ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart40e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ442996.1| Triticum aestivum phosphomannomutase mRNA, comple... 959 0.0
2ref|XM_474395.1| Oryza sativa (japonica cultivar-group), predic... 553 e-154
3gb|DQ442992.1| Oryza sativa (japonica cultivar-group) phosphoman... 553 e-154
4dbj|AK104004.1| Oryza sativa (japonica cultivar-group) cDNA clon... 553 e-154
5dbj|AK061384.1| Oryza sativa (japonica cultivar-group) cDNA clon... 553 e-154
6gb|AY105630.1| Zea mays PCO073836 mRNA sequence 488 e-134
7dbj|AK073871.1| Oryza sativa (japonica cultivar-group) cDNA clon... 343 4e-91
8gb|DQ442995.1| Nicotiana tabacum phosphomannomutase mRNA, comple... 194 2e-46
9gb|DQ442993.1| Lycopersicon esculentum phosphomannomutase mRNA, ... 151 3e-33
10gb|BT013289.1| Lycopersicon esculentum clone 134900R, mRNA sequence 143 8e-31
11emb|AL606641.3|OSJN00074 Oryza sativa genomic DNA, chromosome 4,... 133 7e-28
12dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 133 7e-28
13emb|AL732352.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 133 7e-28
14gb|DQ442994.1| Glycine max phosphomannomutase mRNA, complete cds 119 1e-23
15dbj|AP006402.1| Lotus japonicus genomic DNA, chromosome 1, clone... 88 4e-14
16gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 72 2e-09
17ref|NM_130142.2| Arabidopsis thaliana catalytic/ phosphomannomut... 68 4e-08
18gb|AY113964.1| Arabidopsis thaliana putative phosphomannomutase ... 68 4e-08
19gb|AY050806.1| Arabidopsis thaliana putative phosphomannomutase ... 68 4e-08
20gb|DQ442991.1| Arabidopsis thaliana phosphomannomutase mRNA, com... 68 4e-08
21emb|BX819611.1|CNS0A8ZJ Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
22gb|AY088930.1| Arabidopsis thaliana clone 998 mRNA, complete seq... 68 4e-08
23emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genom... 46 0.13
24gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 46 0.13
25gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 44 0.52
26gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 44 0.52
27gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 44 0.52
28gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 44 0.52
29emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome... 44 0.52
30emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 44 0.52
31emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 44 0.52
32dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
33gb|AC084460.1|AC084460 Caenorhabditis briggsae cosmid CB033D02, ... 44 0.52
34dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
35gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 44 0.52
36gb|AY842241.1| Arabidopsis thaliana chloroplast amidophosphoribo... 42 2.1
37ref|NM_119640.2| Arabidopsis thaliana ATASE2 (GLN PHOSPHORIBOSYL... 42 2.1
38ref|NM_129514.2| Arabidopsis thaliana unknown protein AT2G39560 ... 42 2.1
39ref|NM_202492.2| Arabidopsis thaliana ATP binding / kinase/ prot... 42 2.1
40ref|NM_105552.2| Arabidopsis thaliana unknown protein AT1G68790 ... 42 2.1
41ref|XM_479805.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.1
42gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 2.1
43ref|XM_587106.2| PREDICTED: Bos taurus similar to A-kinase ancho... 42 2.1
44gb|AC183772.2| Pan troglodytes BAC clone CH251-73E21 from chromo... 42 2.1
45ref|XM_848592.1| PREDICTED: Canis familiaris hypothetical protei... 42 2.1
46ref|XM_570142.1| Cryptococcus neoformans var. neoformans JEC21 r... 42 2.1
47emb|Z81502.1|CEF14B6 Caenorhabditis elegans Cosmid F14B6, comple... 42 2.1
48gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clon... 42 2.1
49ref|XM_505974.1| Yarrowia lipolytica CLIB122, YALI0F28039g predi... 42 2.1
50gb|AC139206.5| Mus musculus chromosome 1, clone RP23-82P18, comp... 42 2.1
51emb|AL121875.10|HSBA51C14 Human DNA sequence from clone RP11-51C... 42 2.1
52emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 o... 42 2.1
53ref|XM_963711.1| PREDICTED: Tribolium castaneum similar to CG109... 42 2.1
54ref|XM_795544.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 2.1
55emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genom... 42 2.1
56emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 42 2.1
57emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome 4, B... 42 2.1
58emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 42 2.1
59gb|AC162692.2| Mus musculus chromosome 1, clone RP23-445K23, com... 42 2.1
60gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 42 2.1
61gb|AY120699.1| Arabidopsis thaliana At2g39560/F12L6.22 mRNA, com... 42 2.1
62gb|AE011938.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 2.1
63gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map... 42 2.1
64gb|AY081611.1| Arabidopsis thaliana amidophosphoribosyltransfera... 42 2.1
65gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, com... 42 2.1
66gb|AY075666.1| Arabidopsis thaliana At2g39560/F12L6.22 mRNA, com... 42 2.1
67gb|AY065123.1| Arabidopsis thaliana amidophosphoribosyltransfera... 42 2.1
68gb|AF326399.1|AF326399 Pseudomonas sp. GB13 Mn(II)-oxidation-ass... 42 2.1
69ref|NM_060684.2| Caenorhabditis elegans F14B6.2 (F14B6.2) mRNA, ... 42 2.1
70gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.1
71gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 42 2.1
72gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-61... 42 2.1
73emb|BX824516.1|CNS0A4Q9 Arabidopsis thaliana Full-length cDNA Co... 42 2.1
74gb|AC011914.9|AC011914 Arabidopsis thaliana chromosome 1 BAC F14... 42 2.1
75gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 42 2.1
76gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq... 42 2.1
77gb|AC124758.6| Mus musculus BAC clone RP23-123I10 from chromosom... 42 2.1
78gb|AC008940.3|AC008940 Homo sapiens chromosome 5 clone CTD-2319M... 42 2.1
79dbj|AP004562.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
80dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
81gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 2.1
82dbj|D28869.1|ATHAMIDA Arabidopsis thaliana mRNA for amidophospho... 42 2.1
83gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 42 2.1
84gb|AF002846.1|AF002846 Melipona bicolor microsatellite sequence ... 42 2.1
85emb|CT010499.9| Mouse DNA sequence from clone RP23-211K24 on chr... 42 2.1
86emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 42 2.1
87emb|AL513470.8| Mouse DNA sequence from clone RP21-464E5 on chro... 42 2.1
88gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, comp... 40 8.2
89gb|AC110907.7| Mus musculus chromosome 7, clone RP24-180J10, com... 40 8.2
90gb|AC153879.1| Mus musculus BAC RP23-264C21 (Roswell Park Cance... 40 8.2
91ref|NM_111326.1| Arabidopsis thaliana unknown protein AT3G04550 ... 40 8.2
92ref|NM_148229.1| Arabidopsis thaliana unknown protein AT4G04635 ... 40 8.2
93ref|NM_111327.3| Arabidopsis thaliana unknown protein AT3G04560 ... 40 8.2
94gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, comp... 40 8.2
95gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, co... 40 8.2
96gb|AC162176.2| Mus musculus BAC clone RP24-446P15 from chromosom... 40 8.2
97gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 40 8.2
98gb|AC164170.7| Mus musculus 10 BAC RP24-419C12 (Roswell Park Can... 40 8.2
99gb|AC147455.3| Atelerix albiventris clone LB4-341B4, complete se... 40 8.2
100gb|AC166051.5| Mus musculus BAC clone RP24-166B2 from chromosome... 40 8.2
101gb|AC134474.4| Mus musculus BAC clone RP23-234N16 from chromosom... 40 8.2
102gb|AC158641.12| Mus musculus 10 BAC RP23-461E22 (Roswell Park Ca... 40 8.2
103ref|XM_470078.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.2
104ref|NM_194599.1| Oryza sativa (japonica cultivar-group) putative... 40 8.2
105gb|DQ211982.1| Toxoplasma gondii eukaryotic translation initiati... 40 8.2
106gb|AC101924.24| Mus musculus chromosome 1, clone RP24-391B5, com... 40 8.2
107gb|AC099743.3| Papio anubis clone RP41-450I16, complete sequence 40 8.2
108gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, co... 40 8.2
109gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, comp... 40 8.2
110gb|AC164607.4| Mus musculus chromosome 5, clone RP23-455A10, com... 40 8.2
111gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, co... 40 8.2
112gb|AC154871.13| Mus musculus chromosome 1, clone RP23-354B17, co... 40 8.2
113gb|AC102757.6| Mus musculus chromosome 5, clone RP24-196M24, com... 40 8.2
114gb|AC078891.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
115gb|AC133103.5| Mus musculus BAC clone RP23-226J10 from chromosom... 40 8.2
116gb|AC134443.3| Mus musculus BAC clone RP24-107B13 from chromosom... 40 8.2
117gb|AC103896.3| Papio anubis clone RP41-441D23, complete sequence 40 8.2
118gb|AC135357.3| Mus musculus chromosome 8 clone RP24-84L15, compl... 40 8.2
119gb|AC123597.9| Mus musculus chromosome 8, clone RP23-134A7, comp... 40 8.2
120gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, co... 40 8.2
121gb|AC102223.9| Mus musculus chromosome 1, clone RP24-296E23, com... 40 8.2
122gb|AC126115.5| Rattus norvegicus 4 BAC CH230-213L22 (Children's ... 40 8.2
123gb|AC120148.13| Mus musculus chromosome 9, clone RP24-225E14, co... 40 8.2
124gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, com... 40 8.2
125gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, c... 40 8.2
126ref|XM_458229.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 8.2
127gb|AC145587.4| Mus musculus BAC clone RP24-343E24 from chromosom... 40 8.2
128gb|AC139349.4| Mus musculus BAC clone RP24-318A14 from chromosom... 40 8.2
129gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosom... 40 8.2
130gb|AC132335.3| Mus musculus BAC clone RP24-230C24 from chromosom... 40 8.2
131ref|XM_603394.2| PREDICTED: Bos taurus similar to bromodomain co... 40 8.2
132gb|BC025119.1| Mus musculus cDNA sequence BC032204, mRNA (cDNA c... 40 8.2
133gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, com... 40 8.2
134gb|AC146687.1| Mus musculus BAC clone RP24-487N17 from chromosom... 40 8.2
135gb|AY604200.1| Thermoascus aurantiacus Cre1 (Cre1) gene, complet... 40 8.2
136ref|NM_007371.2| Homo sapiens bromodomain containing 3 (BRD3), mRNA 40 8.2
137gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosom... 40 8.2
138gb|AC131339.3| Mus musculus BAC clone RP23-226F20 from chromosom... 40 8.2
139gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome ... 40 8.2
140gb|AC142103.3| Mus musculus BAC clone RP24-287E15 from chromosom... 40 8.2
141gb|AC124508.5| Mus musculus BAC clone RP23-433B5 from chromosome... 40 8.2
142gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosom... 40 8.2
143gb|AC144809.2| Mus musculus BAC clone RP24-391L5 from chromosome... 40 8.2
144gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosom... 40 8.2
145gb|AC175673.2| Mus musculus BAC clone RP24-26I10 from chromosome... 40 8.2
146gb|AC153900.8| Mus musculus 6 BAC RP23-36I21 (Roswell Park Cance... 40 8.2
147ref|NM_001012732.1| Homo sapiens dCMP deaminase (DCTD), transcri... 40 8.2
148ref|NM_001921.2| Homo sapiens dCMP deaminase (DCTD), transcript ... 40 8.2
149gb|AC119896.6| Mus musculus chromosome 10, clone RP24-226B10, co... 40 8.2
150gb|BC066803.1| Mus musculus cDNA sequence BC032204, mRNA (cDNA c... 40 8.2
151gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome... 40 8.2
152gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, compl... 40 8.2
153gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.2
154gb|AC164316.3| Mus musculus BAC clone RP23-16B4 from chromosome ... 40 8.2
155gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome... 40 8.2
156gb|AC165239.3| Mus musculus chromosome 19, clone RP24-73C2, comp... 40 8.2
157gb|AC036145.11| Mus musculus chromosome 5, clone RP23-439C22, co... 40 8.2
158gb|AC115121.5| Mus musculus BAC clone RP23-204O13 from chromosom... 40 8.2
159gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome... 40 8.2
160gb|AY329370.1| Mus musculus TOX (Tox) mRNA, complete cds 40 8.2
161gb|AC159030.2| Pan troglodytes BAC clone CH251-399F13 from chrom... 40 8.2
162ref|XM_536038.2| PREDICTED: Canis familiaris similar to Amyotrop... 40 8.2
163gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome... 40 8.2
164ref|XM_980207.1| PREDICTED: Mus musculus hypothetical protein LO... 40 8.2
165gb|AC122535.3| Mus musculus BAC clone RP24-539K4 from chromosome... 40 8.2
166ref|XM_976944.1| PREDICTED: Mus musculus hypothetical protein LO... 40 8.2
167gb|AC113542.13| Mus musculus chromosome 5, clone RP23-195A18, co... 40 8.2
168ref|XM_001002052.1| PREDICTED: Mus musculus gamma-aminobutyric a... 40 8.2
169ref|XM_001002044.1| PREDICTED: Mus musculus gamma-aminobutyric a... 40 8.2
170gb|AC140382.3| Mus musculus BAC clone RP24-86A10 from chromosome... 40 8.2
171gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome... 40 8.2
172gb|AC143328.4| Mus musculus BAC clone RP24-119E16 from chromosom... 40 8.2
173gb|AC135594.4| Oryza sativa chromosome 3 BAC OSJNBa0024F18 genom... 40 8.2
174gb|AC122243.3| Mus musculus BAC clone RP23-148C10 from chromosom... 40 8.2
175gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome... 40 8.2
176emb|CT025566.7| Mouse DNA sequence from clone RP24-151A22 on chr... 40 8.2
177ref|XM_540887.2| PREDICTED: Canis familiaris similar to UNC-112 ... 40 8.2
178emb|AJ606051.1| Geum urbanum microsatellite DNA, clone WGU 8-1 40 8.2
179emb|AJ007903.1|NTA7903 Nicotiana tabacum DNA adjacent to H9NP T-... 40 8.2
180gb|AC091519.16| Mus musculus strain 129/SvJ chromosome 2 clone m... 40 8.2
181gb|AC123945.4| Mus musculus BAC clone RP24-87G13 from chromosome... 40 8.2
182gb|AC128700.4| Mus musculus BAC clone RP24-130A20 from chromosom... 40 8.2
183gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome... 40 8.2
184gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosom... 40 8.2
185gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosom... 40 8.2
186gb|AC125087.2| Mus musculus BAC clone RP24-143E18 from chromosom... 40 8.2
187gb|AC122929.4| Mus musculus BAC clone RP23-12A18 from chromosome... 40 8.2
188gb|AC122930.4| Mus musculus BAC clone RP23-13L19 from chromosome... 40 8.2
189gb|AC127594.3| Mus musculus BAC clone RP23-44G8 from chromosome ... 40 8.2
190gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosom... 40 8.2
191emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete ch... 40 8.2
192gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC... 40 8.2
193gb|BC010699.1| Homo sapiens bromodomain containing 3, mRNA (cDNA... 40 8.2
194gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, com... 40 8.2
195ref|XM_859950.1| PREDICTED: Canis familiaris hypothetical protei... 40 8.2
196gb|AC131787.3| Mus musculus BAC clone RP24-397K14 from chromosom... 40 8.2
197gb|AC130205.3| Mus musculus BAC clone RP24-430C1 from chromosome... 40 8.2
198gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosom... 40 8.2
199gb|AC122056.4| Mus musculus BAC clone RP24-466A3 from chromosome... 40 8.2
200gb|AC124411.5| Mus musculus BAC clone RP24-267C20 from chromosom... 40 8.2
201gb|AC123853.2| Mus musculus BAC clone RP23-326J1 from chromosome... 40 8.2
202gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosom... 40 8.2
203gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosom... 40 8.2
204gb|AC124775.4| Mus musculus BAC clone RP23-60N3 from 7, complete... 40 8.2
205gb|AC117197.3| Mus musculus BAC clone RP23-127A21 from 16, compl... 40 8.2
206gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, comple... 40 8.2
207gb|AC122196.2| Mus musculus BAC clone RP23-50P5 from 5, complete... 40 8.2
208gb|BC044975.1| Xenopus laevis nuclear receptor subfamily 2, grou... 40 8.2
209gb|AC112680.12| Mus musculus chromosome 9, clone RP23-203D1, com... 40 8.2
210gb|AC015983.7| Homo sapiens BAC clone RP11-560I19 from 7, comple... 40 8.2
211gb|BC032124.2| Homo sapiens bromodomain containing 3, mRNA (cDNA... 40 8.2
212gb|AC109619.11| Mus musculus chromosome 19, clone RP23-427F6, co... 40 8.2
213gb|AC112990.7| Mus musculus chromosome 19, clone RP24-317E20, co... 40 8.2
214gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 40 8.2
215gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, com... 40 8.2
216gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, comp... 40 8.2
217gb|AC131116.3| Mus musculus BAC clone RP24-344M21 from chromosom... 40 8.2
218gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare str... 40 8.2
219emb|CR855377.7| Zebrafish DNA sequence from clone DKEY-263F15 in... 40 8.2
220gb|AC164616.4| Mus musculus BAC clone RP23-322A5 from chromosome... 40 8.2
221gb|AC175492.4| Mus musculus BAC clone RP24-76P21 from chromosome... 40 8.2
222emb|AL592548.10| Human DNA sequence from clone RP4-654J19 on chr... 40 8.2
223emb|AL591862.5| Human DNA sequence from clone RP11-287J1 on chro... 40 8.2
224emb|AL591850.4| Human DNA sequence from clone RP11-113N4 on chro... 40 8.2
225emb|AL451062.12| Human DNA sequence from clone RP11-184I16 on ch... 40 8.2
226emb|AL513548.8| Human DNA sequence from clone RP11-457M11 on chr... 40 8.2
227emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on ch... 40 8.2
228ref|XM_500908.1| Yarrowia lipolytica CLIB122, YALI0B14971g predi... 40 8.2
229gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 40 8.2
230gb|BT009926.1| Drosophila melanogaster SD26153 full insert cDNA 40 8.2
231ref|NM_001004193.2| Mus musculus reproductive homeobox 8 (Rhox8)... 40 8.2
232gb|AC111321.8| Rattus norvegicus 4 BAC CH230-241A9 (Children's H... 40 8.2
233emb|AL158175.7| Human DNA sequence from clone RP11-359G22 on chr... 40 8.2
234gb|AC105339.9| Homo sapiens chromosome 15, clone RP11-752G15, co... 40 8.2
235emb|AL138773.5| Human DNA sequence from clone RP4-660B20 on chro... 40 8.2
236gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, co... 40 8.2
237emb|AL121959.15|HSDJ78N10 Human DNA sequence from clone RP1-78N1... 40 8.2
238emb|AL031727.43|HS1056L3 Human DNA sequence from clone RP5-1056L... 40 8.2
239gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, com... 40 8.2
240gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, comp... 40 8.2
241emb|AL034348.5|HS84D21 Human DNA sequence from clone RP1-84D21 o... 40 8.2
242gb|AC109707.5| Rattus norvegicus 13 BAC CH230-157O1 (Children's ... 40 8.2
