Clone Name | bart38e06 |
---|---|
Clone Library Name | barley_pub |
>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds Length = 1372 Score = 1130 bits (570), Expect = 0.0 Identities = 585/590 (99%) Strand = Plus / Plus Query: 1 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 14 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 73 Query: 61 cgctagctagccagccggcgtcatggccaacgaggaggcgttgatgttcgcgctgcagct 120 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 74 cgctagctagccagccggcgtcatggccaacgaggaggcgttaatgttcgcgctgcagct 133 Query: 121 ggcttcgtcggctgtcctgccgatgacgcttcgcacttgcatcgagctgggcctgctgga 180 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 134 ggcttcgtcggttgtcctgccgatgacgcttcgcacttgcatcgagctgggcctgctgga 193 Query: 181 gaccctggtgggcgccggtgggaagacgttgacgccggaagaggtagcggccaagcttcc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 194 gaccctggtgggcgccggtgggaagacgttgacgccggaagaggtagcggccaagcttcc 253 Query: 241 gtccaaagcggagtccaacccggacgcggcgtccatggtggatcggttgctgcgggtact 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 254 gtccaaagcggagtccaacccggacgcggcgtccatggtggatcggttgctgcgggtact 313 Query: 301 ggcaacatacaaggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccg 360 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 314 ggcaacatacaaggtcgtttcgcgcctagtggatgagtgcgcagacgggagcctgtcccg 373 Query: 361 caggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccat 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 374 caggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccat 433 Query: 421 ggcgcccttctgcctccttgcccagaacaagctcttcatggaggcctggtgtcacatgaa 480 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 434 ggcgcccttctgcctcctagcccagaacaagctcttcatggaggcctggtgtcacatgaa 493 Query: 481 ggacgcggtccttgagggtggcagtgcattcaccaaggcattcggagcgtcgtggtttga 540 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 494 ggacgcggtccttgagggtggcagtgcattcaccaaggcattcagagcgtcgtggtttga 553 Query: 541 ctacgctggcacagatgatcacttcaatcacctctttaacgaggccatga 590 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 554 ctacgctggcacagatgatcacttcaatcacctctttaacgaggccatga 603
>dbj|AB086418.1| Hordeum vulgare gene for O-methyltransferase, partial cds, isolate:1743 Length = 1393 Score = 202 bits (102), Expect = 9e-49 Identities = 102/102 (100%) Strand = Plus / Plus Query: 1 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1289 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 1348 Query: 61 cgctagctagccagccggcgtcatggccaacgaggaggcgtt 102 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1349 cgctagctagccagccggcgtcatggccaacgaggaggcgtt 1390
>dbj|AB086417.1| Hordeum vulgare gene for O-methyltransferase, partial cds, isolate:K305 Length = 1395 Score = 202 bits (102), Expect = 9e-49 Identities = 102/102 (100%) Strand = Plus / Plus Query: 1 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1291 aagtgttagttagccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcaga 1350 Query: 61 cgctagctagccagccggcgtcatggccaacgaggaggcgtt 102 |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1351 cgctagctagccagccggcgtcatggccaacgaggaggcgtt 1392
>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA, complete cds Length = 1436 Score = 87.7 bits (44), Expect = 4e-14 Identities = 104/124 (83%) Strand = Plus / Plus Query: 82 catggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgcc 141 ||||||| |||| ||||||| |||||||| ||||||||||| |||||||| ||||| Sbjct: 74 catggccgacgaagaggcgtgcatgttcgctctgcagctggccaactcggctgtgctgcc 133 Query: 142 gatgacgcttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgg 201 |||| || || | || | ||||||||||||||| |||||||| || ||||||||||| || Sbjct: 134 gatggcgattaggacatccatcgagctgggccttctggagactcttgtgggcgccggcgg 193 Query: 202 gaag 205 |||| Sbjct: 194 gaag 197 Score = 77.8 bits (39), Expect = 4e-11 Identities = 138/171 (80%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcgcccttctgcct 435 |||||||||| ||||||| | |||||||||||||| | ||||||||| || ||| || Sbjct: 365 gccggtgtgccggtggctcgcccccaacgaggacggcgcctccatggccccgttcgctct 424 Query: 436 ccttgcccagaacaagctcttcatggaggcctggtgtcacatgaaggacgcggtccttga 495 ||| ||||| || ||||||||||||| ||||| ||||||||||||||| |||| || Sbjct: 425 cctcacccaggaccgcgtcttcatggaggcgtggtgccacatgaaggacgcgatcctgga 484 Query: 496 gggtggcagtgcattcaccaaggcattcggagcgtcgtggtttgactacgc 546 ||| ||||| || ||| || ||| ||||| |||||||||| || ||||| Sbjct: 485 gggcggcagcgcgttccacagggcgttcgggacgtcgtggttcgagtacgc 535 Score = 42.1 bits (21), Expect = 2.0 Identities = 33/37 (89%) Strand = Plus / Plus Query: 258 acccggacgcggcgtccatggtggatcggttgctgcg 294 |||||||||||||||||||| | ||||| ||||||| Sbjct: 247 acccggacgcggcgtccatgatagatcgcatgctgcg 283
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete cds Length = 1436 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Plus Query: 363 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatgg 422 |||| ||||| | |||||||||||||| ||||| ||||||||||||||||||||||||| Sbjct: 393 ggtacggcgccgcgccggtgtgcaagttcctcacccccaacgaggacggtgtctccatgg 452 Query: 423 cg 424 || Sbjct: 453 cg 454 Score = 44.1 bits (22), Expect = 0.51 Identities = 40/46 (86%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaag 205 ||||||||| ||||| ||||||||||| ||| |||||| |||||| Sbjct: 193 catcgagcttggcctcctggagaccctcatggccgccggcgggaag 238
