Clone Information

BLAST Search Result

Clone Name	bart39g03
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|BT009136.1\| Triticum aestivum clone wl1n.pk0039.e3:fis, full ...	293	3e-76
2	gb\|AY105313.1\| Zea mays PCO119881 mRNA sequence	293	3e-76
3	dbj\|AK100138.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	176	5e-41
4	dbj\|AK064613.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	176	5e-41
5	dbj\|AK060939.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	176	5e-41
6	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	165	2e-37
7	dbj\|AP003946.3\| Oryza sativa (japonica cultivar-group) genomic D...	165	2e-37
8	dbj\|AP006056.3\| Oryza sativa (japonica cultivar-group) genomic D...	165	2e-37
9	emb\|AL805961.22\| Human DNA sequence from clone RP11-718D19 on ch...	46	0.13
10	gb\|AC122369.5\| Mus musculus BAC clone RP23-454D13 from chromosom...	42	2.0
11	gb\|AC133465.12\| Mus musculus chromosome 1, clone RP24-469B15, co...	40	7.7
12	gb\|AC115947.8\| Mus musculus chromosome 5, clone RP24-560A18, com...	40	7.7
13	gb\|AC168274.5\| Mus musculus BAC RP23-229B1 (Roswell Park Cancer...	40	7.7
14	gb\|AC152956.1\| Mus musculus 6 BAC RP23-261F17 (Roswell Park Canc...	40	7.7
15	gb\|AC170875.2\| Mus musculus BAC clone RP24-266D3 from chromosome...	40	7.7
16	gb\|AC122357.4\| Mus musculus BAC clone RP23-403O8 from chromosome...	40	7.7
17	gb\|AC099884.12\| Mus musculus chromosome 15, clone RP23-11F24, co...	40	7.7
18	gb\|AC116792.17\| Mus musculus chromosome 6, clone RP24-304O23, co...	40	7.7
19	gb\|AC156952.22\| Mus musculus 10 BAC RP24-385D2 (Roswell Park Can...	40	7.7
20	gb\|AC140984.4\| Mus musculus BAC clone RP23-129D21 from chromosom...	40	7.7
21	gb\|AC130671.7\| Mus musculus chromosome 15, clone RP24-90K19, com...	40	7.7
22	gb\|AC121588.2\| Mus musculus chromosome 3 clone RP23-275K22, comp...	40	7.7
23	gb\|AC099607.6\| Mus musculus chromosome 5, clone RP23-361G20, com...	40	7.7
24	gb\|AC165356.5\| Mus musculus BAC clone RP23-142E18 from chromosom...	40	7.7
25	gb\|AC165236.5\| Mus musculus chromosome 5, clone RP23-348C18, com...	40	7.7
26	gb\|AC107811.28\| Mus musculus chromosome 3, clone RP23-69D10, com...	40	7.7
27	gb\|AC166493.6\| Mus musculus chromosome 1, clone RP24-317E14, com...	40	7.7
28	gb\|AC153558.7\| Mus musculus 10 BAC RP23-367D2 (Roswell Park Canc...	40	7.7
29	gb\|AC101802.9\| Mus musculus chromosome 1, clone RP24-221A4, comp...	40	7.7
30	gb\|AC160543.13\| Mus musculus chromosome 1, clone RP23-186L22, co...	40	7.7
31	gb\|AC101778.9\| Mus musculus chromosome 1, clone RP24-125B8, comp...	40	7.7
32	gb\|AC101991.9\| Mus musculus chromosome 1, clone RP24-372E16, com...	40	7.7
33	gb\|AC137623.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.7
34	gb\|AC163449.2\| Mus musculus chromosome 3, clone RP23-193H21, com...	40	7.7
35	gb\|AE017341.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	7.7
36	gb\|AC125253.9\| Mus musculus chromosome 1, clone RP24-141C2, comp...	40	7.7
37	gb\|AC161416.2\| Mus musculus BAC clone RP23-306A2 from chromosome...	40	7.7
38	gb\|AC102460.13\| Mus musculus chromosome 3, clone RP24-318G1, com...	40	7.7
39	gb\|AC163676.4\| Mus musculus BAC clone RP24-81A22 from chromosome...	40	7.7
40	gb\|AC104856.19\| Mus musculus chromosome 5, clone RP23-53G23, com...	40	7.7
41	gb\|AC134933.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.7
42	gb\|AC133874.10\| Mus musculus chromosome 19, clone RP23-81N16, co...	40	7.7
43	gb\|AC124597.5\| Mus musculus BAC clone RP23-21K1 from chromosome ...	40	7.7
44	gb\|AC148006.4\| Mus musculus BAC clone RP23-298P21 from chromosom...	40	7.7
45	gb\|AC132902.9\| Mus musculus chromosome 13, clone RP24-286O14, co...	40	7.7
46	gb\|AC110209.11\| Mus musculus chromosome 12, clone RP23-279O18, c...	40	7.7
47	gb\|AC144860.2\| Mus musculus BAC clone RP24-133K9 from chromosome...	40	7.7
48	gb\|AC145392.2\| Mus musculus BAC clone RP24-171E5 from chromosome...	40	7.7
49	gb\|AC145602.3\| Mus musculus BAC clone RP24-240M7 from chromosome...	40	7.7
50	gb\|AC147135.2\| Mus musculus BAC clone RP24-475E12 from chromosom...	40	7.7
51	gb\|AC139847.3\| Mus musculus BAC clone RP23-387P21 from chromosom...	40	7.7
52	gb\|AC158229.4\| Mus musculus chromosome 1, clone RP23-182F5, comp...	40	7.7
53	gb\|AC163498.3\| Mus musculus chromosome 1, clone RP23-86J11, comp...	40	7.7
54	gb\|AC102492.8\| Mus musculus chromosome 18, clone RP24-546B7, com...	40	7.7
55	gb\|AC150896.6\| Mus musculus BAC clone RP23-414N3 from chromosome...	40	7.7
56	gb\|AC121525.7\| Mus musculus chromosome 5, clone RP23-359D12, com...	40	7.7
57	gb\|AC093477.6\| Mus musculus chromosome 1, clone RP23-58B6, compl...	40	7.7
58	gb\|AC133177.3\| Mus musculus BAC clone RP24-116D7 from chromosome...	40	7.7
59	gb\|AC182456.2\| Mus musculus BAC clone RP24-65H21 from chromosome...	40	7.7
60	gb\|AY230394.1\| Triticum aestivum clone 1Nb-E3 nonfunctional FCA ...	40	7.7
61	gb\|AC138548.8\| Mus musculus chromosome 3, clone RP24-210N9, comp...	40	7.7
62	gb\|AC140386.4\| Mus musculus BAC clone RP24-88H19 from chromosome...	40	7.7
63	gb\|AC147709.1\| Mus musculus BAC clone RP24-97E15 from chromosome...	40	7.7
64	gb\|AC144672.2\| Mus musculus BAC clone RP23-287L2 from chromosome...	40	7.7
65	emb\|CR931798.8\| Mouse DNA sequence from clone RP23-89A4 on chrom...	40	7.7
66	emb\|CR974429.7\| Mouse DNA sequence from clone RP23-177B9 on chro...	40	7.7
67	gb\|AC099710.8\| Mus musculus, clone RP23-366C6, complete sequence	40	7.7
68	ref\|XM_566691.1\| Cryptococcus neoformans var. neoformans JEC21 p...	40	7.7
69	emb\|CT009594.4\| Mouse DNA sequence from clone RP23-146J6 on chro...	40	7.7
70	gb\|AC123871.4\| Mus musculus BAC clone RP23-247L8 from chromosome...	40	7.7
71	gb\|AC127250.3\| Mus musculus BAC clone RP24-482H23 from chromosom...	40	7.7
72	gb\|AC122032.4\| Mus musculus BAC clone RP24-402M18 from chromosom...	40	7.7
73	gb\|AC124369.4\| Mus musculus BAC clone RP24-549O12 from chromosom...	40	7.7
74	gb\|AC127282.3\| Mus musculus BAC clone RP23-318O24 from chromosom...	40	7.7
75	gb\|AC121796.3\| Mus musculus BAC clone RP23-423D22 from chromosom...	40	7.7
76	gb\|AC121923.3\| Mus musculus BAC clone RP24-198O18 from chromosom...	40	7.7
77	gb\|AC121777.3\| Mus musculus BAC clone RP23-359A23 from chromosom...	40	7.7
78	gb\|AC131726.3\| Mus musculus BAC clone RP23-132P9 from 3, complet...	40	7.7
79	gb\|AC125218.3\| Mus musculus BAC clone RP23-67F22 from 18, comple...	40	7.7
80	gb\|AC124175.2\| Mus musculus BAC clone RP23-183N18 from 1, comple...	40	7.7
81	gb\|AC122868.2\| Mus musculus BAC clone RP23-148H17 from 6, comple...	40	7.7
82	emb\|AL844184.14\| Mouse DNA sequence from clone RP23-284N18 on ch...	40	7.7
83	gb\|AC133157.1\| Mus musculus BAC clone RP24-472D8 from 2, complet...	40	7.7
84	gb\|AC114823.4\| Mus musculus BAC clone RP23-209L10 from 2, comple...	40	7.7
85	gb\|AC107670.10\| Mus musculus chromosome 14, clone RP23-54K15, co...	40	7.7
86	gb\|AC116744.8\| Mus musculus chromosome 19, clone RP23-79B16, com...	40	7.7
87	gb\|AC104871.8\| Mus musculus chromosome 13, clone RP23-281C23, co...	40	7.7
88	gb\|AC165160.3\| Mus musculus BAC clone RP23-200E23 from chromosom...	40	7.7
89	gb\|AC109245.11\| Mus musculus chromosome 1, clone RP23-344F24, co...	40	7.7
90	gb\|AC102590.9\| Mus musculus chromosome 12, clone RP23-335D14, co...	40	7.7
91	gb\|AC087063.20\| Mus musculus strain C57BL/6J clone rp23-20o47 ma...	40	7.7
92	gb\|AC107232.4\| Mus musculus chromosome 15, clone RP23-144B2, com...	40	7.7
93	gb\|AC114600.4\| Mus musculus chromosome 5, clone RP23-332O18, com...	40	7.7
94	gb\|AC159466.3\| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can...	40	7.7
95	gb\|AC163298.4\| Mus musculus BAC clone RP23-49H16 from chromosome...	40	7.7
96	gb\|AC107801.14\| Mus musculus, clone RP23-29M6, complete sequence	40	7.7
97	emb\|CR550303.18\| Mouse DNA sequence from clone RP24-87D8 on chro...	40	7.7
98	gb\|AC162868.2\| Mus musculus chromosome 1, clone RP24-296M22, com...	40	7.7
99	gb\|AC084324.8\| Mus musculus Strain C57BL6/J chromosome 2 BAC, RP...	40	7.7
100	gb\|AC159291.3\| Mus musculus BAC clone RP23-287P9 from chromosome...	40	7.7
101	gb\|AC157577.6\| Mus musculus chromosome 1, clone RP24-145K21, com...	40	7.7
102	gb\|AC161482.6\| Mus musculus chromosome 1, clone RP23-415K20, com...	40	7.7
103	emb\|AL731659.9\| Mouse DNA sequence from clone RP23-217J3 on chro...	40	7.7
104	emb\|AJ720180.1\| Gallus gallus mRNA for hypothetical protein, clo...	40	7.7
105	gb\|AC117589.13\| Mus musculus chromosome 18, clone RP23-222A8, co...	40	7.7
106	emb\|AL607105.15\| Mouse DNA sequence from clone RP23-371K8 on chr...	40	7.7
107	emb\|AL590616.23\| Mouse DNA sequence from clone RP23-231P12 on ch...	40	7.7
108	gb\|AC102287.16\| Mus musculus chromosome 8, clone RP24-345M16, co...	40	7.7
109	gb\|AC156023.2\| Mus musculus BAC clone RP23-210I15 from chromosom...	40	7.7
110	gb\|AC182629.3\| Mus musculus BAC clone RP24-573O8 from chromosome...	40	7.7
111	ref\|NM_001012771.1\| Gallus gallus eukaryotic translation initiat...	40	7.7
112	gb\|AE014173.1\| Mus musculus piebald deletion region section 1 of...	40	7.7
113	gb\|AC121248.2\| Homo sapiens chromosome 3 clone RP11-64C1, comple...	40	7.7
