ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart44d07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF255711.1|AF255711 Oryza sativa putative histone deacetylase... 92 2e-15
2dbj|AK072845.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
3dbj|AK063535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 2e-15
4ref|XM_476044.1| Oryza sativa (japonica cultivar-group), predic... 84 6e-13
5gb|AC137000.2| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
6dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
7gb|AC144455.5| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
8gb|U82815.1|ZMU82815 Zea mays nucleolar histone deacetylase HD2-... 48 0.030
9gb|AC103368.7| Mus musculus chromosome 18, clone RP24-131L2, com... 44 0.47
10gb|AC119288.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.47
11gb|BT016674.1| Zea mays clone Contig507 mRNA sequence 44 0.47
12gb|AC137614.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.47
13ref|XM_661108.1| Cryptosporidium hominis TU502 hypothetical prot... 44 0.47
14gb|AC104276.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.47
15ref|XM_625398.1| Cryptosporidium parvum Iowa II hypothetical pro... 44 0.47
16gb|AF230867.1|AF230867 Medicago sativa clone MSMRD59 resistance ... 44 0.47
17gb|AF254073.1|AF254073 Zea mays histone deacetylase 2 isoform c ... 44 0.47
18gb|AY104001.1| Zea mays PCO151917 mRNA sequence 44 0.47
19gb|AC102422.10| Mus musculus chromosome 18, clone RP24-572G3, co... 44 0.47
20gb|AC005487.2| Homo sapiens BAC clone RP11-5N18 from 7, complete... 42 1.9
21emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete ... 42 1.9
22emb|AL732607.9| Mouse DNA sequence from clone RP23-16B24 on chro... 42 1.9
23gb|AC111182.20| Homo sapiens chromosome 17, clone RP11-936I5, co... 42 1.9
24emb|BX294441.9| Mouse DNA sequence from clone RP23-421H1 on chro... 42 1.9
25emb|CT010464.7| M.truncatula DNA sequence from clone MTH2-95O22 ... 42 1.9
26gb|AY105979.1| Zea mays PCO063337 mRNA sequence 42 1.9
27gb|AF026917.1|AF026917 Zea mays histone deacetylase HD2-p39 (HD2... 42 1.9
28gb|AC149528.2| Xenopus tropicalis clone ISB-292P1, complete sequ... 40 7.4
29ref|NM_214167.1| Sus scrofa factor VIII (F8), mRNA 40 7.4
30gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosom... 40 7.4
31gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 7.4
32ref|XM_425907.1| PREDICTED: Gallus gallus similar to WD-repeat p... 40 7.4
33ref|XM_960689.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.4
34ref|XM_600478.2| PREDICTED: Bos taurus similar to ribosomal prot... 40 7.4
35ref|XM_324821.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.4
36ref|XM_866514.1| PREDICTED: Bos taurus similar to ribosomal prot... 40 7.4
37ref|NM_213272.1| Danio rerio zgc:77377 (zgc:77377), mRNA 40 7.4
38gb|BC079674.1| Mus musculus ubiquitin specific peptidase 20, mRN... 40 7.4
39gb|BC037199.1| Mus musculus ubiquitin specific peptidase 20, mRN... 40 7.4
40gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 40 7.4
41gb|AF449715.1| Mus musculus pVHL-interacting deubiquitinating en... 40 7.4
42gb|AC115919.14| Mus musculus chromosome 3, clone RP24-493L18, co... 40 7.4
43emb|AL158200.17| Human DNA sequence from clone RP11-278E11 on ch... 40 7.4
44gb|BC068186.1| Danio rerio zgc:77377, mRNA (cDNA clone MGC:77377... 40 7.4
45emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete ... 40 7.4
46emb|BX640429.1| Bordetella parapertussis strain 12822, complete ... 40 7.4
47emb|BX640414.1| Bordetella pertussis strain Tohama I, complete g... 40 7.4
48emb|AL662846.18| Mouse DNA sequence from clone RP23-399N2 on chr... 40 7.4
49emb|CR592082.1| full-length cDNA clone CS0DE014YD07 of Placenta ... 40 7.4
50gb|AC022392.5| Homo sapiens chromosome 10 clone RP11-150D20, com... 40 7.4
51dbj|AK163663.1| Mus musculus 10 days neonate medulla oblongata c... 40 7.4
52ref|NM_134386.1| Rattus norvegicus G protein-coupled receptor as... 40 7.4
53dbj|AK047242.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 7.4
54dbj|AK042612.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 7.4
55gb|AC159577.3| Macropus eugenii clone ME_KBa-436J11, complete se... 40 7.4
56dbj|AK087412.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 7.4
57dbj|AK054279.1| Mus musculus 2 days pregnant adult female ovary ... 40 7.4
58dbj|AK043439.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 7.4
59dbj|AK029890.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 7.4
60dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.4
61dbj|AK173083.1| Mus musculus mRNA for mKIAA1003 protein 40 7.4
62dbj|AP005563.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.4
63gb|AC145841.3| Macropus eugenii clone ME_KBa-363H17, complete se... 40 7.4
64gb|AY884187.1| Cochliobolus heterostrophus nonribosomal peptide ... 40 7.4
65gb|U49517.1|SSU49517 Sus scrofa factor VIII precursor mRNA, comp... 40 7.4
66gb|BC088063.1| Xenopus tropicalis hypothetical LOC496913, mRNA (... 40 7.4
67ref|NM_028846.2| Mus musculus ubiquitin specific peptidase 20 (U... 40 7.4
68dbj|AP006666.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 7.4
69emb|AL807748.10| Mouse DNA sequence from clone RP23-170A3 on chr... 40 7.4
70emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chro... 40 7.4
71dbj|AB045379.1| Xenopus laevis mRNA for pepsinogen C, complete cds 40 7.4
72dbj|AB051807.1| Rattus norvegicus pips mRNA for Per1 interacting... 40 7.4
73emb|AL133245.4|CNS01DUI BAC sequence from the SPG4 candidate reg... 40 7.4 
>gb|AF255711.1|AF255711 Oryza sativa putative histone deacetylase HD2 mRNA, complete cds
          Length = 894