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1425 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 421 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 468 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 85 ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 144 |||| |||||||||||| |||| ||||||||||||||| |||||| | |||||||||| Sbjct: 115 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 174 Query: 145 gacgct 150 |||||| Sbjct: 175 gacgct 180
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full insert sequence Length = 1227 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 219 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 266
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 3334155 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 3334108 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 85 ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 144 |||| |||||||||||| |||| ||||||||||||||| |||||| | |||||||||| Sbjct: 3334461 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 3334402 Query: 145 gacgct 150 |||||| Sbjct: 3334401 gacgct 3334396
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9) mRNA, complete cds Length = 1190 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 353 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 400 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 85 ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 144 |||| |||||||||||| |||| ||||||||||||||| |||||| | |||||||||| Sbjct: 47 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 106 Query: 145 gacgct 150 |||||| Sbjct: 107 gacgct 112
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid o-methyl transferase, partial cds Length = 1067 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 39 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 86
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0438H08 Length = 148626 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 111722 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 111675 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 85 ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 144 |||| |||||||||||| |||| ||||||||||||||| |||||| | |||||||||| Sbjct: 112028 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 111969 Query: 145 gacgct 150 |||||| Sbjct: 111968 gacgct 111963
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full insert sequence Length = 1425 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 376 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||||||| || |||||||||||||| ||||||||||| Sbjct: 421 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 468 Score = 67.9 bits (34), Expect = 4e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 85 ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 144 |||| |||||||||||| |||| ||||||||||||||| |||||| | |||||||||| Sbjct: 115 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 174 Query: 145 gacgct 150 |||||| Sbjct: 175 gacgct 180
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA, complete cds Length = 1371 Score = 67.9 bits (34), Expect = 4e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 219 ||||||||||||||| |||||||||||||||| |||||| || ||| | ||||||| | Sbjct: 181 catcgagctgggcctcctggagaccctggtggccgccggcggcaagctgctgacgcccgc 240 Query: 220 agaggtagcggccaagcttccgtcca 245 ||||| || |||||||| ||||||| Sbjct: 241 cgaggtggctgccaagctcccgtcca 266 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 380 gtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 424 |||||||||| || || |||||||||||||| |||||||||||| Sbjct: 395 gtgtgcaagttcctgacccccaacgaggacggcgtctccatggcg 439
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA, complete cds Length = 1430 Score = 67.9 bits (34), Expect = 4e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 363 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatgg 422 |||| ||||| | |||||||||||||| ||||| |||||||||||||| |||||||||| Sbjct: 382 ggtacggcgccgcgccggtgtgcaagttcctcacccccaacgaggacggcgtctccatgg 441 Query: 423 cg 424 || Sbjct: 442 cg 443 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaag 205 ||||||||| ||||| |||||||||||| ||| |||||| |||||| Sbjct: 185 catcgagcttggcctcctggagaccctgatggccgccggcgggaag 230
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA, complete cds Length = 1438 Score = 65.9 bits (33), Expect = 1e-07 Identities = 96/117 (82%) Strand = Plus / Plus Query: 308 tacaaggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtat 367 ||||| ||||| |||||||| ||||| ||| || ||||| |||| ||||| || || Sbjct: 311 tacaacgtcgtgtcgtgcctggtggaggagggcaaggacggccgcctctcccggagctac 370 Query: 368 ggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 424 ||||| | ||| |||||||||| ||||| |||||||||||||| |||||||||||| Sbjct: 371 ggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacggcgtctccatggcg 427
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA, complete cds Length = 1440 Score = 65.9 bits (33), Expect = 1e-07 Identities = 69/81 (85%) Strand = Plus / Plus Query: 344 gacgggagcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaac 403 |||||| |||| ||||| || || ||||| | ||| |||||||||| ||||| |||||| Sbjct: 356 gacgggcgcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaac 415 Query: 404 gaggacggtgtctccatggcg 424 |||||||| |||||||||||| Sbjct: 416 gaggacggcgtctccatggcg 436
