ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart45h03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_450842.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1543 Score = 525 bits (265), Expect = e-146 Identities = 454/517 (87%) Strand = Plus / Plus Query: 63 ccgccgccgccgcaccagagatggcggcgtacctgagcatgggcgaggcgcaccgccgta 122 |||| |||||||| || |||||||||||||||||||||||||| |||||||||||||| | Sbjct: 180 ccgcagccgccgcgccggagatggcggcgtacctgagcatgggagaggcgcaccgccgca 239 Query: 123 tctccgactacctctcccgcttggacgtcgctatctctcagtccgacggcgccgacctcg 182 || ||||||||||||||||| ||| | | | |||| ||| |||||||||| |||| Sbjct: 240 tcgccgactacctctcccgcgtggcggactccgtctcctcgtcggacggcgccgcgctcg 299 Query: 183 cctctctcctcgccatctcctcggcgcctgcctccactccgctctccgacgcgctcgccg 242 |||| ||||||||| ||||||| |||| ||| || | |||||||||||||||||| ||| Sbjct: 300 cctccctcctcgccgtctcctccgcgcaggcccccgccccgctctccgacgcgctctccg 359 Query: 243 cttttccggatttcgcccgcctcgccgcggaccgcttcccccacctctccgacttcctcc 302 | || ||||| ||| | ||||||||||| ||||||| ||| |||||||||||| |||||| Sbjct: 360 ccttcccggacttcccgcgcctcgccgccgaccgctacccgcacctctccgacctcctcc 419 Query: 303 ccttgctcctccgcgccattcactctcactccctccgccgcttcggggacgcctactctt 362 || ||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| | Sbjct: 420 ccccgctcctccgcgccatccactcccactccctccgccgcttcgccgacgcctactcct 479 Query: 363 ccttcgagaaggctgccagcgcgttcctgcaggagttccggaactgggagactccttggg 422 ||||||||||||| |||| ||||||| ||||||||||||||||||||||||| || |||| Sbjct: 480 ccttcgagaaggccgccaacgcgttcttgcaggagttccggaactgggagacgccgtggg 539 Query: 423 caatggaggcgatgcacatagtggcgcttgagatcaggctgctagctgagaaggcagata 482 | |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct: 540 cgatggaggcgatgcacacggtggcgcttgagatcaggctgctggctgagaaggcagata 599 Query: 483 gagagcttgtgatgagcgggaagaacccagacaagctgcaggctgctgggtccttcctga 542 | ||||||| | ||| ||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 600 gggagcttgcaacgagtgggaagaaccctgacaagctgcagtctgctgggtccttcctga 659 Query: 543 tgaaggttttcggggcacttgcggttaaaggacctaa 579 ||||||||||||| ||||| ||||||||||| ||||| Sbjct: 660 tgaaggttttcggtgcactcgcggttaaagggcctaa 696
>dbj|AK063271.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-B11, full insert sequence Length = 1543 Score = 525 bits (265), Expect = e-146 Identities = 454/517 (87%) Strand = Plus / Plus Query: 63 ccgccgccgccgcaccagagatggcggcgtacctgagcatgggcgaggcgcaccgccgta 122 |||| |||||||| || |||||||||||||||||||||||||| |||||||||||||| | Sbjct: 180 ccgcagccgccgcgccggagatggcggcgtacctgagcatgggagaggcgcaccgccgca 239 Query: 123 tctccgactacctctcccgcttggacgtcgctatctctcagtccgacggcgccgacctcg 182 || ||||||||||||||||| ||| | | | |||| ||| |||||||||| |||| Sbjct: 240 tcgccgactacctctcccgcgtggcggactccgtctcctcgtcggacggcgccgcgctcg 299 Query: 183 cctctctcctcgccatctcctcggcgcctgcctccactccgctctccgacgcgctcgccg 242 |||| ||||||||| ||||||| |||| ||| || | |||||||||||||||||| ||| Sbjct: 300 cctccctcctcgccgtctcctccgcgcaggcccccgccccgctctccgacgcgctctccg 359 Query: 243 cttttccggatttcgcccgcctcgccgcggaccgcttcccccacctctccgacttcctcc 302 | || ||||| ||| | ||||||||||| ||||||| ||| |||||||||||| |||||| Sbjct: 360 ccttcccggacttcccgcgcctcgccgccgaccgctacccgcacctctccgacctcctcc 419 Query: 303 ccttgctcctccgcgccattcactctcactccctccgccgcttcggggacgcctactctt 362 || ||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| | Sbjct: 