114	emb\|AL808013.9\| Mouse DNA sequence from clone RP23-188N17 on chr...	40	7.7
115	emb\|CR589880.3\| Mouse DNA sequence from clone RP23-10A18 on chro...	40	7.7
116	gb\|AC092857.17\| Rattus norvegicus clone rp32-362k5, complete seq...	40	7.7
117	emb\|AL731773.20\| Mouse DNA sequence from clone RP23-152G20 on ch...	40	7.7
118	gb\|AC084429.5\| Mus Musculus Chromosome 2 Clone RP23-291P1, compl...	40	7.7
119	gb\|AC080021.3\| Genomic sequence for Mus musculus, clone RP23-422...	40	7.7
120	gb\|AC074211.3\| Genomic sequence for Mus musculus, clone RP23-92G...	40	7.7
121	gb\|AC182447.2\| Mus musculus BAC clone RP24-476M3 from chromosome...	40	7.7
122	gb\|AC174641.3\| Mus musculus BAC clone RP24-406C15 from chromosom...	40	7.7
123	emb\|CR524822.2\| Mouse DNA sequence from clone WI1-1536G2 on chro...	40	7.7
124	gb\|AC153553.4\| Mus musculus 10 BAC RP23-329D17 (Roswell Park Can...	40	7.7
125	emb\|BX950196.7\| Mouse DNA sequence from clone RP23-287E8 on chro...	40	7.7
126	gb\|AC158626.6\| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer...	40	7.7
127	gb\|AC129334.3\| Mus musculus BAC clone RP23-108P9 from chromosome...	40	7.7
128	gb\|AE016817.2\| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	40	7.7
129	gb\|AC122937.4\| Mus musculus BAC clone RP23-24P3 from chromosome ...	40	7.7
130	gb\|AC158399.2\| Mus musculus BAC clone RP23-246A2 from chromosome...	40	7.7
131	gb\|AC157661.2\| Mus musculus BAC clone RP23-233F23 from chromosom...	40	7.7
132	emb\|BX511313.20\| Mouse DNA sequence from clone RP24-391O14 on ch...	40	7.7
133	dbj\|AK048370.1\| Mus musculus 16 days embryo head cDNA, RIKEN ful...	40	7.7
134	gb\|AC156287.12\| Mus musculus 6 BAC RP24-243F8 (Roswell Park Canc...	40	7.7
135	gb\|AC158630.5\| Mus musculus 10 BAC RP23-440F7 (Roswell Park Canc...	40	7.7
136	gb\|AC021264.5\|AC021264 Homo sapiens chromosome , clone RP11-14H1...	40	7.7
137	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.7
138	gb\|AC137875.13\| Mus musculus chromosome 15, clone RP23-62B15, co...	40	7.7
139	gb\|AC155723.6\| Mus musculus 6 BAC RP24-131B7 (Roswell Park Cance...	40	7.7
140	gb\|AC156276.6\| Mus musculus 10 BAC RP24-323L12 (Roswell Park Can...	40	7.7
141	gb\|AC155267.1\| Mus musculus BAC clone RP23-248M19 from chromosom...	40	7.7
142	gb\|AC155907.2\| Mus musculus BAC clone RP23-250B18 from chromosom...	40	7.7
143	gb\|AC133521.3\| Mus musculus BAC clone RP23-189F22 from chromosom...	40	7.7
144	gb\|AF463704.1\| Mus musculus strain C57BL/6J cytokine gene cluste...	40	7.7
145	ref\|XM_226458.2\| PREDICTED: Rattus norvegicus similar to adrift ...	40	7.7
146	gb\|AF226992.1\|AF226992 Mus musculus connexin 36 gene, complete cds	40	7.7
147	gb\|AC144715.4\| Mus musculus BAC clone RP23-295N8 from chromosome...	40	7.7
148	gb\|AF263283.1\|AF263283 Filobasidiella neoformans var. neoformans...	40	7.7
149	gb\|AC068564.1\|AC068564 Filobasidiella neoformans, complete sequence	40	7.7
150	gb\|AC146977.22\| Mus musculus chromosome 13, clone RP23-106I12, c...	40	7.7
151	gb\|AC154136.13\| Mus musculus BAC RP23-184A3 (Roswell Park Cance...	40	7.7
152	gb\|AC155324.4\| Mus musculus 10 BAC RP24-143N7 (Roswell Park Canc...	40	7.7
153	emb\|BX001066.14\| Mouse DNA sequence from clone RP23-463P1 on chr...	40	7.7
154	gb\|AC118591.7\| Mus musculus chromosome 3, clone RP24-93G19, comp...	40	7.7
155	emb\|AL670597.18\| Mouse DNA sequence from clone RP23-235P16 on ch...	40	7.7
156	emb\|AL929170.16\| Mouse DNA sequence from clone RP23-451M16 on ch...	40	7.7
157	emb\|AL845175.22\| Mouse DNA sequence from clone RP23-283M2 on chr...	40	7.7
158	emb\|AL672230.6\| Mouse DNA sequence from clone RP23-56L5 on chrom...	40	7.7
159	emb\|AL672034.5\| Mouse DNA sequence from clone RP23-461P10 on chr...	40	7.7
160	dbj\|AK121347.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.7
161	gb\|AC119176.10\| Mus musculus chromosome 1, clone RP24-359F24, co...	40	7.7
162	gb\|AC153611.12\| Mus musculus 6 BAC RP23-110P14 (Roswell Park Can...	40	7.7
163	gb\|AC154417.2\| Mus musculus BAC clone RP23-169H21 from 13, compl...	40	7.7
164	gb\|AC155924.2\| Mus musculus BAC clone RP24-366C10 from 12, compl...	40	7.7
165	ref\|NM_209606.1\| Eremothecium gossypii ADR156Cp (ADR156C), mRNA	40	7.7
166	gb\|AC154464.2\| Mus musculus BAC clone RP24-146B1 from 16, comple...	40	7.7
167	gb\|AC156019.2\| Mus musculus BAC clone RP23-348E17 from 5, comple...	40	7.7
168	gb\|AC121091.10\| Mus musculus chromosome 1, clone RP24-191N24, co...	40	7.7
169	emb\|CT841538.2\| Mouse DNA sequence from clone WI1-1741G19 on chr...	40	7.7
170	gb\|AC111056.20\| Mus musculus chromosome 3, clone RP24-537K9, com...	40	7.7
171	gb\|AC006584.12\|AC006584 Mus musculus BAC GSMB-407A4 (Genome Sys...	40	7.7
172	emb\|BX511198.8\| Mouse DNA sequence from clone RP23-390P10 on chr...	40	7.7
173	gb\|AC115689.22\| Mus musculus chromosome 9, clone RP23-166A9, com...	40	7.7
174	gb\|AC163101.9\| Mus musculus chromosome 18, clone RP24-177G6, com...	40	7.7
175	gb\|AC158785.5\| Mus musculus chromosome 8, clone RP23-182G15, com...	40	7.7
176	emb\|CT573034.8\| Mouse DNA sequence from clone RP23-156C20 on chr...	40	7.7
177	gb\|AC110885.14\| Mus musculus chromosome 7, clone RP24-342P18, co...	40	7.7
178	emb\|AL935312.10\| Mouse DNA sequence from clone RP23-56A7 on chro...	40	7.7
179	emb\|AL928850.5\| Mouse DNA sequence from clone RP23-260B13 on chr...	40	7.7
180	emb\|BX293555.7\| Mouse DNA sequence from clone RP23-202M10 on chr...	40	7.7
181	gb\|AC164978.2\| Mus musculus BAC clone RP23-342O10 from chromosom...	40	7.7
182	gb\|AC174380.3\| Mus musculus BAC clone RP24-196H4 from chromosome...	40	7.7
183	emb\|AL683896.6\| Mouse DNA sequence from clone RP23-184N2 on chro...	40	7.7
184	emb\|CR293526.28\| Mouse DNA sequence from clone RP23-9K14 on chro...	40	7.7
185	emb\|AL691474.29\| Mouse DNA sequence from clone RP23-406D5 on chr...	40	7.7
186	emb\|CT010497.9\| Mouse DNA sequence from clone RP23-239L12 on chr...	40	7.7
187	emb\|CT030166.8\| Mouse DNA sequence from clone RP23-320I11 on chr...	40	7.7
188	gb\|AC163671.5\| Mus musculus BAC clone RP23-21K2 from chromosome ...	40	7.7
189	gb\|AC149598.2\| Mus musculus BAC clone RP24-119N9 from 18, comple...	40	7.7
190	gb\|AC131797.3\| Mus musculus BAC clone RP24-496C20 from 1, comple...	40	7.7
191	gb\|AC140330.3\| Mus musculus BAC clone RP23-410I24 from 6, comple...	40	7.7
192	emb\|BX000691.12\| Mouse DNA sequence from clone RP23-107A12 on ch...	40	7.7
193	emb\|AL845169.12\| Mouse DNA sequence from clone RP23-254K17 on ch...	40	7.7
194	emb\|AL845308.11\| Mouse DNA sequence from clone RP23-31I2 on chro...	40	7.7
195	emb\|AL928912.10\| Mouse DNA sequence from clone RP23-209L8 on chr...	40	7.7
196	emb\|CT030657.5\| Mouse DNA sequence from clone RP23-142A12 on chr...	40	7.7
197	gb\|AC102467.6\| Mus musculus chromosome 1, clone RP24-348G21, com...	40	7.7
198	emb\|AL929456.11\| Mouse DNA sequence from clone RP23-26K1 on chro...	40	7.7
199	emb\|AL935137.5\| Mouse DNA sequence from clone RP23-222L4 on chro...	40	7.7
200	emb\|AL929214.6\| Mouse DNA sequence from clone RP23-195I21 on chr...	40	7.7
201	gb\|AC171325.5\| Mus musculus chromosome 3, clone RP23-124B15, com...	40	7.7
202	emb\|AL844159.7\| Mouse DNA sequence from clone RP23-285A1 on chro...	40	7.7
203	emb\|AL683818.12\| Mouse DNA sequence from clone RP23-229B23 on ch...	40	7.7
204	gb\|AC169084.3\| Mus musculus BAC clone RP24-427O13 from chromosom...	40	7.7
205	emb\|AL732296.11\| Mouse DNA sequence from clone RP23-131P6 on chr...	40	7.7
206	emb\|AL844839.6\| Mouse DNA sequence from clone RP23-191F2 on chro...	40	7.7
207	emb\|AL845542.9\| Mouse DNA sequence from clone RP23-288I12 on chr...	40	7.7
208	emb\|AL672091.4\| Mouse DNA sequence from clone RP23-185L10 on chr...	40	7.7
209	emb\|AL672067.5\| Mouse DNA sequence from clone RP23-5P1 on chromo...	40	7.7
210	emb\|AL671321.16\| Mouse DNA sequence from clone RP23-274I19 on ch...	40	7.7
211	emb\|AL845316.3\| Mouse DNA sequence from clone RP23-348I7 on chro...	40	7.7
212	emb\|AL844569.4\| Mouse DNA sequence from clone RP23-230H3 on chro...	40	7.7
213	emb\|AL772344.4\| Mouse DNA sequence from clone RP23-235J15 on chr...	40	7.7
214	emb\|AL844552.4\| Mouse DNA sequence from clone RP23-265N10 on chr...	40	7.7
215	emb\|AL772327.4\| Mouse DNA sequence from clone RP23-241B2 on chro...	40	7.7
216	emb\|AL805933.7\| Mouse DNA sequence from clone RP23-31P9 on chrom...	40	7.7
217	emb\|AL772224.2\| Mouse DNA sequence from clone RP23-131N18 on chr...	40	7.7
218	emb\|AL928720.6\| Mouse DNA sequence from clone RP23-83A3 on chrom...	40	7.7
219	emb\|AL928546.5\| Mouse DNA sequence from clone RP23-412C22 on chr...	40	7.7
220	emb\|AL671908.8\| Mouse DNA sequence from clone RP23-307G22 on chr...	40	7.7
221	emb\|AL929066.7\| Mouse DNA sequence from clone RP23-68E1 on chrom...	40	7.7
222	gb\|AC168266.2\| Mus musculus BAC clone RP24-245G1 from chromosome...	40	7.7
223	emb\|AL845417.3\| Mouse DNA sequence from clone RP23-20I9 on chrom...	40	7.7
224	emb\|AL669940.14\| Mouse DNA sequence from clone RP23-214P11 on ch...	40	7.7
225	emb\|AL672125.9\| Mouse DNA sequence from clone RP23-370I1 on chro...	40	7.7