243ref|XM_968414.1| PREDICTED: Tribolium castaneum similar to CG460... 40 8.2
244gb|AC095504.7| Rattus norvegicus 2 BAC CH230-7P18 (Children's Ho... 40 8.2
245gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
246ref|XM_794851.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 8.2
247gb|AY063107.1| Arabidopsis thaliana unknown protein (At3g04550) ... 40 8.2
248gb|AY034914.1| Arabidopsis thaliana unknown protein (At3g04550) ... 40 8.2
249emb|CR858411.1| Pongo pygmaeus mRNA; cDNA DKFZp459M1226 (from cl... 40 8.2
250gb|AC163098.4| Mus musculus chromosome 19, clone RP23-262J17, co... 40 8.2
251gb|AC091158.11| Mus musculus Strain C57BL6/J chromosome 6 BAC, R... 40 8.2
252emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS... 40 8.2
253gb|AC157572.4| Mus musculus BAC clone RP23-79O10 from chromosome... 40 8.2
254gb|AC155261.3| Mus musculus BAC clone RP24-66D10 from chromosome... 40 8.2
255gb|AC006454.4| Homo sapiens PAC clone RP5-852P6 from 7, complete... 40 8.2
256gb|AC090574.6| Homo sapiens chromosome 8, clone RP11-449M6, comp... 40 8.2
257gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome ... 40 8.2
258gb|AC139238.5| Mus musculus BAC clone RP24-403G3 from chromosome... 40 8.2
259gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromoso... 40 8.2
260emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete ... 40 8.2
261emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chr... 40 8.2
262emb|AL161501.2|ATCHRIV13 Arabidopsis thaliana DNA chromosome 4, ... 40 8.2
263gb|AC159821.2| Mus musculus BAC clone RP23-152A3 from chromosome... 40 8.2
264gb|AC162913.3| Mus musculus BAC clone RP24-409P22 from chromosom... 40 8.2
265emb|AL670928.7| Mouse DNA sequence from clone RP23-459G6 on chro... 40 8.2
266emb|AL645566.15| Mouse DNA sequence from clone RP23-398M13 on ch... 40 8.2
267emb|AL669857.7| Mouse DNA sequence from clone RP23-291B8 on chro... 40 8.2
268emb|AL669823.7| Mouse DNA sequence from clone RP23-456O1 on chro... 40 8.2
269emb|AL672018.6| Mouse DNA sequence from clone RP23-365O24 on chr... 40 8.2
270emb|AL663060.6| Mouse DNA sequence from clone RP23-239H6 on chro... 40 8.2
271emb|BX276104.14| Mouse DNA sequence from clone RP24-313E3 on chr... 40 8.2
272emb|AL589722.17| Mouse DNA sequence from clone RP23-169M24 on ch... 40 8.2
273emb|AL591611.8| Mouse DNA sequence from clone RP23-228D6 on chro... 40 8.2
274gb|AY513270.1| Homo sapiens endothelial differentiation inhibito... 40 8.2
275gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig co... 40 8.2
276emb|AL590629.16| Mouse DNA sequence from clone RP23-202F23 on ch... 40 8.2
277gb|AC157351.11| Mus musculus chromosome 5, clone RP23-219K16, co... 40 8.2
278gb|AC044792.6| Homo sapiens chromosome 19 clone CTC-258N23, comp... 40 8.2
279gb|AC103540.5| Homo sapiens BAC clone RP11-290F5 from 4, complet... 40 8.2
280emb|AJ582224.1|PTE582224 Paramecium tetraurelia macronuclear nd1... 40 8.2
281gb|AY114629.1| Arabidopsis thaliana unknown protein (At3g04550) ... 40 8.2
282gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence 40 8.2
283gb|AC087726.36| Chlamydomonas reinhardtii clone cr-40a20, comple... 40 8.2
284gb|AC090433.10| Chlamydomonas reinhardtii clone cr-19b23, comple... 40 8.2
285gb|AC079766.7| Homo sapiens BAC clone RP11-188P17 from 4, comple... 40 8.2
286gb|AC067744.6| Homo sapiens chromosome 10 clone RP11-422O6, comp... 40 8.2
287gb|AC103691.2| Homo sapiens chromosome 15, clone RP11-959H21, co... 40 8.2
288gb|AC098936.2| Homo sapiens chromosome 1 clone RP11-576D8, compl... 40 8.2
289dbj|AP007175.1| Aspergillus oryzae RIB40 genomic DNA, SC010 40 8.2
290dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 8.2
291gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 40 8.2
292gb|AC002505.3| Arabidopsis thaliana chromosome 2 clone T9J22 map... 40 8.2
293gb|AC011328.11| Homo sapiens chromosome 10 clone RP11-295O23, co... 40 8.2
294gb|AC113167.2| Homo sapiens chromosome 5 clone CTC-529J12, compl... 40 8.2
295gb|AC023772.22| Homo sapiens chromosome 4, clone RP11-634F16, co... 40 8.2
296gb|AC103409.2| Homo sapiens chromosome 8, clone RP11-1107H4, com... 40 8.2
297gb|AC078917.14| Homo sapiens 12q BAC RP1-78O14 (Roswell Park Can... 40 8.2
298dbj|AK138104.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 40 8.2
299dbj|AK142912.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 40 8.2
300dbj|AK149737.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 40 8.2
301gb|AC098819.3| Homo sapiens chromosome 4 clone RP11-181O2, compl... 40 8.2
302gb|AY062440.1| Arabidopsis thaliana Unknown protein (At3g04550; ... 40 8.2
303gb|AC174641.3| Mus musculus BAC clone RP24-406C15 from chromosom... 40 8.2
304dbj|AK169682.1| Mus musculus 2 days neonate thymus thymic cells ... 40 8.2
305dbj|AK158357.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 8.2
306dbj|AK157476.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 8.2
307gb|AC092018.2| Homo sapiens chromosome 1 clone RP11-543G21, comp... 40 8.2
308ref|NM_001024290.1| Rattus norvegicus similar to Galactose-3-O-s... 40 8.2
309gb|AC103367.11| Mus musculus chromosome 18, clone RP24-127F15, c... 40 8.2
310gb|AC159378.8| Mus musculus 10 BAC RP23-199N18 (Roswell Park Can... 40 8.2
311gb|AC162390.6| Mus musculus 6 BAC RP23-233J7 (Roswell Park Cance... 40 8.2
312gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 40 8.2
313gb|AC152161.4| Mus musculus chromosome 19, clone RP23-162O21, co... 40 8.2
314emb|AL929441.37| Mouse DNA sequence from clone RP23-418E20 on ch... 40 8.2
315gb|AC008880.6| Homo sapiens chromosome 5 clone CTD-2210P10, comp... 40 8.2
316gb|AC157548.7| Mus musculus chromosome 18, clone RP24-310H1, com... 40 8.2
317gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 8.2
318gb|AC016613.7| Homo sapiens chromosome 5 clone CTD-2207L2, compl... 40 8.2
319dbj|AK046953.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 8.2
320gb|AC140419.8| Mus musculus BAC clone RP24-435P9 from chromosome... 40 8.2
321gb|AC118192.13| Mus musculus chromosome 1, clone RP23-200C17, co... 40 8.2
322dbj|AK080322.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 8.2
323gb|AC113295.5| Mus musculus chromosome 5, clone RP23-424M12, com... 40 8.2
324gb|AC055716.24|AC055716 Homo sapiens 12 BAC RP11-641A6 (Roswell ... 40 8.2
325gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 8.2
326gb|AC175393.3| Mus musculus BAC clone RP24-37L23 from chromosome... 40 8.2
327dbj|AK090332.1| Mus musculus adult male accessory axillary lymph... 40 8.2
328gb|AC117816.11| Mus musculus chromosome 19, clone RP24-573C13, c... 40 8.2
329gb|DQ058645.1| Mus musculus reproductive homeobox on X chromosom... 40 8.2
330gb|BC088357.1| Homo sapiens dCMP deaminase, transcript variant 1... 40 8.2
331gb|BC094516.1| Rattus norvegicus similar to Galactose-3-O-sulfot... 40 8.2
332dbj|AK048165.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 8.2
333gb|AC159468.4| Mus musculus 10 BAC RP23-335A3 (Roswell Park Canc... 40 8.2
334gb|AC160413.4| Mus musculus 10 BAC RP24-472F16 (Roswell Park Can... 40 8.2
335gb|AC158679.8| Mus musculus 6 BAC RP23-345O17 (Roswell Park Canc... 40 8.2
336gb|AC155948.12| Mus musculus 6 BAC RP24-98H19 (Roswell Park Canc... 40 8.2
337gb|AC110556.15| Mus musculus chromosome 5, clone RP23-250G21, co... 40 8.2
338emb|BX813330.7| Mouse DNA sequence from clone RP23-11C16 on chro... 40 8.2
339gb|AC020971.3|AC020971 Mus musculus chromosome 18 clone RP23-56B... 40 8.2
340dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
341dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
342dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
343dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
344dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
345dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
346gb|AC083909.20|AC083909 Mus musculus 1 BAC RP23-424A2 (Roswell P... 40 8.2
347gb|AF265361.1|AF265361 Toxoplasma gondii glyceraldehyde-3-phosph... 40 8.2
348gb|AC109617.11| Mus musculus chromosome 15, clone RP24-360D1, co... 40 8.2
349gb|AC079080.5| Homo sapiens BAC clone RP11-162O12 from 4, comple... 40 8.2
350gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 40 8.2
351gb|AC119867.11| Mus musculus chromosome 1, clone RP23-411L6, com... 40 8.2
352gb|AC096758.3| Homo sapiens BAC clone RP11-560J23 from 2, comple... 40 8.2
353gb|AC093524.4| Homo sapiens chromosome 16 clone RP11-185O21, com... 40 8.2
354gb|AC012070.8| Homo sapiens BAC clone RP11-318K6 from 2, complet... 40 8.2
355gb|AC084797.5| Homo sapiens chromosome 16 clone RP11-62O3, compl... 40 8.2
356gb|AC116330.2| Dictyostelium discoideum chromosome 2 map 3191214... 40 8.2
357gb|AC011361.4|AC011361 Homo sapiens chromosome 5 clone CTC-482N1... 40 8.2
358gb|AY553205.1| Rhabdosargus sarba sodium potassium ATPase alpha ... 40 8.2
359gb|AC084625.1|CBRG45C19 Caenorhabditis briggsae cosmid G45C19, c... 40 8.2
360gb|AC084574.1|CBRG39L17 Caenorhabditis briggsae cosmid G39L17, c... 40 8.2
361gb|AC084543.1|CBRG28M02 Caenorhabditis briggsae cosmid G28M02, c... 40 8.2
362gb|AF233653.1|AF233653 Poecilimon hoelzeli microsatellite PhM68 40 8.2
363gb|AC016961.28| Homo sapiens 3 BAC RP11-394J21 (Roswell Park Can... 40 8.2
364gb|AC137492.2| Homo sapiens chromosome 16 clone LA16c-379F6, com... 40 8.2
365gb|AC004950.2|AC004950 Homo sapiens PAC clone RP5-1019E5 from CH... 40 8.2
366gb|AC005186.3| Homo sapiens 12 PAC RP5-916L7 (Roswell Park Cance... 40 8.2
367gb|AC092725.3| Homo sapiens chromosome 16 clone RP11-673P17, com... 40 8.2
368gb|AC091059.12| Homo sapiens chromosome 17, clone RP11-567L7, co... 40 8.2
369gb|AC022224.22|AC022224 Homo sapiens 12p BAC RP11-248B13 (Roswel... 40 8.2
370gb|AC092127.3| Homo sapiens chromosome 16 clone RP11-118F19, com... 40 8.2
371gb|AC142168.3| Mus musculus BAC clone RP24-80B23 from chromosome... 40 8.2
372dbj|AP005739.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
373dbj|AP006155.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
374dbj|AP006344.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
375dbj|AP006343.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
376dbj|AP004022.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
377dbj|AP005069.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
378dbj|BS000126.1| Pan troglodytes chromosome 22 clone:PTB-128A24, ... 40 8.2
379emb|AL935144.11| Zebrafish DNA sequence from clone CH211-89B14 i... 40 8.2
380emb|BX322656.11| Mouse DNA sequence from clone RP23-146D13 on ch... 40 8.2
381emb|BX005298.9| Mouse DNA sequence from clone RP23-261D24 on chr... 40 8.2
382dbj|D26362.1|HUMORFX Homo sapiens KIAA0043 mRNA, partial cds 40 8.2
383gb|AC158408.1| Mus musculus 10 BAC RP24-145P9 (Roswell Park Canc... 40 8.2
384dbj|AK110504.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
385dbj|AK100058.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
386ref|NM_211738.1| Eremothecium gossypii AGR011Wp (AGR011W), mRNA 40 8.2
387gb|AF466203.1| Zea mays clone ZMBBb_0092E12, partial sequence 40 8.2
388gb|BC032204.1| Mus musculus cDNA sequence BC032204, mRNA (cDNA c... 40 8.2
389gb|AC140071.4| Mus musculus BAC clone RP23-394K8 from 3, complet... 40 8.2
390gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, comple... 40 8.2
391gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, co... 40 8.2
392gb|AC137976.13| Mus musculus chromosome 8, clone RP23-262K12, co... 40 8.2
393gb|AC111037.8| Mus musculus chromosome 5, clone RP24-299M10, com... 40 8.2
394gb|AC153555.5| Mus musculus 10 BAC RP23-193J20 (Roswell Park Can... 40 8.2
395emb|CT485616.11| Mouse DNA sequence from clone RP23-14H16 on chr... 40 8.2
396gb|AF149414.1|T19J18 Arabidopsis thaliana BAC T19J18 40 8.2
397gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 8.2
398gb|AC120429.6| Mus musculus chromosome 18, clone RP24-546J19, co... 40 8.2
399gb|AC158911.7| Mus musculus chromosome 5, clone RP24-363D4, comp... 40 8.2
400emb|CT030245.8| M.truncatula DNA sequence from clone MTH2-59B18 ... 40 8.2
401dbj|AP001709.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.2
402gb|AC099713.5| Mus musculus chromosome 15, clone RP23-447B6, com... 40 8.2
403gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, co... 40 8.2
404gb|AC110206.21| Mus musculus chromosome 19, clone RP23-155H17, c... 40 8.2
405gb|AY522334.1| Clostridium difficile phage phiC2 isolate 1.6 hyp... 40 8.2
406gb|AC108782.9| Mus musculus chromosome 8, clone RP23-350C11, com... 40 8.2
407gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, com... 40 8.2
408gb|AC146916.3| Rattus norvegicus strain Brown Norway clone CH230... 40 8.2
409dbj|AB081564.1| Paralichthys olivaceus TCRJd-Cd2-S gene for T ce... 40 8.2
410dbj|AB081562.1| Paralichthys olivaceus TCRJd-Cd1 gene for T cell... 40 8.2
411gb|AC166165.3| Mus musculus BAC clone RP23-381I17 from chromosom... 40 8.2
412gb|DQ180310.1| Fragaria x ananassa clone PBCESTFXA5 SSR marker 40 8.2
413dbj|AP002982.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 8.2
414gb|AY094605.1| Mus musculus putative transcription factor foxl2 ... 40 8.2
415gb|AC174647.2| Mus musculus BAC clone RP23-25C24 from chromosome... 40 8.2
416emb|CT571243.9| Mouse DNA sequence from clone RP23-122I21 on chr... 40 8.2
417emb|AL772179.17| Mouse DNA sequence from clone RP23-100B18 on ch... 40 8.2
418gb|AC158359.2| Mus musculus BAC clone RP23-412H3 from chromosome... 40 8.2
419gb|AC117797.9| Mus musculus chromosome 19, clone RP24-555M16, co... 40 8.2
420emb|AJ509747.1|AME509747 Apis mellifera microsatellite marker Am... 40 8.2
421gb|AC005667.1|AC005667 Homo sapiens chromosome 17, clone hRPK.32... 40 8.2
422emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chro... 40 8.2
423gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
424emb|AL807245.17| Mouse DNA sequence from clone RP23-102B2 on chr... 40 8.2
425gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
426gb|AC168063.3| Mus musculus BAC clone RP23-197G3 from chromosome... 40 8.2
427gb|AC154617.3| Mus musculus BAC clone RP23-319O17 from chromosom... 40 8.2
428gb|AC161039.6| Mus musculus chromosome 18, clone RP24-327J14, co... 40 8.2
429emb|BX294195.4| Mouse DNA sequence from clone RP23-59F2 on chrom... 40 8.2
430gb|AC005206.1|AC005206 Homo sapiens chromosome 17, clone hRPC.11... 40 8.2
431emb|AL731751.4|CNS08C80 Oryza sativa chromosome 12, . BAC OJ1510... 40 8.2
432gb|AC132372.4| Mus musculus BAC clone RP23-478B10 from 8, comple... 40 8.2
433gb|AC150745.2| Mus musculus BAC clone RP24-77E13 from 7, complet... 40 8.2
434gb|AC145610.4| Mus musculus BAC clone RP24-281O20 from 18, compl... 40 8.2
435gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complet... 40 8.2
436gb|AC122504.4| Mus musculus BAC clone RP24-419J13 from 9, comple... 40 8.2
437gb|AC140422.2| Mus musculus BAC clone RP24-445D5 from 3, complet... 40 8.2
438gb|AC141469.4| Mus musculus BAC clone RP24-439P5 from 5, complet... 40 8.2
439gb|AC136020.5| Mus musculus BAC clone RP24-434I13 from 12, compl... 40 8.2
440gb|AC147630.4| Mus musculus BAC clone RP24-530L22 from Y, comple... 40 8.2
441gb|AC147248.5| Mus musculus BAC clone RP24-83D19 from 1, complet... 40 8.2
442gb|AC133584.12| Mus musculus chromosome 5, clone RP24-448L9, com... 40 8.2
443ref|NM_153795.1| Mus musculus cDNA sequence BC032204 (BC032204),... 40 8.2
444gb|AC004073.1|AC004073 Human Chromosome X, complete sequence 40 8.2
445emb|CR974473.23| Mouse DNA sequence from clone RP23-38P5 on chro... 40 8.2
446emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chro... 40 8.2
447emb|BX897747.8| Zebrafish DNA sequence from clone DKEY-187J14 in... 40 8.2
448gb|AC002323.1|AC002323 Genomic sequence from Human 9q34, complet... 40 8.2
449gb|AC002105.1|AC002105 Genomic sequence from Human 9q34, complet... 40 8.2
450gb|AC000391.1|AC000391 Genomic sequence from Human 9q34, complet... 40 8.2
451emb|CT010583.8| Mouse DNA sequence from clone RP23-203B24 on chr... 40 8.2
452emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 8.2
453dbj|AP006384.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 8.2
454gb|AC160112.2| Mus musculus BAC clone RP24-80F17 from chromosome... 40 8.2
455emb|AL929001.7| Mouse DNA sequence from clone RP23-324H1 on chro... 40 8.2
456gb|AC171204.1| Mus musculus BAC clone RP23-312J21 from chromosom... 40 8.2
457emb|AL928662.5| Mouse DNA sequence from clone RP23-379M5 on chro... 40 8.2
458gb|AC171241.2| Mus musculus BAC clone RP23-94E5 from chromosome ... 40 8.2
459emb|AL136329.1|MM303011 Mus musculus chromosome X, clone RP21-30... 40 8.2
460emb|AL773549.5| Mouse DNA sequence from clone RP23-183A1 on chro... 40 8.2
461emb|AL670544.7| Mouse DNA sequence from clone RP23-16G8 on chrom... 40 8.2
462emb|AL691501.15| Mouse DNA sequence from clone RP23-220M11 on ch... 40 8.2
463emb|AL691448.24| Mouse DNA sequence from clone RP23-103A1 on chr... 40 8.2
464emb|AL606863.15| Mouse DNA sequence from clone RP23-37J4 on chro... 40 8.2
465emb|AL669872.8| Mouse DNA sequence from clone RP23-357D5 on chro... 40 8.2
466emb|AL513351.26| Mouse DNA sequence from clone RP23-122P5 on chr... 40 8.2
467emb|AL671882.6| Mouse DNA sequence from clone RP23-32C12 on chro... 40 8.2
468emb|AL671878.8| Mouse DNA sequence from clone RP23-184D5 on chro... 40 8.2
469gb|AC168046.7| Mus musculus chromosome 8, clone RP24-335A7, comp... 40 8.2
470gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, com... 40 8.2
471emb|Z81330.1|HSH2A1KLT Human DNA sequence from clone XX-H2A1KLT ... 40 8.2
472gb|AC162924.5| Mus musculus BAC clone RP23-292J21 from chromosom... 40 8.2
473gb|AC139856.12| Mus musculus chromosome 8, clone RP23-52J10, com... 40 8.2
474gb|AC104620.5| Homo sapiens BAC clone RP11-294O2 from 4, complet... 40 8.2
475gb|AC069509.16| Homo sapiens 3 BAC RP11-406M8 (Roswell Park Canc... 40 8.2
476dbj|AP000244.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 8.2
477dbj|AP000205.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 8.2
478dbj|AP003160.1| Homo sapiens genomic DNA, chromosome 1p36 clone:... 40 8.2
479dbj|AP003112.1| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 8.2
480emb|AL732623.7| Mouse DNA sequence from clone RP23-276F7 on chro... 40 8.2
481emb|AL669940.14| Mouse DNA sequence from clone RP23-214P11 on ch... 40 8.2
482emb|AL365324.12| Mouse DNA sequence from clone RP23-451H2 on chr... 40 8.2
483emb|AL592042.9| Mouse DNA sequence from clone RP23-380K13 on chr... 40 8.2

