ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart36e02 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550346.1| Oryza sativa (japonica cultivar-group), mRNA Length = 976 Score = 509 bits (257), Expect = e-141 Identities = 410/461 (88%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggggaggaggagatgaagctgaagcagctggagggcctc 129 |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 43 cgacggcggcggcggcggcgaggggaggaggagatgaagctgaagcagctggagggtctc 102 Query: 130 ctggggggcctgacccagttccccgaccccaaggtggagctggagcagtacgcgacgggc 189 || || | |||| |||||| ||| ||||||||||||||||||||||| || |||||| Sbjct: 103 ctcggagacctgcagcagttcaccgcacccaaggtggagctggagcagtatgcaacgggc 162 Query: 190 ccccacatcgcgtcgaggatgctctacacggcggagaacagcttcgatgacatagctggt 249 || |||||||||||| |||||||||||||||||||||| || || ||||||||| |||| Sbjct: 163 cctcacatcgcgtcgcggatgctctacacggcggagaatagttttgatgacataactggc 222 Query: 250 aaggtggtggctgattttgggtgcggctgtggtaccctggccatcgcgagtgctctgctg 309 || ||||||||||| ||||| ||||| ||||| |||||| | | || || |||||||| Sbjct: 223 aaagtggtggctgactttggctgcgggtgtggcaccctgtctgtggcaagctctctgctg 282 Query: 310 gatgctgagcatgtcactggtattgatattgacctccagtcccttgaacttgctcaagaa 369 |||||||||||||| ||| ||||||||||||| || ||||||||||||||||||||| Sbjct: 283 gatgctgagcatgttgttggaattgatattgacccgcaatcccttgaacttgctcaagaa 342 Query: 370 aatgctactgatctggagctggatatcgacttaattcagtgtgacataaagaacttaaat 429 |||||| | ||||| ||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 343 aatgctgcagatctagagctggatatcgacttaattcagtgtgatataaagaatttaaat 402 Query: 430 ttaaaaggccttcttgttgacactgttgtcatgaatcctccctttgggacaaaaagaaaa 489 || | ||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 403 ttgagaggccttcttgttgacactgttgtcatgaatcctccctttgggacaagcagaaaa 462 Query: 490 ggagctgacatggaattcctttctatgggcttgaaggttgc 530 |||||||||||||||||| ||||||||||| |||||||||| Sbjct: 463 ggagctgacatggaattcatttctatgggcatgaaggttgc 503
>dbj|AK066755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075C21, full insert sequence Length = 976 Score = 509 bits (257), Expect = e-141 Identities = 410/461 (88%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggggaggaggagatgaagctgaagcagctggagggcctc 129 |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 42 cgacggcggcggcggcggcgaggggaggaggagatgaagctgaagcagctggagggtctc 101 Query: 130 ctggggggcctgacccagttccccgaccccaaggtggagctggagcagtacgcgacgggc 189 || || | |||| |||||| ||| ||||||||||||||||||||||| || |||||| Sbjct: 102 ctcggagacctgcagcagttcaccgcacccaaggtggagctggagcagtatgcaacgggc 161 Query: 190 ccccacatcgcgtcgaggatgctctacacggcggagaacagcttcgatgacatagctggt 249 || |||||||||||| |||||||||||||||||||||| || || ||||||||| |||| Sbjct: 162 cctcacatcgcgtcgcggatgctctacacggcggagaatagttttgatgacataactggc 221 Query: 250 aaggtggtggctgattttgggtgcggctgtggtaccctggccatcgcgagtgctctgctg 309 || ||||||||||| ||||| ||||| ||||| |||||| | | || || |||||||| Sbjct: 222 aaagtggtggctgactttggctgcgggtgtggcaccctgtctgtggcaagctctctgctg 281 Query: 310 gatgctgagcatgtcactggtattgatattgacctccagtcccttgaacttgctcaagaa 369 |||||||||||||| ||| ||||||||||||| || ||||||||||||||||||||| Sbjct: 282 gatgctgagcatgttgttggaattgatattgacccgcaatcccttgaacttgctcaagaa 341 Query: 370 aatgctactgatctggagctggatatcgacttaattcagtgtgacataaagaacttaaat 429 |||||| | ||||| ||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 342 aatgctgcagatctagagctggatatcgacttaattcagtgtgatataaagaatttaaat 401 Query: 430 ttaaaaggccttcttgttgacactgttgtcatgaatcctccctttgggacaaaaagaaaa 489 || | ||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 402 ttgagaggccttcttgttgacactgttgtcatgaatcctccctttgggacaagcagaaaa 461 Query: 490 ggagctgacatggaattcctttctatgggcttgaaggttgc 530 |||||||||||||||||| ||||||||||| |||||||||| Sbjct: 462 ggagctgacatggaattcatttctatgggcatgaaggttgc 502
>gb|AF479051.1| Triticum aestivum early nodule-specific-like protein ENOD8 gene mRNA, partial cds Length = 501 Score = 464 bits (234), Expect = e-127 Identities = 252/258 (97%) Strand = Plus / Plus Query: 274 ggctgtggtaccctggccatcgcgagtgctctgctggatgctgagcatgtcactggtatt 333 ||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||| Sbjct: 4 ggctgtggtaccctggctgttgcgagtgctctgctggatgctgagcatgttactggtatt 63 Query: 334 gatattgacctccagtcccttgaacttgctcaagaaaatgctactgatctggagctggat 393 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 64 gatattgacctccagtcccttgaacttgctcaagaaaatgctactgatctagagctggat 123 Query: 394 atcgacttaattcagtgtgacataaagaacttaaatttaaaaggccttcttgttgacact 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 124 atcgacttaattcagtgtgacataaagaacttaaatttaaaaggccttcttgttgacact 183 Query: 454 gttgtcatgaatcctccctttgggacaaaaagaaaaggagctgacatggaattcctttct 513 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 184 gttgtcatgaatcctcccttcgggacaaaaagaaaaggagctgacatggaattcctttct 243 Query: 514 atgggcttgaaggttgca 531 |||||||||||||||||| Sbjct: 244 atgggcttgaaggttgca 261
>gb|AY106391.1| Zea mays PCO123453 mRNA sequence Length = 1005 Score = 416 bits (210), Expect = e-113 Identities = 397/457 (86%), Gaps = 3/457 (0%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgaggggaggaggagatgaagctgaagcagctggagggcctcctgg 133 ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| Sbjct: 143 ggcgacggcgacggc-agggg--gaggagatgaagctgaagcagctggagggcctcttgg 199 Query: 134 ggggcctgacccagttccccgaccccaaggtggagctggagcagtacgcgacgggccccc 193 | ||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||| | Sbjct: 200 gtggcctgacccagttctccgaccccaagctggagctggagcagtatgcgacgggccctc 259 Query: 194 acatcgcgtcgaggatgctctacacggcggagaacagcttcgatgacatagctggtaagg 253 ||||||||||| |||||||||||| ||| ||||| || ||| |||||||| |||| || | Sbjct: 260 acatcgcgtcgcggatgctctacatggcagagaatagtttcaatgacataactggcaaag 319 Query: 254 tggtggctgattttgggtgcggctgtggtaccctggccatcgcgagtgctctgctggatg 313 |||| ||||| || || || |||||||| || ||||| | ||||||||| | ||||||| Sbjct: 320 tggtagctgacttcggctgtggctgtggcactctggctgtggcgagtgctttactggatg 379 Query: 314 ctgagcatgtcactggtattgatattgacctccagtcccttgaacttgctcaagaaaatg 373 |||| ||||| ||||||||||||||||| ||||| |||||||||||||||||||||| Sbjct: 380 ctgaacatgttcttggtattgatattgacccacagtcacttgaacttgctcaagaaaatg 439 Query: 374 ctactgatctggagctggatatcgacttaattcagtgtgacataaagaacttaaatttaa 433 || |||||||||||||||| ||||| ||| || || ||||||||||||||||||| | | Sbjct: 440 ctgctgatctggagctggacatcgatttagtttggtctgacataaagaacttaaatctga 499 Query: 434 aaggccttcttgttgacactgttgtcatgaatcctccctttgggacaaaaagaaaaggag 493 ||||| | | |||||| |||||||||||||||||||||||||| ||| ||| || |||| Sbjct: 500 aaggcgtccatgttgatactgttgtcatgaatcctccctttggtacacgaaggaatggag 559 Query: 494 ctgacatggaattcctttctatgggcttgaaggttgc 530 | |||||||| ||||| ||||||| |||| ||||||| Sbjct: 560 cagacatggagttcctctctatggccttgcaggttgc 596