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 282 gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
           |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 178 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 237

                                                                       
Query: 342 aattccaagacaacaagcgtcttcttctctggctacaatgttttccaacctgcccaggga 401
           | ||| |||||  | || || ||||| ||||||||||| |||| ||| || ||  ||| |
Sbjct: 238 acttcaaagactgctagtgtgttcttttctggctacaaagtttcccagccggctgaggaa 297

                                     
Query: 402 gatgagatggattttgattctgaaga 427
           ||||| ||||||||||||||||||||
Sbjct: 298 gatgaaatggattttgattctgaaga 323
to top
>dbj|AK072845.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023142J09, full
           insert sequence
          Length = 1284

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 282 gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
           |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 262 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 321

                                                                       
Query: 342 aattccaagacaacaagcgtcttcttctctggctacaatgttttccaacctgcccaggga 401
           | ||| |||||  | || || ||||| ||||||||||| |||| ||| || ||  ||| |
Sbjct: 322 acttcaaagactgctagtgtgttcttttctggctacaaagtttcccagccggctgaggaa 381

                                     
Query: 402 gatgagatggattttgattctgaaga 427
           ||||| ||||||||||||||||||||
Sbjct: 382 gatgaaatggattttgattctgaaga 407
to top
>dbj|AK063535.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-B10, full
           insert sequence
          Length = 1161

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 282 gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
           |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 263 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 322

                                                                       
Query: 342 aattccaagacaacaagcgtcttcttctctggctacaatgttttccaacctgcccaggga 401
           | ||| |||||  | || || ||||| ||||||||||| |||| ||| || ||  ||| |
Sbjct: 323 acttcaaagactgctagtgtgttcttttctggctacaaagtttcccagccggctgaggaa 382

                                     
Query: 402 gatgagatggattttgattctgaaga 427
           ||||| ||||||||||||||||||||
Sbjct: 383 gatgaaatggattttgattctgaaga 408
to top
>ref|XM_476044.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 894

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 282 gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
           |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 178 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 237

                                                                       
Query: 342 aattccaagacaacaagcgtcttcttctctggctacaatgttttccaacctgcccaggga 401
           | ||| |||||  | || || ||||| ||||||||||| |||| ||| || ||  ||| |
Sbjct: 238 acttcaaagactgctagtgtgttcttttctggctacaaagtttcccagccggctgaggaa 297