>gb|DQ442996.1| Triticum aestivum phosphomannomutase mRNA, complete cds
          Length = 750

 Score =  959 bits (484), Expect = 0.0
 Identities = 532/548 (97%)
 Strand = Plus / Plus

                                                                       
Query: 54  atggcggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctc 113
           |||||||||||| |||||  | |||||||||||||||||||||||||||||||||| |||
Sbjct: 1   atggcggcggcgaggaaggacgccggtgtgctcgcgctcttcgacgtcgacggcaccctc 60

                                                                       
Query: 114 accgcgccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgag 173
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 61  accgcgccccgcaaggaggtgacgccggagatgctcgagttcatgaagcgcctgcgcgag 120

                                                                       
Query: 174 aatgtgaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggc 233
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 121 aatgtgaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcagctcggc 180

                                                                       
Query: 234 aaatcagttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaag 293
           |||||||| ||||||||||| ||||||||||||||||||||||||||||| || ||||||
Sbjct: 181 aaatcagtcatcaccgactatgactacgtcttctccgagaacggcctggtcgcgcacaag 240

                                                                       
Query: 294 gacggcaagctcatcgggacgcaaagcttgaaaacgtatcttggagatgaccagcttaag 353
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 241 gacggcaagctcatcgggacgcagagcttgaaaacgtatcttggagatgaccagcttaag 300

                                                                       
Query: 354 gaattcattaacttcactcttcattacattgcggacttggatatcccaattaaaaggggt 413
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 301 gaattcattaacttcactcttcattacatcgcggatttggatatcccaattaaaaggggt 360

                                                                       
Query: 414 acattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaactgtagt 473
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 361 acattcatagagttcaggagtggaatgatcaatgtgtcgcctatagggaggaactgtagt 420

                                                                       
Query: 474 caagaagaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatg 533
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 caagaagaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatg 480

                                                                       
Query: 534 gtgtcagtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattggagggcag 593
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 481 gtgtcagtgcttcgtgaaaagtttgcacacctgaacctgactttttctattggagggcag 540

                   
Query: 594 atcagttt 601
           ||||||||
Sbjct: 541 atcagttt 548



to top

>ref|XM_474395.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 747

 Score =  553 bits (279), Expect = e-154
 Identities = 477/543 (87%)
 Strand = Plus / Plus

                                                                       
Query: 59  ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
           ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 3   ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 62

                                                                       
Query: 119 gccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgagaatgt 178
           ||||||||||| ||||||||||||||||||| | ||||||||||  ||||||||| ||||
Sbjct: 63  gccccgcaaggtggtgacgccggagatgctccagttcatgaagcagctgcgcgagcatgt 122

                                                                       
Query: 179 gaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatc 238
            || || |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 123 cactgtgggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatc 182

                                                                       
Query: 239 agttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaaggacgg 298
           |||||  || || ||||| |||  |||||| || || |||||||| || |||||| ||||
Sbjct: 183 agttactactgattacgattactgcttctctgaaaatggcctggtcgcgcacaagaacgg 242

                                                                       
Query: 299 caagctcatcgggacgcaaagcttgaaaacgtatcttggagatgaccagcttaaggaatt 358
           | | ||||| || || ||||| |||||| ||| |||||||||||| ||||| ||||||||
Sbjct: 243 cgaactcattggaactcaaagtttgaaatcgtttcttggagatgatcagctaaaggaatt 302

                                                                       
Query: 359 cattaacttcactcttcattacattgcggacttggatatcccaattaaaaggggtacatt 418
            ||||||||||| |||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 303 tattaacttcacgcttcattacattgctgacttggacatcccaatcaaaaggggtacatt 362

                                                                       
Query: 419 catagagttcaggagtggaatgatcaatgtgtcacctatagggaggaactgtagtcaaga 478
           |||||||||| | ||||||||| | |||||||| || |||||||| || |||||||||||
Sbjct: 363 catagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaattgtagtcaaga 422

                                                                       
Query: 479 agaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatggtgtc 538
           |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 423 agaacgtgatgagtttgaaaagtatgataaggtacataacattcggcctaaaatggtctc 482

                                                                       
Query: 539 agtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattggagggcagatcag 598
           |||||||||||||||||| || ||| ||||| |||| |||||||||||||||||||| ||
Sbjct: 483 agtgcttcgtgaaaagttcgcccacttgaacttgacattttctattggagggcagattag 542

              
Query: 599 ttt 601
           |||
Sbjct: 543 ttt 545



to top

>gb|DQ442992.1| Oryza sativa (japonica cultivar-group) phosphomannomutase mRNA,
           complete cds
          Length = 747

 Score =  553 bits (279), Expect = e-154
 Identities = 477/543 (87%)
 Strand = Plus / Plus

                                                                       
Query: 59  ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
           ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 3   ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 62

                                                                       
Query: 119 gccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgagaatgt 178
           ||||||||||| ||||||||||||||||||| | ||||||||||  ||||||||| ||||
Sbjct: 63  gccccgcaaggtggtgacgccggagatgctccagttcatgaagcagctgcgcgagcatgt 122

                                                                       
Query: 179 gaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatc 238
            || || |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 123 cactgtgggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatc 182