420 ccccgctcctccgcgccatccactcccactccctccgccgcttcgccgacgcctactcct 479 Query: 363 ccttcgagaaggctgccagcgcgttcctgcaggagttccggaactgggagactccttggg 422 ||||||||||||| |||| ||||||| ||||||||||||||||||||||||| || |||| Sbjct: 480 ccttcgagaaggccgccaacgcgttcttgcaggagttccggaactgggagacgccgtggg 539 Query: 423 caatggaggcgatgcacatagtggcgcttgagatcaggctgctagctgagaaggcagata 482 | |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct: 540 cgatggaggcgatgcacacggtggcgcttgagatcaggctgctggctgagaaggcagata 599 Query: 483 gagagcttgtgatgagcgggaagaacccagacaagctgcaggctgctgggtccttcctga 542 | ||||||| | ||| ||||||||||| |||||||||||| |||||||||||||||||| Sbjct: 600 gggagcttgcaacgagtgggaagaaccctgacaagctgcagtctgctgggtccttcctga 659 Query: 543 tgaaggttttcggggcacttgcggttaaaggacctaa 579 ||||||||||||| ||||| ||||||||||| ||||| Sbjct: 660 tgaaggttttcggtgcactcgcggttaaagggcctaa 696
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 274 bits (138), Expect = 3e-70 Identities = 273/318 (85%) Strand = Plus / Minus Query: 63 ccgccgccgccgcaccagagatggcggcgtacctgagcatgggcgaggcgcaccgccgta 122 |||| |||||||| || |||||||||||||||||||||||||| |||||||||||||| | Sbjct: 13124233 ccgcagccgccgcgccggagatggcggcgtacctgagcatgggagaggcgcaccgccgca 13124174 Query: 123 tctccgactacctctcccgcttggacgtcgctatctctcagtccgacggcgccgacctcg 182 || ||||||||||||||||| ||| | | | |||| ||| |||||||||| |||| Sbjct: 13124173 tcgccgactacctctcccgcgtggcggactccgtctcctcgtcggacggcgccgcgctcg 13124114 Query: 183 cctctctcctcgccatctcctcggcgcctgcctccactccgctctccgacgcgctcgccg 242 |||| ||||||||| ||||||| |||| ||| || | |||||||||||||||||| ||| Sbjct: 13124113 cctccctcctcgccgtctcctccgcgcaggcccccgccccgctctccgacgcgctctccg 13124054 Query: 243 cttttccggatttcgcccgcctcgccgcggaccgcttcccccacctctccgacttcctcc 302 | || ||||| ||| | ||||||||||| ||||||| ||| |||||||||||| |||||| Sbjct: 13124053 ccttcccggacttcccgcgcctcgccgccgaccgctacccgcacctctccgacctcctcc 13123994 Query: 303 ccttgctcctccgcgccattcactctcactccctccgccgcttcggggacgcctactctt 362 || ||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| | Sbjct: 13123993 ccccgctcctccgcgccatccactcccactccctccgccgcttcgccgacgcctactcct 13123934 Query: 363 ccttcgagaaggctgcca 380 ||||||||||||| |||| Sbjct: 13123933 ccttcgagaaggccgcca 13123916 Score = 139 bits (70), Expect = 1e-29 Identities = 91/98 (92%) Strand = Plus / Minus Query: 379 cagcgcgttcctgcaggagttccggaactgggagactccttgggcaatggaggcgatgca 438 |||||||||| ||||||||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 13123807 cagcgcgttcttgcaggagttccggaactgggagacgccgtgggcgatggaggcgatgca 13123748 Query: 439 catagtggcgcttgagatcaggctgctagctgagaagg 476 || ||||||||||||||||||||||| |||||||||| Sbjct: 13123747 cacggtggcgcttgagatcaggctgctggctgagaagg 13123710 Score = 115 bits (58), Expect = 2e-22 Identities = 85/94 (90%) Strand = Plus / Minus Query: 474 aggcagatagagagcttgtgatgagcgggaagaacccagacaagctgcaggctgctgggt 533 |||||||||| ||||||| | ||| ||||||||||| |||||||||||| ||||||||| Sbjct: 13123621 aggcagatagggagcttgcaacgagtgggaagaaccctgacaagctgcagtctgctgggt 13123562 Query: 534 ccttcctgatgaaggttttcggggcacttgcggt 567 |||||||||||||||||||||| ||||| ||||| Sbjct: 13123561 ccttcctgatgaaggttttcggtgcactcgcggt 13123528