                                     
Query: 402 gatgagatggattttgattctgaaga 427
           |||||  |||||||||||||||||||
Sbjct: 298 gatgaattggattttgattctgaaga 323
to top
>gb|AC137000.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0035I01, complete sequence
          Length = 147813

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                         
Query: 282   gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
             |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 19383 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 19324

                                                        
Query: 342   aattccaagacaacaagcgtcttcttctctggctacaatgttt 384
             | ||| |||||  | || || ||||| ||||||||||| ||||
Sbjct: 19323 acttcaaagactgctagtgtgttcttttctggctacaaagttt 19281



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   atggattttgattctgaaga 427
             ||||||||||||||||||||
Sbjct: 19127 atggattttgattctgaaga 19108
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                            
Query: 282      gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
                |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 29534881 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 29534822

                                                           
Query: 342      aattccaagacaacaagcgtcttcttctctggctacaatgttt 384
                | ||| |||||  | || || ||||| ||||||||||| ||||
Sbjct: 29534821 acttcaaagactgctagtgtgttcttttctggctacaaagttt 29534779



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 386     ccaacctgcccagggagatgag 407
               ||||||||||||||||||||||
Sbjct: 3519556 ccaacctgcccagggagatgag 3519577



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 408      atggattttgattctgaaga 427
                ||||||||||||||||||||
Sbjct: 29534625 atggattttgattctgaaga 29534606
to top
>gb|AC144455.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0086G17,
              complete sequence
          Length = 134631

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                          
Query: 282    gacaagttccctcagatccagttcgacctcgtcttcgaaaaggaatttgagctgtcacac 341
              |||||||||||||| |||||||| ||  | ||||| || || || |||||||||||||||
Sbjct: 119151 gacaagttccctcaaatccagtttgatttggtctttgacaaagagtttgagctgtcacac 119092

                                                         
Query: 342    aattccaagacaacaagcgtcttcttctctggctacaatgttt 384
              | ||| |||||  | || || ||||| ||||||||||| ||||
Sbjct: 119091 acttcaaagactgctagtgtgttcttttctggctacaaagttt 119049



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 408    atggattttgattctgaaga 427
              ||||||||||||||||||||
Sbjct: 118895 atggattttgattctgaaga 118876
to top
>gb|U82815.1|ZMU82815 Zea mays nucleolar histone deacetylase HD2-p39 mRNA, complete cds
          Length = 1169

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 327 tttgagctgtcacacaattccaagacaacaagcgtcttcttctctggctacaatgttttc 386
           ||||||||||| ||||  || || || || |||||||||||| |||||||||| |||   
Sbjct: 293 tttgagctgtcgcacacatcaaaaactaccagcgtcttcttcactggctacaaggttgaa 352

                                                       
Query: 387 caacctgcccagggagatgagatggattttgattctgaagatga 430
           || ||   | ||| |||||| |||||| ||||||||||||||||
Sbjct: 353 cagccattcgaggaagatgaaatggatcttgattctgaagatga 396



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 105 atggagttctggggcctcgaggttaagcct 134
           |||||||||||||| |||||||| ||||||
Sbjct: 74  atggagttctggggtctcgaggtcaagcct 103
to top
>gb|AC103368.7| Mus musculus chromosome 18, clone RP24-131L2, complete sequence
          Length = 160855

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 139   agtccatcaaggtttctcctga 160
             ||||||||||||||||||||||
Sbjct: 11024 agtccatcaaggtttctcctga 11045
to top
>gb|AC119288.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017J22,
              complete sequence
          Length = 177153

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 386    ccaacctgcccagggagatgag 407
              ||||||||||||||||||||||
Sbjct: 149038 ccaacctgcccagggagatgag 149059
to top
>gb|BT016674.1| Zea mays clone Contig507 mRNA sequence
          Length = 1258

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 401 agatgagatggattttgattctgaagatga 430
           |||||| |||||| ||||||||||||||||
Sbjct: 372 agatgaaatggatcttgattctgaagatga 401



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 327 tttgagctgtcacacaattccaagacaacaagcgtcttcttctctggctacaa 379
           ||||||||||| ||||  || || || || |||||||||||| ||||||||||
Sbjct: 298 tttgagctgtcgcacacatcaaaaactaccagcgtcttcttcactggctacaa 350
to top
>gb|AC137614.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0034O12, complete sequence
          Length = 156263

