| |||||||||||||| ||| Sbjct: 355 ggctatggatgggcaattgcgaaggcacttgctgcggctggtgctgaaattcttgtgggt 414 Query: 460 acatgggtgcctgcacttaacatattcgagaca 492 ||||||||||| |||||||||||||| |||||| Sbjct: 415 acatgggtgccggcacttaacatatttgagaca 447
>gb|AY112451.1| Zea mays CL3046_1 mRNA sequence Length = 1482 Score = 168 bits (85), Expect = 1e-38 Identities = 136/153 (88%) Strand = Plus / Plus Query: 340 gggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataac 399 ||||| ||||| ||||| ||||| ||||| ||||| |||||||| |||||||||||||| Sbjct: 291 gggcttcccattgatctcagaggtaaaagggcattcattgctggagttgctgatgataat 350 Query: 400 ggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggt 459 |||||||| ||||||||||| ||||| ||||| || ||||| |||||||||||||| ||| Sbjct: 351 ggctatggatgggcaattgcgaaggcacttgctgcggctggtgctgaaattcttgtgggt 410 Query: 460 acatgggtgcctgcacttaacatattcgagaca 492 ||||||||||| |||||||||||||| |||||| Sbjct: 411 acatgggtgccggcacttaacatatttgagaca 443
>gb|AY106087.1| Zea mays PCO109463 mRNA sequence Length = 1496 Score = 149 bits (75), Expect = 1e-32 Identities = 129/147 (87%) Strand = Plus / Plus Query: 346 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 405 ||||| ||||| | ||| |||||||||||||| ||||| |||||||||||||| || ||| Sbjct: 346 cccattgatctcacaggtaaaagagcatttatagctggagttgctgatgataatggttat 405 Query: 406 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 465 || ||||||||||| ||||||||||| || ||||| ||||| |||||||||||||||||| Sbjct: 406 ggttgggcaattgctaaggctcttgctgctgctggtgctgagattcttgttggtacatgg 465 Query: 466 gtgcctgcacttaacatattcgagaca 492 |||||||| | |||||||| |||||| Sbjct: 466 gtgcctgcgttgaacatatttgagaca 492
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 145 bits (73), Expect = 2e-31 Identities = 100/109 (91%) Strand = Plus / Plus Query: 364 aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 423 |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 5729046 aaaagagcatttattgctggagttgctgatgataatggctatggctgggcaatagcaaaa 5729105 Query: 424 gctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctg 472 |||||||| |||||||| || || |||||||||||||||||||| |||| Sbjct: 5729106 gctcttgctgcagctggtgccgagattcttgttggtacatgggtacctg 5729154
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 145 bits (73), Expect = 2e-31 Identities = 91/97 (93%) Strand = Plus / Plus Query: 376 attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 435 |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 14409114 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 14409173 Query: 436 gctggggctgaaattcttgttggtacatgggtgcctg 472 ||||| ||||||||||||||||||||||||||||||| Sbjct: 14409174 gctggtgctgaaattcttgttggtacatgggtgcctg 14409210 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 14407860 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 14407919 Query: 213 ggccgtct 220 ||| |||| Sbjct: 14407920 ggcggtct 14407927
>dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0701E06 Length = 123415 Score = 145 bits (73), Expect = 2e-31 Identities = 100/109 (91%) Strand = Plus / Plus Query: 364 aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 423 |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| Sbjct: 25251 aaaagagcatttattgctggagttgctgatgataatggctatggctgggcaatagcaaaa 25310 Query: 424 gctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctg 472 |||||||| |||||||| || || |||||||||||||||||||| |||| Sbjct: 25311 gctcttgctgcagctggtgccgagattcttgttggtacatgggtacctg 25359
>dbj|AP005490.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0049I01 Length = 140261 Score = 145 bits (73), Expect = 2e-31 Identities = 91/97 (93%) Strand = Plus / Plus Query: 376 attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 435 |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 3982 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 4041 Query: 436 gctggggctgaaattcttgttggtacatgggtgcctg 472 ||||| ||||||||||||||||||||||||||||||| Sbjct: 4042 gctggtgctgaaattcttgttggtacatgggtgcctg 4078 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 2728 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 2787 Query: 213 ggccgtct 220 ||| |||| Sbjct: 2788 ggcggtct 2795
>dbj|AP004759.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0670E08 Length = 133106 Score = 145 bits (73), Expect = 2e-31 Identities = 91/97 (93%) Strand = Plus / Plus Query: 376 attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 435 |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 53397 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 53456 Query: 436 gctggggctgaaattcttgttggtacatgggtgcctg 472 ||||| ||||||||||||||||||||||||||||||| Sbjct: 53457 gctggtgctgaaattcttgttggtacatgggtgcctg 53493 Score = 48.1 bits (24), Expect = 0.027 Identities = 57/68 (83%) Strand = Plus / Plus Query: 153 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 212 ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || ||||| Sbjct: 52143 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 52202 Query: 213 ggccgtct 220 ||| |||| Sbjct: 52203 ggcggtct 52210