>gb|BT009136.1| Triticum aestivum clone wl1n.pk0039.e3:fis, full insert mRNA
           sequence
          Length = 1164

 Score =  293 bits (148), Expect = 3e-76
 Identities = 277/320 (86%)
 Strand = Plus / Plus

                                                                       
Query: 246 aggcctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctc 305
           ||||| ||||||||||||||||||||||| |||||||| ||||||||||| |||||||| 
Sbjct: 145 aggccccgggtcctccttgctgcttcaggaagtgtagccgctataaaatttgagagcctt 204

                                                                       
Query: 306 tgccgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcac 365
           ||||||| |||||| ||||||||||| |||||||||||||| |||| | || | ||||||
Sbjct: 205 tgccgtagcttctctgagtgggcggatgtccgagctgtggccaccacgccatccttgcac 264

                                                                       
Query: 366 tttgttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtgg 425
           || ||||| ||||||||||| ||||| | | |||| |||||||||||||| ||||| |||
Sbjct: 265 ttcgttgatagatcatctctaccaagtggcatcgttctttacactgatgacgatgaatgg 324

                                                                       
Query: 426 tctacctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagac 485
           ||||||||||  ||||||||||| || ||  | ||||| |||||||| || |||||||||
Sbjct: 325 tctacctggaagaagataggagatgaagtcttacacatcgagctgcggaaatgggcagac 384

                                                                       
Query: 486 atcatggtgatcgcccccttatcagcaaacactctggccaagatcgccggcgggttatgc 545
            | ||||||||||| || || |||||||| || ||||| ||||||||||| |||||||||
Sbjct: 385 gttatggtgatcgctccattgtcagcaaataccctggctaagatcgccggtgggttatgc 444

                               
Query: 546 gacaacctcctgacgtgcat 565
           ||||||||| |||| |||||
Sbjct: 445 gacaacctcttgacctgcat 464

to top

>gb|AY105313.1| Zea mays PCO119881 mRNA sequence
          Length = 1165

 Score =  293 bits (148), Expect = 3e-76
 Identities = 277/320 (86%)
 Strand = Plus / Plus

                                                                       
Query: 246 aggcctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctc 305
           ||||| ||||||||||||||||||||||| |||||||| ||||||||||| |||||||| 
Sbjct: 211 aggccccgggtcctccttgctgcttcaggaagtgtagccgctataaaatttgagagcctt 270

                                                                       
Query: 306 tgccgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcac 365
           ||||||| |||||| ||||||||||| |||||||||||||| |||| | || | ||||||
Sbjct: 271 tgccgtagcttctctgagtgggcggatgtccgagctgtggccaccacgccatccttgcac 330

                                                                       
Query: 366 tttgttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtgg 425
           || ||||| ||||||||||| ||||| | | |||| |||||||||||||| ||||| |||
Sbjct: 331 ttcgttgatagatcatctctaccaagtggcatcgttctttacactgatgacgatgaatgg 390

                                                                       
Query: 426 tctacctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagac 485
           ||||||||||  ||||||||||| || ||  | ||||| |||||||| || |||||||||
Sbjct: 391 tctacctggaagaagataggagatgaagtcttacacatcgagctgcggaaatgggcagac 450

                                                                       
Query: 486 atcatggtgatcgcccccttatcagcaaacactctggccaagatcgccggcgggttatgc 545
            | ||||||||||| || || |||||||| || ||||| ||||||||||| |||||||||
Sbjct: 451 gttatggtgatcgctccattgtcagcaaataccctggctaagatcgccggtgggttatgc 510

                               
Query: 546 gacaacctcctgacgtgcat 565
           ||||||||| |||| |||||
Sbjct: 511 gacaacctcttgacctgcat 530

to top

>dbj|AK100138.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010L24, full
           insert sequence
          Length = 1128

 Score =  176 bits (89), Expect = 5e-41
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 249 cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
           |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 221 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 280

                                                                       
Query: 309 cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
           |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 281 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 340

                                                                       
Query: 369 gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
            |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 341 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 400

                                                                       
Query: 429 acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
           |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 401 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 460