>dbj|AP005728.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0048A13 Length = 137680 Score = 274 bits (138), Expect = 3e-70 Identities = 273/318 (85%) Strand = Plus / Minus Query: 63 ccgccgccgccgcaccagagatggcggcgtacctgagcatgggcgaggcgcaccgccgta 122 |||| |||||||| || |||||||||||||||||||||||||| |||||||||||||| | Sbjct: 46323 ccgcagccgccgcgccggagatggcggcgtacctgagcatgggagaggcgcaccgccgca 46264 Query: 123 tctccgactacctctcccgcttggacgtcgctatctctcagtccgacggcgccgacctcg 182 || ||||||||||||||||| ||| | | | |||| ||| |||||||||| |||| Sbjct: 46263 tcgccgactacctctcccgcgtggcggactccgtctcctcgtcggacggcgccgcgctcg 46204 Query: 183 cctctctcctcgccatctcctcggcgcctgcctccactccgctctccgacgcgctcgccg 242 |||| ||||||||| ||||||| |||| ||| || | |||||||||||||||||| ||| Sbjct: 46203 cctccctcctcgccgtctcctccgcgcaggcccccgccccgctctccgacgcgctctccg 46144 Query: 243 cttttccggatttcgcccgcctcgccgcggaccgcttcccccacctctccgacttcctcc 302 | || ||||| ||| | ||||||||||| ||||||| ||| |||||||||||| |||||| Sbjct: 46143 ccttcccggacttcccgcgcctcgccgccgaccgctacccgcacctctccgacctcctcc 46084 Query: 303 ccttgctcctccgcgccattcactctcactccctccgccgcttcggggacgcctactctt 362 || ||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| | Sbjct: 46083 ccccgctcctccgcgccatccactcccactccctccgccgcttcgccgacgcctactcct 46024 Query: 363 ccttcgagaaggctgcca 380 ||||||||||||| |||| Sbjct: 46023 ccttcgagaaggccgcca 46006 Score = 139 bits (70), Expect = 1e-29 Identities = 91/98 (92%) Strand = Plus / Minus Query: 379 cagcgcgttcctgcaggagttccggaactgggagactccttgggcaatggaggcgatgca 438 |||||||||| ||||||||||||||||||||||||| || ||||| |||||||||||||| Sbjct: 45897 cagcgcgttcttgcaggagttccggaactgggagacgccgtgggcgatggaggcgatgca 45838 Query: 439 catagtggcgcttgagatcaggctgctagctgagaagg 476 || ||||||||||||||||||||||| |||||||||| Sbjct: 45837 cacggtggcgcttgagatcaggctgctggctgagaagg 45800 Score = 115 bits (58), Expect = 2e-22 Identities = 85/94 (90%) Strand = Plus / Minus Query: 474 aggcagatagagagcttgtgatgagcgggaagaacccagacaagctgcaggctgctgggt 533 |||||||||| ||||||| | ||| ||||||||||| |||||||||||| ||||||||| Sbjct: 45711 aggcagatagggagcttgcaacgagtgggaagaaccctgacaagctgcagtctgctgggt 45652 Query: 534 ccttcctgatgaaggttttcggggcacttgcggt 567 |||||||||||||||||||||| ||||| ||||| Sbjct: 45651 ccttcctgatgaaggttttcggtgcactcgcggt 45618
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 56 gcggctcccgccgccgccgcacc 78 ||||||||||||||||||||||| Sbjct: 2246795 gcggctcccgccgccgccgcacc 2246773
>ref|XM_748810.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g07310) partial mRNA Length = 2016 Score = 44.1 bits (22), Expect = 0.51 Identities = 31/34 (91%) Strand = Plus / Plus Query: 280 cccccacctctccgacttcctccccttgctcctc 313 ||||||||||||| ||||||||| ||| |||||| Sbjct: 1547 cccccacctctcccacttcctccacttcctcctc 1580
>gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosome 9, complete sequence Length = 169614 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 468 ctgagaaggcagatagagagct 489 |||||||||||||||||||||| Sbjct: 34891 ctgagaaggcagatagagagct 34870
>gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, complete sequence Length = 202544 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 468 ctgagaaggcagatagagagct 489 |||||||||||||||||||||| Sbjct: 14495 ctgagaaggcagatagagagct 14516
>gb|AC135161.11| Medicago truncatula clone mth2-30k24, complete sequence Length = 88701 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 cgccgccgccgcaccagagatg 85 |||||||||||||||||||||| Sbjct: 32097 cgccgccgccgcaccagagatg 32118