>gb|AY083164.1| Olea europaea subsp. europaea enoyl ACP reductase (ear) mRNA, complete cds Length = 1674 Score = 101 bits (51), Expect = 2e-18 Identities = 111/131 (84%) Strand = Plus / Plus Query: 344 tgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggct 403 ||||| ||||||| ||||| || || |||||||||||||| | || |||||||| || | Sbjct: 475 tgcccgtcgatctgagaggtaagagggcatttattgctggtatagcggatgataatggat 534 Query: 404 atggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacat 463 |||| |||||||| ||||| ||||||| || ||||| ||||| |||||||||||||||| Sbjct: 535 atggatgggcaatagcaaaatctcttgcagctgctggtgctgagattcttgttggtacat 594 Query: 464 gggtgcctgca 474 |||| |||||| Sbjct: 595 gggttcctgca 605
>emb|AJ243090.1|BNA243090 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase, isoform B2 (enrB2 gene) Length = 1380 Score = 99.6 bits (50), Expect = 8e-18 Identities = 131/158 (82%) Strand = Plus / Plus Query: 334 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 393 |||||||| || ||||| ||| | |||||||||||||| ||||||||||| | |||||| Sbjct: 305 tcttctggacttcccattgatttgagagggaaaagagcctttattgctggtatagctgat 364 Query: 394 gataacggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattctt 453 ||||| || ||||| ||||| || || || ||||||| || ||||| ||||||||| | Sbjct: 365 gataatggatatggttgggccatagccaaatctcttgctgctgctggtgctgaaattttg 424 Query: 454 gttggtacatgggtgcctgcacttaacatattcgagac 491 ||||| || ||||| |||||||||||||| || ||||| Sbjct: 425 gttgggacttgggttcctgcacttaacatttttgagac 462
>ref|NM_126612.2| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); enoyl-[acyl-carrier protein] reductase (NADH)/ oxidoreductase AT2G05990 (MOD1) transcript variant AT2G05990.1 mRNA, complete cds Length = 1606 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 431 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 490 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 491 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 550 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 551 aatatatttgagaca 565
>ref|NM_179609.1| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); enoyl-[acyl-carrier protein] reductase (NADH)/ oxidoreductase AT2G05990 (MOD1) transcript variant AT2G05990.2 mRNA, complete cds Length = 1639 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 464 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 523 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 524 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 583 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 584 aatatatttgagaca 598
>gb|AF327528.1| Arabidopsis thaliana At2g05990 mRNA sequence Length = 1314 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 400 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 459 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 460 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 519 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 520 aatatatttgagaca 534
>gb|AY113962.1| Arabidopsis thaliana putative enoyl-ACP reductase enr-A (At2g05990) mRNA, complete cds Length = 1204 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 277 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 336 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 337 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 396 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 397 aatatatttgagaca 411
>gb|AY056192.1| Arabidopsis thaliana putative enoyl-ACP reductase enr-A (At2g05990) mRNA, complete cds Length = 1561 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 435 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 494 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 495 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 554 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 555 aatatatttgagaca 569
>emb|AJ003124.1|PHAJ3124 Petunia hybrida pte gene Length = 5047 Score = 93.7 bits (47), Expect = 5e-16 Identities = 89/103 (86%) Strand = Plus / Plus Query: 370 gcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaaggctctt 429 |||||||||||||| | || ||||| || || ||||| ||||| || |||||| ||||| Sbjct: 1833 gcatttattgctggcatagcagatgacaatgggtatggatgggcgatagcaaagtctctt 1892 Query: 430 gccgcagctggggctgaaattcttgttggtacatgggtgcctg 472 || || || |||||||||||||||||||||||||||||||||| Sbjct: 1893 gcagctgcaggggctgaaattcttgttggtacatgggtgcctg 1935