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 65.9 bits (33), Expect = 1e-07 Identities = 96/117 (82%) Strand = Plus / Plus Query: 308 tacaaggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtat 367 ||||| ||||| |||||||| ||||| ||| || ||||| |||| ||||| || || Sbjct: 144 tacaacgtcgtgtcgtgcctggtggaggagggcaaggacggccgcctctcccggagctac 203 Query: 368 ggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 424 ||||| | ||| |||||||||| ||||| |||||||||||||| |||||||||||| Sbjct: 204 ggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacggcgtctccatggcg 260 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccgg 198 ||||||||||||||| ||||||| |||||| | |||||| Sbjct: 2 catcgagctgggcctcctggagatcctggtagccgccgg 40
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase Length = 1486 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 384 gcaagtggctcactcccaacgaggacggtgtctccatggc 423 ||||||||||||| |||||||||||||| ||||||||||| Sbjct: 436 gcaagtggctcacccccaacgaggacggcgtctccatggc 475 Score = 42.1 bits (21), Expect = 2.0 Identities = 51/61 (83%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| ||| || | ||||||| ||||||| Sbjct: 142 acgaggaggcgtgcatgtacgcgatgcagctggcgtcggcgtccatcctgcccatgacgc 201 Query: 150 t 150 | Sbjct: 202 t 202
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT) gene, complete cds Length = 2012 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 384 gcaagtggctcactcccaacgaggacggtgtctccatggc 423 ||||||||||||| |||||||||||||| ||||||||||| Sbjct: 332 gcaagtggctcacccccaacgaggacggcgtctccatggc 371 Score = 42.1 bits (21), Expect = 2.0 Identities = 51/61 (83%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| ||| || | ||||||| ||||||| Sbjct: 38 acgaggaggcgtgcatgtacgcgatgcagctggcgtcggcgtccatcctgcccatgacgc 97 Query: 150 t 150 | Sbjct: 98 t 98
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA sequence Length = 1314 Score = 60.0 bits (30), Expect = 9e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 219 |||||||||||| || |||||||||||||||| |||||| || ||| | ||||||| | Sbjct: 113 catcgagctgggtctcctggagaccctggtggccgccggcggcaagctgctgacgcccgc 172 Query: 220 agaggtagcggccaagcttccgtcca 245 ||||| || |||||||| ||||||| Sbjct: 173 cgaggtggcagccaagctcccgtcca 198 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Plus Query: 353 ctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggt 412 |||||||| |||| ||||| | ||| |||||||||| ||||| |||||||| ||||| Sbjct: 300 ctgtcccggcggtacggcgccgcgcccgtgtgcaagttcctcacccccaacgaagacggc 359 Query: 413 gtctccatggcg 424 |||||||||||| Sbjct: 360 gtctccatggcg 371
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA, complete cds Length = 1446 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 351 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 410 |||| ||||| || || ||||| | ||| |||||||||| ||||| ||||||||||||| Sbjct: 337 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 396 Query: 411 gtgtctccatggcg 424 | |||||||||||| Sbjct: 397 gcgtctccatggcg 410 Score = 46.1 bits (23), Expect = 0.13 Identities = 122/155 (78%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 ||||||| |||| |||||||| || ||||| ||||| ||| | ||||| |||||||||| Sbjct: 82 acgaggacgcgtgcatgttcgccctccagctcgcttcctcgtcggtcctcccgatgacgc 141 Query: 150 ttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgt 209 | | ||||||||| ||||| ||||||| |||||||| |||||| || ||| || Sbjct: 142 tgaagaacgccatcgagcttggcctcctggagatcctggtggccgccggcggcaagtcgc 201 Query: 210 tgacgccggaagaggtagcggccaagcttccgtcc 244 |||| ||| ||||| || |||||||| |||||| Sbjct: 202 tgaccccgaccgaggtggccgccaagctcccgtcc 236
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate o-methyltransferase (comt gene) Length = 878 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 351 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 410 |||| ||||| || || ||||| | ||| |||||||||| ||||| ||||||||||||| Sbjct: 187 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 246 Query: 411 gtgtctccatggcg 424 | |||||||||||| Sbjct: 247 gcgtctccatggcg 260 Score = 58.0 bits (29), Expect = 3e-05 Identities = 71/85 (83%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 219 ||||||||||||||| ||||||| |||||||| |||||| || ||| || |||| ||| Sbjct: 2 catcgagctgggccttctggagatcctggtggccgccggcggcaagtcgctgaccccgac 61 Query: 220 agaggtagcggccaagcttccgtcc 244 ||||| || |||||||| |||||| Sbjct: 62 cgaggtggccgccaagctcccgtcc 86
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete cds Length = 1455 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 351 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 410 |||| ||||| || || ||||| | ||| |||||||||| ||||| ||||||||||||| Sbjct: 344 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 403 Query: 411 gtgtctccatggcg 424 | |||||||||||| Sbjct: 404 gcgtctccatggcg 417 Score = 46.1 bits (23), Expect = 0.13 Identities = 122/155 (78%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 ||||||| |||| |||||||| || ||||| ||||| ||| | ||||| |||||||||| Sbjct: 89 acgaggacgcgtgcatgttcgccctccagctcgcttcctcgtcggtcctcccgatgacgc 148 Query: 150 ttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgt 209 | | ||||||||| ||||| ||||||| |||||||| |||||| || ||| || Sbjct: 149 tgaagaacgccatcgagcttggcctcctggagatcctggtggccgccggcggcaagtcgc 208 Query: 210 tgacgccggaagaggtagcggccaagcttccgtcc 244 |||| ||| ||||| || |||||||| |||||| Sbjct: 209 tgaccccgaccgaggtggccgccaagctcccgtcc 243