                                                                       
Query: 239 agttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaaggacgg 298
           |||||  || || ||||| |||  |||||| || || |||||||| || |||||| ||||
Sbjct: 183 agttactactgattacgattactgcttctctgaaaatggcctggtcgcgcacaagaacgg 242

                                                                       
Query: 299 caagctcatcgggacgcaaagcttgaaaacgtatcttggagatgaccagcttaaggaatt 358
           | | ||||| || || ||||| |||||| ||| |||||||||||| ||||| ||||||||
Sbjct: 243 cgaactcattggaactcaaagtttgaaatcgtttcttggagatgatcagctaaaggaatt 302

                                                                       
Query: 359 cattaacttcactcttcattacattgcggacttggatatcccaattaaaaggggtacatt 418
            ||||||||||| |||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 303 tattaacttcacgcttcattacattgctgacttggacatcccaatcaaaaggggtacatt 362

                                                                       
Query: 419 catagagttcaggagtggaatgatcaatgtgtcacctatagggaggaactgtagtcaaga 478
           |||||||||| | ||||||||| | |||||||| || |||||||| || |||||||||||
Sbjct: 363 catagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaattgtagtcaaga 422

                                                                       
Query: 479 agaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatggtgtc 538
           |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 423 agaacgtgatgagtttgaaaagtatgataaggtacataacattcggcctaaaatggtctc 482

                                                                       
Query: 539 agtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattggagggcagatcag 598
           |||||||||||||||||| || ||| ||||| |||| |||||||||||||||||||| ||
Sbjct: 483 agtgcttcgtgaaaagttcgcccacttgaacttgacattttctattggagggcagattag 542

              
Query: 599 ttt 601
           |||
Sbjct: 543 ttt 545



to top

>dbj|AK104004.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-C04, full
           insert sequence
          Length = 1190

 Score =  553 bits (279), Expect = e-154
 Identities = 477/543 (87%)
 Strand = Plus / Plus

                                                                       
Query: 59  ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
           ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 272 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 331

                                                                       
Query: 119 gccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgagaatgt 178
           ||||||||||| ||||||||||||||||||| | ||||||||||  ||||||||| ||||
Sbjct: 332 gccccgcaaggtggtgacgccggagatgctccagttcatgaagcagctgcgcgagcatgt 391

                                                                       
Query: 179 gaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatc 238
            || || |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 392 cactgtgggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatc 451

                                                                       
Query: 239 agttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaaggacgg 298
           |||||  || || ||||| |||  |||||| || || |||||||| || |||||| ||||
Sbjct: 452 agttactactgattacgattactgcttctctgaaaatggcctggtcgcgcacaagaacgg 511

                                                                       
Query: 299 caagctcatcgggacgcaaagcttgaaaacgtatcttggagatgaccagcttaaggaatt 358
           | | ||||| || || ||||| |||||| ||| |||||||||||| ||||| ||||||||
Sbjct: 512 cgaactcattggaactcaaagtttgaaatcgtttcttggagatgatcagctaaaggaatt 571

                                                                       
Query: 359 cattaacttcactcttcattacattgcggacttggatatcccaattaaaaggggtacatt 418
            ||||||||||| |||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 572 tattaacttcacgcttcattacattgctgacttggacatcccaatcaaaaggggtacatt 631

                                                                       
Query: 419 catagagttcaggagtggaatgatcaatgtgtcacctatagggaggaactgtagtcaaga 478
           |||||||||| | ||||||||| | |||||||| || |||||||| || |||||||||||
Sbjct: 632 catagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaattgtagtcaaga 691

                                                                       
Query: 479 agaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatggtgtc 538
           |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 692 agaacgtgatgagtttgaaaagtatgataaggtacataacattcggcctaaaatggtctc 751

                                                                       
Query: 539 agtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattggagggcagatcag 598
           |||||||||||||||||| || ||| ||||| |||| |||||||||||||||||||| ||
Sbjct: 752 agtgcttcgtgaaaagttcgcccacttgaacttgacattttctattggagggcagattag 811

              
Query: 599 ttt 601
           |||
Sbjct: 812 ttt 814



to top

>dbj|AK061384.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-H09, full
           insert sequence
          Length = 1232

 Score =  553 bits (279), Expect = e-154
 Identities = 477/543 (87%)
 Strand = Plus / Plus

                                                                       
Query: 59  ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
           ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 307 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 366

                                                                       
Query: 119 gccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgagaatgt 178
           ||||||||||| ||||||||||||||||||| | ||||||||||  ||||||||| ||||
Sbjct: 367 gccccgcaaggtggtgacgccggagatgctccagttcatgaagcagctgcgcgagcatgt 426

                                                                       
Query: 179 gaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatc 238
            || || |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 427 cactgtgggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatc 486

                                                                       
Query: 239 agttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaaggacgg 298
           |||||  || || ||||| |||  |||||| || || |||||||| || |||||| ||||
Sbjct: 487 agttactactgattacgattactgcttctctgaaaatggcctggtcgcgcacaagaacgg 546

                                                                       
Query: 299 caagctcatcgggacgcaaagcttgaaaacgtatcttggagatgaccagcttaaggaatt 358
           | | ||||| || || ||||| |||||| ||| |||||||||||| ||||| ||||||||
Sbjct: 547 cgaactcattggaactcaaagtttgaaatcgtttcttggagatgatcagctaaaggaatt 606

                                                                       
Query: 359 cattaacttcactcttcattacattgcggacttggatatcccaattaaaaggggtacatt 418
            ||||||||||| |||||||||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 607 tattaacttcacgcttcattacattgctgacttggacatcccaatcaaaaggggtacatt 666

                                                                       
Query: 419 catagagttcaggagtggaatgatcaatgtgtcacctatagggaggaactgtagtcaaga 478
           |||||||||| | ||||||||| | |||||||| || |||||||| || |||||||||||
Sbjct: 667 catagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaattgtagtcaaga 726

                                                                       
Query: 479 agaacgtgatgattttgagaagtatgataaggtacataacgttcggcctaaaatggtgtc 538
           |||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 727 agaacgtgatgagtttgaaaagtatgataaggtacataacattcggcctaaaatggtctc 786

                                                                       
Query: 539 agtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattggagggcagatcag 598
           |||||||||||||||||| || ||| ||||| |||| |||||||||||||||||||| ||
Sbjct: 787 agtgcttcgtgaaaagttcgcccacttgaacttgacattttctattggagggcagattag 846

              
Query: 599 ttt 601
           |||
Sbjct: 847 ttt 849



to top

>gb|AY105630.1| Zea mays PCO073836 mRNA sequence
          Length = 1305

 Score =  488 bits (246), Expect = e-134
 Identities = 450/518 (86%)
 Strand = Plus / Plus

                                                                       
Query: 84  ctcgcgctcttcgacgtcgacggcacgctcaccgcgccccgcaaggaggtgacgccggag 143
           |||||||||||||||||||||||||| ||||| ||||| ||||||| ||||||||| |||
Sbjct: 260 ctcgcgctcttcgacgtcgacggcaccctcacagcgccgcgcaagggggtgacgccagag 319

                                                                       
Query: 144 atgctcgacttcatgaagcgcctgcgcgagaatgtgaccgtcggcgtggtggggggatcc 203
           ||||| || ||||||||||  |||||| || ||||||| || |||||||| || ||||||
Sbjct: 320 atgctagagttcatgaagcagctgcgccagcatgtgacagtgggcgtggttggcggatcc 379

                                                                       
Query: 204 gatctggtcaagatctccgagcaactcggcaaatcagttatcaccgactacgactacgtc 263
           |||||||| |||||  ||||||| |||||||   ||||||| || || || || ||||||
Sbjct: 380 gatctggtgaagattaccgagcagctcggcagtacagttattactgattatgattacgtc 439

                                                                       
Query: 264 ttctccgagaacggcctggttgcacacaaggacggcaagctcatcgggacgcaaagcttg 323
           |||||||| ||||||||||||||||||||  | ||| | || || || || ||||| |||
Sbjct: 440 ttctccgaaaacggcctggttgcacacaaaaatggccaactaattggaacccaaagtttg 499

                                                                       
Query: 324 aaaacgtatcttggagatgaccagcttaaggaattcattaacttcactcttcattacatt 383
           ||| | | | | ||||| ||| |||| |||||||| ||||||||||||||||||||||||
Sbjct: 500 aaatcatttatcggagaagacaagctgaaggaatttattaacttcactcttcattacatt 559

                                                                       
Query: 384 gcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtggaatgatc 443
           || |||||||||||||||||||||||||||||||||||||||||| | ||||||||||| 
Sbjct: 560 gctgacttggatatcccaattaaaaggggtacattcatagagttccgaagtggaatgatt 619

                                                                       
Query: 444 aatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgagaagtat 503
           ||||| || |||||||| || |||||||| ||||||||||| ||||| ||||||||||| 
Sbjct: 620 aatgtatctcctataggaagaaactgtagccaagaagaacgggatgaatttgagaagtac 679

                                                                       
Query: 504 gataaggtacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcacac 563
           |||||||| |||||| | || |||||||||||||||||||||||||||||||||||||||
Sbjct: 680 gataaggtgcataacatccgacctaaaatggtgtcagtgcttcgtgaaaagtttgcacac 739

                                                 
Query: 564 ctgaacctgaccttttctattggagggcagatcagttt 601
            ||||| |||| |||||||| ||||||||||| |||||
Sbjct: 740 atgaacttgacattttctatcggagggcagattagttt 777



to top

>dbj|AK073871.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033075F07, full
            insert sequence
          Length = 2028

 Score =  343 bits (173), Expect = 4e-91
 Identities = 254/281 (90%)
 Strand = Plus / Plus

                                                                        
Query: 321  ttgaaaacgtatcttggagatgaccagcttaaggaattcattaacttcactcttcattac 380
            |||||| ||| |||||||||||| ||||| |||||||| ||||||||||| |||||||||
Sbjct: 790  ttgaaatcgtttcttggagatgatcagctaaaggaatttattaacttcacgcttcattac 849

                                                                        
Query: 381  attgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtggaatg 440
            ||||| |||||||| |||||||| |||||||||||||||||||||||| | |||||||||
Sbjct: 850  attgctgacttggacatcccaatcaaaaggggtacattcatagagttccgaagtggaatg 909

                                                                        
Query: 441  atcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgagaag 500
             | |||||||| || |||||||| || ||||||||||||||||||||||| ||||| |||
Sbjct: 910  ctgaatgtgtcgcccatagggagaaattgtagtcaagaagaacgtgatgagtttgaaaag 969

                                                                        
Query: 501  tatgataaggtacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgca 560
            |||||||||||||||||| |||||||||||||||| |||||||||||||||||||| || 
Sbjct: 970  tatgataaggtacataacattcggcctaaaatggtctcagtgcttcgtgaaaagttcgcc 1029

                                                     
Query: 561  cacctgaacctgaccttttctattggagggcagatcagttt 601
            ||| ||||| |||| |||||||||||||||||||| |||||
Sbjct: 1030 cacttgaacttgacattttctattggagggcagattagttt 1070



 Score =  216 bits (109), Expect = 6e-53
 Identities = 208/241 (86%)
 Strand = Plus / Plus

                                                                       
Query: 59  ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
           ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 273 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 332

                                                                       
Query: 119 gccccgcaaggaggtgacgccggagatgctcgacttcatgaagcgcctgcgcgagaatgt 178
           ||||||||||| ||||||||||||||||||| | ||||||||||  ||||||||| ||||
Sbjct: 333 gccccgcaaggtggtgacgccggagatgctccagttcatgaagcagctgcgcgagcatgt 392

                                                                       
Query: 179 gaccgtcggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatc 238
            || || |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||
Sbjct: 393 cactgtgggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatc 452

                                                                       
Query: 239 agttatcaccgactacgactacgtcttctccgagaacggcctggttgcacacaaggacgg 298
           |||||  || || ||||| |||  |||||| || || |||||||| || |||||| ||||
Sbjct: 453 agttactactgattacgattactgcttctctgaaaatggcctggtcgcgcacaagaacgg 512

            
Query: 299 c 299
           |
Sbjct: 513 c 513



to top

>gb|DQ442995.1| Nicotiana tabacum phosphomannomutase mRNA, complete cds
          Length = 759

 Score =  194 bits (98), Expect = 2e-46
 Identities = 260/314 (82%)
 Strand = Plus / Plus

                                                                       
Query: 276 ggcctggttgcacacaaggacggcaagctcatcgggacgcaaagcttgaaaacgtatctt 335
           ||||| || ||||| ||||| |||||||| || || || || ||||||||  | | ||||
Sbjct: 217 ggccttgtagcacataaggatggcaagcttattggtacacagagcttgaagtcatttctt 276

                                                                       
Query: 336 ggagatgaccagcttaaggaattcattaacttcactcttcattacattgcggacttggat 395
           ||||| ||  |||| |||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 277 ggagacgagaagctcaaggaatttattaactttaccctccattacattgctgacttggat 336

                                                                       
Query: 396 atcccaattaaaaggggtacattcatagagttcaggagtggaatgatcaatgtgtcacct 455
           || ||||| || || || |||||||| |||||||| ||||| ||| | ||||| ||||||
Sbjct: 337 attccaataaagagaggaacattcattgagttcagaagtggcatgctaaatgtctcacct 396

                                                                       
Query: 456 atagggaggaactgtagtcaagaagaacgtgatgattttgagaagtatgataaggtacat 515
           ||||||||| |||||||||| |||||||||||||| |||||||||||||| |||||||| 
Sbjct: 397 atagggagggactgtagtcaggaagaacgtgatgaatttgagaagtatgacaaggtacac 456

                                                                       
Query: 516 aacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcacacctgaacctgacc 575
           ||  | || |  | |||||| || |||||  | ||||||||||||||||| ||||| |||
Sbjct: 457 aagatacgtcaaacaatggtatctgtgctcagagaaaagtttgcacaccttaacctcacc 516

                         
Query: 576 ttttctattggagg 589
           || || ||||||||
Sbjct: 517 ttctccattggagg 530



to top

>gb|DQ442993.1| Lycopersicon esculentum phosphomannomutase mRNA, complete cds
          Length = 759

 Score =  151 bits (76), Expect = 3e-33
 Identities = 193/232 (83%)
 Strand = Plus / Plus

                                                                       
Query: 331 atcttggagatgaccagcttaaggaattcattaacttcactcttcattacattgcggact 390
           |||||||||| ||  |||| |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 272 atcttggagacgagaagctcaaggaatttattaactttaccctccattacattgctgact 331

                                                                       
Query: 391 tggatatcccaattaaaaggggtacattcatagagttcaggagtggaatgatcaatgtgt 450
           ||||||| ||||| || || || |||||||| |||||||| ||||| ||| | |||||||
Sbjct: 332 tggatattccaataaagagaggaacattcattgagttcagaagtggcatgctaaatgtgt 391

                                                                       
Query: 451 cacctatagggaggaactgtagtcaagaagaacgtgatgattttgagaagtatgataagg 510
           | ||||| ||||| |||||||||||||||||| | ||||| ||||| |||||||| ||||
Sbjct: 392 cgcctattgggagaaactgtagtcaagaagaaagagatgaatttgaaaagtatgacaagg 451

                                                               
Query: 511 tacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcaca 562
           |||| ||  | ||    | |||||| ||||||||| | ||||||||||||||
Sbjct: 452 tacagaagatacgcgaaacaatggtatcagtgcttagagaaaagtttgcaca 503



to top

>gb|BT013289.1| Lycopersicon esculentum clone 134900R, mRNA sequence
          Length = 1302