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 386   ccaacctgcccagggagatgag 407
             ||||||||||||||||||||||
Sbjct: 85187 ccaacctgcccagggagatgag 85208
to top
>ref|XM_661108.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20036)
           partial mRNA
          Length = 552

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 411 gattttgattctgaagatgagt 432
           ||||||||||||||||||||||
Sbjct: 7   gattttgattctgaagatgagt 28
to top
>gb|AC104276.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1231_F08,
             complete sequence
          Length = 118049

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 386   ccaacctgcccagggagatgag 407
             ||||||||||||||||||||||
Sbjct: 86838 ccaacctgcccagggagatgag 86859
to top
>ref|XM_625398.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_290),
           partial mRNA
          Length = 552

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 411 gattttgattctgaagatgagt 432
           ||||||||||||||||||||||
Sbjct: 7   gattttgattctgaagatgagt 28
to top
>gb|AF230867.1|AF230867 Medicago sativa clone MSMRD59 resistance gene primer amplified
           sequence
          Length = 109

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 427 atgagtctgagtctgaggatga 448
           ||||||||||||||||||||||
Sbjct: 81  atgagtctgagtctgaggatga 60
to top
>gb|AF254073.1|AF254073 Zea mays histone deacetylase 2 isoform c mRNA, complete cds
          Length = 903

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 401 agatgagatggattttgattctgaagatga 430
           |||||| |||||| ||||||||||||||||
Sbjct: 294 agatgaaatggatcttgattctgaagatga 323



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 105 atggagttctggggcctcgaggttaagcct 134
           |||||||||||||| |||||||| ||||||
Sbjct: 1   atggagttctggggtctcgaggtcaagcct 30
to top
>gb|AY104001.1| Zea mays PCO151917 mRNA sequence
          Length = 1291

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 401 agatgagatggattttgattctgaagatga 430
           |||||| |||||| ||||||||||||||||
Sbjct: 372 agatgaaatggatcttgattctgaagatga 401



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 105 atggagttctggggcctcgaggttaagcct 134
           |||||||||||||| |||||||| ||||||
Sbjct: 79  atggagttctggggtctcgaggtcaagcct 108
to top
>gb|AC102422.10| Mus musculus chromosome 18, clone RP24-572G3, complete sequence
          Length = 173218

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 139  agtccatcaaggtttctcctga 160
            ||||||||||||||||||||||
Sbjct: 5997 agtccatcaaggtttctcctga 5976
to top
>gb|AC005487.2| Homo sapiens BAC clone RP11-5N18 from 7, complete sequence
          Length = 54183

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 384   ttccaacctgcccagggagatgaga 408
             |||| ||||||||||||||||||||
Sbjct: 50181 ttcccacctgcccagggagatgaga 50157
to top
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29
          Length = 276800

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 234   gtcaaggtcgacggcggccag 254
             |||||||||||||||||||||
Sbjct: 36134 gtcaaggtcgacggcggccag 36154
to top
>emb|AL732607.9| Mouse DNA sequence from clone RP23-16B24 on chromosome 11 Contains a
             novel pseudogene, two novel genes and a methionine
             aminopeptidase 2 (Metap2) pseudogene, complete sequence
          Length = 66800

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 441   gaggatgagcaggagcccatc 461
             |||||||||||||||||||||
Sbjct: 63103 gaggatgagcaggagcccatc 63123
to top
>gb|AC111182.20| Homo sapiens chromosome 17, clone RP11-936I5, complete sequence
          Length = 171898

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 434   tgagtctgaggatgagcagga 454
             |||||||||||||||||||||
Sbjct: 67775 tgagtctgaggatgagcagga 67795
to top
>emb|BX294441.9| Mouse DNA sequence from clone RP23-421H1 on chromosome 2, complete
             sequence
          Length = 96360

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 168   cacttcctccatctctcccag 188
             |||||||||||||||||||||
Sbjct: 68460 cacttcctccatctctcccag 68440
to top
>emb|CT010464.7| M.truncatula DNA sequence from clone MTH2-95O22 on chromosome 3,
             complete sequence
          Length = 117153

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   gatgacaagacaaccttgttt 233
             |||||||||||||||||||||
Sbjct: 94874 gatgacaagacaaccttgttt 94854
to top
>gb|AY105979.1| Zea mays PCO063337 mRNA sequence
          Length = 1307