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid O-methyltransferase mRNA, complete cds Length = 1475 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 351 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 410 |||| ||||| || || ||||| | ||| |||||||||| ||||| ||||||||||||| Sbjct: 363 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 422 Query: 411 gtgtctccatggcg 424 | |||||||||||| Sbjct: 423 gcgtctccatggcg 436
>emb|X80669.1|ZMMRFV3 Z.mays MRFV3 mRNA Length = 392 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 16 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 56
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902 Query: 150 t 150 | Sbjct: 903 t 903
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete cds Length = 2955 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1096 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1136 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 797 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 856 Query: 150 t 150 | Sbjct: 857 t 857
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial cds Length = 2925 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070 Query: 150 t 150 | Sbjct: 1071 t 1071
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete cds Length = 3282 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070 Query: 150 t 150 | Sbjct: 1071 t 1071
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds Length = 2757 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902 Query: 150 t 150 | Sbjct: 903 t 903
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial cds Length = 2850 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1210 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1250 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 911 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 970 Query: 150 t 150 | Sbjct: 971 t 971
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds Length = 2675 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1161 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1201 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 862 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 921 Query: 150 t 150 | Sbjct: 922 t 922
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial cds Length = 2782 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902 Query: 150 t 150 | Sbjct: 903 t 903
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial cds Length = 2927 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070 Query: 150 t 150 | Sbjct: 1071 t 1071
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds Length = 3206 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1588 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1628 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1289 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1348 Query: 150 t 150 | Sbjct: 1349 t 1349
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete cds Length = 2676 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1129 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1169 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 830 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 889 Query: 150 t 150 | Sbjct: 890 t 890
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds Length = 2643 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1129 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1169 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 830 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 889 Query: 150 t 150 | Sbjct: 890 t 890
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial cds Length = 3151 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1524 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1564 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1225 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1284 Query: 150 t 150 | Sbjct: 1285 t 1285
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial cds Length = 2639 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1125 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1165 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 826 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 885 Query: 150 t 150 | Sbjct: 886 t 886
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds Length = 3102 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1487 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1527 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1188 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1247 Query: 150 t 150 | Sbjct: 1248 t 1248
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial cds Length = 3154 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1524 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1564 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1225 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1284 Query: 150 t 150 | Sbjct: 1285 t 1285