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 153 bits (77), Expect = 7e-34 Identities = 89/93 (95%) Strand = Plus / Minus Query: 435 aggccttcttgttgacactgttgtcatgaatcctccctttgggacaaaaagaaaaggagc 494 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 3154609 aggccttcttgttgacactgttgtcatgaatcctccctttgggacaagcagaaaaggagc 3154550 Query: 495 tgacatggaattcctttctatgggcttgaaggt 527 ||||||||||||| ||||||||||| ||||||| Sbjct: 3154549 tgacatggaattcatttctatgggcatgaaggt 3154517 Score = 99.6 bits (50), Expect = 9e-18 Identities = 59/62 (95%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgaggggaggaggagatgaagctgaagcagctggagggcctc 129 |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 3157380 cgacggcggcggcggcggcgaggggaggaggagatgaagctgaagcagctggagggtctc 3157321 Query: 130 ct 131 || Sbjct: 3157320 ct 3157319 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 161 aggtggagctggagcagtacgcgacgggcccccacatcgcgtcgaggatgctctacacgg 220 ||||||||||||||||||| || |||||||| |||||||||||| ||||||||||||||| Sbjct: 3157152 aggtggagctggagcagtatgcaacgggccctcacatcgcgtcgcggatgctctacacgg 3157093 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 386 agctggatatcgacttaattcagtgtgacataaagaacttaaattt 431 |||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 3155073 agctggatatcgacttaattcagtgtgatataaagaatttaaattt 3155028 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 331 attgatattgacctccagtcccttgaacttgctcaagaaaatgct 375 ||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 3155866 attgatattgacccgcaatcccttgaacttgctcaagaaaatgct 3155822 Score = 63.9 bits (32), Expect = 5e-07 Identities = 83/100 (83%) Strand = Plus / Minus Query: 219 ggcggagaacagcttcgatgacatagctggtaaggtggtggctgattttgggtgcggctg 278 ||||||||| || || ||||||||| |||| || ||||||||||| ||||| ||||| || Sbjct: 3156506 ggcggagaatagttttgatgacataactggcaaagtggtggctgactttggctgcgggtg 3156447 Query: 279 tggtaccctggccatcgcgagtgctctgctggatgctgag 318 ||| |||||| | | || || ||||||||||||||||| Sbjct: 3156446 tggcaccctgtctgtggcaagctctctgctggatgctgag 3156407 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgaggggaggaggag 102 |||| ||||||||||||||||||||||| || ||||||| Sbjct: 29900675 cgacggcgacggcgacggcgacggcgagcggcggaggag 29900637 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 2994501 gcgacggcgacggcgacggcgacggcgagg 2994530 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 25869037 cgcgacggcgacggcgacggcga 25869015 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggc 88 |||||| |||||||||||||||||||| Sbjct: 25869037 cgcgacggcgacggcgacggcgacggc 25869011 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 25261491 cgacggcgacggcgacggcgacggcga 25261517 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 5068752 cgacggcgacggcgacggcgacggcga 5068726 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgagg 92 |||||||||||||||||||||| Sbjct: 25699561 gacggcgacggcgacggcgagg 25699582 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcg 83 |||||||||||||||||||||| Sbjct: 19672905 cgcgaccgcgacggcgacggcg 19672884 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 19645008 gcgacggcgacggcgacggcga 19644987 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9995352 cggcgacggcgacggcgagggg 9995331 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9995169 cggcgacggcgacggcgagggg 9995148 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9776895 cggcgacggcgacggcgagggg 9776874 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9776712 cggcgacggcgacggcgagggg 9776691 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9170417 cggcgacggcgacggcgagggg 9170438 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6491657 gcgacggcgacggcgacggcga 6491678 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggaggaggag 102 ||||||||||||||||||| || ||||||| Sbjct: 5460028 cggcgacggcgacggcgagcggcggaggag 5459999 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 5068747 gcgacggcgacggcgacggcgacggc 5068722 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4836480 cggcgacggcgacggcgagggg 4836459 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4836297 cggcgacggcgacggcgagggg 4836276 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 29351223 gcgacggcgacggcgacggcg 29351203 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgag 91 ||||||||||||||||||||| Sbjct: 28140497 gacggcgacggcgacggcgag 28140517 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||| ||||| Sbjct: 27498460 gcgacggcgacggcgacggagaggg 27498436 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 25261496 gcgacggcgacggcgacggcgacgg 25261520 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 23990248 gcgacggcgacggcgacggcg 23990228 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcgagg 92 |||| |||||||||||||||| ||||||| Sbjct: 17606358 cgacggcgacggcgacggcgatggcgagg 17606386 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 9611976 gcgacggcgacggcgacggcg 9611996 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5859999 gcgacggcgacggcgacggcg 5859979 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 23990252 gacggcgacggcgacggcga 23990233 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 20370209 cgacggcgacggcgacggcg 20370190 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 11503733 cgacggcgacggcgacggcg 11503752 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 11498760 cgacggcgacggcgacggcg 11498741 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 9995129 gcgacggcgacggcgagggg 9995110 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 9170482 gcgacggcgacggcgagggg 9170501 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 6233576 cggcgacggcgacggcgagg 6233557 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 4906410 cgacggcgacggcgacggcg 4906391 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 3672069 gcgacggcgacggcgacggc 3672088 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 3345197 gcgacggcgacggcgacggc 3345216
>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0681F10 Length = 170371 Score = 153 bits (77), Expect = 7e-34 Identities = 89/93 (95%) Strand = Plus / Minus Query: 435 aggccttcttgttgacactgttgtcatgaatcctccctttgggacaaaaagaaaaggagc 494 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 108794 aggccttcttgttgacactgttgtcatgaatcctccctttgggacaagcagaaaaggagc 108735 Query: 495 tgacatggaattcctttctatgggcttgaaggt 527 ||||||||||||| ||||||||||| ||||||| Sbjct: 108734 tgacatggaattcatttctatgggcatgaaggt 108702 Score = 99.6 bits (50), Expect = 9e-18 Identities = 59/62 (95%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgaggggaggaggagatgaagctgaagcagctggagggcctc 129 |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 111565 cgacggcggcggcggcggcgaggggaggaggagatgaagctgaagcagctggagggtctc 111506 Query: 130 ct 131 || Sbjct: 111505 ct 111504 Score = 87.7 bits (44), Expect = 3e-14 Identities = 56/60 (93%) Strand = Plus / Minus Query: 161 aggtggagctggagcagtacgcgacgggcccccacatcgcgtcgaggatgctctacacgg 220 ||||||||||||||||||| || |||||||| |||||||||||| ||||||||||||||| Sbjct: 111337 aggtggagctggagcagtatgcaacgggccctcacatcgcgtcgcggatgctctacacgg 111278 Score = 75.8 bits (38), Expect = 1e-10 Identities = 44/46 (95%) Strand = Plus / Minus Query: 386 agctggatatcgacttaattcagtgtgacataaagaacttaaattt 431 |||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 109258 agctggatatcgacttaattcagtgtgatataaagaatttaaattt 109213 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 331 attgatattgacctccagtcccttgaacttgctcaagaaaatgct 375 ||||||||||||| || ||||||||||||||||||||||||||| Sbjct: 110051 attgatattgacccgcaatcccttgaacttgctcaagaaaatgct 110007 Score = 63.9 bits (32), Expect = 5e-07 Identities = 83/100 (83%) Strand = Plus / Minus Query: 219 ggcggagaacagcttcgatgacatagctggtaaggtggtggctgattttgggtgcggctg 278 ||||||||| || || ||||||||| |||| || ||||||||||| ||||| ||||| || Sbjct: 110691 ggcggagaatagttttgatgacataactggcaaagtggtggctgactttggctgcgggtg 110632 Query: 279 tggtaccctggccatcgcgagtgctctgctggatgctgag 318 ||| |||||| | | || || ||||||||||||||||| Sbjct: 110631 tggcaccctgtctgtggcaagctctctgctggatgctgag 110592