>gb|AF324719.2|AF324719 Arabidopsis thaliana At2g05990 (At2g05990/T6P5.19) mRNA, complete cds Length = 1335 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 400 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 459 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 460 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 519 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 520 aatatatttgagaca 534
>emb|BX820208.1|CNS0AA28 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZH11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1376 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 290 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 349 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 350 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 409 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 410 aatatatttgagaca 424
>emb|BX820100.1|CNS0AA6U Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZA07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1427 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 336 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 395 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 396 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 455 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 456 aatatatttgagaca 470
>emb|BX819977.1|CNS0AA6V Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1468 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 398 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 457 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 458 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 517 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 518 aatatatttgagaca 532
>emb|BX819653.1|CNS0AA6M Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS11ZF12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1399 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 310 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 369 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 370 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 429 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 430 aatatatttgagaca 444
>gb|AF207593.1|AF207593 Arabidopsis thaliana enoyl-ACP reductase (ENR1) mRNA, complete cds Length = 1597 Score = 93.7 bits (47), Expect = 5e-16 Identities = 113/135 (83%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 |||||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || Sbjct: 464 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 523 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 ||||| ||||||| || ||||| |||||||| | ||||| || ||||| ||||||||| Sbjct: 524 gcaaaatctcttgctgctgctggagctgaaatattggttgggacttgggttcctgcactt 583 Query: 478 aacatattcgagaca 492 || ||||| |||||| Sbjct: 584 aatatatttgagaca 598
>emb|AJ243088.1|BNA243088 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase, isoform A2 (enrA2 gene) Length = 1332 Score = 83.8 bits (42), Expect = 5e-13 Identities = 111/134 (82%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 ||||||||||| || || |||||||| | ||||||||||| || ||||| ||||| || Sbjct: 304 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 363 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 || || ||||||| || ||||| |||||||| | ||||| |||||||| ||||||||| Sbjct: 364 gccaaatctcttgctgctgctggtgctgaaatattggttgggacatgggttcctgcactt 423 Query: 478 aacatattcgagac 491 ||||| |||||||| Sbjct: 424 aacattttcgagac 437
>emb|AJ243087.1|BNA243087 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase, isoform 1A, (enrA1 gene) Length = 1349 Score = 83.8 bits (42), Expect = 5e-13 Identities = 111/134 (82%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 ||||||||||| || || |||||||| | ||||||||||| || ||||| ||||| || Sbjct: 329 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 388 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 || || ||||||| || ||||| |||||||| | ||||| |||||||| ||||||||| Sbjct: 389 gccaaatctcttgctgctgctggtgctgaaatattggttgggacatgggttcctgcactt 448 Query: 478 aacatattcgagac 491 ||||| |||||||| Sbjct: 449 aacattttcgagac 462
>gb|S60064.1|S60064 Brassica napus enoyl-acyl carrier protein reductase mRNA, complete cds Length = 1358 Score = 83.8 bits (42), Expect = 5e-13 Identities = 129/158 (81%) Strand = Plus / Plus Query: 334 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 393 |||||||| || ||||| ||| | |||||||||||||| ||||||||||| | |||||| Sbjct: 287 tcttctggacttcccattgatttgagagggaaaagagcctttattgctggtatagctgat 346 Query: 394 gataacggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattctt 453 ||||| || || || ||||| | || || ||||||| || ||||| ||||||||| | Sbjct: 347 gataatggatacggttgggccgtagccaaatctcttgctgctgctggtgctgaaattttg 406 Query: 454 gttggtacatgggtgcctgcacttaacatattcgagac 491 ||||| || ||||| |||||||||||||| || ||||| Sbjct: 407 gttgggacttgggttcctgcacttaacatttttgagac 444
