ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart43h12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC157798.5| Mus musculus chromosome 1, clone RP24-153N24, com... 40 7.6
2emb|BX248584.1| Blochmannia floridanus complete genome; segment 1/3 40 7.6
3gb|AC009121.8| Homo sapiens chromosome 16 clone RP11-485G7, comp... 40 7.6
4gb|AY116594.1| Haemophilus paragallinarum HctD (hctD), HctC (hct... 40 7.6
5gb|AC006055.1| Homo sapiens 3p22 Contig 7 PAC RPCI4-672N11 (Rosw... 40 7.6
6gb|AC113015.12| Mus musculus chromosome 1, clone RP23-180E19, co... 40 7.6
7gb|AC008483.7| Homo sapiens chromosome 5 clone CTC-406I6, comple... 40 7.6
8emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 i... 40 7.6
9gb|AC007220.4|AC007220 Homo sapiens chromosome 16 clone RP11-396... 40 7.6
10gb|AC010423.8| Homo sapiens chromosome 5 clone CTD-2193G5, compl... 40 7.6
11gb|AC170597.2| Mus musculus BAC clone RP23-391A19 from chromosom... 40 7.6
12gb|AC084069.28| Mus musculus strain C57BL/6J chromosome 13 clone... 40 7.6

>gb|AC157798.5| Mus musculus chromosome 1, clone RP24-153N24, complete sequence
          Length = 163087

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 314    ctcaagttcaagggctatag 333
              ||||||||||||||||||||
Sbjct: 125028 ctcaagttcaagggctatag 125009



to top

>emb|BX248584.1| Blochmannia floridanus complete genome; segment 1/3
          Length = 250050

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 369    aatccagatggaaagtcgatgggtatga 396
              |||||||||||||  |||||||||||||
Sbjct: 195564 aatccagatggaatatcgatgggtatga 195591



to top

>gb|AC009121.8| Homo sapiens chromosome 16 clone RP11-485G7, complete sequence
          Length = 131487

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 334    cttgaccacagacatcagca 353
              ||||||||||||||||||||
Sbjct: 125775 cttgaccacagacatcagca 125756



to top

>gb|AY116594.1| Haemophilus paragallinarum HctD (hctD), HctC (hctC), HctB (hctB), and
            HctA (hctA) genes, complete cds
          Length = 4090

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 529  agatccaagaggagtattta 548
            ||||||||||||||||||||
Sbjct: 1046 agatccaagaggagtattta 1065



to top

>gb|AC006055.1| Homo sapiens 3p22 Contig 7 PAC RPCI4-672N11 (Roswell Park Cancer
             Institute Human PAC Library) complete sequence
          Length = 91885

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 223   caagagaagcttcaactgtg 242
             ||||||||||||||||||||
Sbjct: 45310 caagagaagcttcaactgtg 45329



to top

>gb|AC113015.12| Mus musculus chromosome 1, clone RP23-180E19, complete sequence
          Length = 188389

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 314    ctcaagttcaagggctatag 333
              ||||||||||||||||||||
Sbjct: 173289 ctcaagttcaagggctatag 173308



to top

>gb|AC008483.7| Homo sapiens chromosome 5 clone CTC-406I6, complete sequence
          Length = 152533

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 360   attgctttaaatccagatggaaag 383
             |||| |||||||||||||||||||
Sbjct: 60754 attgttttaaatccagatggaaag 60777



to top

>emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 in linkage group 2,
              complete sequence
          Length = 153636

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 251    caggccttcaccatggaaaa 270
              ||||||||||||||||||||
Sbjct: 133991 caggccttcaccatggaaaa 134010



to top

>gb|AC007220.4|AC007220 Homo sapiens chromosome 16 clone RP11-396B14, complete sequence
          Length = 172945

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 334    cttgaccacagacatcagca 353
              ||||||||||||||||||||
Sbjct: 151721 cttgaccacagacatcagca 151740



to top

>gb|AC010423.8| Homo sapiens chromosome 5 clone CTD-2193G5, complete sequence
          Length = 183787

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 360   attgctttaaatccagatggaaag 383
             |||| |||||||||||||||||||
Sbjct: 33940 attgttttaaatccagatggaaag 33917



to top

>gb|AC170597.2| Mus musculus BAC clone RP23-391A19 from chromosome 13, complete sequence
          Length = 223662

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 356    gaccattgctttaaatccag 375
              ||||||||||||||||||||
Sbjct: 188527 gaccattgctttaaatccag 188546



to top

>gb|AC084069.28| Mus musculus strain C57BL/6J chromosome 13 clone rp23-257b17, complete
              sequence
          Length = 222775

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 356    gaccattgctttaaatccag 375
              ||||||||||||||||||||
Sbjct: 200052 gaccattgctttaaatccag 200033


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,565,100
Number of Sequences: 3902068
Number of extensions: 3565100
Number of successful extensions: 61056
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61038
Number of HSP's gapped (non-prelim): 18
length of query: 558
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 535
effective length of database: 17,143,297,704
effective search space: 9171664271640
effective search space used: 9171664271640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top