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 60.0 bits (30), Expect = 8e-06 Identities = 30/30 (100%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||||||||| Sbjct: 1343331 ccgcgaccgcgacggcgacggcgacggcga 1343360 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||| |||||||||||||||||||||| Sbjct: 1343337 ccgcgacggcgacggcgacggcgacggcga 1343366 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||| |||||||||||||||| Sbjct: 1343325 ccgcgaccgcgaccgcgacggcgacggcga 1343354 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||| ||||| |||||||||| Sbjct: 1343319 ccgcgaccgcgaccgcgaccgcgacggcga 1343348 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||||||||| ||||| |||| Sbjct: 1343301 ccgcgaccgcgacggcgaccgcgaccgcga 1343330 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||| ||||||||||| |||| Sbjct: 1343295 ccgcgaccgcgaccgcgacggcgaccgcga 1343324 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||| ||||| |||||||||| Sbjct: 1343289 ccgcgaccgcgaccgcgaccgcgacggcga 1343318 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 1334648 cgacggcgacggcgacggcga 1334628 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggc 88 |||| |||||||||||||||||||| Sbjct: 1334648 cgacggcgacggcgacggcgacggc 1334624
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggag 96 |||||||||||||||||||||||||||| Sbjct: 2724689 gcgacggcgacggcgacggcgaggggag 2724716 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| |||||||||||||||||||||| Sbjct: 27258766 cgcgacggcgacggcgacggcgacggcga 27258738 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgag 91 ||||| ||||||||||||||||||||||| Sbjct: 27258759 gcgacggcgacggcgacggcgacggcgag 27258731 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 30928082 gcgacggcgacggcgacggcgagg 30928105 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||||||||||||| Sbjct: 28735808 cgcgacggcgacggcgacggcgacggcg 28735781 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||||| Sbjct: 13238143 cgacggcgacggcgacggcgaggg 13238166 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 32683958 cgcgacggcgacggcgacggcga 32683980 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcg 83 ||||||||||||||||||||||| Sbjct: 31753857 ccgcgaccgcgacggcgacggcg 31753835 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 28735808 cgcgacggcgacggcgacggcga 28735786 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 7265035 gcgacggcgacggcgacggcgacggcg 7265061 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 33018653 gcgacggcgacggcgacggcga 33018674 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacgg 87 |||||| ||||||||||||||||||| Sbjct: 32683958 cgcgacggcgacggcgacggcgacgg 32683983 Score = 44.1 bits (22), Expect = 0.46 Identities = 31/34 (91%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggggaggaggaga 103 ||||| ||||| ||||| |||||||||||||||| Sbjct: 32483255 cgacgacgacgacgacgacgaggggaggaggaga 32483288 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 31021268 gcgacggcgacggcgacggcga 31021247 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgaggggag 96 |||||||||| ||||||||||||||| Sbjct: 29021969 gacggcgacgacgacggcgaggggag 29021994 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 16495251 cggcgacggcgacggcgagggg 16495272 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||| ||||||| Sbjct: 14061990 ccgcgacggcgacggcgatggcgagg 14061965 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 12407038 gcgacggcgacggcgacggcga 12407059 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 7265035 gcgacggcgacggcgacggcga 7265056 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 32113192 cgacggcgacggcgacggcga 32113212 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggagg 97 |||||||||||| ||||||||||| |||| Sbjct: 30712150 gcgacggcgacgacgacggcgaggcgagg 30712122 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 20048175 cggcgacggcgacggcgaggg 20048195 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 17098608 gcgacggcgacggcgacggcg 17098588 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 16495181 cggcgacggcgacggcgaggg 16495201 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 16495144 ggcgacggcgacggcgagggg 16495164 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 13125515 cgacggcgacggcgacggcga 13125495 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 7323461 gcgacggcgacggcgacggcg 7323441 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 6520030 gcgacggcgacggcgacggcg 6520050 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5611483 gcgacggcgacggcgacggcg 5611503 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 4355412 gcgacggcgacggcgacggcg 4355432 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 33156012 cgacggcgacggcgacggcg 33155993 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 33018653 gcgacggcgacggcgacggcgacg 33018676 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 29743931 cgacggcgacggcgacggcg 29743950 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcg 83 |||||||||||||||||||| Sbjct: 27525341 cgaccgcgacggcgacggcg 27525360 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24686830 cgacggcgacggcgacggcg 24686811 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 24139785 cggcgacggcgacggcgagg 24139804 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24114091 cgacggcgacggcgacggcg 24114072 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 15551624 gcgacggcgacggcgacggc 15551605 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 12407038 gcgacggcgacggcgacggcgacg 12407061 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 9577687 ccgcgacggcgacggcgacg 9577668 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7436886 cgacggcgacggcgacggcg 7436905 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 7356188 gacggcgacggcgacggcga 7356207 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||| ||||||||||||||||| Sbjct: 5833398 gcgacgtcgacggcgacggcgagg 5833421
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggag 96 |||||||||||||||||||||||||||| Sbjct: 2724799 gcgacggcgacggcgacggcgaggggag 2724826 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| |||||||||||||||||||||| Sbjct: 27350089 cgcgacggcgacggcgacggcgacggcga 27350061 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgag 91 ||||| ||||||||||||||||||||||| Sbjct: 27350082 gcgacggcgacggcgacggcgacggcgag 27350054 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 31018605 gcgacggcgacggcgacggcgagg 31018628 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||||||||||||| Sbjct: 28827132 cgcgacggcgacggcgacggcgacggcg 28827105 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||||| Sbjct: 13234918 cgacggcgacggcgacggcgaggg 13234941 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 32774468 cgcgacggcgacggcgacggcga 32774490 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcg 83 ||||||||||||||||||||||| Sbjct: 31844373 ccgcgaccgcgacggcgacggcg 31844351 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 28827132 cgcgacggcgacggcgacggcga 28827110 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 7262930 gcgacggcgacggcgacggcgacggcg 7262956 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 33109163 