                                                                       
Query: 489 atggtgatcgcccccttatcagcaaacactctggccaagatcgccggcgggttatgcgac 548
           |||||||| || || |||||||| || || || || ||||| || || || ||||| |||
Sbjct: 461 atggtgattgcgccattatcagctaataccctagctaagattgctggtggtttatgtgac 520

                            
Query: 549 aacctcctgacgtgcat 565
           |||||| |||| |||||
Sbjct: 521 aacctcttgacatgcat 537

to top

>dbj|AK064613.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-113-C02, full
           insert sequence
          Length = 1706

 Score =  176 bits (89), Expect = 5e-41
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 249 cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
           |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 184 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 243

                                                                       
Query: 309 cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
           |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 244 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 303

                                                                       
Query: 369 gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
            |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 304 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 363

                                                                       
Query: 429 acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
           |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 364 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 423

                                                                       
Query: 489 atggtgatcgcccccttatcagcaaacactctggccaagatcgccggcgggttatgcgac 548
           |||||||| || || |||||||| || || || || ||||| || || || ||||| |||
Sbjct: 424 atggtgattgcgccattatcagctaataccctagctaagattgctggtggtttatgtgac 483

                            
Query: 549 aacctcctgacgtgcat 565
           |||||| |||| |||||
Sbjct: 484 aacctcttgacatgcat 500

to top

>dbj|AK060939.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-C05, full
           insert sequence
          Length = 1111

 Score =  176 bits (89), Expect = 5e-41
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 249 cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
           |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 181 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 240

                                                                       
Query: 309 cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
           |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 241 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 300

                                                                       
Query: 369 gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
            |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 301 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 360

                                                                       
Query: 429 acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
           |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 361 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 420

                                                                       
Query: 489 atggtgatcgcccccttatcagcaaacactctggccaagatcgccggcgggttatgcgac 548
           |||||||| || || |||||||| || || || || ||||| || || || ||||| |||
Sbjct: 421 atggtgattgcgccattatcagctaataccctagctaagattgctggtggtttatgtgac 480

                            
Query: 549 aacctcctgacgtgcat 565
           |||||| |||| |||||
Sbjct: 481 aacctcttgacatgcat 497

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                           
Query: 249     cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
               |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 5066770 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 5066711

                                                                           
Query: 309     cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
               |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 5066710 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 5066651

                                                                           
Query: 369     gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
                |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 5066650 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 5066591

                                                                           
Query: 429     acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
               |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 5066590 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 5066531

                                      
Query: 489     atggtgatcgcccccttatcagc 511
               |||||||| || || ||||||||
Sbjct: 5066530 atggtgattgcgccattatcagc 5066508

to top

>dbj|AP003946.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OJ1147_D11
          Length = 138444

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                         
Query: 249   cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
             |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 25808 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 25749

                                                                         
Query: 309   cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
             |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 25748 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 25689

                                                                         
Query: 369   gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
              |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 25688 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 25629

                                                                         
Query: 429   acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
             |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 25628 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 25569

                                    
Query: 489   atggtgatcgcccccttatcagc 511
             |||||||| || || ||||||||
Sbjct: 25568 atggtgattgcgccattatcagc 25546

to top

>dbj|AP006056.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:B1172G12
          Length = 171974

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                          
Query: 249    cctcgggtcctccttgctgcttcagggagtgtagctgctataaaattcgagagcctctgc 308
              |||||||||||||||||||| || || || || |||||||||||||| |||||||| |||
Sbjct: 108884 cctcgggtcctccttgctgcctctggaagcgtcgctgctataaaatttgagagcctttgc 108825

                                                                          
Query: 309    cgtatcttctccgagtgggcggaagtccgagctgtggcgaccaagtcagcattgcacttt 368
              |||| |||||| || ||||| |||||| |||| || || |||||| |  |||| || |||
Sbjct: 108824 cgtagcttctcggaatgggcagaagtcagagccgtcgccaccaaggcttcattacatttt 108765

                                                                          
Query: 369    gttgacagatcatctctgccaagcgacgtcgtcctttacactgatgatgatgagtggtct 428
               |||| ||| | |||||||| ||| |  |  | |||||||||||||||||||| ||||||
Sbjct: 108764 attgatagaacgtctctgcctagcaatattattctttacactgatgatgatgaatggtct 108705

                                                                          
Query: 429    acctggacaaagataggagacgaggttctgcacatagagctgcgaaagtgggcagacatc 488
              |||||||  |||||||| || || ||| ||||||| || |||||||| |||||||| |||
Sbjct: 108704 acctggaagaagataggggatgaagttttgcacattgaactgcgaaaatgggcagatatc 108645

                                     
Query: 489    atggtgatcgcccccttatcagc 511
              |||||||| || || ||||||||
Sbjct: 108644 atggtgattgcgccattatcagc 108622

to top

>emb|AL805961.22| Human DNA sequence from clone RP11-718D19 on chromosome 1, complete
              sequence
          Length = 166258

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 228    tgggagctggaatccagcaggcc 250
              |||||||||||||||||||||||
Sbjct: 151861 tgggagctggaatccagcaggcc 151839

to top

>gb|AC122369.5| Mus musculus BAC clone RP23-454D13 from chromosome 6, complete sequence
          Length = 203593

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 408    actgatgatgatgagtggtct 428
              |||||||||||||||||||||
Sbjct: 154070 actgatgatgatgagtggtct 154090

to top

>gb|AC133465.12| Mus musculus chromosome 1, clone RP24-469B15, complete sequence
          Length = 166435

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 76564 ctgatgatgatgagtggtct 76545

to top

>gb|AC115947.8| Mus musculus chromosome 5, clone RP24-560A18, complete sequence
          Length = 202882

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 143480 ctgatgatgatgagtggtct 143499

to top

>gb|AC168274.5| Mus musculus  BAC RP23-229B1 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 177020

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 141438 ctgatgatgatgagtggtct 141419

to top

>gb|AC152956.1| Mus musculus 6 BAC RP23-261F17 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 177077

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 9368 ctgatgatgatgagtggtct 9387

to top

>gb|AC170875.2| Mus musculus BAC clone RP24-266D3 from chromosome 3, complete sequence
          Length = 155248

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 13364 ctgatgatgatgagtggtct 13383

to top

>gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome 13, complete sequence
          Length = 203039

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 200055 ctgatgatgatgagtggtct 200036

to top

>gb|AC099884.12| Mus musculus chromosome 15, clone RP23-11F24, complete sequence
          Length = 265797

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 194746 ctgatgatgatgagtggtct 194765

to top

>gb|AC116792.17| Mus musculus chromosome 6, clone RP24-304O23, complete sequence
          Length = 155145

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 257   cctccttgctgcttcaggga 276
             ||||||||||||||||||||
Sbjct: 79474 cctccttgctgcttcaggga 79455

to top

>gb|AC156952.22| Mus musculus 10 BAC RP24-385D2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 179140

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 56060 ctgatgatgatgagtggtct 56041

to top

>gb|AC140984.4| Mus musculus BAC clone RP23-129D21 from chromosome 3, complete sequence
          Length = 204109

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 189502 ctgatgatgatgagtggtct 189521

to top

>gb|AC130671.7| Mus musculus chromosome 15, clone RP24-90K19, complete sequence
          Length = 205646

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 23853 ctgatgatgatgagtggtct 23834

to top

>gb|AC121588.2| Mus musculus chromosome 3 clone RP23-275K22, complete sequence
          Length = 189679

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 8850 ctgatgatgatgagtggtct 8831

to top

>gb|AC099607.6| Mus musculus chromosome 5, clone RP23-361G20, complete sequence
          Length = 204179

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 60402 ctgatgatgatgagtggtct 60383

to top

>gb|AC165356.5| Mus musculus BAC clone RP23-142E18 from chromosome 7, complete sequence
          Length = 207936

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 107677 ctgatgatgatgagtggtct 107696

to top

>gb|AC165236.5| Mus musculus chromosome 5, clone RP23-348C18, complete sequence
          Length = 204772

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 179520 ctgatgatgatgagtggtct 179501

to top

>gb|AC107811.28| Mus musculus chromosome 3, clone RP23-69D10, complete sequence
          Length = 166255

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 102735 ctgatgatgatgagtggtct 102754

to top

>gb|AC166493.6| Mus musculus chromosome 1, clone RP24-317E14, complete sequence
          Length = 178538

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 72887 ctgatgatgatgagtggtct 72906

to top

>gb|AC153558.7| Mus musculus 10 BAC RP23-367D2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207823

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 185119 ctgatgatgatgagtggtct 185138

to top

>gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, complete sequence
          Length = 166975

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 127322 ctgatgatgatgagtggtct 127303

to top

>gb|AC160543.13| Mus musculus chromosome 1, clone RP23-186L22, complete sequence
          Length = 212353

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 25266 ctgatgatgatgagtggtct 25285

to top

>gb|AC101778.9| Mus musculus chromosome 1, clone RP24-125B8, complete sequence
          Length = 173893

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 93358 ctgatgatgatgagtggtct 93339

to top

>gb|AC101991.9| Mus musculus chromosome 1, clone RP24-372E16, complete sequence
          Length = 135000

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 70081 ctgatgatgatgagtggtct 70062



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 409 ctgatgatgatgagtggtct 428
           ||||||||||||||||||||
Sbjct: 471 ctgatgatgatgagtggtct 490

to top

>gb|AC137623.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0426G01,
             complete sequence
          Length = 173074

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   ccgcctccgccgccatcttc 134
             ||||||||||||||||||||
Sbjct: 17552 ccgcctccgccgccatcttc 17571

to top

>gb|AC163449.2| Mus musculus chromosome 3, clone RP23-193H21, complete sequence
          Length = 199224

