>emb|AL513263.9| Human DNA sequence from clone CTB-1189H8 on chromosome 1 Contains the
3' end of the SYT14 gene for synaptotagmin XIV, complete
sequence
Length = 125553
Score = 44.1 bits (22), Expect = 0.54
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 496 gatttctctgatgtttttggtt 517
||||||||||||||||||||||
Sbjct: 82480 gatttctctgatgtttttggtt 82501
>emb|AL513366.11| Human DNA sequence from clone CTD-2522E6 on chromosome X Contains the
RGN gene for regucalcin (senescence marker protein-30)
(RC, SMP30), the gene for neuronal protein 17.3 (P17.3),
the RBM10 gene for RNA binding motif protein 10 (MGC997,
MGC1132, DXS8237E, KIAA0122), an inositol
1,3,4-triphosphate 5/6 kinase (ITPK1) pseudogene, the UBE1
gene for ubiquitin-activating enzyme E1 (A1S9T and BN75
temperature sensitivity complementing) (A1S9, A1ST, GXP1,
A1S9T, UBE1X, MGC4781), the 5' UTR of the PCTK1 gene for
PCTAIRE protein kinase 1 and five CpG islands, complete
sequence
Length = 145456
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 435 tacaaagataattttcccca 454
||||||||||||||||||||
Sbjct: 75960 tacaaagataattttcccca 75941
>emb|AL357094.4|CNS05TDT Human chromosome 14 DNA sequence BAC R-14N4 of library RPCI-11 from
chromosome 14 of Homo sapiens (Human), complete sequence
Length = 158151
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 242 atatcattttacatccttgg 261
||||||||||||||||||||
Sbjct: 82558 atatcattttacatccttgg 82539
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,509,673
Number of Sequences: 3902068
Number of extensions: 5509673
Number of successful extensions: 96946
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 39
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96807
Number of HSP's gapped (non-prelim): 139
length of query: 623
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 600
effective length of database: 17,143,297,704
effective search space: 10285978622400
effective search space used: 10285978622400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)