gcgacggcgacggcgacggcga 33109184 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacgg 87 |||||| ||||||||||||||||||| Sbjct: 32774468 cgcgacggcgacggcgacggcgacgg 32774493 Score = 44.1 bits (22), Expect = 0.46 Identities = 31/34 (91%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggggaggaggaga 103 ||||| ||||| ||||| |||||||||||||||| Sbjct: 32573765 cgacgacgacgacgacgacgaggggaggaggaga 32573798 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 31111791 gcgacggcgacggcgacggcga 31111770 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgaggggag 96 |||||||||| ||||||||||||||| Sbjct: 29113391 gacggcgacgacgacggcgaggggag 29113416 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 16488884 cggcgacggcgacggcgagggg 16488905 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||| ||||||| Sbjct: 14056965 ccgcgacggcgacggcgatggcgagg 14056940 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 12403801 gcgacggcgacggcgacggcga 12403822 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 7262930 gcgacggcgacggcgacggcga 7262951 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 32203704 cgacggcgacggcgacggcga 32203724 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggagg 97 |||||||||||| ||||||||||| |||| Sbjct: 30803574 gcgacggcgacgacgacggcgaggcgagg 30803546 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 20041203 cggcgacggcgacggcgaggg 20041223 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 17092177 gcgacggcgacggcgacggcg 17092157 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 16488814 cggcgacggcgacggcgaggg 16488834 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 16488777 ggcgacggcgacggcgagggg 16488797 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 13122290 cgacggcgacggcgacggcga 13122270 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 7321356 gcgacggcgacggcgacggcg 7321336 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 6519243 gcgacggcgacggcgacggcg 6519263 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5610696 gcgacggcgacggcgacggcg 5610716 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 4355527 gcgacggcgacggcgacggcg 4355547 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 33246522 cgacggcgacggcgacggcg 33246503 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 33109163 gcgacggcgacggcgacggcgacg 33109186 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 29835353 cgacggcgacggcgacggcg 29835372 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcg 83 |||||||||||||||||||| Sbjct: 27616664 cgaccgcgacggcgacggcg 27616683 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24603660 cgacggcgacggcgacggcg 24603641 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 24056719 cggcgacggcgacggcgagg 24056738 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24031156 cgacggcgacggcgacggcg 24031137 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 15546158 gcgacggcgacggcgacggc 15546139 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 12403801 gcgacggcgacggcgacggcgacg 12403824 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 9575808 ccgcgacggcgacggcgacg 9575789 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7434721 cgacggcgacggcgacggcg 7434740 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 7354083 gacggcgacggcgacggcga 7354102 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||| ||||||||||||||||| Sbjct: 5832611 gcgacgtcgacggcgacggcgagg 5832634
>gb|AC105734.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0050N02, complete sequence Length = 133373 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggag 96 |||||||||||||||||||||||||||| Sbjct: 69608 gcgacggcgacggcgacggcgaggggag 69635
>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07, complete sequence Length = 164477 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggaggaggaga 103 |||||| |||||||||||||||| ||||||||||| Sbjct: 99461 gcgacgtcgacggcgacggcgagcggaggaggaga 99427 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 68601 cgaccacgacggcgacggcgacgccgaggg 68630 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 57245 cgaccacgacggcgacggcgacgccgaggg 57216 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 77117 ccgcgacggcgacggcgacg 77136
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggaggaggaga 103 |||||| |||||||||||||||| ||||||||||| Sbjct: 895037 gcgacgtcgacggcgacggcgagcggaggaggaga 895003 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 5159186 gcgacggcgacggcgacggcgaggg 5159162 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||||||||| Sbjct: 2302433 ccgcgacggcgacggcgacggcgacggcg 2302461 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 25236171 gcgacggcgacggcgacggcgagg 25236194 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 23915253 gcgacggcgacggcgacggcgacggcga 23915280 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 2302433 ccgcgacggcgacggcgacggcga 2302456 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 8753536 gcgacggcgacggcgacggcgacggcg 8753510 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 28476344 gcgacggcgacggcgacggcga 28476323 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 24537810 gcgacggcgacggcgacggcga 24537789 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 72 acggcgacggcgacggcgaggg 93 |||||||||||||||||||||| Sbjct: 22640427 acggcgacggcgacggcgaggg 22640406 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgagg 92 |||||||||||||||||||||| Sbjct: 17851500 gacggcgacggcgacggcgagg 17851479 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 8753536 gcgacggcgacggcgacggcga 8753515 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6522220 gcgacggcgacggcgacggcga 6522199 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 5159001 cggcgacggcgacggcgagggg 5158980 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 5072143 cggcgacggcgacggcgagggg 5072164 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 5071960 cggcgacggcgacggcgagggg 5071981 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 2157288 gcgacggcgacggcgacggcga 2157267 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||| Sbjct: 2134512 ccgcgccggcgacggcgacggcgagg 2134537 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 864178 cgaccacgacggcgacggcgacgccgaggg 864207 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 852822 cgaccacgacggcgacggcgacgccgaggg 852793 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcgagg 92 |||||||||||||||||||| |||| Sbjct: 28084330 cgcgacggcgacggcgacggggagg 28084354 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 27679720 cggcgacggcgacggcgaggg 27679700 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 26204754 gcgacggcgacggcgacggcg 26204734 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 |||||||||||||||| |||||||| Sbjct: 24988296 gcgacggcgacggcgagggcgaggg 24988272 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 23636692 gcgacggcgacggcgacggcg 23636712 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 23241642 cgacggcgacggcgacggcga 23241622 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 22763245 cgacggcgacggcgacggcga 22763225 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggc 88 |||| |||||||||||||||||||| Sbjct: 22763245 cgacggcgacggcgacggcgacggc 22763221 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 |||||||||||||||| |||||||| Sbjct: 22640424 gcgacggcgacggcgagggcgaggg 22640400 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 17818092 cgacggcgacggcgacggcga 17818112 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 7148840 gcgacggcgacggcgacggcg 7148820 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 6843022 gcgacggcgacggcgacggcg 6843042 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 3279162 gcgacggcgacggcgacggcg 3279142 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2907220 gcgacggcgacggcgacggcg 2907200 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2652038 gcgacggcgacggcgacggcg 2652018 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 29019406 cgacggcgacggcgacggcg 29019387 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 28476348 gacggcgacggcgacggcga 28476329 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 28476344 gcgacggcgacggcgacggcgacg 28476321 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 74 ggcgacggcgacggcgaggg 93 |||||||||||||||||||| Sbjct: 24988297 ggcgacggcgacggcgaggg 24988278 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 24537810 gcgacggcgacggcgacggcgacg 24537787 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 24415428 gcgacggcgacggcgacggc 24415447 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 23544138 cggcgacggcgacggcgagg 23544119 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 23167823 cgacggcgacggcgacggcg 23167804 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||| ||||||||| Sbjct: 22307402 gcgacggcgacggcgacgacgacggcga 22307375 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgagggg 94 ||||||| |||||||||||||||| Sbjct: 21937119 gacggcggcggcgacggcgagggg 21937142 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggggagg 97 |||||||| ||||| ||||||||||||| Sbjct: 18090952 cgacggcggcggcgtcggcgaggggagg 18090979 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 17032286 cggcgacggcgacggcgagg 17032267 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcg 83 |||||||||||||||||||| Sbjct: 14227894 cgaccgcgacggcgacggcg 14227875 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 12595123 cgacggcgacggcgacggcg 12595104 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 12586627 cgacggcgacggcgacggcg 12586608 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 6689201 gcgacggcgacggcgacggc 6689220 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 6522220 gcgacggcgacggcgacggcgacg 6522197 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 6426267 gcgacggcgacggcgacggc 6426286 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 6227580 cgacggcgacggcgacggcg 6227561 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 2907224 gacggcgacggcgacggcga 2907205 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 2792532 cggcgacggcgacggcgagg 2792513 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacg 80 |||||||||||||||||||| Sbjct: 2187317 ccgcgaccgcgacggcgacg 2187336 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 872693 ccgcgacggcgacggcgacg 872712
>dbj|AP003614.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0481E08 Length = 171965 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgaggggaggaggag 102 |||| ||||||||||||||||||||||| || ||||||| Sbjct: 96188 cgacggcgacggcgacggcgacggcgagcggcggaggag 96150
>ref|XM_482139.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1469 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 149 gcgacggcgacggcgacggcgagggg 124
>ref|XM_471612.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 579 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 50 gcgacggcgacggcgacggcgacggcgagg 21 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 54 gacggcgacggcgacggcga 35
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 12687109 gcgacggcgacggcgacggcgacggcgagg 12687080 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 4399134 cgacggcgacggcgacggcgagg 4399112 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 22329368 cgacggcgacggcgacggcgacggcg 22329393 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 20918591 gcgacggcgacggcgacggcga 20918570 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 18901443 cggcgacggcgacggcgagggg 18901422 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 18549871 gcgacggcgacggcgacggcga 18549850 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 8707785 cggcgacggcgacggcgagggg 8707764 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 8707602 cggcgacggcgacggcgagggg 8707581 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcg 89 |||||||||||||||||||||| Sbjct: 6977826 cgcgacggcgacggcgacggcg 6977805 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4813189 cggcgacggcgacggcgagggg 4813210 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcg 89 |||||||||||||||||||||| Sbjct: 2144551 cgcgacggcgacggcgacggcg 2144572 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1930091 cggcgacggcgacggcgagggg 1930112 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1929916 cggcgacggcgacggcgagggg 1929937 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1170736 cggcgacggcgacggcgagggg 1170715 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1170553 cggcgacggcgacggcgagggg 1170532 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggc 88 |||| |||||||||||||||||||| Sbjct: 31992322 cgacggcgacggcgacggcgacggc 31992346 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 31992322 cgacggcgacggcgacggcga 31992342 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 31068935 gcgacggcgacggcgacggcg 31068915 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 28213895 gcgacggcgacggcgacggcg 28213915 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 23954514 gcgacggcgacggcgacggcg 23954534 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 22329368 cgacggcgacggcgacggcga 22329388 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 20633595 cgacggcgacggcgacggcga 20633575 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 18901624 cggcgacggcgacggcgaggg 18901604 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 72 acggcgacggcgacggcgagg 92 ||||||||||||||||||||| Sbjct: 18706859 acggcgacggcgacggcgagg 18706839 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 8049306 cgacggcgacggcgacggcga 8049286 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggc 88 |||| |||||||||||||||||||| Sbjct: 8049306 cgacggcgacggcgacggcgacggc 8049282 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 3602635 cgacggcgacggcgacggcga 3602615 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 34535404 ccgcgacggcgacggcgacg 34535385 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 30737049 gacggcgacggcgacggcga 30737068 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 acggcgacggcgacggcgagggga 95 |||||| ||||||||||||||||| Sbjct: 24944819 acggcggcggcgacggcgagggga 24944842 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||||||| |||||| Sbjct: 23954514 gcgacggcgacggcgacggcgccggcga 23954541 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||| Sbjct: 22937040 ccgcggcggcgacggcgacggcga 22937063 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 19284531 cgacggcgacggcgacggcg 19284550 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||| ||||| Sbjct: 14861147 ccgcgacggcgacggcgatggcga 14861170 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 14271074 cgacggcgacggcgacggcg 14271055 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 12687113 gacggcgacggcgacggcga 12687094 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 1170513 gcgacggcgacggcgagggg 1170494