>gb|AY013246.1| Hordeum vulgare chromosome 5 BAC 635P2, complete sequence Length = 102433 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 354 cctactcttccttcgagaaggc 375 |||||||||||||||||||||| Sbjct: 230 cctactcttccttcgagaaggc 251
>emb|CT009560.9| Pig DNA sequence from clone CH242-4C12 on chromosome 17, complete sequence Length = 166118 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 51 cccgcgcggctcccgccgccg 71 ||||||||||||||||||||| Sbjct: 148980 cccgcgcggctcccgccgccg 148960
>emb|AL160289.14| Human DNA sequence from clone RP11-161K20 on chromosome 10 Contains the 5' end of the gene for the likely ortholog of mouse sialyltransferase 8-VI (alpha-2 8-sialytransferase) (ST8SIA-VI), the 3' end of a novel gene and a CpG island, complete sequence Length = 62918 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 55 cgcggctcccgccgccgccgc 75 ||||||||||||||||||||| Sbjct: 41462 cgcggctcccgccgccgccgc 41482
>gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, complete sequence Length = 212494 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 tctccgacttcctccccttg 307 |||||||||||||||||||| Sbjct: 31785 tctccgacttcctccccttg 31804
>gb|AC150416.2| Branchiostoma floridae clone CH302-63L21, complete sequence Length = 164084 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 319 cattcactctcactccctcc 338 |||||||||||||||||||| Sbjct: 8078 cattcactctcactccctcc 8097
>ref|XM_528666.1| PREDICTED: Pan troglodytes similar to KIAA1076 protein (LOC473295), mRNA Length = 6018 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 gcctcgccgcggaccgcttccccc 284 |||||||| ||||||||||||||| Sbjct: 409 gcctcgccccggaccgcttccccc 386
>gb|AY168016.1| Gregarina niphandrodes DNA-dependent RNA polymerase II largest subunit (RPB1) gene, partial cds Length = 3061 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 57 cggctcccgccgccgccgca 76 |||||||||||||||||||| Sbjct: 316 cggctcccgccgccgccgca 297
>gb|AY767247.1| Hepatitis C virus isolate 32050-R core E1 gene, partial sequence Length = 400 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 accagagatggcggcgtacc 95 |||||||||||||||||||| Sbjct: 210 accagagatggcggcgtacc 229
>gb|AC163297.4| Mus musculus BAC clone RP23-106G24 from chromosome 3, complete sequence Length = 194271 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 41616 atgagcgggaagaaaccagacaag 41593
>gb|AC132918.17| Mus musculus chromosome 15, clone RP24-328F10, complete sequence Length = 186125 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 caggctgctgggtccttcct 540 |||||||||||||||||||| Sbjct: 70725 caggctgctgggtccttcct 70744
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 ccgctctccgacgcgctcgc 240 |||||||||||||||||||| Sbjct: 2180370 ccgctctccgacgcgctcgc 2180389
>gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, complete sequence Length = 195273 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 266 gccgcggaccgcttcccccacctc 289 ||||| |||||||||||||||||| Sbjct: 49509 gccgcagaccgcttcccccacctc 49486
>ref|NM_011516.1| Mus musculus synaptonemal complex protein 1 (Sycp1), mRNA Length = 3277 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 716 atgagcgggaagaaaccagacaag 739
>gb|DQ356948.1| Crocodilepox virus, complete genome Length = 190054 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 gcggctcccgccgccgccgc 75 |||||||||||||||||||| Sbjct: 117544 gcggctcccgccgccgccgc 117563