>emb|X95462.1|BNENOYLRD B.napus mRNA for enoyl reductase Length = 1351 Score = 75.8 bits (38), Expect = 1e-10 Identities = 110/134 (82%) Strand = Plus / Plus Query: 358 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 417 ||||||||||| || || |||||||| | ||||||||||| || ||||| ||||| || Sbjct: 327 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 386 Query: 418 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgggtgcctgcactt 477 || || ||||||| || |||| |||||||| | ||||| |||||||| ||||||||| Sbjct: 387 gccaaatctcttgctgctgctgctgctgaaatattggttgggacatgggttcctgcactt 446 Query: 478 aacatattcgagac 491 ||||| |||||||| Sbjct: 447 aacattttcgagac 460
>emb|AJ243089.1|BNA243089 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase, isoform B1 (enrB1 gene) Length = 1384 Score = 75.8 bits (38), Expect = 1e-10 Identities = 128/158 (81%) Strand = Plus / Plus Query: 334 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 393 |||||||| || ||||| ||| | ||||||||||| || ||||||||||| | |||||| Sbjct: 299 tcttctggacttcccattgatttgagagggaaaagggcctttattgctggtatagctgat 358 Query: 394 gataacggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattctt 453 ||||| || ||||| ||||| || || || ||||||| || ||||| |||||||| | Sbjct: 359 gataatggatatggttgggccatagccaaatctcttgctgctgctggtgctgaaatattg 418 Query: 454 gttggtacatgggtgcctgcacttaacatattcgagac 491 ||||| || ||||| ||||| |||||||| || ||||| Sbjct: 419 gttgggacttgggttcctgcgcttaacatttttgagac 456
>gb|AC005970.3| Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence Length = 121160 Score = 67.9 bits (34), Expect = 3e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 360 agggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgc 419 |||||||||||| || |||||||| | ||||||||||| |||||||| ||||| || || Sbjct: 107142 agggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccatagc 107201 Query: 420 aaaggctcttgccgcagctggggctgaaat 449 ||| ||||||| || ||||| |||||||| Sbjct: 107202 aaaatctcttgctgctgctggagctgaaat 107231
>emb|Y13860.1|ATENRA Arabidopsis thaliana enr-A gene Length = 4198 Score = 60.0 bits (30), Expect = 7e-06 Identities = 75/90 (83%) Strand = Plus / Plus Query: 360 agggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgc 419 |||||||||||| || |||||||| | ||||||||||| ||||| || ||||| || || Sbjct: 1840 agggaaaagagctttcattgctggtatagctgatgataatggctacggttgggccatagc 1899 Query: 420 aaaggctcttgccgcagctggggctgaaat 449 ||| ||||||| || ||||| |||||||| Sbjct: 1900 aaaatctcttgctgctgctggagctgaaat 1929
>gb|AC154828.2| Mus musculus BAC clone RP24-549A19 from 13, complete sequence Length = 138426 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 |||||||||||||||||||||||| Sbjct: 112835 ctcccccacccagatccctccctc 112858
>emb|CT009754.11| Mouse DNA sequence from clone RP23-5P19 on chromosome 13, complete sequence Length = 255133 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 |||||||||||||||||||||||| Sbjct: 17574 ctcccccacccagatccctccctc 17597
>gb|AC106840.12| Mus musculus chromosome 1, clone RP24-144D4, complete sequence Length = 139608 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 48 ccctgtgctcccccacccagatccctccctc 78 |||||| ||||||||||||| |||||||||| Sbjct: 125054 ccctgtcctcccccacccagttccctccctc 125084
>gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, complete sequence Length = 191603 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 48 ccctgtgctcccccacccagatccctccctc 78 |||||| ||||||||||||| |||||||||| Sbjct: 183097 ccctgtcctcccccacccagttccctccctc 183067
>gb|AC122834.2| Mus musculus BAC clone RP23-183H9 from 15, complete sequence Length = 191019 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 56 tcccccacccagatccctccctc 78 ||||||||||||||||||||||| Sbjct: 150742 tcccccacccagatccctccctc 150764
>gb|AC171401.8| Mus musculus chromosome 7, clone RP23-174D7, complete sequence Length = 211696 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccct 77 ||||||||||||||||||||||| Sbjct: 144183 ctcccccacccagatccctccct 144205
>gb|AC161261.5| Mus musculus BAC clone RP23-376D23 from chromosome 17, complete sequence Length = 190041 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctcac 80 |||||||||||||||||||||| Sbjct: 45474 cccacccagatccctccctcac 45495
>gb|AC107645.28| Mus musculus chromosome 15, clone RP23-78J21, complete sequence Length = 240912 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctca 79 ||||||||||||||||||||| Sbjct: 66946 cccacccagatccctccctca 66966
>gb|DQ490467.1| Emericella nidulans beta-glucosidase (AN0712-2) mRNA, complete cds Length = 2538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 324 agaaggtagctcttctgggct 344 ||||||||||||||||||||| Sbjct: 1019 agaaggtagctcttctgggct 1039