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 327 tttgagctgtcacacaattccaagacaacaagcgtcttcttctctggctacaa 379
           |||||| | ||||||||||| |||||| | || || ||||||| |||||||||
Sbjct: 309 tttgagttatcacacaattcaaagacagctagtgttttcttctgtggctacaa 361
to top
>gb|AF026917.1|AF026917 Zea mays histone deacetylase HD2-p39 (HD2) gene, complete cds
          Length = 2486

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                 
Query: 327  tttgagctgtcacacaattccaagacaacaagcgtcttcttctctggctacaa 379
            ||||||||||| ||||  || || || || |||||||||||| ||||||||||
Sbjct: 1069 tttgagctgtcgcacacatcaaaaactaccagcgtcttcttcactggctacaa 1121
to top
>gb|AC149528.2| Xenopus tropicalis clone ISB-292P1, complete sequence
          Length = 87806

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 518  ggttttaattgacactggatcttc 541
            ||||||| ||||||||||||||||
Sbjct: 8509 ggttttatttgacactggatcttc 8486
to top
>ref|NM_214167.1| Sus scrofa factor VIII (F8), mRNA
          Length = 6539

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 359  cgtcttcttctctggctaca 378
            ||||||||||||||||||||
Sbjct: 2144 cgtcttcttctctggctaca 2163
to top
>gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosome 17, complete
             sequence
          Length = 207685

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   cagaagaagcaggttttaat 526
             ||||||||||||||||||||
Sbjct: 71799 cagaagaagcaggttttaat 71780
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 240     gtcgacggcggccagaagct 259
               ||||||||||||||||||||
Sbjct: 2281071 gtcgacggcggccagaagct 2281052
to top
>ref|XM_425907.1| PREDICTED: Gallus gallus similar to WD-repeat protein 18
           (LOC428347), mRNA
          Length = 513

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 ggatgagcaggagcccatca 462
           ||||||||||||||||||||
Sbjct: 439 ggatgagcaggagcccatca 420
to top
>ref|XM_960689.1| Neurospora crassa OR74A hypothetical protein (NCU00642.1) partial
            mRNA
          Length = 2967

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  ggtcaagaaggatgacaaga 222
            ||||||||||||||||||||
Sbjct: 1533 ggtcaagaaggatgacaaga 1552
to top
>ref|XM_600478.2| PREDICTED: Bos taurus similar to ribosomal protein L22 like 1
           (LOC522203), mRNA
          Length = 1145

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 422 tgaagatgagtctgagtctgagga 445
           ||||||||| ||||||||||||||
Sbjct: 363 tgaagatgaatctgagtctgagga 386
to top
>ref|XM_324821.1| Neurospora crassa OR74A hypothetical protein (NCU00642.1) partial
            mRNA
          Length = 2967

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 203  ggtcaagaaggatgacaaga 222
            ||||||||||||||||||||
Sbjct: 1533 ggtcaagaaggatgacaaga 1552
to top
>ref|XM_866514.1| PREDICTED: Bos taurus similar to ribosomal protein L22 like 1
           (LOC614872), mRNA
          Length = 1162

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 422 tgaagatgagtctgagtctgagga 445
           ||||||||| ||||||||||||||
Sbjct: 362 tgaagatgaatctgagtctgagga 385
to top
>ref|NM_213272.1| Danio rerio zgc:77377 (zgc:77377), mRNA
          Length = 3862

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 429  gagtctgagtctgaggatga 448
            ||||||||||||||||||||
Sbjct: 2735 gagtctgagtctgaggatga 2754
to top
>gb|BC079674.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           MGC:90775 IMAGE:30531994), complete cds
          Length = 5012

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 515 gagtctgagtctgaggatga 534
to top
>gb|BC037199.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           IMAGE:3672749)
          Length = 3544

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 10  gagtctgagtctgaggatga 29
to top
>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 411    gattttgattctgaagatga 430
              ||||||||||||||||||||
Sbjct: 868800 gattttgattctgaagatga 868819
to top
>gb|AF449715.1| Mus musculus pVHL-interacting deubiquitinating enzyme 2 (Vdu2)
           mRNA, complete cds
          Length = 4094

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 577 gagtctgagtctgaggatga 596
to top
>gb|AC115919.14| Mus musculus chromosome 3, clone RP24-493L18, complete sequence
          Length = 195790