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||||| Sbjct: 24560944 ccgcgacggcgacggcgacggcgagg 24560969 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 22838630 gcgacggcgacggcgacggcgagggg 22838605 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 9195259 gcgacggcgacggcgacggcgagggg 9195234 Score = 50.1 bits (25), Expect = 0.007 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg-ggaggagga 101 ||||||||||||||||||||||| ||||||||| Sbjct: 26995906 cgacggcgacggcgacggcgaggaggaggagga 26995874 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggag 96 ||||||||||||||||||||||| |||| Sbjct: 25990836 gcgacggcgacggcgacggcgagaggag 25990863 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 6755283 gcgacggcgacggcgacggcgagg 6755306 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1721266 gcgacggcgacggcgacggcgacggcga 1721293 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1721260 gcgacggcgacggcgacggcgacggcga 1721287 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 26471202 gcgacggcgacggcgacggcgag 26471180 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 25090808 ccgcgacggcgacggcgacggcg 25090786 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 10572678 cgcgacggcgacggcgacggcga 10572700 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 1721272 gcgacggcgacggcgacggcgacggcg 1721298 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 24071363 gcgacggcgacggcgacggcga 24071342 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 22838411 cggcgacggcgacggcgagggg 22838390 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21871829 cggcgacggcgacggcgagggg 21871850 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21871771 cggcgacggcgacggcgagggg 21871792 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 20178276 gcgacggcgacggcgacggcga 20178297 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 16027619 cggcgacggcgacggcgagggg 16027640 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15241282 cggcgacggcgacggcgagggg 15241261 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15241082 cggcgacggcgacggcgagggg 15241061 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9195444 cggcgacggcgacggcgagggg 9195423 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcg 89 |||||||||||||||||||||| Sbjct: 7940503 cgcgacggcgacggcgacggcg 7940482 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6346105 gcgacggcgacggcgacggcga 6346084 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgagg 92 |||||||||||||||||||||| Sbjct: 2705322 gacggcgacggcgacggcgagg 2705301 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 1854020 cgacggcgacggcgacggcgag 1854041 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggagg 97 ||||||||||||||||||| ||||| Sbjct: 26696999 cggcgacggcgacggcgagcggagg 26696975 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||| ||||| Sbjct: 25090808 ccgcgacggcgacggcgacggcggcggcg 25090780 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 18893293 cggcgacggcgacggcgaggg 18893313 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 6346105 gcgacggcgacggcgacggcgacgg 6346081 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2677197 gcgacggcgacggcgacggcg 2677177 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 2396670 cgacggcgacggcgacggcga 2396650 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1721221 gcgacggcgacggcgacggcg 1721241 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 24905154 gacggcgacggcgacggcga 24905173 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| || ||||||||||||||||||| Sbjct: 24655333 gcgacggctacggcgacggcgacggcga 24655306 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcga 84 ||||||| |||||||||||||||| Sbjct: 24560944 ccgcgacggcgacggcgacggcga 24560967 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 24209230 cggcgacggcgacggcgagg 24209211 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 22681911 gcgacggcgacggcgacggc 22681930 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 20178276 gcgacggcgacggcgacggcgacg 20178299 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 17819057 cgacggcgacggcgacggcg 17819038 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 17521509 cgacggcgacggcgacggcg 17521528 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 16027271 gcgacggcgacggcgagggg 16027290 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 10582246 cgcgacggcgacggcgacgg 10582265
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 18100971 gcgacggcgacggcgacggcgagggg 18100996 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Plus Query: 60 tccgcgaccgcgacggcgacggcgacggcgag 91 |||||||| |||||||||||| |||||||||| Sbjct: 26273189 tccgcgacggcgacggcgacgacgacggcgag 26273220 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 24614304 gcgacggcgacggcgacggcgagg 24614281 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggaggag 99 ||||||||||| |||||||||| |||||||| Sbjct: 2318260 gcgacggcgactgcgacggcgacgggaggag 2318230 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 14084112 cggcgacggcgacggcgagggg 14084091 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 14083929 cggcgacggcgacggcgagggg 14083908 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 8275696 gcgacggcgacggcgacggcgacggc 8275721 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 8275696 gcgacggcgacggcgacggcga 8275717 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 3874687 cggcgacggcgacggcgagggg 3874666 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 3874503 cggcgacggcgacggcgagggg 3874482 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||||||||||||||||| ||||||| Sbjct: 25087616 cgcgaccgcgacggcgacgggaacggcga 25087644 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 19740963 gcgacggcgacggcgacggcg 19740943 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 17287311 ggcgacggcgacggcgagggg 17287331 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 8156276 cggcgacggcgacggcgaggg 8156256 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2134473 gcgacggcgacggcgacggcg 2134453 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1578553 gcgacggcgacggcgacggcg 1578533 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 27664434 gcgacggcgacggcgacggc 27664415 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||| ||||||| Sbjct: 26858673 ccgcgacggcgacggcaacggcga 26858650 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggggag 96 ||||| |||||||||||||||||| Sbjct: 26382567 cggcggcggcgacggcgaggggag 26382590 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 19731668 cgacggcgacggcgacggcg 19731687 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 18267448 cgacggcgacggcgacggcg 18267429 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 17202153 cggcgacggcgacggcgagg 17202134 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 8398221 gcgacggcgacggcgacggc 8398202 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 3064133 cggcgacggcgacggcgagg 3064152