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial cds Length = 2892 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1391 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1431 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1092 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1151 Query: 150 t 150 | Sbjct: 1152 t 1152
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial cds Length = 2951 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207 Query: 150 t 150 | Sbjct: 1208 t 1208
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete cds Length = 2982 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207 Query: 150 t 150 | Sbjct: 1208 t 1208
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds Length = 2948 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207 Query: 150 t 150 | Sbjct: 1208 t 1208
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds Length = 3131 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1516 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1556 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1217 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1276 Query: 150 t 150 | Sbjct: 1277 t 1277
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds Length = 3190 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1517 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1557 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1218 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1277 Query: 150 t 150 | Sbjct: 1278 t 1278
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial cds Length = 2748 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1095 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1135 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 796 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 855 Query: 150 t 150 | Sbjct: 856 t 856
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene, complete cds Length = 3088 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1441 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1481 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1142 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1201 Query: 150 t 150 | Sbjct: 1202 t 1202
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene, complete cds Length = 3095 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207 Query: 150 t 150 | Sbjct: 1208 t 1208
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds Length = 3105 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1490 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1530 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1191 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1250 Query: 150 t 150 | Sbjct: 1251 t 1251
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds Length = 3111 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1495 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1535 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1196 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1255 Query: 150 t 150 | Sbjct: 1256 t 1256
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds Length = 3146 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1520 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1560 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1221 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1280 Query: 150 t 150 | Sbjct: 1281 t 1281
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds Length = 3073 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1456 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1496 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1157 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1216 Query: 150 t 150 | Sbjct: 1217 t 1217
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene, complete cds Length = 3061 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 1527 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1567 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 1228 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1287 Query: 150 t 150 | Sbjct: 1288 t 1288
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete cds Length = 2041 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 507 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 547 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 208 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 267 Query: 150 t 150 | Sbjct: 268 t 268
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227 Query: 150 t 150 | Sbjct: 228 t 228
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete cds Length = 2074 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 528 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 568 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 229 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 288 Query: 150 t 150 | Sbjct: 289 t 289