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 152210 ctgatgatgatgagtggtct 152229

to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
              sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 519    ctggccaagatcgccggcgg 538
              ||||||||||||||||||||
Sbjct: 739432 ctggccaagatcgccggcgg 739451

to top

>gb|AC125253.9| Mus musculus chromosome 1, clone RP24-141C2, complete sequence
          Length = 144529

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 38646 ctgatgatgatgagtggtct 38665

to top

>gb|AC161416.2| Mus musculus BAC clone RP23-306A2 from chromosome 1, complete sequence
          Length = 196764

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 94651 ctgatgatgatgagtggtct 94670

to top

>gb|AC102460.13| Mus musculus chromosome 3, clone RP24-318G1, complete sequence
          Length = 197362

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 84965 ctgatgatgatgagtggtct 84984

to top

>gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome 3, complete sequence
          Length = 223760

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 68159 ctgatgatgatgagtggtct 68140

to top

>gb|AC104856.19| Mus musculus chromosome 5, clone RP23-53G23, complete sequence
          Length = 169800

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 86127 ctgatgatgatgagtggtct 86108

to top

>gb|AC134933.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05,
             complete sequence
          Length = 107407

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   ccgcctccgccgccatcttc 134
             ||||||||||||||||||||
Sbjct: 79397 ccgcctccgccgccatcttc 79416

to top

>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence
          Length = 215113

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 71346 ctgatgatgatgagtggtct 71327

to top

>gb|AC124597.5| Mus musculus BAC clone RP23-21K1 from chromosome 6, complete sequence
          Length = 185242

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 86380 ctgatgatgatgagtggtct 86361

to top

>gb|AC148006.4| Mus musculus BAC clone RP23-298P21 from chromosome 19, complete sequence
          Length = 209327

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 183074 ctgatgatgatgagtggtct 183093



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 169427 ctgatgatgatgagtggtct 169446

to top

>gb|AC132902.9| Mus musculus chromosome 13, clone RP24-286O14, complete sequence
          Length = 160759

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 96056 ctgatgatgatgagtggtct 96075

to top

>gb|AC110209.11| Mus musculus chromosome 12, clone RP23-279O18, complete sequence
          Length = 177587

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 64881 ctgatgatgatgagtggtct 64900

to top

>gb|AC144860.2| Mus musculus BAC clone RP24-133K9 from chromosome 17, complete sequence
          Length = 170928

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 27198 ctgatgatgatgagtggtct 27179

to top

>gb|AC145392.2| Mus musculus BAC clone RP24-171E5 from chromosome Y, complete sequence
          Length = 162238

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 30567 ctgatgatgatgagtggtct 30586

to top

>gb|AC145602.3| Mus musculus BAC clone RP24-240M7 from chromosome Y, complete sequence
          Length = 160337

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 119582 ctgatgatgatgagtggtct 119563

to top

>gb|AC147135.2| Mus musculus BAC clone RP24-475E12 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 216125 ctgatgatgatgagtggtct 216106

to top

>gb|AC139847.3| Mus musculus BAC clone RP23-387P21 from chromosome 3, complete sequence
          Length = 203824

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 184603 ctgatgatgatgagtggtct 184584

to top

>gb|AC158229.4| Mus musculus chromosome 1, clone RP23-182F5, complete sequence
          Length = 204380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 15201 ctgatgatgatgagtggtct 15182

to top

>gb|AC163498.3| Mus musculus chromosome 1, clone RP23-86J11, complete sequence
          Length = 192061

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 177974 ctgatgatgatgagtggtct 177993

to top

>gb|AC102492.8| Mus musculus chromosome 18, clone RP24-546B7, complete sequence
          Length = 149705

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 106082 ctgatgatgatgagtggtct 106101



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 38410 ctgatgatgatgagtggtct 38429

to top

>gb|AC150896.6| Mus musculus BAC clone RP23-414N3 from chromosome 1, complete sequence
          Length = 207503

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 15586 ctgatgatgatgagtggtct 15605

to top

>gb|AC121525.7| Mus musculus chromosome 5, clone RP23-359D12, complete sequence
          Length = 188700

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 37322 ctgatgatgatgagtggtct 37341

to top

>gb|AC093477.6| Mus musculus chromosome 1, clone RP23-58B6, complete sequence
          Length = 225321

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 71381 ctgatgatgatgagtggtct 71400

to top

>gb|AC133177.3| Mus musculus BAC clone RP24-116D7 from chromosome 18, complete sequence
          Length = 185838

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 182929 ctgatgatgatgagtggtct 182910

to top

>gb|AC182456.2| Mus musculus BAC clone RP24-65H21 from chromosome y, complete sequence
          Length = 194102

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 123943 ctgatgatgatgagtggtct 123962

to top

>gb|AY230394.1| Triticum aestivum clone 1Nb-E3 nonfunctional FCA protein (Fca)
           mRNA, partial sequence
          Length = 2217

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 108 gaacctaccgcctccgccgccatc 131
           |||||| |||||||||||||||||
Sbjct: 167 gaacctcccgcctccgccgccatc 144

to top

>gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, complete sequence
          Length = 155964

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 116363 ctgatgatgatgagtggtct 116382

to top

>gb|AC140386.4| Mus musculus BAC clone RP24-88H19 from chromosome Y, complete sequence
          Length = 222469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 216125 ctgatgatgatgagtggtct 216106

to top

>gb|AC147709.1| Mus musculus BAC clone RP24-97E15 from chromosome Y, complete sequence
          Length = 197983

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 188845 ctgatgatgatgagtggtct 188864

to top

>gb|AC144672.2| Mus musculus BAC clone RP23-287L2 from chromosome 18, complete sequence
          Length = 139404

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 28009 ctgatgatgatgagtggtct 27990

to top

>emb|CR931798.8| Mouse DNA sequence from clone RP23-89A4 on chromosome 4, complete
             sequence
          Length = 83980

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 75799 ctgatgatgatgagtggtct 75780

to top

>emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chromosome 12, complete
            sequence
          Length = 212593

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 4566 ctgatgatgatgagtggtct 4585

to top

>gb|AC099710.8| Mus musculus, clone RP23-366C6, complete sequence
          Length = 225122

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 115221 ctgatgatgatgagtggtct 115202

to top

>ref|XM_566691.1| Cryptococcus neoformans var. neoformans JEC21 protein phosphatase
           inhibitor (CNA02840) partial mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 519 ctggccaagatcgccggcgg 538
           ||||||||||||||||||||
Sbjct: 430 ctggccaagatcgccggcgg 449

to top

>emb|CT009594.4| Mouse DNA sequence from clone RP23-146J6 on chromosome 17, complete
             sequence
          Length = 176432

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 97466 ctgatgatgatgagtggtct 97485

to top

>gb|AC123871.4| Mus musculus BAC clone RP23-247L8 from chromosome 7, complete sequence
          Length = 184312

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 137289 ctgatgatgatgagtggtct 137308

to top

>gb|AC127250.3| Mus musculus BAC clone RP24-482H23 from chromosome 3, complete sequence
          Length = 136942

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 85354 ctgatgatgatgagtggtct 85373

to top

>gb|AC122032.4| Mus musculus BAC clone RP24-402M18 from chromosome 1, complete sequence
          Length = 161153

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 59900 ctgatgatgatgagtggtct 59881

to top

>gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosome 7, complete sequence
          Length = 147686

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 59578 ctgatgatgatgagtggtct 59559

to top

>gb|AC127282.3| Mus musculus BAC clone RP23-318O24 from chromosome 5, complete sequence
          Length = 222651

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 74642 ctgatgatgatgagtggtct 74661

to top

>gb|AC121796.3| Mus musculus BAC clone RP23-423D22 from chromosome 18, complete
             sequence
          Length = 158469

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 45530 ctgatgatgatgagtggtct 45511

to top

>gb|AC121923.3| Mus musculus BAC clone RP24-198O18 from chromosome 8, complete sequence
          Length = 172772

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 90887 ctgatgatgatgagtggtct 90868

to top

>gb|AC121777.3| Mus musculus BAC clone RP23-359A23 from chromosome 16, complete sequence
          Length = 192846

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 177631 ctgatgatgatgagtggtct 177612

to top

>gb|AC131726.3| Mus musculus BAC clone RP23-132P9 from 3, complete sequence
          Length = 190554

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 135082 ctgatgatgatgagtggtct 135063

to top

>gb|AC125218.3| Mus musculus BAC clone RP23-67F22 from 18, complete sequence
          Length = 149450

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 2991 ctgatgatgatgagtggtct 2972

to top

>gb|AC124175.2| Mus musculus BAC clone RP23-183N18 from 1, complete sequence
          Length = 227946

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 165973 ctgatgatgatgagtggtct 165954

to top

>gb|AC122868.2| Mus musculus BAC clone RP23-148H17 from 6, complete sequence
          Length = 202374

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 16535 ctgatgatgatgagtggtct 16516

to top

>emb|AL844184.14| Mouse DNA sequence from clone RP23-284N18 on chromosome X, complete
            sequence
          Length = 148500

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 7578 ctgatgatgatgagtggtct 7559

to top

>gb|AC133157.1| Mus musculus BAC clone RP24-472D8 from 2, complete sequence
          Length = 172460

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   ccatcttcaaccgcttattt 146
             ||||||||||||||||||||
Sbjct: 99201 ccatcttcaaccgcttattt 99182

to top

>gb|AC114823.4| Mus musculus BAC clone RP23-209L10 from 2, complete sequence
          Length = 170884

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 29903 ctgatgatgatgagtggtct 29884

to top

>gb|AC107670.10| Mus musculus chromosome 14, clone RP23-54K15, complete sequence
          Length = 202048

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 5212 ctgatgatgatgagtggtct 5231

to top

>gb|AC116744.8| Mus musculus chromosome 19, clone RP23-79B16, complete sequence
          Length = 236661