>gb|AC156448.2| Volvox carteri clone JGIAOBO-33O24, complete sequence Length = 38975 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 |||||||||||||||||||||||||| Sbjct: 15348 gcgaccgcgacggcgacggcgacggc 15323
>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0702F05 Length = 145018 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 82450 gcgacggcgacggcgacggcgacggcgagg 82479
>dbj|AK101378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033036C08, full insert sequence Length = 1195 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 87 gcgacggcgacggcgacggcgacggcgagg 58
>dbj|AK066483.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013070M16, full insert sequence Length = 2668 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||||| Sbjct: 604 ccgcgacggcgacggcgacggcgagg 629 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcga 84 ||||||| |||||||||||||||| Sbjct: 604 ccgcgacggcgacggcgacggcga 627
>dbj|AK065829.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013037D04, full insert sequence Length = 1469 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 149 gcgacggcgacggcgacggcgagggg 124
>dbj|AK059986.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-G11, full insert sequence Length = 1121 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 86 gcgacggcgacggcgacggcgacggcgagg 57
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||||| Sbjct: 24489150 ccgcgacggcgacggcgacggcgagg 24489175 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 22766821 gcgacggcgacggcgacggcgagggg 22766796 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 9195144 gcgacggcgacggcgacggcgagggg 9195119 Score = 50.1 bits (25), Expect = 0.007 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg-ggaggagga 101 ||||||||||||||||||||||| ||||||||| Sbjct: 26922303 cgacggcgacggcgacggcgaggaggaggagga 26922271 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggag 96 ||||||||||||||||||||||| |||| Sbjct: 25919012 gcgacggcgacggcgacggcgagaggag 25919039 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 6755162 gcgacggcgacggcgacggcgagg 6755185 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1721242 gcgacggcgacggcgacggcgacggcga 1721269 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1721236 gcgacggcgacggcgacggcgacggcga 1721263 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 26399371 gcgacggcgacggcgacggcgag 26399349 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 25019009 ccgcgacggcgacggcgacggcg 25018987 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 10572560 cgcgacggcgacggcgacggcga 10572582 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 1721248 gcgacggcgacggcgacggcgacggcg 1721274 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 23999569 gcgacggcgacggcgacggcga 23999548 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 22766602 cggcgacggcgacggcgagggg 22766581 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21800174 cggcgacggcgacggcgagggg 21800195 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21800116 cggcgacggcgacggcgagggg 21800137 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 20104490 gcgacggcgacggcgacggcga 20104511 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15980852 cggcgacggcgacggcgagggg 15980873 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15195565 cggcgacggcgacggcgagggg 15195544 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15195365 cggcgacggcgacggcgagggg 15195344 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9195329 cggcgacggcgacggcgagggg 9195308 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcg 89 |||||||||||||||||||||| Sbjct: 7940384 cgcgacggcgacggcgacggcg 7940363 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6345980 gcgacggcgacggcgacggcga 6345959 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgagg 92 |||||||||||||||||||||| Sbjct: 2705266 gacggcgacggcgacggcgagg 2705245 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 1853998 cgacggcgacggcgacggcgag 1854019 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggagg 97 ||||||||||||||||||| ||||| Sbjct: 26625168 cggcgacggcgacggcgagcggagg 26625144 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||| ||||| Sbjct: 25019009 ccgcgacggcgacggcgacggcggcggcg 25018981 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 18819520 cggcgacggcgacggcgaggg 18819540 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 6345980 gcgacggcgacggcgacggcgacgg 6345956 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2677141 gcgacggcgacggcgacggcg 2677121 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 2396614 cgacggcgacggcgacggcga 2396594 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1721197 gcgacggcgacggcgacggcg 1721217 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 24833360 gacggcgacggcgacggcga 24833379 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| || ||||||||||||||||||| Sbjct: 24583539 gcgacggctacggcgacggcgacggcga 24583512 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcga 84 ||||||| |||||||||||||||| Sbjct: 24489150 ccgcgacggcgacggcgacggcga 24489173 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 24137436 cggcgacggcgacggcgagg 24137417 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 22610102 gcgacggcgacggcgacggc 22610121 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 20104490 gcgacggcgacggcgacggcgacg 20104513 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 17745376 cgacggcgacggcgacggcg 17745357 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 17475880 cgacggcgacggcgacggcg 17475899 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 15980504 gcgacggcgacggcgagggg 15980523 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 10582128 cgcgacggcgacggcgacgg 10582147
>emb|AL935070.3|CNS08CCM Oryza sativa chromosome 12, . BAC OSJNBa0040P10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 148705 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 118214 gcgacggcgacggcgacggcgagggg 118239 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 118433 cggcgacggcgacggcgagggg 118454
>emb|AL731633.2|OSJN00280 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0096E05, complete sequence Length = 129908 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||||||| Sbjct: 102095 gcgacggcgacggcgacggcgacggcgagg 102066 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 102099 gacggcgacggcgacggcga 102080
>emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573_A06 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 143895 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||||| Sbjct: 5810 ccgcgacggcgacggcgacggcgagg 5835 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| || ||||||||||||||||||| Sbjct: 100199 gcgacggctacggcgacggcgacggcga 100172 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcga 84 ||||||| |||||||||||||||| Sbjct: 5810 ccgcgacggcgacggcgacggcga 5833
>emb|AL713954.3|CNS07YPZ Oryza sativa chromosome 12, . BAC OJ1134_G02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 121600 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 11586 gcgacggcgacggcgacggcgagggg 11611 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 11401 cggcgacggcgacggcgagggg 11422