 Score =  143 bits (72), Expect = 8e-31
 Identities = 153/180 (85%)
 Strand = Plus / Plus

                                                                       
Query: 331 atcttggagatgaccagcttaaggaattcattaacttcactcttcattacattgcggact 390
           |||||||||| ||  |||| |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 411 atcttggagacgagaagctcaaggaatttattaactttaccctccattacattgctgact 470

                                                                       
Query: 391 tggatatcccaattaaaaggggtacattcatagagttcaggagtggaatgatcaatgtgt 450
           ||||||| ||||| || || || ||||| || |||||||| ||||| ||| | |||||||
Sbjct: 471 tggatattccaataaagagaggaacatttattgagttcagaagtggcatgctaaatgtgt 530

                                                                       
Query: 451 cacctatagggaggaactgtagtcaagaagaacgtgatgattttgagaagtatgataagg 510
           | ||||| ||||| ||||||||||| |||||| | ||||| |||||||||||||||||||
Sbjct: 531 cgcctattgggagaaactgtagtcaggaagaaagggatgaatttgagaagtatgataagg 590



to top

>emb|AL606641.3|OSJN00074 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06,
             complete sequence
          Length = 148023

 Score =  133 bits (67), Expect = 7e-28
 Identities = 97/107 (90%)
 Strand = Plus / Plus

                                                                         
Query: 408   aggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaac 467
             ||||||||||||||||||||| | ||||||||| | |||||||| || |||||||| || 
Sbjct: 70927 aggggtacattcatagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaat 70986

                                                            
Query: 468   tgtagtcaagaagaacgtgatgattttgagaagtatgataaggtaca 514
             ||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 70987 tgtagtcaagaagaacgtgatgagtttgaaaagtatgataaggtaca 71033



 Score =  123 bits (62), Expect = 7e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                         
Query: 508   aggtacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcacacctga 567
             ||||||||||| |||||||||||||||| |||||||||||||||||||| || ||| |||
Sbjct: 71106 aggtacataacattcggcctaaaatggtctcagtgcttcgtgaaaagttcgcccacttga 71165

                                               
Query: 568   acctgaccttttctattggagggcagatcagttt 601
             || |||| |||||||||||||||||||| |||||
Sbjct: 71166 acttgacattttctattggagggcagattagttt 71199



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 65/71 (91%)
 Strand = Plus / Plus

                                                                         
Query: 59    ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
             ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 69806 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 69865

                        
Query: 119   gccccgcaagg 129
             |||||||||||
Sbjct: 69866 gccccgcaagg 69876



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                        
Query: 352   aggaattcattaacttcactcttcattacattgcggacttggatatcccaattaaaagg 410
             ||||||| ||||||||||| |||||||||||||| |||||||| |||||||| ||||||
Sbjct: 70798 aggaatttattaacttcacgcttcattacattgctgacttggacatcccaatcaaaagg 70856



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 186   ggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatcag 240
             |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||||
Sbjct: 70172 ggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatcag 70226



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                        
Query: 131   ggtgacgccggagatgctcgacttcatgaagcgcctgcgcgag 173
             ||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 70010 ggtgacgccggagatgctccagttcatgaagcagctgcgcgag 70052



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  133 bits (67), Expect = 7e-28
 Identities = 97/107 (90%)
 Strand = Plus / Plus

                                                                            
Query: 408      aggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaac 467
                ||||||||||||||||||||| | ||||||||| | |||||||| || |||||||| || 
Sbjct: 34864814 aggggtacattcatagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaat 34864873

                                                               
Query: 468      tgtagtcaagaagaacgtgatgattttgagaagtatgataaggtaca 514
                ||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 34864874 tgtagtcaagaagaacgtgatgagtttgaaaagtatgataaggtaca 34864920



 Score =  123 bits (62), Expect = 7e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                            
Query: 508      aggtacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcacacctga 567
                ||||||||||| |||||||||||||||| |||||||||||||||||||| || ||| |||
Sbjct: 34864993 aggtacataacattcggcctaaaatggtctcagtgcttcgtgaaaagttcgcccacttga 34865052

                                                  
Query: 568      acctgaccttttctattggagggcagatcagttt 601
                || |||| |||||||||||||||||||| |||||
Sbjct: 34865053 acttgacattttctattggagggcagattagttt 34865086



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 65/71 (91%)
 Strand = Plus / Plus

                                                                            
Query: 59       ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
                ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 34863693 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 34863752

                           
Query: 119      gccccgcaagg 129
                |||||||||||
Sbjct: 34863753 gccccgcaagg 34863763



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                           
Query: 352      aggaattcattaacttcactcttcattacattgcggacttggatatcccaattaaaagg 410
                ||||||| ||||||||||| |||||||||||||| |||||||| |||||||| ||||||
Sbjct: 34864685 aggaatttattaacttcacgcttcattacattgctgacttggacatcccaatcaaaagg 34864743



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                       
Query: 186      ggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatcag 240
                |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||||
Sbjct: 34864059 ggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatcag 34864113



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                           
Query: 131      ggtgacgccggagatgctcgacttcatgaagcgcctgcgcgag 173
                ||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 34863897 ggtgacgccggagatgctccagttcatgaagcagctgcgcgag 34863939



to top

>emb|AL732352.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0124B04, complete
             sequence
          Length = 115564

 Score =  133 bits (67), Expect = 7e-28
 Identities = 97/107 (90%)
 Strand = Plus / Plus

                                                                         
Query: 408   aggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaac 467
             ||||||||||||||||||||| | ||||||||| | |||||||| || |||||||| || 
Sbjct: 44452 aggggtacattcatagagttccgaagtggaatgctgaatgtgtcgcccatagggagaaat 44511

                                                            
Query: 468   tgtagtcaagaagaacgtgatgattttgagaagtatgataaggtaca 514
             ||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 44512 tgtagtcaagaagaacgtgatgagtttgaaaagtatgataaggtaca 44558



 Score =  123 bits (62), Expect = 7e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                         
Query: 508   aggtacataacgttcggcctaaaatggtgtcagtgcttcgtgaaaagtttgcacacctga 567
             ||||||||||| |||||||||||||||| |||||||||||||||||||| || ||| |||
Sbjct: 44631 aggtacataacattcggcctaaaatggtctcagtgcttcgtgaaaagttcgcccacttga 44690

                                               
Query: 568   acctgaccttttctattggagggcagatcagttt 601
             || |||| |||||||||||||||||||| |||||
Sbjct: 44691 acttgacattttctattggagggcagattagttt 44724



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 65/71 (91%)
 Strand = Plus / Plus

                                                                         
Query: 59    ggcggcggggaagagcaccggtgtgctcgcgctcttcgacgtcgacggcacgctcaccgc 118
             ||||||| ||||||   ||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 43332 ggcggcgaggaagaatgccggtgtcctcgcgctcttcgacgtcgacggcaccctcaccgc 43391

                        
Query: 119   gccccgcaagg 129
             |||||||||||
Sbjct: 43392 gccccgcaagg 43402



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                        
Query: 352   aggaattcattaacttcactcttcattacattgcggacttggatatcccaattaaaagg 410
             ||||||| ||||||||||| |||||||||||||| |||||||| |||||||| ||||||
Sbjct: 44323 aggaatttattaacttcacgcttcattacattgctgacttggacatcccaatcaaaagg 44381



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 186   ggcgtggtggggggatccgatctggtcaagatctccgagcaactcggcaaatcag 240
             |||||||| |||||||| |||||||| ||||| ||||| ||||||||||||||||
Sbjct: 43697 ggcgtggttgggggatctgatctggtgaagatttccgaacaactcggcaaatcag 43751



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                        
Query: 131   ggtgacgccggagatgctcgacttcatgaagcgcctgcgcgag 173
             ||||||||||||||||||| | ||||||||||  |||||||||
Sbjct: 43535 ggtgacgccggagatgctccagttcatgaagcagctgcgcgag 43577



to top

>gb|DQ442994.1| Glycine max phosphomannomutase mRNA, complete cds
          Length = 744

 Score =  119 bits (60), Expect = 1e-23
 Identities = 207/256 (80%)
 Strand = Plus / Plus

                                                                       
Query: 346 agcttaaggaattcattaacttcactcttcattacattgcggacttggatatcccaatta 405
           |||| ||||| || |||||||| || |||||||| ||||| || ||||| ||||| ||||
Sbjct: 287 agctcaaggagtttattaactttacacttcattatattgctgatttggacatccccatta 346

                                                                       
Query: 406 aaaggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggagga 465
           | ||||| ||||| ||||||||| | ||||| ||| | |||||||||||||| ||  | |
Sbjct: 347 agaggggaacatttatagagttccgtagtgggatgctgaatgtgtcacctattggccgaa 406

                                                                       
Query: 466 actgtagtcaagaagaacgtgatgattttgagaagtatgataaggtacataacgttcggc 525
           | ||||| ||||||||| | ||||| |||||||| ||||| ||||| || ||  | || |
Sbjct: 407 attgtagccaagaagaaagagatgagtttgagaaatatgacaaggttcacaatatacgcc 466

                                                                       
Query: 526 ctaaaatggtgtcagtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattg 585
           | |||||||| || || |||||||| |||||||| || || ||| |||| || || ||||
Sbjct: 467 cgaaaatggtttctgtacttcgtgagaagtttgctcatcttaacttgacattctccattg 526

                           
Query: 586 gagggcagatcagttt 601
           |||| ||||| |||||
Sbjct: 527 gaggacagataagttt 542



to top

>dbj|AP006402.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT34J23, TM0284,
             complete sequence
          Length = 92675

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                         
Query: 408   aggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaac 467
             ||||| ||||| ||||||||| | ||||| ||| | ||||||||||| || ||||| |||
Sbjct: 14934 aggggaacatttatagagttccgtagtgggatgctgaatgtgtcaccaattgggagaaac 14993

                                                         
Query: 468   tgtagtcaagaagaacgtgatgattttgagaagtatgataaggt 511
             ||||| ||||||||| | ||||| |||||||||||||| |||||
Sbjct: 14994 tgtagccaagaagaaagagatgaatttgagaagtatgacaaggt 15037



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 352   aggaattcattaacttcactcttcattacattgcggacttggatatcccaattaa 406
             ||||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||
Sbjct: 14794 aggaatttattaactttactctgcattacattgctgacttggatatccctattaa 14848



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                         
Query: 528   aaaatggtgtcagtgcttcgtgaaaagtttgcacacctgaacctgaccttttctattgga 587
             |||||||| || || |||||||| |||||||| || || |||||||| ||||||||||||
Sbjct: 15160 aaaatggtttctgtacttcgtgagaagtttgctcatcttaacctgacattttctattgga 15219

                     
Query: 588   gggcagat 595
             || |||||
Sbjct: 15220 ggacagat 15227



to top

>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                         
Query: 408   aggggtacattcatagagttcaggagtggaatgatcaatgtgtcacctatagggaggaac 467
             ||||| ||||| ||||||||| | ||||| ||| | ||||| ||||| || ||| | |||
Sbjct: 19619 aggggaacatttatagagttccgtagtgggatgctgaatgtatcaccgattgggcgaaac 19560

                                                         
Query: 468   tgtagtcaagaagaacgtgatgattttgagaagtatgataaggt 511
             ||||| ||||||||| | ||||| |||||||||||||| |||||
Sbjct: 19559 tgtagccaagaagaaagagatgagtttgagaagtatgacaaggt 19516



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                    
Query: 352   aggaattcattaacttcactcttcattacattgcggacttggatatcccaattaa 406
             ||||||| ||||| || ||||||||||||||||| |||||||||||||| |||||
Sbjct: 19750 aggaatttattaattttactcttcattacattgctgacttggatatccctattaa 19696



to top

>ref|NM_130142.2| Arabidopsis thaliana catalytic/ phosphomannomutase AT2G45790 mRNA,
           complete cds
          Length = 1453

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 416 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 475

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 476 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 535

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 536 agatatgataaggt 549



to top

>gb|AY113964.1| Arabidopsis thaliana putative phosphomannomutase (At2g45790) mRNA,
           complete cds
          Length = 772

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 319 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 378

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 379 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 438

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 439 agatatgataaggt 452



to top

>gb|AY050806.1| Arabidopsis thaliana putative phosphomannomutase (At2g45790) mRNA,
           complete cds
          Length = 1064

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 407 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 466

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 467 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 526

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 527 agatatgataaggt 540



to top

>gb|DQ442991.1| Arabidopsis thaliana phosphomannomutase mRNA, complete cds
          Length = 741

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 319 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 378

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 379 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 438

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 439 agatatgataaggt 452



to top

>emb|BX819611.1|CNS0A8ZJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB93ZG09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 371 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 430

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 431 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 490

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 491 agatatgataaggt 504



to top

>gb|AY088930.1| Arabidopsis thaliana clone 998 mRNA, complete sequence
          Length = 992

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 tacattgcggacttggatatcccaattaaaaggggtacattcatagagttcaggagtgga 437
           |||||||| ||| ||||||| |||||||| ||||| ||||| || || ||| | | ||||
Sbjct: 416 tacattgcagacctggatattccaattaagaggggaacatttattgaattccgaaatgga 475

                                                                       
Query: 438 atgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattttgag 497
           ||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||||||
Sbjct: 476 atgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatttgag 535

                         
Query: 498 aagtatgataaggt 511
           |  |||||||||||
Sbjct: 536 agatatgataaggt 549



to top

>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16
          Length = 345012

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 91     tcttcgacgtcgacggcacgctc 113
              |||||||||||||||||||||||
Sbjct: 216648 tcttcgacgtcgacggcacgctc 216626



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    tgctcgacttcatgaagcgc 164
              ||||||||||||||||||||
Sbjct: 224915 tgctcgacttcatgaagcgc 224896



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                         
Query: 434   tggaatgatcaatgtgtcacctatagggaggaactgtagtcaagaagaacgtgatgattt 493
             ||||||| ||||||| ||||| || ||  | ||||| || ||||||||| | ||||| ||
Sbjct: 69883 tggaatgctcaatgtatcacccattggtcgcaactgcagccaagaagaaagagatgaatt 69824

                                
Query: 494   tgagaagtatgataaggta 512
             |||||  ||||||||||||
Sbjct: 69823 tgagagatatgataaggta 69805



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 131    ggtgacgccggagatgctcgac 152
              ||||||||||||||||||||||
Sbjct: 572326 ggtgacgccggagatgctcgac 572347



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 98      cgtcgacggcacgctcaccgcg 119
               ||||||||||||||||||||||
Sbjct: 1019880 cgtcgacggcacgctcaccgcg 1019859



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 131     ggtgacgccggagatgctcgac 152
               ||||||||||||||||||||||
Sbjct: 3202444 ggtgacgccggagatgctcgac 3202423



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 91      tcttcgacgtcgacggcacgct 112
               ||||||||||||||||||||||
Sbjct: 3903651 tcttcgacgtcgacggcacgct 3903672



to top

>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13
          Length = 349564

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 98     cgtcgacggcacgctcaccgcg 119
              ||||||||||||||||||||||
Sbjct: 335594 cgtcgacggcacgctcaccgcg 335573



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 131     ggtgacgccggagatgctcgac 152
               ||||||||||||||||||||||
Sbjct: 2932310 ggtgacgccggagatgctcgac 2932289



to top

>emb|BX248337.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             4/14
          Length = 327650