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 113596 ctgatgatgatgagtggtct 113577



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 99949 ctgatgatgatgagtggtct 99930

to top

>gb|AC104871.8| Mus musculus chromosome 13, clone RP23-281C23, complete sequence
          Length = 165863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 10495 ctgatgatgatgagtggtct 10514

to top

>gb|AC165160.3| Mus musculus BAC clone RP23-200E23 from chromosome 3, complete sequence
          Length = 183763

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 95451 ctgatgatgatgagtggtct 95432

to top

>gb|AC109245.11| Mus musculus chromosome 1, clone RP23-344F24, complete sequence
          Length = 206211

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 116815 ctgatgatgatgagtggtct 116834

to top

>gb|AC102590.9| Mus musculus chromosome 12, clone RP23-335D14, complete sequence
          Length = 202328

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 67899 ctgatgatgatgagtggtct 67918

to top

>gb|AC087063.20| Mus musculus strain C57BL/6J clone rp23-20o47 map 7, complete sequence
          Length = 241381

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 222980 ctgatgatgatgagtggtct 222961

to top

>gb|AC107232.4| Mus musculus chromosome 15, clone RP23-144B2, complete sequence
          Length = 204292

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 36438 ctgatgatgatgagtggtct 36457

to top

>gb|AC114600.4| Mus musculus chromosome 5, clone RP23-332O18, complete sequence
          Length = 203401

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 137977 ctgatgatgatgagtggtct 137996

to top

>gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190140

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 106558 ctgatgatgatgagtggtct 106577

to top

>gb|AC163298.4| Mus musculus BAC clone RP23-49H16 from chromosome 16, complete sequence
          Length = 141731

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 57252 ctgatgatgatgagtggtct 57233

to top

>gb|AC107801.14| Mus musculus, clone RP23-29M6, complete sequence
          Length = 283075

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 167602 ctgatgatgatgagtggtct 167621

to top

>emb|CR550303.18| Mouse DNA sequence from clone RP24-87D8 on chromosome 4, complete
              sequence
          Length = 194565

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 139639 ctgatgatgatgagtggtct 139658



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 59495 ctgatgatgatgagtggtct 59514

to top

>gb|AC162868.2| Mus musculus chromosome 1, clone RP24-296M22, complete sequence
          Length = 172586

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 134530 ctgatgatgatgagtggtct 134511



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 64920 ctgatgatgatgagtggtct 64939

to top

>gb|AC084324.8| Mus musculus Strain C57BL6/J chromosome 2 BAC, RP23-96L7 Complete
             Sequence, complete sequence
          Length = 205893

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 14394 ctgatgatgatgagtggtct 14413

to top

>gb|AC159291.3| Mus musculus BAC clone RP23-287P9 from chromosome 5, complete sequence
          Length = 197357

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 193014 ctgatgatgatgagtggtct 192995

to top

>gb|AC157577.6| Mus musculus chromosome 1, clone RP24-145K21, complete sequence
          Length = 169199

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 41733 ctgatgatgatgagtggtct 41752

to top

>gb|AC161482.6| Mus musculus chromosome 1, clone RP23-415K20, complete sequence
          Length = 190103

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 78409 ctgatgatgatgagtggtct 78428

to top

>emb|AL731659.9| Mouse DNA sequence from clone RP23-217J3 on chromosome 13 Contains the
             gene for dual specificity phosphatase TS-DSP2 and an H+
             transporting mitochondrial F0 complex ATP synthase f2
             (Atp5j2) pseudogene, complete sequence
          Length = 76568

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     agtcgctccccaattccctc 25
             ||||||||||||||||||||
Sbjct: 57995 agtcgctccccaattccctc 58014

to top

>emb|AJ720180.1| Gallus gallus mRNA for hypothetical protein, clone 12b11
          Length = 1786

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 ccgcctccgccgccatcttc 134
           ||||||||||||||||||||
Sbjct: 101 ccgcctccgccgccatcttc 82

to top

>gb|AC117589.13| Mus musculus chromosome 18, clone RP23-222A8, complete sequence
          Length = 211309

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 62364 ctgatgatgatgagtggtct 62383



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 12486 ctgatgatgatgagtggtct 12505

to top

>emb|AL607105.15| Mouse DNA sequence from clone RP23-371K8 on chromosome 13 Contains
            the gene for a novel protein similar to ribosomal protein
            S18 (Rps18), complete sequence
          Length = 54630

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 1082 ctgatgatgatgagtggtct 1063

to top

>emb|AL590616.23| Mouse DNA sequence from clone RP23-231P12 on chromosome 13 Contains
           the gene for prolactin-like protein L and the Prlpa gene
           for prolactin-like protein A, complete sequence
          Length = 202629

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 409 ctgatgatgatgagtggtct 428
           ||||||||||||||||||||
Sbjct: 919 ctgatgatgatgagtggtct 938

to top

>gb|AC102287.16| Mus musculus chromosome 8, clone RP24-345M16, complete sequence
          Length = 179888

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 143967 ctgatgatgatgagtggtct 143986

to top

>gb|AC156023.2| Mus musculus BAC clone RP23-210I15 from chromosome 16, complete sequence
          Length = 196765

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 161985 ctgatgatgatgagtggtct 161966

to top

>gb|AC182629.3| Mus musculus BAC clone RP24-573O8 from chromosome 7, complete sequence
          Length = 168009

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 74611 ctgatgatgatgagtggtct 74630

to top

>ref|NM_001012771.1| Gallus gallus eukaryotic translation initiation factor 3, subunit 1
           alpha, 35kDa (EIF3S1), mRNA
          Length = 1786

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 ccgcctccgccgccatcttc 134
           ||||||||||||||||||||
Sbjct: 101 ccgcctccgccgccatcttc 82

to top

>gb|AE014173.1| Mus musculus piebald deletion region section 1 of 11 of the complete
              sequence
          Length = 400029

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 105111 ctgatgatgatgagtggtct 105130

to top

>gb|AC121248.2| Homo sapiens chromosome 3 clone RP11-64C1, complete sequence
          Length = 185845

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 466    agctgcgaaagtgggcagacatca 489
              ||||| ||||||||||||||||||
Sbjct: 171779 agctgggaaagtgggcagacatca 171756

to top

>emb|AL808013.9| Mouse DNA sequence from clone RP23-188N17 on chromosome X, complete
              sequence
          Length = 173481

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 127924 ctgatgatgatgagtggtct 127905

to top

>emb|CR589880.3| Mouse DNA sequence from clone RP23-10A18 on chromosome 4, complete
            sequence
          Length = 40133

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 6384 ctgatgatgatgagtggtct 6403

to top

>gb|AC092857.17| Rattus norvegicus clone rp32-362k5, complete sequence
          Length = 143406

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 184  tccaagtgaagcagatggct 203
            ||||||||||||||||||||
Sbjct: 8917 tccaagtgaagcagatggct 8936

to top

>emb|AL731773.20| Mouse DNA sequence from clone RP23-152G20 on chromosome X, complete
             sequence
          Length = 162215

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 24698 ctgatgatgatgagtggtct 24717

to top

>gb|AC084429.5| Mus Musculus Chromosome 2 Clone RP23-291P1, complete sequence
          Length = 181684

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 62464 ctgatgatgatgagtggtct 62483

to top

>gb|AC080021.3| Genomic sequence for Mus musculus, clone RP23-422L7, complete sequence
          Length = 200065

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 12461 ctgatgatgatgagtggtct 12480

to top

>gb|AC074211.3| Genomic sequence for Mus musculus, clone RP23-92G8, complete sequence
          Length = 212134

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 163160 ctgatgatgatgagtggtct 163179

to top

>gb|AC182447.2| Mus musculus BAC clone RP24-476M3 from chromosome y, complete sequence
          Length = 175402

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 153387 ctgatgatgatgagtggtct 153368

to top

>gb|AC174641.3| Mus musculus BAC clone RP24-406C15 from chromosome y, complete sequence
          Length = 174265

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 76601 ctgatgatgatgagtggtct 76582

to top

>emb|CR524822.2| Mouse DNA sequence from clone WI1-1536G2 on chromosome X, complete
             sequence
          Length = 40056

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 14475 ctgatgatgatgagtggtct 14456

to top

>gb|AC153553.4| Mus musculus 10 BAC RP23-329D17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 185583

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 78573 ctgatgatgatgagtggtct 78592

to top

>emb|BX950196.7| Mouse DNA sequence from clone RP23-287E8 on chromosome 4, complete
              sequence
          Length = 170778

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 124084 ctgatgatgatgagtggtct 124065

to top

>gb|AC158626.6| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 240079

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    cctccttgctgcttcaggga 276
              ||||||||||||||||||||
Sbjct: 147355 cctccttgctgcttcaggga 147336

to top

>gb|AC129334.3| Mus musculus BAC clone RP23-108P9 from chromosome 8, complete sequence
          Length = 207032

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 104798 ctgatgatgatgagtggtct 104817

to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 465    gagctgcgaaagtgggcagacatc 488
              |||||||| |||||||||||||||
Sbjct: 978777 gagctgcgcaagtgggcagacatc 978754

to top

>gb|AC122937.4| Mus musculus BAC clone RP23-24P3 from chromosome 15, complete sequence
          Length = 196863

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 79918 ctgatgatgatgagtggtct 79899

to top

>gb|AC158399.2| Mus musculus BAC clone RP23-246A2 from chromosome 14, complete sequence
          Length = 198948

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 186353 ctgatgatgatgagtggtct 186372

to top

>gb|AC157661.2| Mus musculus BAC clone RP23-233F23 from chromosome 3, complete sequence
          Length = 195603