>ref|XM_531921.2| PREDICTED: Canis familiaris similar to jumonji domain containing 1B (LOC474695), mRNA Length = 6117 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 gcggctcccgccgccgccgc 75 |||||||||||||||||||| Sbjct: 5275 gcggctcccgccgccgccgc 5294
>gb|AC122219.3| Mus musculus BAC clone RP23-119F18 from 3, complete sequence Length = 196563 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 50412 atgagcgggaagaaaccagacaag 50435
>gb|AC149065.4| Mus musculus BAC clone RP23-121I6 from chromosome 7, complete sequence Length = 208092 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 170746 atgagcgggaagaaaccagacaag 170769
>emb|AL160270.19| Human DNA sequence from clone RP11-296L22 on chromosome 9 Contains the 5' end of the C9orf25 gene for chromosome 9 open reading frame 25 (FLJ39031), the DNAI1 gene for dynein axonemal intermediate polypeptide 1, the CNTFR gene for ciliary neurotrophic factor receptor, a novel pseudogene, three novel genes, the 3' end of the DCTN3 gene for dynactin (p22) and five CpG islands, complete sequence Length = 199114 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 52 ccgcgcggctcccgccgccgccgc 75 |||||| ||||||||||||||||| Sbjct: 107745 ccgcgcagctcccgccgccgccgc 107722
>emb|AL080286.16|HSDJ655C4 Human DNA sequence from clone RP4-655C4 on chromosome 1p32.3-34.3 Contains a ferritin light polypeptide (FTL) pseudogene, complete sequence Length = 155278 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 281 ccccacctctccgacttcct 300 |||||||||||||||||||| Sbjct: 78610 ccccacctctccgacttcct 78629
>ref|XM_783290.1| PREDICTED: Strongylocentrotus purpuratus similar to FLJ46154 protein (LOC583377), mRNA Length = 5091 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 295 cttcctccccttgctcctcc 314 |||||||||||||||||||| Sbjct: 2275 cttcctccccttgctcctcc 2256
>gb|AC009319.19| Homo sapiens 3 BAC RP11-297K7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172581 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 acttcctccccttgctcctc 313 |||||||||||||||||||| Sbjct: 126726 acttcctccccttgctcctc 126745
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 ccggatttcgcccgcctcgc 267 |||||||||||||||||||| Sbjct: 4981876 ccggatttcgcccgcctcgc 4981895
>gb|AC026271.6| Homo sapiens chromosome 17, clone RP11-815I9, complete sequence Length = 171978 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 gcggctcccgccgccgccgc 75 |||||||||||||||||||| Sbjct: 46683 gcggctcccgccgccgccgc 46664
>dbj|AK133229.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932419D11 product:synaptonemal complex protein 1, full insert sequence Length = 2485 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 726 atgagcgggaagaaaccagacaag 749
>gb|AC153651.4| Mus musculus BAC clone RP24-74B24 from chromosome 7, complete sequence Length = 256298 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 148181 atgagcgggaagaaaccagacaag 148158
>dbj|AK015899.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930526B16 product:synaptonemal complex protein 1, pseudogene 1, full insert sequence Length = 741 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 442 atgagcgggaagaaaccagacaag 465