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 520   ttttaattgacactggatcttcaa 543
             ||||| ||||||||||||||||||
Sbjct: 48804 ttttatttgacactggatcttcaa 48827
to top
>emb|AL158200.17| Human DNA sequence from clone RP11-278E11 on chromosome Xp11.21-11.22
             Contains a novel gene and the gene for a novel protein
             similar to ubiquinol-cytochrome c reductase binding
             protein (UQCRB), complete sequence
          Length = 87538

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 499   ccaaggagcagaagaagcag 518
             ||||||||||||||||||||
Sbjct: 43269 ccaaggagcagaagaagcag 43250
to top
>gb|BC068186.1| Danio rerio zgc:77377, mRNA (cDNA clone MGC:77377 IMAGE:6969157),
            complete cds
          Length = 3862

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 429  gagtctgagtctgaggatga 448
            ||||||||||||||||||||
Sbjct: 2735 gagtctgagtctgaggatga 2754
to top
>emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete genome; segment 5/16
          Length = 348624

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    aggtcgacggcggccagaag 257
              ||||||||||||||||||||
Sbjct: 176798 aggtcgacggcggccagaag 176817
to top
>emb|BX640429.1| Bordetella parapertussis strain 12822, complete genome; segment 7/14
          Length = 344321

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 238    aggtcgacggcggccagaag 257
              ||||||||||||||||||||
Sbjct: 126949 aggtcgacggcggccagaag 126968
to top
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12
          Length = 343243

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   aggtcgacggcggccagaag 257
             ||||||||||||||||||||
Sbjct: 77557 aggtcgacggcggccagaag 77538
to top
>emb|AL662846.18| Mouse DNA sequence from clone RP23-399N2 on chromosome 11 Contains a
             zinc finger protein of the cerebellum 5 (Zic5) pseudogene,
             complete sequence
          Length = 189287

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   ccacttcctccatctctccc 186
             ||||||||||||||||||||
Sbjct: 41721 ccacttcctccatctctccc 41702
to top
>emb|CR592082.1| full-length cDNA clone CS0DE014YD07 of Placenta of Homo sapiens
           (human)
          Length = 1310

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 48  cccctcgcctccggccacca 67
           ||||||||||||||||||||
Sbjct: 116 cccctcgcctccggccacca 135
to top
>gb|AC022392.5| Homo sapiens chromosome 10 clone RP11-150D20, complete sequence
          Length = 196467

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    ggccttaaacccaaccctag 43
             ||||||||||||||||||||
Sbjct: 33873 ggccttaaacccaaccctag 33854
to top
>dbj|AK163663.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN
           full-length enriched library, clone:B830039L20
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4052

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 536 gagtctgagtctgaggatga 555
to top
>ref|NM_134386.1| Rattus norvegicus G protein-coupled receptor associated sorting
            protein 1 (Gprasp1), mRNA
          Length = 6400

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 416  tgattctgaagatgagtctg 435
            ||||||||||||||||||||
Sbjct: 2718 tgattctgaagatgagtctg 2737
to top
>dbj|AK047242.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930041H10 product:BA409K20.4
           (UBIQUITIN SPECIFIC PROTEASE 20 (KIAA1003)) homolog
           [Homo sapiens], full insert sequence
          Length = 4065

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 545 gagtctgagtctgaggatga 564
to top
>dbj|AK042612.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730010I05 product:weakly
           similar to BA409K20.4 (UBIQUITIN SPECIFIC PROTEASE 20
           (KIAA1003)) [Homo sapiens], full insert sequence
          Length = 1361

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 543 gagtctgagtctgaggatga 562
to top
>gb|AC159577.3| Macropus eugenii clone ME_KBa-436J11, complete sequence
          Length = 23152

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 411   gattttgattctgaagatga 430
             ||||||||||||||||||||
Sbjct: 21706 gattttgattctgaagatga 21725
to top
>dbj|AK087412.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130012I02 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4053

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 537 gagtctgagtctgaggatga 556
to top
>dbj|AK054279.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330009O13
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4101

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 569 gagtctgagtctgaggatga 588
to top
>dbj|AK043439.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730095K12
           product:unclassifiable, full insert sequence
          Length = 511

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 507 cagaagaagcaggttttaat 526
           ||||||||||||||||||||
Sbjct: 361 cagaagaagcaggttttaat 342
to top
>dbj|AK029890.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4931427A11 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4980