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 146936 ctgatgatgatgagtggtct 146917

to top

>emb|BX511313.20| Mouse DNA sequence from clone RP24-391O14 on chromosome X, complete
              sequence
          Length = 178972

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 100007 ctgatgatgatgagtggtct 100026

to top

>dbj|AK048370.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130053F07 product:L1 repeat, Tf
           subfamily, member 30, full insert sequence
          Length = 3610

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 409 ctgatgatgatgagtggtct 428
           ||||||||||||||||||||
Sbjct: 201 ctgatgatgatgagtggtct 220

to top

>gb|AC156287.12| Mus musculus 6 BAC RP24-243F8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 159846

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 122795 ctgatgatgatgagtggtct 122814

to top

>gb|AC158630.5| Mus musculus 10 BAC RP23-440F7 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 191380

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 5876 ctgatgatgatgagtggtct 5895

to top

>gb|AC021264.5|AC021264 Homo sapiens chromosome , clone RP11-14H1, complete sequence
          Length = 117083

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   caaagctgggagctggaatc 241
             ||||||||||||||||||||
Sbjct: 82587 caaagctgggagctggaatc 82606

to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 115      ccgcctccgccgccatcttc 134
                ||||||||||||||||||||
Sbjct: 20345807 ccgcctccgccgccatcttc 20345826

to top

>gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, complete sequence
          Length = 195956

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 95567 ctgatgatgatgagtggtct 95548

to top

>gb|AC155723.6| Mus musculus 6 BAC RP24-131B7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183349

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 77087 ctgatgatgatgagtggtct 77106

to top

>gb|AC156276.6| Mus musculus 10 BAC RP24-323L12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 199119

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 175756 ctgatgatgatgagtggtct 175737

to top

>gb|AC155267.1| Mus musculus BAC clone RP23-248M19 from chromosome 13, complete
             sequence
          Length = 178290

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 71914 ctgatgatgatgagtggtct 71933

to top

>gb|AC155907.2| Mus musculus BAC clone RP23-250B18 from chromosome 9, complete sequence
          Length = 183619

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 100190 ctgatgatgatgagtggtct 100209

to top

>gb|AC133521.3| Mus musculus BAC clone RP23-189F22 from chromosome 12, complete sequence
          Length = 219682

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 195411 ctgatgatgatgagtggtct 195430

to top

>gb|AF463704.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence
          Length = 2020

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 1105 ctgatgatgatgagtggtct 1124

to top

>ref|XM_226458.2| PREDICTED: Rattus norvegicus similar to adrift CG5032-PA (predicted)
            (LOC292016), mRNA
          Length = 2334

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 264  gctgcttcagggagtgtagc 283
            ||||||||||||||||||||
Sbjct: 1926 gctgcttcagggagtgtagc 1907

to top

>gb|AF226992.1|AF226992 Mus musculus connexin 36 gene, complete cds
          Length = 7600

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 127  ccatcttcaaccgcttattt 146
            ||||||||||||||||||||
Sbjct: 7354 ccatcttcaaccgcttattt 7335

to top

>gb|AC144715.4| Mus musculus BAC clone RP23-295N8 from chromosome unknown, complete
              sequence
          Length = 208503

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 109101 ctgatgatgatgagtggtct 109120

to top

>gb|AF263283.1|AF263283 Filobasidiella neoformans var. neoformans clone CRYP02, complete
             sequence
          Length = 93593

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 519   ctggccaagatcgccggcgg 538
             ||||||||||||||||||||
Sbjct: 85944 ctggccaagatcgccggcgg 85963

to top

>gb|AC068564.1|AC068564 Filobasidiella neoformans, complete sequence
          Length = 93979

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 519   ctggccaagatcgccggcgg 538
             ||||||||||||||||||||
Sbjct: 86115 ctggccaagatcgccggcgg 86134

to top

>gb|AC146977.22| Mus musculus chromosome 13, clone RP23-106I12, complete sequence
          Length = 200131

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 160703 ctgatgatgatgagtggtct 160684

to top

>gb|AC154136.13| Mus musculus  BAC RP23-184A3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 220233

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 206104 ctgatgatgatgagtggtct 206085

to top

>gb|AC155324.4| Mus musculus 10 BAC RP24-143N7 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 179677

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 107384 ctgatgatgatgagtggtct 107403

to top

>emb|BX001066.14| Mouse DNA sequence from clone RP23-463P1 on chromosome 4, complete
              sequence
          Length = 195216

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 185234 ctgatgatgatgagtggtct 185253



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 107030 ctgatgatgatgagtggtct 107049



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 30661 ctgatgatgatgagtggtct 30680

to top

>gb|AC118591.7| Mus musculus chromosome 3, clone RP24-93G19, complete sequence
          Length = 208878

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 179932 ctgatgatgatgagtggtct 179951

to top

>emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on chromosome X, complete
             sequence
          Length = 186284

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 42884 ctgatgatgatgagtggtct 42903

to top

>emb|AL929170.16| Mouse DNA sequence from clone RP23-451M16 on chromosome 2, complete
              sequence
          Length = 164121

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 109314 ctgatgatgatgagtggtct 109295

to top

>emb|AL845175.22| Mouse DNA sequence from clone RP23-283M2 on chromosome 2, complete
             sequence
          Length = 123888

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 55311 ctgatgatgatgagtggtct 55330

to top

>emb|AL672230.6| Mouse DNA sequence from clone RP23-56L5 on chromosome X, complete
             sequence
          Length = 226781

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 96300 ctgatgatgatgagtggtct 96281

to top

>emb|AL672034.5| Mouse DNA sequence from clone RP23-461P10 on chromosome X, complete
            sequence
          Length = 199101

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 1257 ctgatgatgatgagtggtct 1238

to top

>dbj|AK121347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023121J07, full
           insert sequence
          Length = 2921

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 115 ccgcctccgccgccatcttc 134
           ||||||||||||||||||||
Sbjct: 68  ccgcctccgccgccatcttc 49

to top

>gb|AC119176.10| Mus musculus chromosome 1, clone RP24-359F24, complete sequence
          Length = 208009

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 188806 ctgatgatgatgagtggtct 188787

to top

>gb|AC153611.12| Mus musculus 6 BAC RP23-110P14 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 174538

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 93077 ctgatgatgatgagtggtct 93058

to top

>gb|AC154417.2| Mus musculus BAC clone RP23-169H21 from 13, complete sequence
          Length = 233984

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 208999 ctgatgatgatgagtggtct 208980

to top

>gb|AC155924.2| Mus musculus BAC clone RP24-366C10 from 12, complete sequence
          Length = 142540

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 88960 ctgatgatgatgagtggtct 88941

to top

>ref|NM_209606.1| Eremothecium gossypii ADR156Cp (ADR156C), mRNA
          Length = 1593

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 465  gagctgcgaaagtgggcagacatc 488
            |||||||| |||||||||||||||
Sbjct: 1021 gagctgcgcaagtgggcagacatc 1044

to top

>gb|AC154464.2| Mus musculus BAC clone RP24-146B1 from 16, complete sequence
          Length = 143858

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 136550 ctgatgatgatgagtggtct 136531

to top

>gb|AC156019.2| Mus musculus BAC clone RP23-348E17 from 5, complete sequence
          Length = 204727

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 179475 ctgatgatgatgagtggtct 179456

to top

>gb|AC121091.10| Mus musculus chromosome 1, clone RP24-191N24, complete sequence
          Length = 150109

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 2450 ctgatgatgatgagtggtct 2469

to top

>emb|CT841538.2| Mouse DNA sequence from clone WI1-1741G19 on chromosome 4, complete
             sequence
          Length = 39308

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 13822 ctgatgatgatgagtggtct 13841

to top

>gb|AC111056.20| Mus musculus chromosome 3, clone RP24-537K9, complete sequence
          Length = 165443

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 117110 ctgatgatgatgagtggtct 117091

to top

>gb|AC006584.12|AC006584 Mus musculus  BAC GSMB-407A4 (Genome Systems Mouse BAC Library)
             complete sequence
          Length = 160288

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 72098 ctgatgatgatgagtggtct 72079

to top

>emb|BX511198.8| Mouse DNA sequence from clone RP23-390P10 on chromosome 4, complete
             sequence
          Length = 183261

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 24374 ctgatgatgatgagtggtct 24355

to top

>gb|AC115689.22| Mus musculus chromosome 9, clone RP23-166A9, complete sequence
          Length = 221548

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 118152 ctgatgatgatgagtggtct 118171

to top

>gb|AC163101.9| Mus musculus chromosome 18, clone RP24-177G6, complete sequence
          Length = 154555

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 52267 ctgatgatgatgagtggtct 52286

to top

>gb|AC158785.5| Mus musculus chromosome 8, clone RP23-182G15, complete sequence
          Length = 208815

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 98965 ctgatgatgatgagtggtct 98946

to top

>emb|CT573034.8| Mouse DNA sequence from clone RP23-156C20 on chromosome 13, complete
             sequence
          Length = 117658

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 75555 ctgatgatgatgagtggtct 75574

to top

>gb|AC110885.14| Mus musculus chromosome 7, clone RP24-342P18, complete sequence
          Length = 223826

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 36480 ctgatgatgatgagtggtct 36461

to top

>emb|AL935312.10| Mouse DNA sequence from clone RP23-56A7 on chromosome 2, complete
             sequence
          Length = 124236

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 26943 ctgatgatgatgagtggtct 26924

to top

>emb|AL928850.5| Mouse DNA sequence from clone RP23-260B13 on chromosome 2, complete
             sequence
          Length = 166560

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 77900 ctgatgatgatgagtggtct 77919

to top

>emb|BX293555.7| Mouse DNA sequence from clone RP23-202M10 on chromosome 2, complete
              sequence
          Length = 192154