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 98    cgtcgacggcacgctcaccgcg 119
             ||||||||||||||||||||||
Sbjct: 33333 cgtcgacggcacgctcaccgcg 33312



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 393      gatatcccaattaaaaggggtacatt 418
                |||||||||||||||||||| |||||
Sbjct: 23001950 gatatcccaattaaaagggggacatt 23001975



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 89      gctcttcgacgtcgacggcacgctcaccg 117
               |||||||||||||| | ||||||||||||
Sbjct: 1009691 gctcttcgacgtcgtctgcacgctcaccg 1009663



to top

>gb|AC084460.1|AC084460 Caenorhabditis briggsae cosmid CB033D02, complete sequence
          Length = 77513

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 2     ccttcttcttcttctccttcgt 23
             ||||||||||||||||||||||
Sbjct: 45993 ccttcttcttcttctccttcgt 45972



to top

>dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0470B03
          Length = 163371

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 393   gatatcccaattaaaaggggtacatt 418
             |||||||||||||||||||| |||||
Sbjct: 61678 gatatcccaattaaaagggggacatt 61703



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 131     ggtgacgccggagatgctcgac 152
               ||||||||||||||||||||||
Sbjct: 1942190 ggtgacgccggagatgctcgac 1942211



to top

>gb|AY842241.1| Arabidopsis thaliana chloroplast amidophosphoribosyltransferase
           gene, complete cds; nuclear gene for chloroplast product
          Length = 2249

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 161 cttcttcttcttctccttcgt 181



to top

>ref|NM_119640.2| Arabidopsis thaliana ATASE2 (GLN PHOSPHORIBOSYL PYROPHOSPHATE
           AMIDOTRANSFERASE 2); amidophosphoribosyltransferase/
           transferase AT4G34740 (ATASE2) mRNA, complete cds
          Length = 2095

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 253 cttcttcttcttctccttcgt 273



to top

>ref|NM_129514.2| Arabidopsis thaliana unknown protein AT2G39560 mRNA, complete cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 381 cccttcttcttcttctccttc 401



to top

>ref|NM_202492.2| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
           serine/threonine kinase/ protein-tyrosine kinase
           AT3G04810 transcript variant AT3G04810.2 mRNA, complete
           cds
          Length = 2313

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 182 cttcttcttcttctccttcgt 202



to top

>ref|NM_105552.2| Arabidopsis thaliana unknown protein AT1G68790 mRNA, complete cds
          Length = 3643

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 3    cttcttcttcttctccttcgt 23
            |||||||||||||||||||||
Sbjct: 3355 cttcttcttcttctccttcgt 3335



to top

>ref|XM_479805.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1326

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 89  gctcttcgacgtcgacggcacgctcaccg 117
           |||||||||||||| | ||||||||||||
Sbjct: 759 gctcttcgacgtcgtctgcacgctcaccg 787



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
               sequence
          Length = 1783081

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 3       cttcttcttcttctccttcgt 23
               |||||||||||||||||||||
Sbjct: 1492609 cttcttcttcttctccttcgt 1492629



to top

>ref|XM_587106.2| PREDICTED: Bos taurus similar to A-kinase anchor protein 13 isoform 2
            (LOC510024), mRNA
          Length = 2385

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1    cccttcttcttcttctccttc 21
            |||||||||||||||||||||
Sbjct: 2309 cccttcttcttcttctccttc 2289



to top

>gb|AC183772.2| Pan troglodytes BAC clone CH251-73E21 from chromosome 9, complete
              sequence
          Length = 162544

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 2      ccttcttcttcttctccttcgtagcagct 30
              |||||||||||||||||||| || |||||
Sbjct: 116348 ccttcttcttcttctccttcctaccagct 116376



to top

>ref|XM_848592.1| PREDICTED: Canis familiaris hypothetical protein LOC610992
            (LOC610992), mRNA
          Length = 3237

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1    cccttcttcttcttctccttc 21
            |||||||||||||||||||||
Sbjct: 2151 cccttcttcttcttctccttc 2131



to top

>ref|XM_570142.1| Cryptococcus neoformans var. neoformans JEC21 rRNA
           processing-related protein (CND05510) partial mRNA
          Length = 1300

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 957 cttcttcttcttctccttcgt 937



to top

>emb|Z81502.1|CEF14B6 Caenorhabditis elegans Cosmid F14B6, complete sequence
          Length = 29283

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1    cccttcttcttcttctccttc 21
            |||||||||||||||||||||
Sbjct: 5103 cccttcttcttcttctccttc 5123



to top

>gb|AC155341.1| Brassica rapa subsp. pekinensis chromosome 6 clone KBrH004D11, complete
             sequence
          Length = 106476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     cttcttcttcttctccttcgt 23
             |||||||||||||||||||||
Sbjct: 33921 cttcttcttcttctccttcgt 33901



to top

>ref|XM_505974.1| Yarrowia lipolytica CLIB122, YALI0F28039g predicted mRNA
          Length = 1557

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 259 acgtcttctccgagaacggcc 279
           |||||||||||||||||||||
Sbjct: 357 acgtcttctccgagaacggcc 377



to top

>gb|AC139206.5| Mus musculus chromosome 1, clone RP23-82P18, complete sequence
          Length = 304494

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 83305 cccttcttcttcttctccttc 83325



to top

>emb|AL121875.10|HSBA51C14 Human DNA sequence from clone RP11-51C14 on chromosome Xq26.2-27.3
              Contains an embryonic ectoderm development (EED)
              pseudogene, a ribosomal protein S17 (RPS17) pseudogene, the
              SOX3 gene for SRY (sex determining region Y)-box 3 and
              three CpG islands, complete sequence
          Length = 148598

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      cccttcttcttcttctccttc 21
              |||||||||||||||||||||
Sbjct: 111176 cccttcttcttcttctccttc 111156



to top

>emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 81674

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 27349 cccttcttcttcttctccttc 27369



to top

>ref|XM_963711.1| PREDICTED: Tribolium castaneum similar to CG10936-PA, isoform A
           (LOC657242), mRNA
          Length = 3633

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 886 cttcttcttcttctccttcgt 866



to top

>ref|XM_795544.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC591148 (LOC591148), mRNA
          Length = 609

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 447 cccttcttcttcttctccttc 427



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 308 cccttcttcttcttctccttc 288



to top

>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16
          Length = 349746

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 24    agcagcttcagcagcgccggc 44
             |||||||||||||||||||||
Sbjct: 33027 agcagcttcagcagcgccggc 33047



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     cttcttcttcttctccttcgt 23
             |||||||||||||||||||||
Sbjct: 31197 cttcttcttcttctccttcgt 31177



to top

>emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome 4, BAC clone F11I11 (ESSA
            project)
          Length = 103150

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 3    cttcttcttcttctccttcgt 23
            |||||||||||||||||||||
Sbjct: 1740 cttcttcttcttctccttcgt 1720



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 3      cttcttcttcttctccttcgt 23
              |||||||||||||||||||||
Sbjct: 112429 cttcttcttcttctccttcgt 112409



to top

>gb|AC162692.2| Mus musculus chromosome 1, clone RP23-445K23, complete sequence
          Length = 181625

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 52366 cccttcttcttcttctccttc 52346



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 93      ttcgacgtcgacggcacgctc 113
               |||||||||||||||||||||
Sbjct: 3149911 ttcgacgtcgacggcacgctc 3149891



to top

>gb|AY120699.1| Arabidopsis thaliana At2g39560/F12L6.22 mRNA, complete cds
          Length = 702

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 198 cccttcttcttcttctccttc 218



to top

>gb|AE011938.1| Xanthomonas axonopodis pv. citri str. 306,  section 316 of 469 of the
            complete genome
          Length = 11157

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 93   ttcgacgtcgacggcacgctcaccg 117
            |||||||||||||||||||| ||||
Sbjct: 7299 ttcgacgtcgacggcacgctgaccg 7323



to top

>gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map CIC10A06, complete
             sequence
          Length = 102312

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 74318 cccttcttcttcttctccttc 74298



to top

>gb|AY081611.1| Arabidopsis thaliana amidophosphoribosyltransferase 2 precursor
           (At4g34740) mRNA, complete cds
          Length = 1796

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 161 cttcttcttcttctccttcgt 181



to top

>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence
          Length = 149015

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 40554 cccttcttcttcttctccttc 40534



to top

>gb|AY075666.1| Arabidopsis thaliana At2g39560/F12L6.22 mRNA, complete cds
          Length = 1163

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 381 cccttcttcttcttctccttc 401



to top

>gb|AY065123.1| Arabidopsis thaliana amidophosphoribosyltransferase 2 precursor
           (At4g34740; T4L20.320) mRNA, complete cds
          Length = 2095

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 253 cttcttcttcttctccttcgt 273



to top

>gb|AF326399.1|AF326399 Pseudomonas sp. GB13 Mn(II)-oxidation-associated multicopper
           oxidase (cumA) gene, partial cds
          Length = 1056

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 75  accggtgtgctcgcgctcttcgacg 99
           ||||||| |||||||||||||||||
Sbjct: 210 accggtgggctcgcgctcttcgacg 186



to top

>ref|NM_060684.2| Caenorhabditis elegans F14B6.2 (F14B6.2) mRNA, complete cds
          Length = 2217

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   cccttcttcttcttctccttc 21
           |||||||||||||||||||||
Sbjct: 824 cccttcttcttcttctccttc 804



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 84     ctcgcgctcttcgacgtcgac 104
              |||||||||||||||||||||
Sbjct: 875144 ctcgcgctcttcgacgtcgac 875164



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 145     tgctcgacttcatgaagcgcctgcgcgag 173
               ||||||| || ||||||||||||||||||
Sbjct: 5700568 tgctcgaattaatgaagcgcctgcgcgag 5700596



to top

>gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-617D22, complete sequence
          Length = 162482

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 78814 cccttcttcttcttctccttc 78794



to top

>emb|BX824516.1|CNS0A4Q9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZF11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2308

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 152 cttcttcttcttctccttcgt 172



to top

>gb|AC011914.9|AC011914 Arabidopsis thaliana chromosome 1 BAC F14K14 genomic sequence, complete
             sequence
          Length = 96808

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     cttcttcttcttctccttcgt 23
             |||||||||||||||||||||
Sbjct: 62491 cttcttcttcttctccttcgt 62471



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     cttcttcttcttctccttcgt 23
             |||||||||||||||||||||
Sbjct: 87504 cttcttcttcttctccttcgt 87484



to top

>gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq23, complete sequence
          Length = 132068

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 30819 cccttcttcttcttctccttc 30799



to top

>gb|AC124758.6| Mus musculus BAC clone RP23-123I10 from chromosome 6, complete sequence
          Length = 216956

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 3      cttcttcttcttctccttcgt 23
              |||||||||||||||||||||
Sbjct: 138337 cttcttcttcttctccttcgt 138357



to top

>gb|AC008940.3|AC008940 Homo sapiens chromosome 5 clone CTD-2319M24, complete sequence
          Length = 131975

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      cccttcttcttcttctccttc 21
              |||||||||||||||||||||
Sbjct: 100274 cccttcttcttcttctccttc 100294



to top

>dbj|AP004562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0470F10
          Length = 185294

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 89     gctcttcgacgtcgacggcacgctcaccg 117
              |||||||||||||| | ||||||||||||
Sbjct: 172429 gctcttcgacgtcgtctgcacgctcaccg 172401



to top

>dbj|AP003925.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1005_B05
          Length = 144799

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 89    gctcttcgacgtcgacggcacgctcaccg 117
             |||||||||||||| | ||||||||||||
Sbjct: 38218 gctcttcgacgtcgtctgcacgctcaccg 38190



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 84      ctcgcgctcttcgacgtcgac 104
               |||||||||||||||||||||
Sbjct: 2506956 ctcgcgctcttcgacgtcgac 2506936



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 45     ggaagaaggatggcggcggcgggg 68
              |||||| |||||||||||||||||
Sbjct: 872900 ggaagacggatggcggcggcgggg 872877



to top

>dbj|D28869.1|ATHAMIDA Arabidopsis thaliana mRNA for amidophosphoribosyltransferase,
           partial cds
          Length = 1649

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 124 cttcttcttcttctccttcgt 144



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 97      acgtcgacggcacgctcaccg 117
               |||||||||||||||||||||
Sbjct: 3178816 acgtcgacggcacgctcaccg 3178796



to top

>gb|AF002846.1|AF002846 Melipona bicolor microsatellite sequence Mbi278AAG
          Length = 385

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 3   cttcttcttcttctccttcgt 23
           |||||||||||||||||||||
Sbjct: 331 cttcttcttcttctccttcgt 351



to top

>emb|CT010499.9| Mouse DNA sequence from clone RP23-211K24 on chromosome 9, complete
             sequence
          Length = 212470

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     cccttcttcttcttctccttc 21
             |||||||||||||||||||||
Sbjct: 44547 cccttcttcttcttctccttc 44527



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 259     acgtcttctccgagaacggcc 279
               |||||||||||||||||||||
Sbjct: 3572579 acgtcttctccgagaacggcc 3572599



to top

>emb|AL513470.8| Mouse DNA sequence from clone RP21-464E5 on chromosome 1, complete
              sequence
          Length = 166333

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      cccttcttcttcttctccttc 21
              |||||||||||||||||||||
Sbjct: 125708 cccttcttcttcttctccttc 125688



to top

>gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, complete sequence
          Length = 198559

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58480 ccttcttcttcttctccttc 58461



to top

>gb|AC110907.7| Mus musculus chromosome 7, clone RP24-180J10, complete sequence
          Length = 179750

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 179233 ccttcttcttcttctccttc 179252



to top

>gb|AC153879.1| Mus musculus  BAC RP23-264C21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 182252

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 20760 ccttcttcttcttctccttc 20741



to top

>ref|NM_111326.1| Arabidopsis thaliana unknown protein AT3G04550 mRNA, complete cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 877 ccttcttcttcttctccttc 858



to top

>ref|NM_148229.1| Arabidopsis thaliana unknown protein AT4G04635 mRNA, complete cds
          Length = 855

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 755 ccttcttcttcttctccttc 736



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 704 ccttcttcttcttctccttc 685



to top

>ref|NM_111327.3| Arabidopsis thaliana unknown protein AT3G04560 mRNA, complete cds
          Length = 2212

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2032 ccttcttcttcttctccttc 2051



to top

>gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, complete sequence
          Length = 201791

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 122864 ccttcttcttcttctccttc 122883



to top

>gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, complete sequence
          Length = 211052

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 146345 ccttcttcttcttctccttc 146326



to top

>gb|AC162176.2| Mus musculus BAC clone RP24-446P15 from chromosome 9, complete sequence
          Length = 204098

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 53838 ccttcttcttcttctccttc 53819



to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 82862 ccttcttcttcttctccttc 82843



to top

>gb|AC164170.7| Mus musculus 10 BAC RP24-419C12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 158496

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 18514 ccttcttcttcttctccttc 18495



to top

>gb|AC147455.3| Atelerix albiventris clone LB4-341B4, complete sequence
          Length = 164065

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 43346 ccttcttcttcttctccttc 43327



to top

>gb|AC166051.5| Mus musculus BAC clone RP24-166B2 from chromosome 9, complete sequence
          Length = 152610

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 87400 ccttcttcttcttctccttc 87381



to top

>gb|AC134474.4| Mus musculus BAC clone RP23-234N16 from chromosome 6, complete sequence
          Length = 171491

