ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart45d10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX469912.5| Zebrafish DNA sequence from clone CH211-156L18 i... 50 0.001
2emb|AL627405.17| Mouse DNA sequence from clone RP23-183D11 on ch... 40 1.0
3gb|AC122264.3| Mus musculus BAC clone RP23-197G20 from chromosom... 38 4.1
4emb|AL672047.10| Mouse DNA sequence from clone RP23-316B4 on chr... 38 4.1
5emb|AL356981.13| Human DNA sequence from clone RP11-548N1 on chr... 38 4.1
6gb|AC018555.5| Homo sapiens chromosome 16 clone RP11-486F10, com... 38 4.1
7gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-1... 38 4.1
8gb|AC152070.4| Pan troglodytes BAC clone RP43-135N21 from chromo... 38 4.1
9gb|AC009081.8| Homo sapiens chromosome 16 clone RP11-354I13, com... 38 4.1
10emb|AL626782.10| Mouse DNA sequence from clone RP23-335N15 on ch... 38 4.1

>emb|BX469912.5| Zebrafish DNA sequence from clone CH211-156L18 in linkage group 11,
             complete sequence
          Length = 175462

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 44    cttgcagcctcttcctgcacagctagcac 72
             |||||| ||||||||||||||||||||||
Sbjct: 34866 cttgcatcctcttcctgcacagctagcac 34894



to top

>emb|AL627405.17| Mouse DNA sequence from clone RP23-183D11 on chromosome 4, complete
             sequence
          Length = 193847

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    cttgcagcctcttcctgcacagct 67
             ||||||||| ||||||||||||||
Sbjct: 79541 cttgcagccccttcctgcacagct 79564



to top

>gb|AC122264.3| Mus musculus BAC clone RP23-197G20 from chromosome 12, complete
             sequence
          Length = 199646

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 45    ttgcagcctcttcctgcac 63
             |||||||||||||||||||
Sbjct: 80348 ttgcagcctcttcctgcac 80366



to top

>emb|AL672047.10| Mouse DNA sequence from clone RP23-316B4 on chromosome X, complete
             sequence
          Length = 183697

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    tggtttcttgcagcctctt 56
             |||||||||||||||||||
Sbjct: 33933 tggtttcttgcagcctctt 33915



to top

>emb|AL356981.13| Human DNA sequence from clone RP11-548N1 on chromosome 1 Contains part
             of the NMNAT2 gene for nicotinamide nucleotide
             adenylyltransferase 2 and a processed pseudogene similar
             to ribosomal protein S3A (RPS3A), complete sequence
          Length = 51018

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    gcaattttggtttcttgca 49
             |||||||||||||||||||
Sbjct: 10602 gcaattttggtttcttgca 10584



to top

>gb|AC018555.5| Homo sapiens chromosome 16 clone RP11-486F10, complete sequence
          Length = 187844

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 15    tctccaattggggatcgcaattt 37
             |||||||||||||||| ||||||
Sbjct: 26452 tctccaattggggatcacaattt 26430



to top

>gb|AC174465.2| Medicago truncatula chromosome 2 BAC clone mth2-189f20, complete
             sequence
          Length = 90320

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    cctcttcctgcacagctag 69
             |||||||||||||||||||
Sbjct: 68735 cctcttcctgcacagctag 68753



to top

>gb|AC152070.4| Pan troglodytes BAC clone RP43-135N21 from chromosome 7, complete
             sequence
          Length = 162075

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    ttttggtttcttgcagcct 53
             |||||||||||||||||||
Sbjct: 13891 ttttggtttcttgcagcct 13909



to top

>gb|AC009081.8| Homo sapiens chromosome 16 clone RP11-354I13, complete sequence
          Length = 166179

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 15     tctccaattggggatcgcaattt 37
              |||||||||||||||| ||||||
Sbjct: 131911 tctccaattggggatcacaattt 131889



to top

>emb|AL626782.10| Mouse DNA sequence from clone RP23-335N15 on chromosome X, complete
              sequence
          Length = 177264

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     tcttcctgcacagctagca 71
              |||||||||||||||||||
Sbjct: 122098 tcttcctgcacagctagca 122116


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 733,187
Number of Sequences: 3902068
Number of extensions: 733187
Number of successful extensions: 58551
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58534
Number of HSP's gapped (non-prelim): 17
length of query: 94
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 73
effective length of database: 17,151,101,840
effective search space: 1252030434320
effective search space used: 1252030434320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top