ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart45b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 44 0.017
2ref|XM_747666.1| Aspergillus fumigatus Af293 U4/U6 small nuclear... 40 0.27
3emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 40 0.27
4gb|AC105133.6| Homo sapiens chromosome 15, clone CTD-2071N1, com... 40 0.27
5gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 38 1.1
6gb|CP000316.1| Polaromonas sp. JS666, complete genome 38 1.1
7gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 38 1.1
8gb|AC115858.14| Mus musculus chromosome 7, clone RP24-285C16, co... 36 4.2
9emb|AL590548.22| Human DNA sequence from clone RP11-299N6 on chr... 36 4.2
10emb|AL159164.14| Human DNA sequence from clone RP1-104D1 on chro... 36 4.2
11gb|AC111086.18| Mus musculus chromosome 7, clone RP23-152P5, com... 36 4.2
12emb|AL591486.5| Mouse DNA sequence from clone RP23-465D7 on chro... 36 4.2
13gb|AC008213.4|AC008213 Drosophila melanogaster, chromosome 3R, r... 36 4.2
14gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, ... 36 4.2
15gb|AC008212.8|AC008212 Drosophila melanogaster, chromosome 3R, r... 36 4.2
16emb|AJ337508.1|HSA337508 Homo sapiens genomic sequence surroundi... 36 4.2
17emb|AJ337519.1|HSA337519 Homo sapiens genomic sequence surroundi... 36 4.2
18emb|AJ337518.1|HSA337518 Homo sapiens genomic sequence surroundi... 36 4.2
19emb|AJ337511.1|HSA337511 Homo sapiens genomic sequence surroundi... 36 4.2
20emb|AJ337409.1|HSA337409 Homo sapiens genomic sequence surroundi... 36 4.2
21ref|NM_003195.4| Homo sapiens transcription elongation factor A ... 36 4.2
22gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94... 36 4.2
23gb|U86749.1|HSU86749 Human transcription elongation factor S-II ... 36 4.2
24emb|AL606750.13| Mouse DNA sequence from clone RP23-335A19 on ch... 36 4.2

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete
              genome
          Length = 3570858

 Score = 44.1 bits (22), Expect = 0.017
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 14     agcagaggctgtgcgcgccgcg 35
              ||||||||||||||||||||||
Sbjct: 635824 agcagaggctgtgcgcgccgcg 635803



to top

>ref|XM_747666.1| Aspergillus fumigatus Af293 U4/U6 small nuclear ribonucleoprotein
           (Afu1g13890) partial mRNA
          Length = 1773

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 13  aagcagaggctgtgcgcgcc 32
           ||||||||||||||||||||
Sbjct: 170 aagcagaggctgtgcgcgcc 189



to top

>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    aagcagaggctgtgcgcgcc 32
             ||||||||||||||||||||
Sbjct: 60454 aagcagaggctgtgcgcgcc 60435



to top

>gb|AC105133.6| Homo sapiens chromosome 15, clone CTD-2071N1, complete sequence
          Length = 115519

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 8     cgcccaagcagaggctgtgcgcgccgcgccgc 39
             ||||||| ||||||| | ||||||||||||||
Sbjct: 51305 cgcccaatcagaggccgcgcgcgccgcgccgc 51274



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 18      gaggctgtgcgcgccgcgc 36
               |||||||||||||||||||
Sbjct: 1473843 gaggctgtgcgcgccgcgc 1473861



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 18     gaggctgtgcgcgccgcgc 36
              |||||||||||||||||||
Sbjct: 991442 gaggctgtgcgcgccgcgc 991424



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 38.2 bits (19), Expect = 1.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     gaggctgtgcgcgccgcgc 36
              |||||||||||||||||||
Sbjct: 769157 gaggctgtgcgcgccgcgc 769175



to top

>gb|AC115858.14| Mus musculus chromosome 7, clone RP24-285C16, complete sequence
          Length = 175843

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      gcccaagcagaggctgtg 26
              ||||||||||||||||||
Sbjct: 151262 gcccaagcagaggctgtg 151245



to top

>emb|AL590548.22| Human DNA sequence from clone RP11-299N6 on chromosome 20 Contains
            the TCEA2 gene for transcription elongation factor A
            (SII) 2, the RGS19 gene for regulator of G-protein
            signalling 19, the 5' end of the OPRL1 gene for opiate
            receptor-like 1, a novel gene and five CpG islands,
            complete sequence
          Length = 33499