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 71615 ccttcttcttcttctccttc 71596



to top

>gb|AC158641.12| Mus musculus 10 BAC RP23-461E22 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 186390

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 52206 ccttcttcttcttctccttc 52225



to top

>ref|XM_470078.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 891

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 4   ttcttcttcttctccttcgt 23
           ||||||||||||||||||||
Sbjct: 683 ttcttcttcttctccttcgt 664



to top

>ref|NM_194599.1| Oryza sativa (japonica cultivar-group) putative polyprotein
            (OSJNBa0092N12.4), mRNA
          Length = 1404

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 4    ttcttcttcttctccttcgt 23
            ||||||||||||||||||||
Sbjct: 1127 ttcttcttcttctccttcgt 1108



to top

>gb|DQ211982.1| Toxoplasma gondii eukaryotic translation initiation factor 5 (eIF5)
            gene, complete cds
          Length = 5000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2839 ccttcttcttcttctccttc 2820



to top

>gb|AC101924.24| Mus musculus chromosome 1, clone RP24-391B5, complete sequence
          Length = 161617

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 21744 ccttcttcttcttctccttc 21725



to top

>gb|AC099743.3| Papio anubis clone RP41-450I16, complete sequence
          Length = 115022

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 102092 ccttcttcttcttctccttc 102073



to top

>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence
          Length = 188514

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 39078 ccttcttcttcttctccttc 39097



to top

>gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, complete sequence
          Length = 181063

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     cttcttcttcttctccttcg 22
             ||||||||||||||||||||
Sbjct: 17157 cttcttcttcttctccttcg 17176



to top

>gb|AC164607.4| Mus musculus chromosome 5, clone RP23-455A10, complete sequence
          Length = 183927

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      cttcttcttcttctccttcgtagc 26
              |||||||||||||| |||||||||
Sbjct: 178874 cttcttcttcttcttcttcgtagc 178851



to top

>gb|AC121517.7| Mus musculus chromosome 15, clone RP23-120A12, complete sequence
          Length = 222681

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 22767 ccttcttcttcttctccttc 22786



to top

>gb|AC154871.13| Mus musculus chromosome 1, clone RP23-354B17, complete sequence
          Length = 211644

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 156443 ccttcttcttcttctccttc 156424



to top

>gb|AC102757.6| Mus musculus chromosome 5, clone RP24-196M24, complete sequence
          Length = 179876

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 3970 ccttcttcttcttctccttc 3989



to top

>gb|AC078891.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBa0092N12, complete sequence
          Length = 109198

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     ttcttcttcttctccttcgt 23
             ||||||||||||||||||||
Sbjct: 28860 ttcttcttcttctccttcgt 28879



to top

>gb|AC133103.5| Mus musculus BAC clone RP23-226J10 from chromosome 1, complete sequence
          Length = 241735

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 155611 ccttcttcttcttctccttc 155630



to top

>gb|AC134443.3| Mus musculus BAC clone RP24-107B13 from chromosome 8, complete sequence
          Length = 182604

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 145485 ccttcttcttcttctccttc 145466



to top

>gb|AC103896.3| Papio anubis clone RP41-441D23, complete sequence
          Length = 156540

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 3372 ccttcttcttcttctccttc 3353



to top

>gb|AC135357.3| Mus musculus chromosome 8 clone RP24-84L15, complete sequence
          Length = 175089

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 88899 ccttcttcttcttctccttc 88918



to top

>gb|AC123597.9| Mus musculus chromosome 8, clone RP23-134A7, complete sequence
          Length = 172297

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 12770 ccttcttcttcttctccttc 12751



to top

>gb|AC116507.9| Mus musculus chromosome 19, clone RP24-309C17, complete sequence
          Length = 168364

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 76185 ccttcttcttcttctccttc 76204



to top

>gb|AC102223.9| Mus musculus chromosome 1, clone RP24-296E23, complete sequence
          Length = 182165

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 135160 ccttcttcttcttctccttc 135141



to top

>gb|AC126115.5| Rattus norvegicus 4 BAC CH230-213L22 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 214442

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 85638 ccttcttcttcttctccttc 85657



to top

>gb|AC120148.13| Mus musculus chromosome 9, clone RP24-225E14, complete sequence
          Length = 201783

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     gcggcggggaagagcaccgg 79
              ||||||||||||||||||||
Sbjct: 101754 gcggcggggaagagcaccgg 101773



to top

>gb|AC109239.8| Mus musculus chromosome 3, clone RP23-191N23, complete sequence
          Length = 187162

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 53294 ccttcttcttcttctccttc 53275



to top

>gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, complete sequence
          Length = 190974

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 174691 ccttcttcttcttctccttc 174672



to top

>ref|XM_458229.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C13695g)
           partial mRNA
          Length = 957

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 253 ccttcttcttcttctccttc 234



to top

>gb|AC145587.4| Mus musculus BAC clone RP24-343E24 from chromosome Y, complete sequence
          Length = 160323

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 152397 ccttcttcttcttctccttc 152378



to top

>gb|AC139349.4| Mus musculus BAC clone RP24-318A14 from chromosome 8, complete sequence
          Length = 199464

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 54663 ccttcttcttcttctccttc 54682



to top

>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete
             sequence
          Length = 210128

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 28539 ccttcttcttcttctccttc 28558



to top

>gb|AC132335.3| Mus musculus BAC clone RP24-230C24 from chromosome 10, complete
             sequence
          Length = 180642

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 95322 ccttcttcttcttctccttc 95341



to top

>ref|XM_603394.2| PREDICTED: Bos taurus similar to bromodomain containing protein 3
            (LOC525051), mRNA
          Length = 2994

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1501 ccttcttcttcttctccttc 1482



to top

>gb|BC025119.1| Mus musculus cDNA sequence BC032204, mRNA (cDNA clone MGC:36836
           IMAGE:4190760), complete cds
          Length = 2538

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 598 ccttcttcttcttctccttc 579



to top

>gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, complete sequence
          Length = 168824

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 109032 ccttcttcttcttctccttc 109013



to top

>gb|AC146687.1| Mus musculus BAC clone RP24-487N17 from chromosome Y, complete sequence
          Length = 162474

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 109332 ccttcttcttcttctccttc 109351



to top

>gb|AY604200.1| Thermoascus aurantiacus Cre1 (Cre1) gene, complete cds
          Length = 3998

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    cttcttcttcttctccttcg 22
            ||||||||||||||||||||
Sbjct: 2599 cttcttcttcttctccttcg 2618



to top

>ref|NM_007371.2| Homo sapiens bromodomain containing 3 (BRD3), mRNA
          Length = 3085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1646 ccttcttcttcttctccttc 1627



to top

>gb|AC130529.2| Mus musculus BAC clone RP23-124O11 from chromosome 16, complete
             sequence
          Length = 231967

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 87405 ccttcttcttcttctccttc 87386



to top

>gb|AC131339.3| Mus musculus BAC clone RP23-226F20 from chromosome 16, complete sequence
          Length = 180384

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 106322 ccttcttcttcttctccttc 106341



to top

>gb|AC147105.2| Mus musculus BAC clone RP24-66E5 from chromosome Y, complete sequence
          Length = 223344

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 56747 ccttcttcttcttctccttc 56728



to top

>gb|AC142103.3| Mus musculus BAC clone RP24-287E15 from chromosome 17, complete sequence
          Length = 175787

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 137351 ccttcttcttcttctccttc 137332



to top

>gb|AC124508.5| Mus musculus BAC clone RP23-433B5 from chromosome 7, complete sequence
          Length = 188011

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 121720 ccttcttcttcttctccttc 121739



to top

>gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosome 8, complete sequence
          Length = 171823

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 110689 ccttcttcttcttctccttc 110670



to top

>gb|AC144809.2| Mus musculus BAC clone RP24-391L5 from chromosome 9, complete sequence
          Length = 185599

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 17218 ccttcttcttcttctccttc 17199



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 17203 ccttcttcttcttctccttc 17184



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 17188 ccttcttcttcttctccttc 17169



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 17173 ccttcttcttcttctccttc 17154



to top

>gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 219129 ccttcttcttcttctccttc 219110



to top

>gb|AC175673.2| Mus musculus BAC clone RP24-26I10 from chromosome y, complete sequence
          Length = 203739

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 144693 ccttcttcttcttctccttc 144674



to top

>gb|AC153900.8| Mus musculus 6 BAC RP23-36I21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 194216

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 118249 ccttcttcttcttctccttc 118230



to top

>ref|NM_001012732.1| Homo sapiens dCMP deaminase (DCTD), transcript variant 1, mRNA
          Length = 2042

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 56  ggcggcggcggggaagagcaccgg 79
           |||||||||||||| |||||||||
Sbjct: 118 ggcggcggcggggacgagcaccgg 141



to top

>ref|NM_001921.2| Homo sapiens dCMP deaminase (DCTD), transcript variant 2, mRNA
          Length = 2019

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 56  ggcggcggcggggaagagcaccgg 79
           |||||||||||||| |||||||||
Sbjct: 118 ggcggcggcggggacgagcaccgg 141



to top

>gb|AC119896.6| Mus musculus chromosome 10, clone RP24-226B10, complete sequence
          Length = 215123

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 206565 ccttcttcttcttctccttc 206584



to top

>gb|BC066803.1| Mus musculus cDNA sequence BC032204, mRNA (cDNA clone MGC:76489
           IMAGE:30043017), complete cds
          Length = 2875

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 627 ccttcttcttcttctccttc 608



to top

>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence
          Length = 236510

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 15894 ccttcttcttcttctccttc 15875



to top

>gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, complete sequence
          Length = 250903

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 35192 ccttcttcttcttctccttc 35173



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 4        ttcttcttcttctccttcgt 23
                ||||||||||||||||||||
Sbjct: 33816337 ttcttcttcttctccttcgt 33816356



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 50      aaggatggcggcggcgggga 69
               ||||||||||||||||||||
Sbjct: 5396761 aaggatggcggcggcgggga 5396742



to top

>gb|AC164316.3| Mus musculus BAC clone RP23-16B4 from chromosome 6, complete sequence
          Length = 222892

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 126868 ccttcttcttcttctccttc 126887



to top

>gb|AC161884.5| Mus musculus BAC clone RP23-77K23 from chromosome 14, complete sequence
          Length = 243730

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 235090 ccttcttcttcttctccttc 235109



to top

>gb|AC165239.3| Mus musculus chromosome 19, clone RP24-73C2, complete sequence
          Length = 208461

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 82197 ccttcttcttcttctccttc 82178



to top

>gb|AC036145.11| Mus musculus chromosome 5, clone RP23-439C22, complete sequence
          Length = 182228

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 114846 ccttcttcttcttctccttc 114827



to top

>gb|AC115121.5| Mus musculus BAC clone RP23-204O13 from chromosome 19, complete sequence
          Length = 227154

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 140137 ccttcttcttcttctccttc 140156



to top

>gb|AC137742.3| Mus musculus BAC clone RP24-345F6 from chromosome 16, complete sequence
          Length = 170248

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 167654 ccttcttcttcttctccttc 167635



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 167343 ccttcttcttcttctccttc 167324



to top

>gb|AY329370.1| Mus musculus TOX (Tox) mRNA, complete cds
          Length = 1237

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 575 ccttcttcttcttctccttc 556



to top

>gb|AC159030.2| Pan troglodytes BAC clone CH251-399F13 from chromosome unknown,
             complete sequence
          Length = 176914

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 67227 ccttcttcttcttctccttc 67246



to top

>ref|XM_536038.2| PREDICTED: Canis familiaris similar to Amyotrophic lateral sclerosis
            2 chromosome region candidate gene protein 19
            (Partitioning-defective 3-like protein) (PAR3-L protein)
            (PAR3-beta) (LOC478879), mRNA
          Length = 4324

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2440 ccttcttcttcttctccttc 2421



to top

>gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome y, complete
            sequence
          Length = 194102

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2533 ccttcttcttcttctccttc 2514



to top

>ref|XM_980207.1| PREDICTED: Mus musculus hypothetical protein LOC670249 (LOC670249),
           mRNA
          Length = 366

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 284 ccttcttcttcttctccttc 265



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 269 ccttcttcttcttctccttc 250



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 242 ccttcttcttcttctccttc 223



to top

>gb|AC122535.3| Mus musculus BAC clone RP24-539K4 from chromosome 7, complete sequence
          Length = 186561

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 181180 ccttcttcttcttctccttc 181161



to top

>ref|XM_976944.1| PREDICTED: Mus musculus hypothetical protein LOC669758 (LOC669758),
           mRNA
          Length = 912

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 250 ccttcttcttcttctccttc 231



to top

>gb|AC113542.13| Mus musculus chromosome 5, clone RP23-195A18, complete sequence
          Length = 215127

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 189462 ccttcttcttcttctccttc 189443



to top

>ref|XM_001002052.1| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA-A) receptor,
            subunit alpha 2, transcript variant 3 (Gabra2), mRNA
          Length = 2730

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2551 ccttcttcttcttctccttc 2532



to top

>ref|XM_001002044.1| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA-A) receptor,
            subunit alpha 2, transcript variant 2 (Gabra2), mRNA
          Length = 2323

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2144 ccttcttcttcttctccttc 2125



to top

>gb|AC140382.3| Mus musculus BAC clone RP24-86A10 from chromosome Y, complete sequence
          Length = 193056

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 66049 ccttcttcttcttctccttc 66030



to top

>gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 219129 ccttcttcttcttctccttc 219110



to top

>gb|AC143328.4| Mus musculus BAC clone RP24-119E16 from chromosome Y, complete sequence
          Length = 163625

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 121255 ccttcttcttcttctccttc 121236



to top

>gb|AC135594.4| Oryza sativa chromosome 3 BAC OSJNBa0024F18 genomic sequence, complete
             sequence
          Length = 159795

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     ttcttcttcttctccttcgt 23
             ||||||||||||||||||||
Sbjct: 56903 ttcttcttcttctccttcgt 56884



to top

>gb|AC122243.3| Mus musculus BAC clone RP23-148C10 from chromosome 17, complete
            sequence
          Length = 204584

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 6347 ccttcttcttcttctccttc 6328



to top

>gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome 19, complete sequence
          Length = 237854

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58907 ccttcttcttcttctccttc 58926



to top

>emb|CT025566.7| Mouse DNA sequence from clone RP24-151A22 on chromosome 13, complete
             sequence
          Length = 149381

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 50368 ccttcttcttcttctccttc 50349



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 50353 ccttcttcttcttctccttc 50334



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 50326 ccttcttcttcttctccttc 50307



to top

>ref|XM_540887.2| PREDICTED: Canis familiaris similar to UNC-112 related protein 2
           short form (LOC483766), mRNA
          Length = 2497

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 667 ccttcttcttcttctccttc 648



to top

>emb|AJ606051.1| Geum urbanum microsatellite DNA, clone WGU 8-1
          Length = 451

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 3   cttcttcttcttctccttcg 22
           ||||||||||||||||||||
Sbjct: 183 cttcttcttcttctccttcg 164



to top

>emb|AJ007903.1|NTA7903 Nicotiana tabacum DNA adjacent to H9NP T-DNA left border
          Length = 9667

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 4377 ccttcttcttcttctccttc 4396



to top

>gb|AC091519.16| Mus musculus strain 129/SvJ chromosome 2 clone mgs1-452h5, complete
              sequence
          Length = 229220