>ref|XM_653224.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0712.2), mRNA Length = 2538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 324 agaaggtagctcttctgggct 344 ||||||||||||||||||||| Sbjct: 1019 agaaggtagctcttctgggct 1039
>gb|AC117243.3| Mus musculus BAC clone RP24-198D9 from 9, complete sequence Length = 168127 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 60 ccacccagatccctccctcac 80 ||||||||||||||||||||| Sbjct: 78820 ccacccagatccctccctcac 78800
>emb|BX324117.16| Mouse DNA sequence from clone RP23-389N3 on chromosome X, complete sequence Length = 155139 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 ccccacccagatccctccctc 78 ||||||||||||||||||||| Sbjct: 62877 ccccacccagatccctccctc 62897
>emb|BX000694.9| Mouse DNA sequence from clone RP23-30B5 on chromosome 4, complete sequence Length = 55045 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 275 cctgctctaggtctcttggttcttg 299 |||||||| |||||||||||||||| Sbjct: 19120 cctgctctgggtctcttggttcttg 19144
>gb|AY665242.1| Saimiri boliviensis chondroitin sulfate proteoglycan 3 mRNA, partial cds Length = 3594 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 43 gcatcccctgtgctcccccacccagatc 70 |||||||||||||||||| |||||||| Sbjct: 1495 gcatcccctgtgctcccctccccagatc 1522
>gb|AC107839.14| Mus musculus chromosome 7, clone RP23-284K1, complete sequence Length = 170751 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 63117 cccacccagatccctccctc 63098
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 151 gcgcagatgctggccgcacgcccc 174 |||||| ||||||||||||||||| Sbjct: 1841788 gcgcaggtgctggccgcacgcccc 1841811
>gb|AC116726.11| Mus musculus chromosome 10, clone RP23-285L15, complete sequence Length = 185427 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 ||||| |||||||||||||||||| Sbjct: 24388 ctccctcacccagatccctccctc 24411
>gb|AC109283.8| Mus musculus chromosome 1, clone RP24-156F3, complete sequence Length = 133845 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 38985 cccacccagatccctccctc 39004
>gb|AC122773.8| Mus musculus chromosome 1, clone RP24-160N7, complete sequence Length = 142124 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 1851 cccacccagatccctccctc 1870
>gb|AF125314.2| Mus musculus chromosome X clones MP1-C03180, MP1-C22301, CT7-374D15, proximal part, complete sequence Length = 300285 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 161127 cccacccagatccctccctc 161146
>gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Hospital Oakland Research Institute) complete sequence Length = 217673 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 ||||||||||||| |||||||||| Sbjct: 4573 ctcccccacccagttccctccctc 4596
>gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, complete sequence Length = 177037 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctc 74 |||||||||||||||||||| Sbjct: 90576 ctcccccacccagatccctc 90595
>gb|AC101956.5| Mus musculus chromosome 5, clone RP24-166L23, complete sequence Length = 183807 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 12762 cccacccagatccctccctc 12743
>gb|AC147985.3| Mus musculus BAC clone RP24-402C11 from chromosome 19, complete sequence Length = 170479 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 126584 cccacccagatccctccctc 126603
>gb|AC140303.3| Mus musculus BAC clone RP23-381H21 from chromosome 3, complete sequence Length = 192020 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 162172 cccacccagatccctccctc 162153
>gb|AC091353.6| Rattus norvegicus 4 BAC CH230-1B20 (Children's Hospital Oakland Research Institute) complete sequence Length = 242904 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 ||||||||||||| |||||||||| Sbjct: 126031 ctcccccacccagttccctccctc 126054
>gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hospital Oakland Research Institute) complete sequence Length = 234084 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 ||||||||||||| |||||||||| Sbjct: 12173 ctcccccacccagttccctccctc 12150
>gb|AC124181.3| Mus musculus BAC clone RP23-204B12 from chromosome 18, complete sequence Length = 220244 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 138365 cccacccagatccctccctc 138384
>gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome 9, complete sequence Length = 195460 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 187361 cccacccagatccctccctc 187342
>gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome 14, complete sequence Length = 200348 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 ||||||| |||||||||||||||| Sbjct: 73405 ctccccctcccagatccctccctc 73382