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 18   gaggctgtgcgcgccgcg 35
            ||||||||||||||||||
Sbjct: 1498 gaggctgtgcgcgccgcg 1515



to top

>emb|AL159164.14| Human DNA sequence from clone RP1-104D1 on chromosome 6 Contains the 5'
             end of the BACH2 gene for BTB and CNC homology 1 basic
             leucine zipper transcription factor 2 and a CpG island,
             complete sequence
          Length = 62464

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     gcccaagcagaggctgtg 26
             ||||||||||||||||||
Sbjct: 45285 gcccaagcagaggctgtg 45268



to top

>gb|AC111086.18| Mus musculus chromosome 7, clone RP23-152P5, complete sequence
          Length = 186200

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 9    gcccaagcagaggctgtg 26
            ||||||||||||||||||
Sbjct: 1248 gcccaagcagaggctgtg 1231



to top

>emb|AL591486.5| Mouse DNA sequence from clone RP23-465D7 on chromosome 11, complete
            sequence
          Length = 79379

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 10   cccaagcagaggctgtgc 27
            ||||||||||||||||||
Sbjct: 7407 cccaagcagaggctgtgc 7424



to top

>gb|AC008213.4|AC008213 Drosophila melanogaster, chromosome 3R, region 97B-97B, BAC clone
             BACR15K06, complete sequence
          Length = 183370

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    ctgtgcgcgccgcgccgc 39
             ||||||||||||||||||
Sbjct: 55001 ctgtgcgcgccgcgccgc 55018



to top

>gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, region 97B2-97B9, BAC clone
             BACR48G23, complete sequence
          Length = 166543

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    ctgtgcgcgccgcgccgc 39
             ||||||||||||||||||
Sbjct: 12134 ctgtgcgcgccgcgccgc 12151



to top

>gb|AC008212.8|AC008212 Drosophila melanogaster, chromosome 3R, region 97A-97B, BAC clone
              BACR19L21, complete sequence
          Length = 162876

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     ctgtgcgcgccgcgccgc 39
              ||||||||||||||||||
Sbjct: 142047 ctgtgcgcgccgcgccgc 142064



to top

>emb|AJ337508.1|HSA337508 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-TN20RS
          Length = 623

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 111 gaggctgtgcgcgccgcg 94



to top

>emb|AJ337519.1|HSA337519 Homo sapiens genomic sequence surrounding NotI site, clone
           NL1-YN20RS
          Length = 713

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 111 gaggctgtgcgcgccgcg 94



to top

>emb|AJ337518.1|HSA337518 Homo sapiens genomic sequence surrounding NotI site, clone
           NR3-BD16RS
          Length = 709

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 111 gaggctgtgcgcgccgcg 94



to top

>emb|AJ337511.1|HSA337511 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-TC17RS
          Length = 641

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 111 gaggctgtgcgcgccgcg 94



to top

>emb|AJ337409.1|HSA337409 Homo sapiens genomic sequence surrounding NotI site, clone
          NR1-RH7RS
          Length = 749

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 18 gaggctgtgcgcgccgcg 35
          ||||||||||||||||||
Sbjct: 75 gaggctgtgcgcgccgcg 58



to top

>ref|NM_003195.4| Homo sapiens transcription elongation factor A (SII), 2 (TCEA2),
           transcript variant 1, mRNA
          Length = 1749

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 397 gaggctgtgcgcgccgcg 414



to top

>gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94 of 118 of the complete
              sequence
          Length = 322332

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     ctgtgcgcgccgcgccgc 39
              ||||||||||||||||||
Sbjct: 115894 ctgtgcgcgccgcgccgc 115911



to top

>gb|U86749.1|HSU86749 Human transcription elongation factor S-II (TCEA2) gene, partial
           cds
          Length = 1100

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 18  gaggctgtgcgcgccgcg 35
           ||||||||||||||||||
Sbjct: 755 gaggctgtgcgcgccgcg 772



to top

>emb|AL606750.13| Mouse DNA sequence from clone RP23-335A19 on chromosome 3, complete
              sequence
          Length = 207366

 Score = 36.2 bits (18), Expect = 4.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 5      tctcgcccaagcagaggc 22
              ||||||||||||||||||
Sbjct: 153565 tctcgcccaagcagaggc 153582


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 313,699
Number of Sequences: 3902068
Number of extensions: 313699
Number of successful extensions: 92012
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91515
Number of HSP's gapped (non-prelim): 497
length of query: 39
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 19
effective length of database: 17,155,003,908
effective search space: 325945074252
effective search space used: 325945074252
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top