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 119193 ctgatgatgatgagtggtct 119212

to top

>gb|AC164978.2| Mus musculus BAC clone RP23-342O10 from chromosome 14, complete
             sequence
          Length = 206840

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 43639 ctgatgatgatgagtggtct 43658

to top

>gb|AC174380.3| Mus musculus BAC clone RP24-196H4 from chromosome 7, complete sequence
          Length = 173395

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 30973 ctgatgatgatgagtggtct 30992

to top

>emb|AL683896.6| Mouse DNA sequence from clone RP23-184N2 on chromosome 2, complete
             sequence
          Length = 67308

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 13990 ctgatgatgatgagtggtct 14009

to top

>emb|CR293526.28| Mouse DNA sequence from clone RP23-9K14 on chromosome X, complete
              sequence
          Length = 211297

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 118173 ctgatgatgatgagtggtct 118192

to top

>emb|AL691474.29| Mouse DNA sequence from clone RP23-406D5 on chromosome 4, complete
             sequence
          Length = 176652

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 47540 ctgatgatgatgagtggtct 47559

to top

>emb|CT010497.9| Mouse DNA sequence from clone RP23-239L12 on chromosome 12, complete
             sequence
          Length = 189472

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 21958 ctgatgatgatgagtggtct 21977

to top

>emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chromosome 13, complete
              sequence
          Length = 222942

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 197485 ctgatgatgatgagtggtct 197466

to top

>gb|AC163671.5| Mus musculus BAC clone RP23-21K2 from chromosome 3, complete sequence
          Length = 215382

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 175724 ctgatgatgatgagtggtct 175705

to top

>gb|AC149598.2| Mus musculus BAC clone RP24-119N9 from 18, complete sequence
          Length = 161955

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 113209 ctgatgatgatgagtggtct 113190



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 63331 ctgatgatgatgagtggtct 63312

to top

>gb|AC131797.3| Mus musculus BAC clone RP24-496C20 from 1, complete sequence
          Length = 139995

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 58785 ctgatgatgatgagtggtct 58766

to top

>gb|AC140330.3| Mus musculus BAC clone RP23-410I24 from 6, complete sequence
          Length = 185681

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 33259 ctgatgatgatgagtggtct 33278

to top

>emb|BX000691.12| Mouse DNA sequence from clone RP23-107A12 on chromosome X, complete
              sequence
          Length = 117743

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 105863 ctgatgatgatgagtggtct 105844

to top

>emb|AL845169.12| Mouse DNA sequence from clone RP23-254K17 on chromosome X, complete
             sequence
          Length = 109887

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 36254 ctgatgatgatgagtggtct 36273

to top

>emb|AL845308.11| Mouse DNA sequence from clone RP23-31I2 on chromosome 2, complete
             sequence
          Length = 209309

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 94260 ctgatgatgatgagtggtct 94241

to top

>emb|AL928912.10| Mouse DNA sequence from clone RP23-209L8 on chromosome 2, complete
             sequence
          Length = 136821

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 70042 ctgatgatgatgagtggtct 70023

to top

>emb|CT030657.5| Mouse DNA sequence from clone RP23-142A12 on chromosome 13, complete
              sequence
          Length = 201402

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 169035 ctgatgatgatgagtggtct 169054

to top

>gb|AC102467.6| Mus musculus chromosome 1, clone RP24-348G21, complete sequence
          Length = 167344

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 152920 ctgatgatgatgagtggtct 152901

to top

>emb|AL929456.11| Mouse DNA sequence from clone RP23-26K1 on chromosome 4, complete
             sequence
          Length = 59271

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   ccagcaggcctcgggtcctc 260
             ||||||||||||||||||||
Sbjct: 45130 ccagcaggcctcgggtcctc 45149

to top

>emb|AL935137.5| Mouse DNA sequence from clone RP23-222L4 on chromosome 2, complete
             sequence
          Length = 27686

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   ccatcttcaaccgcttattt 146
             ||||||||||||||||||||
Sbjct: 26897 ccatcttcaaccgcttattt 26916

to top

>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete
             sequence
          Length = 43009

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 14268 ctgatgatgatgagtggtct 14249

to top

>gb|AC171325.5| Mus musculus chromosome 3, clone RP23-124B15, complete sequence
          Length = 191795

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 85942 ctgatgatgatgagtggtct 85923

to top

>emb|AL844159.7| Mouse DNA sequence from clone RP23-285A1 on chromosome X, complete
             sequence
          Length = 27698

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 26955 ctgatgatgatgagtggtct 26936

to top

>emb|AL683818.12| Mouse DNA sequence from clone RP23-229B23 on chromosome 4, complete
              sequence
          Length = 210718

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 169374 ctgatgatgatgagtggtct 169355

to top

>gb|AC169084.3| Mus musculus BAC clone RP24-427O13 from chromosome 9, complete sequence
          Length = 170491

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 18342 ctgatgatgatgagtggtct 18361

to top

>emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chromosome 2, complete
              sequence
          Length = 203503

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 125735 ctgatgatgatgagtggtct 125754

to top

>emb|AL844839.6| Mouse DNA sequence from clone RP23-191F2 on chromosome 2, complete
              sequence
          Length = 191156

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 177453 ctgatgatgatgagtggtct 177434

to top

>emb|AL845542.9| Mouse DNA sequence from clone RP23-288I12 on chromosome 2, complete
              sequence
          Length = 178976

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 105562 ctgatgatgatgagtggtct 105543

to top

>emb|AL672091.4| Mouse DNA sequence from clone RP23-185L10 on chromosome X, complete
              sequence
          Length = 206291

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 117125 ctgatgatgatgagtggtct 117144

to top

>emb|AL672067.5| Mouse DNA sequence from clone RP23-5P1 on chromosome X, complete
             sequence
          Length = 225196

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 23643 ctgatgatgatgagtggtct 23662

to top

>emb|AL671321.16| Mouse DNA sequence from clone RP23-274I19 on chromosome X, complete
              sequence
          Length = 234316

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 164739 ctgatgatgatgagtggtct 164720

to top

>emb|AL845316.3| Mouse DNA sequence from clone RP23-348I7 on chromosome X, complete
              sequence
          Length = 197688

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 136942 ctgatgatgatgagtggtct 136923

to top

>emb|AL844569.4| Mouse DNA sequence from clone RP23-230H3 on chromosome 2, complete
            sequence
          Length = 198872

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 127  ccatcttcaaccgcttattt 146
            ||||||||||||||||||||
Sbjct: 1211 ccatcttcaaccgcttattt 1230

to top

>emb|AL772344.4| Mouse DNA sequence from clone RP23-235J15 on chromosome 4, complete
             sequence
          Length = 223771

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 35494 ctgatgatgatgagtggtct 35513

to top

>emb|AL844552.4| Mouse DNA sequence from clone RP23-265N10 on chromosome 2, complete
             sequence
          Length = 77710

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 45804 ctgatgatgatgagtggtct 45785

to top

>emb|AL772327.4| Mouse DNA sequence from clone RP23-241B2 on chromosome 4, complete
              sequence
          Length = 222631

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 198473 ctgatgatgatgagtggtct 198454



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 129960 ctgatgatgatgagtggtct 129941

to top

>emb|AL805933.7| Mouse DNA sequence from clone RP23-31P9 on chromosome X, complete
             sequence
          Length = 209410

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 38987 ctgatgatgatgagtggtct 38968

to top

>emb|AL772224.2| Mouse DNA sequence from clone RP23-131N18 on chromosome 2, complete
             sequence
          Length = 182544

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 60796 ctgatgatgatgagtggtct 60815

to top

>emb|AL928720.6| Mouse DNA sequence from clone RP23-83A3 on chromosome 2, complete
            sequence
          Length = 89813

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctgatgatgatgagtggtct 428
            ||||||||||||||||||||
Sbjct: 8991 ctgatgatgatgagtggtct 8972

to top

>emb|AL928546.5| Mouse DNA sequence from clone RP23-412C22 on chromosome 2, complete
             sequence
          Length = 193834

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 40228 ctgatgatgatgagtggtct 40209

to top

>emb|AL671908.8| Mouse DNA sequence from clone RP23-307G22 on chromosome X, complete
             sequence
          Length = 205224

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 25217 ctgatgatgatgagtggtct 25198

to top

>emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chromosome 2, complete
              sequence
          Length = 210907

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 162557 ctgatgatgatgagtggtct 162576

to top

>gb|AC168266.2| Mus musculus BAC clone RP24-245G1 from chromosome 9, complete sequence
          Length = 188778

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 41551 ctgatgatgatgagtggtct 41532

to top

>emb|AL845417.3| Mouse DNA sequence from clone RP23-20I9 on chromosome 2, complete
              sequence
          Length = 144844

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctgatgatgatgagtggtct 428
              ||||||||||||||||||||
Sbjct: 104602 ctgatgatgatgagtggtct 104583

to top

>emb|AL669940.14| Mouse DNA sequence from clone RP23-214P11 on chromosome 4, complete
             sequence
          Length = 129987

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 54376 ctgatgatgatgagtggtct 54395

to top

>emb|AL672125.9| Mouse DNA sequence from clone RP23-370I1 on chromosome X, complete
             sequence
          Length = 110826

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 409   ctgatgatgatgagtggtct 428
             ||||||||||||||||||||
Sbjct: 84635 ctgatgatgatgagtggtct 84616


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,704,979
Number of Sequences: 3902068
Number of extensions: 3704979
Number of successful extensions: 64531
Number of sequences better than 10.0: 225
Number of HSP's better than 10.0 without gapping: 225
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64053
Number of HSP's gapped (non-prelim): 478
length of query: 569
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 546
effective length of database: 17,143,297,704
effective search space: 9360240546384
effective search space used: 9360240546384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result