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete cds Length = 2326 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227 Query: 150 t 150 | Sbjct: 228 t 228
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds Length = 2512 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 383 tgcaagtggctcactcccaacgaggacggtgtctccatggc 423 |||||||||||||| |||||||||||||| || |||||||| Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 149 |||||||||||| |||| |||| |||||||||| |||||| | ||||||| ||||||| Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227 Query: 150 t 150 | Sbjct: 228 t 228
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds Length = 3312 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 384 gcaagtggctcactcccaacgaggacggtgtctccatggc 423 ||||||||||||| || ||||||||||| ||||||||||| Sbjct: 632 gcaagtggctcacccctaacgaggacggcgtctccatggc 671 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcg 130 |||||||||||| |||| |||| |||||||||| |||||| Sbjct: 344 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcg 384
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds Length = 1458 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 384 gcaagtggctcactcccaacgaggacggtgtctccatggc 423 ||||||||||||| || ||||||||||| ||||||||||| Sbjct: 435 gcaagtggctcacccctaacgaggacggcgtctccatggc 474 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Plus Query: 90 acgaggaggcgttgatgttcgcgctgcagctggcttcgtcg 130 |||||||||||| |||| |||| |||||||||| |||||| Sbjct: 147 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcg 187
>gb|AY555144.1| Vanilla planifolia caffeic acid O-methyltransferase mRNA, complete cds Length = 1219 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 395 actcccaacgaggacggtgtctccatggcgcc 426 ||||||||| ||||||| |||||||||||||| Sbjct: 355 actcccaaccaggacggcgtctccatggcgcc 386
>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA sequence Length = 1308 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 380 gtgtgcaagtggctcactcccaacgaggacgg 411 ||||| ||||||||||| |||||||||||||| Sbjct: 420 gtgtgtaagtggctcacacccaacgaggacgg 451 Score = 48.1 bits (24), Expect = 0.033 Identities = 45/52 (86%) Strand = Plus / Plus Query: 160 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttg 211 ||||||||||||| |||| |||| ||| ||||| ||||| ||||||| |||| Sbjct: 206 catcgagctgggcatgctcgagatcctcgtgggtgccggcgggaagatgttg 257
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds Length = 1233 Score = 46.1 bits (23), Expect = 0.13 Identities = 50/59 (84%) Strand = Plus / Plus Query: 363 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatg 421 |||| ||||| | ||| |||||||||| ||||| |||||||||||||| || |||||| Sbjct: 367 ggtacggcgccgcgcccgtgtgcaagtacctcacccccaacgaggacggcgtgtccatg 425
>gb|AC009372.6| Drosophila melanogaster 3L BAC RP98-48N4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175095 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 tggtggatcggttgctgcgggt 297 |||||||||||||||||||||| Sbjct: 78590 tggtggatcggttgctgcgggt 78569
>ref|NM_140803.1| Drosophila melanogaster CG14073-RB, transcript variant B (CG14073), mRNA Length = 6922 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 tggtggatcggttgctgcgggt 297 |||||||||||||||||||||| Sbjct: 134 tggtggatcggttgctgcgggt 113
>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete sequence Length = 294542 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 276 tggtggatcggttgctgcgggt 297 |||||||||||||||||||||| Sbjct: 183419 tggtggatcggttgctgcgggt 183440
>dbj|AB093137.1| Mus musculus gene for liver type neutral ceramidase, promoter region Length = 1548 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagacc 184 |||||||||||||||||||||| Sbjct: 1425 cgagctgggcctgctggagacc 1446
>dbj|AB037111.1| Mus musculus LCDase mRNA for neutral ceramidase, complete cds Length = 3108 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagacc 184 |||||||||||||||||||||| Sbjct: 125 cgagctgggcctgctggagacc 146
>gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, complete sequence Length = 190974 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 108104 cgagctgggcctgctggagac 108124
>gb|AC099783.2| Homo sapiens chromosome 3 clone RP11-115I24, complete sequence Length = 159870 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ctcaccacaaaggtttgcagt 41 ||||||||||||||||||||| Sbjct: 24222 ctcaccacaaaggtttgcagt 24202
>gb|AC092044.2| Homo sapiens chromosome 3 clone RP11-146E16, complete sequence Length = 73569 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 ctcaccacaaaggtttgcagt 41 ||||||||||||||||||||| Sbjct: 24222 ctcaccacaaaggtttgcagt 24202
>dbj|AK166100.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730038N06 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 1598 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 145 cgagctgggcctgctggagac 165
>gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, complete sequence Length = 206879 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 29204 cgagctgggcctgctggagac 29184
>dbj|AK080951.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length enriched library, clone:B430217G19 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 3323 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 133 cgagctgggcctgctggagac 153