>ref|NG_001119.1| Homo sapiens forkhead box O3B (FOXO3B) pseudogene on chromosome 17 Length = 3244 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 gcggctcccgccgccgccgc 75 |||||||||||||||||||| Sbjct: 889 gcggctcccgccgccgccgc 870
>dbj|AK015000.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4921535C03 product:synaptonemal complex protein 1, full insert sequence Length = 1806 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 726 atgagcgggaagaaaccagacaag 749
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 cccgccgccgccgcaccaga 81 |||||||||||||||||||| Sbjct: 3577335 cccgccgccgccgcaccaga 3577354
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 ctctccgacgcgctcgccgc 243 |||||||||||||||||||| Sbjct: 1864940 ctctccgacgcgctcgccgc 1864959
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 ttcgcccgcctcgccgcgga 273 |||||||||||||||||||| Sbjct: 3054958 ttcgcccgcctcgccgcgga 3054977
>gb|U35665.1|MMU35665 Mus musculus cadherin 11 (Cdh11) gene, exon 3, and synaptonemal complex protein 1 (Scp1-ps2) pseudogene Length = 6313 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 3559 atgagcgggaagaaaccagacaag 3582
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 ttcgcccgcctcgccgcgga 273 |||||||||||||||||||| Sbjct: 1077608 ttcgcccgcctcgccgcgga 1077589
>gb|AF032887.1|AF032887 Homo sapiens forkhead (FKHRL1P1) pseudogene, chromosome 17 Length = 3244 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 gcggctcccgccgccgccgc 75 |||||||||||||||||||| Sbjct: 889 gcggctcccgccgccgccgc 870
>emb|Z38118.1|MMSCP1MR M.musculus mRNA for synaptonemal complex protein 1 Length = 3277 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 716 atgagcgggaagaaaccagacaag 739
>gb|L41536.1|MUSSCPA Mus musculus Sycp1-rs gene Length = 245 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 102 atgagcgggaagaaaccagacaag 125
>gb|L41069.1|MUSTP Mus musculus testicular protein mRNA, 3' end of cds Length = 3267 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 706 atgagcgggaagaaaccagacaag 729
>emb|AL732572.10| Mouse DNA sequence from clone RP23-32C16 on chromosome 2, complete sequence Length = 213704 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 402 ggaactgggagactccttgg 421 |||||||||||||||||||| Sbjct: 74745 ggaactgggagactccttgg 74726
>dbj|D88539.1| Mus musculus mRNA for synaptonemal complex protein 1, partial cds Length = 2081 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 494 atgagcgggaagaacccagacaag 517 |||||||||||||| ||||||||| Sbjct: 315 atgagcgggaagaaaccagacaag 338
>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster Length = 104326 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 cccgccgccgccgcaccaga 81 |||||||||||||||||||| Sbjct: 60470 cccgccgccgccgcaccaga 60451 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,707,343 Number of Sequences: 3902068 Number of extensions: 4707343 Number of successful extensions: 123536 Number of sequences better than 10.0: 49 Number of HSP's better than 10.0 without gapping: 49 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 122279 Number of HSP's gapped (non-prelim): 1257 length of query: 581 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 558 effective length of database: 17,143,297,704 effective search space: 9565960118832 effective search space used: 9565960118832 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