>gb|AC114010.6| Mus musculus BAC clone RP24-378K23 from chromosome 12, complete sequence Length = 175670 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 50378 cccacccagatccctccctc 50397
>gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, complete sequence Length = 229313 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 ||||||| |||||||||||||||| Sbjct: 218715 ctccccctcccagatccctccctc 218738
>gb|AC132458.3| Mus musculus BAC clone RP23-152C8 from chromosome 5, complete sequence Length = 219470 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 ||||||||||||| |||||||||| Sbjct: 92450 ctcccccacccaggtccctccctc 92427
>emb|CT025565.5| Mouse DNA sequence from clone RP24-126K5 on chromosome 17, complete sequence Length = 175523 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 11839 cccacccagatccctccctc 11858
>gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, complete sequence Length = 293695 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 241634 cccacccagatccctccctc 241653
>gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosome 15, complete sequence Length = 205859 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 94676 cccacccagatccctccctc 94657
>gb|AC126552.5| Mus musculus BAC clone RP23-342F3 from chromosome 15, complete sequence Length = 213862 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 171253 cccacccagatccctccctc 171234
>gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosome 9, complete sequence Length = 140024 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 58505 cccacccagatccctccctc 58486
>gb|AC122261.2| Mus musculus BAC clone RP23-187F24 from 15, complete sequence Length = 223801 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 196265 cccacccagatccctccctc 196284
>gb|AC117670.15| Mus musculus chromosome 7, clone RP23-383P11, complete sequence Length = 219661 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 4045 cccacccagatccctccctc 4064
>gb|AC104863.12| Mus musculus chromosome 6, clone RP23-109C11, complete sequence Length = 198321 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 154998 cccacccagatccctccctc 155017
>gb|AC036121.11| Mus musculus chromosome 6, clone RP23-158O9, complete sequence Length = 215685 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 133013 cccacccagatccctccctc 133032
>gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, complete sequence Length = 200679 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 107206 cccacccagatccctccctc 107225
>gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosome 17, complete sequence Length = 196132 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 190637 cccacccagatccctccctc 190656
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 tgctgcgctcatcaacagca 39 |||||||||||||||||||| Sbjct: 85777 tgctgcgctcatcaacagca 85758
>gb|AC102609.7| Mus musculus, clone RP23-403I3, complete sequence Length = 208575 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 tcttctcccgaggctggtgg 108 |||||||||||||||||||| Sbjct: 66662 tcttctcccgaggctggtgg 66643
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 146 ccggcgcgcagatgctggcc 165 |||||||||||||||||||| Sbjct: 364221 ccggcgcgcagatgctggcc 364240
>gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence Length = 224221 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 204567 cccacccagatccctccctc 204548
>gb|AC116071.5| Rattus norvegicus 3 BAC CH230-230O7 (Children's Hospital Oakland Research Institute) complete sequence Length = 224778 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 359 gagggaaaagagcatttattgctg 382 |||||| ||||||||||||||||| Sbjct: 180093 gagggataagagcatttattgctg 180116
>emb|Y13862.1|NTENRT1 Nicotiana tabacum enr-T1 gene Length = 8492 Score = 40.1 bits (20), Expect = 6.7 Identities = 83/104 (79%) Strand = Plus / Plus Query: 364 aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 423 ||||| |||||||| ||||| | ||||||||||| || || || ||||| ||||| ||| Sbjct: 5389 aaaagggcatttatagctggtatagctgatgataatggatacggatgggctattgctaag 5448 Query: 424 gctcttgccgcagctggggctgaaattcttgttggtacatgggt 467 | || || || || || ||||||||||| ||||| || ||||| Sbjct: 5449 tccctggctgctgcgggagctgaaattctagttggaacctgggt 5492
>emb|Y13861.1|NTENRT2 Nicotiana tabacum enr-T2 gene Length = 6543 Score = 40.1 bits (20), Expect = 6.7 Identities = 83/104 (79%) Strand = Plus / Plus Query: 364 aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 423 ||||| |||||||| ||||| | ||||||||||| || || || ||||| ||||| ||| Sbjct: 4020 aaaagggcatttatagctggtatagctgatgataatggatacgggtgggctattgctaag 4079 Query: 424 gctcttgccgcagctggggctgaaattcttgttggtacatgggt 467 | || || || || || ||||||||||| ||||| || ||||| Sbjct: 4080 tccctggctgctgcaggagctgaaattctagttggaacctgggt 4123