>dbj|AK046540.1| Mus musculus adult male adrenal gland cDNA, RIKEN full-length enriched library, clone:B330020D04 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 4055 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 146 cgagctgggcctgctggagac 166
>dbj|AK042079.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630056F24 product:unclassifiable, full insert sequence Length = 1900 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 172 cgagctgggcctgctggagac 192
>dbj|AK034493.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched library, clone:9330200A12 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 3384 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 187 cgagctgggcctgctggagac 207
>dbj|AK041937.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630048A04 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 3459 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 142 cgagctgggcctgctggagac 162
>dbj|AK047692.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length enriched library, clone:C030011O21 product:N-acylsphingosine amidohydrolase 2, full insert sequence Length = 1538 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 cgagctgggcctgctggagac 183 ||||||||||||||||||||| Sbjct: 143 cgagctgggcctgctggagac 163
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 258 acccggacgcggcgtccatggtgga 282 |||||||||||||| |||||||||| Sbjct: 1536507 acccggacgcggcgcccatggtgga 1536483
>dbj|AK217207.1| Mus musculus cDNA, clone:Y2G0141A19, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000025649, based on BLAT search Length = 194 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 487 ggtccttgagggtggcagtgc 507 ||||||||||||||||||||| Sbjct: 91 ggtccttgagggtggcagtgc 71
>gb|AC135321.2| Homo sapiens chromosome 3 clone RP11-733F11, complete sequence Length = 177164 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 ctcaccacaaaggtttgcagt 41 ||||||||||||||||||||| Sbjct: 84292 ctcaccacaaaggtttgcagt 84312
>gb|AC161235.6| Mus musculus chromosome 3, clone RP24-86C19, complete sequence Length = 206729 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 430 ctgcctccttgcccagaaca 449 |||||||||||||||||||| Sbjct: 177358 ctgcctccttgcccagaaca 177377
>emb|AL096791.13|HSJ659F15 Human DNA sequence from clone RP4-659F15 on chromosome Xp11.21-11.4 Contains the PCTK1 gene for PCTAIRE protein kinase 1, the USP11 gene for ubiquitin specific protease 11 (UXH1) and a CpG Island, complete sequence Length = 41087 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 gcccttctgcctccttgccc 443 |||||||||||||||||||| Sbjct: 22265 gcccttctgcctccttgccc 22246
>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16 Length = 348706 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 173 ctgctggagaccctggtgggcgcc 196 |||||| ||||||||||||||||| Sbjct: 257321 ctgctgcagaccctggtgggcgcc 257344
>emb|BX640431.1| Bordetella parapertussis strain 12822, complete genome; segment 9/14 Length = 347894 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 173 ctgctggagaccctggtgggcgcc 196 |||||| ||||||||||||||||| Sbjct: 329006 ctgctgcagaccctggtgggcgcc 329029
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12 Length = 347071 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 173 ctgctggagaccctggtgggcgcc 196 |||||| ||||||||||||||||| Sbjct: 3883 ctgctgcagaccctggtgggcgcc 3860
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 accctggtgggcgccggtgg 201 |||||||||||||||||||| Sbjct: 6921152 accctggtgggcgccggtgg 6921171
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 gcatcgagctgggcctgctg 178 |||||||||||||||||||| Sbjct: 2767680 gcatcgagctgggcctgctg 2767699
>gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, complete sequence Length = 195448 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 ctcaccacaaaggtttgcag 40 |||||||||||||||||||| Sbjct: 75649 ctcaccacaaaggtttgcag 75668
>gb|AE004655.1| Pseudomonas aeruginosa PAO1, section 216 of 529 of the complete genome Length = 10829 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 163 cgagctgggcctgctggaga 182 |||||||||||||||||||| Sbjct: 5993 cgagctgggcctgctggaga 5974
>gb|AC104908.10| Mus musculus chromosome 3, clone RP23-325M18, complete sequence Length = 231792 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 ctgcctccttgcccagaaca 449 |||||||||||||||||||| Sbjct: 162914 ctgcctccttgcccagaaca 162895
>gb|AC174773.1| Gasterosteus aculeatus clone VMRC28-91K14, complete sequence Length = 153630 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 550 cacagatgatcacttcaatc 569 |||||||||||||||||||| Sbjct: 47923 cacagatgatcacttcaatc 47942 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,392,947 Number of Sequences: 3902068 Number of extensions: 3392947 Number of successful extensions: 59744 Number of sequences better than 10.0: 95 Number of HSP's better than 10.0 without gapping: 95 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 59284 Number of HSP's gapped (non-prelim): 459 length of query: 590 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 567 effective length of database: 17,143,297,704 effective search space: 9720249798168 effective search space used: 9720249798168 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)