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 523 gagtctgagtctgaggatga 542
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 125     ggttaagcctaaccagtcca 144
               ||||||||||||||||||||
Sbjct: 1848258 ggttaagcctaaccagtcca 1848277
to top
>dbj|AK173083.1| Mus musculus mRNA for mKIAA1003 protein
          Length = 4044

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 528 gagtctgagtctgaggatga 547
to top
>dbj|AP005563.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1227_D07
          Length = 118358

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   ggttaagcctaaccagtcca 144
             ||||||||||||||||||||
Sbjct: 86920 ggttaagcctaaccagtcca 86939
to top
>gb|AC145841.3| Macropus eugenii clone ME_KBa-363H17, complete sequence
          Length = 144488

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 411 gattttgattctgaagatga 430
           ||||||||||||||||||||
Sbjct: 601 gattttgattctgaagatga 620
to top
>gb|AY884187.1| Cochliobolus heterostrophus nonribosomal peptide synthetase 2 (NPS2)
             gene, complete cds
          Length = 18149

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 337   cacacaattccaagacaacaagcgtctt 364
             |||| |||||||||| ||||||||||||
Sbjct: 10532 cacataattccaagagaacaagcgtctt 10559
to top
>gb|U49517.1|SSU49517 Sus scrofa factor VIII precursor mRNA, complete cds
          Length = 6539

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 359  cgtcttcttctctggctaca 378
            ||||||||||||||||||||
Sbjct: 2144 cgtcttcttctctggctaca 2163
to top
>gb|BC088063.1| Xenopus tropicalis hypothetical LOC496913, mRNA (cDNA clone
           IMAGE:7024289), partial cds
          Length = 1334

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 518 ggttttaattgacactggatcttc 541
           ||||||| ||||||||||||||||
Sbjct: 234 ggttttatttgacactggatcttc 257
to top
>ref|NM_028846.2| Mus musculus ubiquitin specific peptidase 20 (Usp20), mRNA
          Length = 5012

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gagtctgagtctgaggatga 448
           ||||||||||||||||||||
Sbjct: 515 gagtctgagtctgaggatga 534
to top
>dbj|AP006666.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT46L11, TM0365,
             complete sequence
          Length = 122449

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 417   gattctgaagatgagtctga 436
             ||||||||||||||||||||
Sbjct: 87314 gattctgaagatgagtctga 87333
to top
>emb|AL807748.10| Mouse DNA sequence from clone RP23-170A3 on chromosome 4, complete
             sequence
          Length = 170162

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 429   gagtctgagtctgaggatga 448
             ||||||||||||||||||||
Sbjct: 84231 gagtctgagtctgaggatga 84212
to top
>emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chromosome 2, complete
             sequence
          Length = 170475

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 429   gagtctgagtctgaggatga 448
             ||||||||||||||||||||
Sbjct: 30043 gagtctgagtctgaggatga 30062
to top
>dbj|AB045379.1| Xenopus laevis mRNA for pepsinogen C, complete cds
          Length = 1301

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 518 ggttttaattgacactggatcttc 541
           ||||||| ||||||||||||||||
Sbjct: 243 ggttttatttgacactggatcttc 266
to top
>dbj|AB051807.1| Rattus norvegicus pips mRNA for Per1 interacting protein of the
            suprachiamatic nucleus, complete cds
          Length = 6400

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 416  tgattctgaagatgagtctg 435
            ||||||||||||||||||||
Sbjct: 2718 tgattctgaagatgagtctg 2737
to top
>emb|AL133245.4|CNS01DUI BAC sequence from the SPG4 candidate region at 2p21-2p22 BAC 854M03 of
             library RPCI-11 from chromosome 2 of Homo sapiens (Human)
          Length = 138041

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    cccctcgcctccggccacca 67
             ||||||||||||||||||||
Sbjct: 68757 cccctcgcctccggccacca 68738


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,995,392
Number of Sequences: 3902068
Number of extensions: 4995392
Number of successful extensions: 109407
Number of sequences better than 10.0: 73
Number of HSP's better than 10.0 without gapping: 74
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109125
Number of HSP's gapped (non-prelim): 282
length of query: 546
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 523
effective length of database: 17,143,297,704
effective search space: 8965944699192
effective search space used: 8965944699192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top