>gb|AC166324.1| Mus musculus BAC clone RP24-500J7 from chromosome 9, complete sequence Length = 168018 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 |||||||||||| ||||||||||| Sbjct: 120503 ctcccccacccatatccctccctc 120526
>emb|AL607126.9| Mouse DNA sequence from clone RP23-206I16 on chromosome 11, complete sequence Length = 221930 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 46 tcccctgtgctcccccacccagatccct 73 |||||| | ||||||||||||||||||| Sbjct: 87989 tcccctctcctcccccacccagatccct 87962
>emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on chromosome 11 Contains the 5' end of the gene for a novel protein (C330012F17Rik, C130096N06Rik), a ribosomal protein L37a (Rpl37a) pseudogene, a pseudogene similar to part of a novel protein (D130064H19Rik), a fibrillarin (Fbl) pseudogene, the 5' end of the gene for a novel protein (4931428D14Rik) (2300003H10) and three CpG islands, complete sequence Length = 199018 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 132333 cccacccagatccctccctc 132352
>gb|AC108211.3| Homo sapiens BAC clone RP11-511I14 from 4, complete sequence Length = 222457 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 433 gcagctggggctgaaattct 452 |||||||||||||||||||| Sbjct: 54248 gcagctggggctgaaattct 54229
>dbj|AK033076.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length enriched library, clone:7630403P10 product:unclassifiable, full insert sequence Length = 1299 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 429 cccacccagatccctccctc 410
>gb|AC155310.2| Mus musculus BAC clone RP24-81L10 from chromosome 14, complete sequence Length = 177707 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 |||||||| ||||||||||||||| Sbjct: 145254 ctcccccaaccagatccctccctc 145231
>gb|AC158380.2| Mus musculus BAC clone RP24-178I16 from chromosome 6, complete sequence Length = 168179 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 145472 cccacccagatccctccctc 145491
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 gcgctcatcaacagcacgcg 43 |||||||||||||||||||| Sbjct: 1670607 gcgctcatcaacagcacgcg 1670626
>gb|AC012382.14|AC012382 Mus musculus chromosome 7, clone RP23-92L23, complete sequence Length = 276523 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 224354 cccacccagatccctccctc 224335
>gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosome 12, complete sequence Length = 220385 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 56781 cccacccagatccctccctc 56800
>gb|AC005237.2|AC005237 Homo sapiens BAC clone RP11-556H17 from 2, complete sequence Length = 175179 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 agagcggtgtcaggagaagg 329 |||||||||||||||||||| Sbjct: 50024 agagcggtgtcaggagaagg 50043
>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence Length = 212426 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 164933 cccacccagatccctccctc 164952
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 368 gagcatttattgctggggtt 387 |||||||||||||||||||| Sbjct: 4318399 gagcatttattgctggggtt 4318380
>gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complete sequence Length = 164883 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 ||||||||||||| |||||||||| Sbjct: 114955 ctcccccacccagttccctccctc 114932
>emb|CT009515.16| Mouse DNA sequence from clone RP23-117H6 on chromosome 14, complete sequence Length = 197196 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 13916 cccacccagatccctccctc 13935
>gb|AC100406.7| Mus musculus chromosome 9, clone RP23-134M7, complete sequence Length = 183837 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 110846 cccacccagatccctccctc 110827
>gb|AC110216.10| Mus musculus chromosome 18, clone RP24-502I6, complete sequence Length = 201138 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 113601 cccacccagatccctccctc 113582
>gb|AC159965.5| Mus musculus chromosome 15, clone RP23-471C16, complete sequence Length = 173156 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 129285 cccacccagatccctccctc 129266
>emb|CT030260.9| Mouse DNA sequence from clone RP23-462I24 on chromosome 12, complete sequence Length = 164672 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 103248 cccacccagatccctccctc 103267
>gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, complete sequence Length = 213096 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 12176 cccacccagatccctccctc 12195
>emb|CT027564.7| Mouse DNA sequence from clone RP24-293N14 on chromosome 16, complete sequence Length = 180784 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 ||||||| |||||||||||||||| Sbjct: 14746 ctcccccccccagatccctccctc 14769
>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete sequence Length = 194408 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 12496 cccacccagatccctccctc 12477
>emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on chromosome 2, complete sequence Length = 257676 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 143956 cccacccagatccctccctc 143937
>emb|CT030684.4| Mouse DNA sequence from clone RP24-88G11 on chromosome 14, complete sequence Length = 200616 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 |||||||| ||||||||||||||| Sbjct: 8157 ctcccccaaccagatccctccctc 8180
>emb|AL662929.15| Mouse DNA sequence from clone RP23-435E13 on chromosome 11, complete sequence Length = 140752 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 68374 cccacccagatccctccctc 68355
>emb|AL929556.14| Mouse DNA sequence from clone RP23-353B17 on chromosome 2, complete sequence Length = 192715 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 118724 cccacccagatccctccctc 118743
>gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome 16, complete sequence Length = 206740 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ctcccccacccagatccctccctc 78 ||||||| |||||||||||||||| Sbjct: 31443 ctcccccccccagatccctccctc 31420
>emb|AL928601.6| Mouse DNA sequence from clone RP23-88B5 on chromosome 11, complete sequence Length = 55129 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 32154 cccacccagatccctccctc 32135
>emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chromosome 2, complete sequence Length = 185348 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 27763 cccacccagatccctccctc 27782
>emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chromosome X, complete sequence Length = 141713 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 55 ctcccccacccagatccctccctc 78 |||||||||| ||||||||||||| Sbjct: 37948 ctcccccaccaagatccctccctc 37971
>emb|AL671888.8| Mouse DNA sequence from clone RP23-247O14 on chromosome X, complete sequence Length = 52491 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 47 cccctgtgctcccccacccagatccctccctc 78 ||||| |||||||||||| || |||||||||| Sbjct: 22593 cccctatgctcccccacctagttccctccctc 22562
>emb|AL672054.5| Mouse DNA sequence from clone RP23-237I22 on chromosome X, complete sequence Length = 187770 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 100824 cccacccagatccctccctc 100805
>emb|AL691469.9| Mouse DNA sequence from clone RP23-248F18 on chromosome 2, complete sequence Length = 191923 Score = 40.1 bits (20), Expect = 6.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 47 cccctgtgctcccccacccagatccctccctc 78 ||||| ||||| || ||||||||||||||||| Sbjct: 171937 cccctctgctctccaacccagatccctccctc 171906
>emb|AL772145.9| Mouse DNA sequence from clone RP23-212H4 on chromosome 3, complete sequence Length = 228623 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 140661 cccacccagatccctccctc 140680
>gb|AC151299.3| Mus musculus BAC clone RP23-11N17 from chromosome 17, complete sequence Length = 206555 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 54285 cccacccagatccctccctc 54266
>emb|AL929399.6| Mouse DNA sequence from clone RP23-59E24 on chromosome 4, complete sequence Length = 120490 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 40613 cccacccagatccctccctc 40632
>emb|AL671982.4| Mouse DNA sequence from clone RP23-132H1 on chromosome X, complete sequence Length = 190627 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 137670 cccacccagatccctccctc 137651
>emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chromosome X, complete sequence Length = 218939 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 68811 cccacccagatccctccctc 68830
>dbj|AP003145.1| Mus musculus genomic DNA, chromosome 7, clone:RP23-17N3, complete sequences Length = 138654 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 102544 cccacccagatccctccctc 102525
>emb|AL772294.6| Mouse DNA sequence from clone RP23-125F4 on chromosome X, complete sequence Length = 144678 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 cccacccagatccctccctc 78 |||||||||||||||||||| Sbjct: 29552 cccacccagatccctccctc 29571 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,467,875 Number of Sequences: 3902068 Number of extensions: 3467875 Number of successful extensions: 66870 Number of sequences better than 10.0: 126 Number of HSP's better than 10.0 without gapping: 126 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 66476 Number of HSP's gapped (non-prelim): 393 length of query: 492 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 470 effective length of database: 17,147,199,772 effective search space: 8059183892840 effective search space used: 8059183892840 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)