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 202088 ccttcttcttcttctccttc 202107



to top

>gb|AC123945.4| Mus musculus BAC clone RP24-87G13 from chromosome 14, complete sequence
          Length = 207945

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 183061 ccttcttcttcttctccttc 183080



to top

>gb|AC128700.4| Mus musculus BAC clone RP24-130A20 from chromosome 8, complete
            sequence
          Length = 161757

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 7147 ccttcttcttcttctccttc 7128



to top

>gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome 18, complete sequence
          Length = 173614

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 146509 ccttcttcttcttctccttc 146490



to top

>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete
             sequence
          Length = 154681

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 84061 ccttcttcttcttctccttc 84042



to top

>gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosome 8, complete sequence
          Length = 174384

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 103739 ccttcttcttcttctccttc 103720



to top

>gb|AC125087.2| Mus musculus BAC clone RP24-143E18 from chromosome 14, complete sequence
          Length = 180794

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 164700 ccttcttcttcttctccttc 164681



to top

>gb|AC122929.4| Mus musculus BAC clone RP23-12A18 from chromosome 6, complete sequence
          Length = 252503

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 172752 ccttcttcttcttctccttc 172733



to top

>gb|AC122930.4| Mus musculus BAC clone RP23-13L19 from chromosome 9, complete
            sequence
          Length = 224108

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   gcggcggggaagagcaccgg 79
            ||||||||||||||||||||
Sbjct: 2951 gcggcggggaagagcaccgg 2932



to top

>gb|AC127594.3| Mus musculus BAC clone RP23-44G8 from chromosome 7, complete sequence
          Length = 209828

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 158789 ccttcttcttcttctccttc 158770



to top

>gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosome 9, complete sequence
          Length = 219833

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58198 ccttcttcttcttctccttc 58217



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58183 ccttcttcttcttctccttc 58202



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58168 ccttcttcttcttctccttc 58187



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 58153 ccttcttcttcttctccttc 58172



to top

>emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete chromosome; segment 2/12
          Length = 306650

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     cgtcgacggcacgctcaccg 117
              ||||||||||||||||||||
Sbjct: 100945 cgtcgacggcacgctcaccg 100926



to top

>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence,
            complete sequence
          Length = 95310

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 5151 ccttcttcttcttctccttc 5132



to top

>gb|BC010699.1| Homo sapiens bromodomain containing 3, mRNA (cDNA clone
            IMAGE:3873627), with apparent retained intron
          Length = 2085

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1665 ccttcttcttcttctccttc 1646



to top

>gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, complete sequence
          Length = 177719

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 88069 ccttcttcttcttctccttc 88050



to top

>ref|XM_859950.1| PREDICTED: Canis familiaris hypothetical protein LOC609710
           (LOC609710), mRNA
          Length = 540

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 166 ccttcttcttcttctccttc 147



to top

>gb|AC131787.3| Mus musculus BAC clone RP24-397K14 from chromosome 18, complete sequence
          Length = 159775

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 102925 ccttcttcttcttctccttc 102906



to top

>gb|AC130205.3| Mus musculus BAC clone RP24-430C1 from chromosome 1, complete sequence
          Length = 165927

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 89682 ccttcttcttcttctccttc 89663



to top

>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete sequence
          Length = 168423

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 145399 ccttcttcttcttctccttc 145418



to top

>gb|AC122056.4| Mus musculus BAC clone RP24-466A3 from chromosome 14, complete
            sequence
          Length = 179685

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 2576 ccttcttcttcttctccttc 2557



to top

>gb|AC124411.5| Mus musculus BAC clone RP24-267C20 from chromosome 13, complete sequence
          Length = 177414

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 126938 ccttcttcttcttctccttc 126919



to top

>gb|AC123853.2| Mus musculus BAC clone RP23-326J1 from chromosome 19, complete sequence
          Length = 205768

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 121663 ccttcttcttcttctccttc 121644



to top

>gb|AC129326.3| Mus musculus BAC clone RP23-326H12 from chromosome 19, complete
             sequence
          Length = 184128

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 64446 ccttcttcttcttctccttc 64465



to top

>gb|AC124699.4| Mus musculus BAC clone RP24-187B13 from chromosome 1, complete sequence
          Length = 177793

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 60320 ccttcttcttcttctccttc 60301



to top

>gb|AC124775.4| Mus musculus BAC clone RP23-60N3 from 7, complete sequence
          Length = 234834

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 143980 ccttcttcttcttctccttc 143999



to top

>gb|AC117197.3| Mus musculus BAC clone RP23-127A21 from 16, complete sequence
          Length = 211410

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 123371 ccttcttcttcttctccttc 123390



to top

>gb|AC125206.3| Mus musculus BAC clone RP23-240G3 from 10, complete sequence
          Length = 184252

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 67509 ccttcttcttcttctccttc 67490



to top

>gb|AC122196.2| Mus musculus BAC clone RP23-50P5 from 5, complete sequence
          Length = 151406

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 94969 ccttcttcttcttctccttc 94988



to top

>gb|BC044975.1| Xenopus laevis nuclear receptor subfamily 2, group F, member 2,
           mRNA (cDNA clone MGC:52954 IMAGE:4930383), complete cds
          Length = 1655

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 212 ccttcttcttcttctccttc 231



to top

>gb|AC112680.12| Mus musculus chromosome 9, clone RP23-203D1, complete sequence
          Length = 226883

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 86259 ccttcttcttcttctccttc 86240



to top

>gb|AC015983.7| Homo sapiens BAC clone RP11-560I19 from 7, complete sequence
          Length = 177476

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 124802 ccttcttcttcttctccttc 124821



to top

>gb|BC032124.2| Homo sapiens bromodomain containing 3, mRNA (cDNA clone MGC:29612
            IMAGE:4856840), complete cds
          Length = 2539

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1805 ccttcttcttcttctccttc 1786



to top

>gb|AC109619.11| Mus musculus chromosome 19, clone RP23-427F6, complete sequence
          Length = 170072

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 9399 ccttcttcttcttctccttc 9418



to top

>gb|AC112990.7| Mus musculus chromosome 19, clone RP24-317E20, complete sequence
          Length = 183322

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 139002 ccttcttcttcttctccttc 139021



to top

>gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, complete sequence
          Length = 218079

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 163653 ccttcttcttcttctccttc 163672



to top

>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence
          Length = 211521

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 863 ccttcttcttcttctccttc 882



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 848 ccttcttcttcttctccttc 867



to top

>gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, complete sequence
          Length = 161721

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 101232 ccttcttcttcttctccttc 101213



to top

>gb|AC131116.3| Mus musculus BAC clone RP24-344M21 from chromosome 7, complete sequence
          Length = 190325

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 152646 ccttcttcttcttctccttc 152665



to top

>gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0009J13, from chromosome 3, complete sequence
          Length = 147205

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     aaggatggcggcggcgggga 69
              ||||||||||||||||||||
Sbjct: 102929 aaggatggcggcggcgggga 102910



to top

>emb|CR855377.7| Zebrafish DNA sequence from clone DKEY-263F15 in linkage group 8,
             complete sequence
          Length = 107728

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 13611 ccttcttcttcttctccttc 13592



to top

>gb|AC164616.4| Mus musculus BAC clone RP23-322A5 from chromosome 12, complete sequence
          Length = 204974

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 157427 ccttcttcttcttctccttc 157408



to top

>gb|AC175492.4| Mus musculus BAC clone RP24-76P21 from chromosome y, complete sequence
          Length = 203854

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 75503 ccttcttcttcttctccttc 75484



to top

>emb|AL592548.10| Human DNA sequence from clone RP4-654J19 on chromosome 1, complete
             sequence
          Length = 97656

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 33259 ccttcttcttcttctccttc 33278



to top

>emb|AL591862.5| Human DNA sequence from clone RP11-287J1 on chromosome 1, complete
            sequence
          Length = 19317

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 9102 ccttcttcttcttctccttc 9121



to top

>emb|AL591850.4| Human DNA sequence from clone RP11-113N4 on chromosome 10 Contains part
             of a novel gene (FLJ13031) (FLJ40349), complete sequence
          Length = 30511

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 11056 ccttcttcttcttctccttc 11037



to top

>emb|AL451062.12| Human DNA sequence from clone RP11-184I16 on chromosome 1 Contains the 3'
              end of the JMJD2 gene for jumonji domain containing 2, two
              novel genes, the 5' end of the SIAT6 gene for
              sialyltransferase 6 (N-acetyllacosaminide alpha
              2,3-sialyltransferase), a SMT3 suppressor of mif two 3
              (yeast) family pseudogene and a CpG island, complete
              sequence
          Length = 141866

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 134870 ccttcttcttcttctccttc 134889



to top

>emb|AL513548.8| Human DNA sequence from clone RP11-457M11 on chromosome 6 Contains
            the gene for basal transcriptional activator HABT1,
            ,vomeronasal olfactory 1 receptor chromosome 6-5
            pseudogene VN1R6-5P, a novel gene, a novel zinc finger
            protein gene or pseudogene and three CpG islands,
            complete sequence
          Length = 109476

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 6200 ccttcttcttcttctccttc 6219



to top

>emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on chromosome 9 Contains the 5'
              end of the VAV2 gene for vav 2 oncogene, a novel gene
              (FLJ35348), the 3' end of the BRD3 gene for bromodomain
              containing 3, a novel gene and five CpG islands, complete
              sequence
          Length = 175033

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 153376 ccttcttcttcttctccttc 153395



to top

>ref|XM_500908.1| Yarrowia lipolytica CLIB122, YALI0B14971g predicted mRNA
          Length = 3990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1729 ccttcttcttcttctccttc 1710



to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     ttcgacgtcgacggcacgct 112
              ||||||||||||||||||||
Sbjct: 649842 ttcgacgtcgacggcacgct 649823



to top

>gb|BT009926.1| Drosophila melanogaster SD26153 full insert cDNA
          Length = 981

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 89  gctcttcgacgtcgacggcacgct 112
           |||||||||||| |||||||||||
Sbjct: 104 gctcttcgacgtggacggcacgct 127



to top

>ref|NM_001004193.2| Mus musculus reproductive homeobox 8 (Rhox8), mRNA
          Length = 1206

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 575 ccttcttcttcttctccttc 556



to top

>gb|AC111321.8| Rattus norvegicus 4 BAC CH230-241A9 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 227849

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 4116 ccttcttcttcttctccttc 4135



to top

>emb|AL158175.7| Human DNA sequence from clone RP11-359G22 on chromosome 20 Contains the
              KRT18P3 gene for keratin 18 pseudogene 3 and a novel
             gene, complete sequence
          Length = 86025

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 41590 ccttcttcttcttctccttc 41609



to top

>gb|AC105339.9| Homo sapiens chromosome 15, clone RP11-752G15, complete sequence
          Length = 175786

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 82387 ccttcttcttcttctccttc 82368



to top

>emb|AL138773.5| Human DNA sequence from clone RP4-660B20 on chromosome 10 Contains a
              novel gene and a CpG island, complete sequence
          Length = 125661

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 115951 ccttcttcttcttctccttc 115970



to top

>gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, complete sequence
          Length = 181400

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 37186 ccttcttcttcttctccttc 37167



to top

>emb|AL121959.15|HSDJ78N10 Human DNA sequence from clone RP1-78N10 on chromosome 6q22.33-23.3
             Contains the 5' end of the EYA4 gene for eyes absent
             homolog 4 (Drosophila) (Deafness, autosomal nonsyndromic
             sensorineural, 10 (DFNA10)) and a novel gene. Contains a
             CpG island, complete sequence
          Length = 136377

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 14882 ccttcttcttcttctccttc 14901



to top

>emb|AL031727.43|HS1056L3 Human DNA sequence from clone RP5-1056L3 on chromosome 1p35.1-36.13
             Contains a novel gene, the gene for a novel protein
             (LOC374960), a ribosomal protein S14 (RPS14) pseudogene,
             the NBL1 gene for neuroblastoma suppression of
             tumorigenicity 1, the HTR6 gene for 5-hydroxytryptamine
             (serotonin) receptor 6, the 3' end of the gene for a novel
             protein (LOC255104) (FLJ45636) and two CpG islands,
             complete sequence
          Length = 163848

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     cccttcttcttcttctcctt 20
             ||||||||||||||||||||
Sbjct: 27047 cccttcttcttcttctcctt 27028



to top

>gb|AC158910.3| Mus musculus chromosome 1, clone RP23-181P16, complete sequence
          Length = 195115

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 70690 ccttcttcttcttctccttc 70709



to top

>gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, complete sequence
          Length = 166808

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      ccttcttcttcttctccttc 21
              ||||||||||||||||||||
Sbjct: 101256 ccttcttcttcttctccttc 101275



to top

>emb|AL034348.5|HS84D21 Human DNA sequence from clone RP1-84D21 on chromosome 6q15-16.3,
             complete sequence
          Length = 120514

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 87203 ccttcttcttcttctccttc 87222



to top

>gb|AC109707.5| Rattus norvegicus 13 BAC CH230-157O1 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 205150

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 19660 ccttcttcttcttctccttc 19641



to top

>ref|XM_968414.1| PREDICTED: Tribolium castaneum similar to CG4602-PA (LOC662308), mRNA
          Length = 1581

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 2    ccttcttcttcttctccttc 21
            ||||||||||||||||||||
Sbjct: 1426 ccttcttcttcttctccttc 1407



to top

>gb|AC095504.7| Rattus norvegicus 2 BAC CH230-7P18 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 227012

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 495    gagaagtatgataaggtaca 514
              ||||||||||||||||||||
Sbjct: 149419 gagaagtatgataaggtaca 149400



to top

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
              Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      ttcttcttcttctccttcgt 23
              ||||||||||||||||||||
Sbjct: 973694 ttcttcttcttctccttcgt 973675



to top

>ref|XM_794851.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
          LOC577100 (LOC577100), mRNA
          Length = 258

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 2  ccttcttcttcttctccttc 21
          ||||||||||||||||||||
Sbjct: 88 ccttcttcttcttctccttc 69



to top

>gb|AY063107.1| Arabidopsis thaliana unknown protein (At3g04550) mRNA, complete cds
          Length = 1381

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 838 ccttcttcttcttctccttc 819



to top

>gb|AY034914.1| Arabidopsis thaliana unknown protein (At3g04550) mRNA, complete cds
          Length = 1532

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 2   ccttcttcttcttctccttc 21
           ||||||||||||||||||||
Sbjct: 877 ccttcttcttcttctccttc 858



to top

>emb|CR858411.1| Pongo pygmaeus mRNA; cDNA DKFZp459M1226 (from clone
          DKFZp459M1226)
          Length = 2019

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 56 ggcggcggcggggaagagcaccgg 79
          |||||||||||||| |||||||||
Sbjct: 9  ggcggcggcggggacgagcaccgg 32



to top

>gb|AC163098.4| Mus musculus chromosome 19, clone RP23-262J17, complete sequence
          Length = 170948

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     ccttcttcttcttctccttc 21
             ||||||||||||||||||||
Sbjct: 41930 ccttcttcttcttctccttc 41911


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,047,835
Number of Sequences: 3902068
Number of extensions: 6047835
Number of successful extensions: 719024
Number of sequences better than 10.0: 483
Number of HSP's better than 10.0 without gapping: 486
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 701481
Number of HSP's gapped (non-prelim): 16656
length of query: 601
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 578
effective length of database: 17,143,297,704
effective search space: 9908826072912
effective search space used: 9908826072912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top