>emb|AL731760.2|CNS07YPJ Oryza sativa chromosome 12, . BAC OJ1005_C11 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 104533 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 51149 gcgacggcgacggcgacggcgagggg 51124 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 51334 cggcgacggcgacggcgagggg 51313
>dbj|AP005795.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1090H08 Length = 200720 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagggg 94 |||||||||||||||||||||||||| Sbjct: 104767 gcgacggcgacggcgacggcgagggg 104792
>gb|AC116368.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0061D06, complete sequence Length = 172126 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 101674 gcgacggcgacggcgacggcgaggg 101698
>gb|AC097174.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1111_A10, complete sequence Length = 155106 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 73689 gcgacggcgacggcgacggcgaggg 73665 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 73504 cggcgacggcgacggcgagggg 73483
>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence Length = 150155 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgag 91 ||||| ||||||||||||||||||||||| Sbjct: 45636 gcgacggcgacggcgacggcgacggcgag 45664 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| |||||||||||||||||||||| Sbjct: 45629 cgcgacggcgacggcgacggcgacggcga 45657
>gb|AC027133.3| Oryza sativa (japonica cultivar-group) chromosome 12 clone OSJNBb0003F09, complete sequence Length = 159600 Score = 50.1 bits (25), Expect = 0.007 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg-ggaggagga 101 ||||||||||||||||||||||| ||||||||| Sbjct: 119100 cgacggcgacggcgacggcgaggaggaggagga 119068
>ref|XM_539498.2| PREDICTED: Canis familiaris similar to pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8 (LOC482381), mRNA Length = 2367 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 713 gcgacggcgacggcgacggcgaggg 737 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgaggg 93 ||||| |||||||||||||||| |||||||| Sbjct: 713 gcgacggcgacggcgacggcgagggcgaggg 743
>gb|AC169376.2| Sorghum bicolor clone SB_BBc0046M17, complete sequence Length = 127914 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 18235 gcgacggcgacggcgacggcgaggg 18259
>gb|BC026816.1| Mus musculus Sel1 (suppressor of lin-12) 1 homolog (C. elegans), mRNA (cDNA clone MGC:25250 IMAGE:4457637), complete cds Length = 3540 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 53 gcgacggcgacggcgacggcgaggg 77
>dbj|AK220502.1| Mus musculus mRNA for mKIAA4137 protein Length = 5723 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 81 gcgacggcgacggcgacggcgaggg 105
>gb|AE010147.1| Pyrococcus furiosus DSM 3638, section 22 of 173 of the complete genome Length = 11842 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 444 tgttgacactgttgtcatgaatcctccctttgg 476 |||||| |||||||| ||||||||||||||||| Sbjct: 5570 tgttgatactgttgttatgaatcctccctttgg 5602
>dbj|AK146022.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530024L02 product:Sel1 (suppressor of lin-12) 1 homolog (C. elegans), full insert sequence Length = 4287 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 55 gcgacggcgacggcgacggcgaggg 79
>dbj|AK160420.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700080G14 product:Sel1 (suppressor of lin-12) 1 homolog (C. elegans), full insert sequence Length = 1486 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 63 gcgacggcgacggcgacggcgaggg 87
>dbj|AK160936.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:4021401G01 product:Sel1 (suppressor of lin-12) 1 homolog (C. elegans), full insert sequence Length = 5530 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 39 gcgacggcgacggcgacggcgaggg 63
>dbj|AK161546.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330403H04 product:Sel-1 homolog precursor (Suppressor of lin-12-like protein) (Sel-1L) homolog [Mus musculus], full insert sequence Length = 1403 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 55 gcgacggcgacggcgacggcgaggg 79
>dbj|AK005544.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched library, clone:1600026C08 product:Sel1 (suppressor of lin-12) 1 homolog (C. elegans), full insert sequence Length = 617 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 64 gcgacggcgacggcgacggcgaggg 88
>dbj|AK005023.2| Mus musculus adult male liver cDNA, RIKEN full-length enriched library, clone:1300016D21 product:Sel1 (suppressor of lin-12) 1 homolog (C. elegans), full insert sequence Length = 3056 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 54 gcgacggcgacggcgacggcgaggg 78
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 9648003 gcgacggcgacggcgacggcgaggg 9647979 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 25076354 cgcgacggcgacggcgacggcga 25076332 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 5918816 gcgacggcgacggcgacggcgag 5918794 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 27114361 gcgacggcgacggcgacggcga 27114382 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcgag 91 |||||| |||||||||||||||| |||||| Sbjct: 25076354 cgcgacggcgacggcgacggcgatggcgag 25076325 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 19769101 cggcgacggcgacggcgagggg 19769080 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15595376 cggcgacggcgacggcgagggg 15595397 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 1928211 cgacggcgacggcgacggcgag 1928232 Score = 44.1 bits (22), Expect = 0.46 Identities = 31/34 (91%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggaggaggag 102 ||||||||||||||| ||||| ||||||||||| Sbjct: 1774193 gcgacggcgacggcggcggcggcgggaggaggag 1774226 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20261077 gcgacggcgacggcgacggcg 20261097 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 19769282 cggcgacggcgacggcgaggg 19769262 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 18403499 gcgacggcgacggcgacggcg 18403479 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 15595559 cggcgacggcgacggcgaggg 15595579 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 58 gctccgcgaccgcgacggcgacggcgacg 86 |||||||||| |||||||||||| ||||| Sbjct: 8819803 gctccgcgacggcgacggcgacgacgacg 8819831 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5217324 gcgacggcgacggcgacggcg 5217344 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 2763792 ggcgacggcgacggcgagggg 2763812 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 2763673 ggcgacggcgacggcgagggg 2763693 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||| Sbjct: 27114353 ccgcggcggcgacggcgacggcga 27114376 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 25098608 cgacggcgacggcgacggcg 25098627 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 25056241 cgacggcgacggcgacggcg 25056260 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24583135 cgacggcgacggcgacggcg 24583154 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||| ||||||||| Sbjct: 23542989 cgcgacggcgacggcgaccgcgacggcg 23543016 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 22959274 gcgacggcgacggcgacggc 22959255 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacg 80 |||||||||||||||||||| Sbjct: 21061917 ccgcgaccgcgacggcgacg 21061936 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 20053680 cggcgacggcgacggcgagg 20053699 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 18982620 gcgacggcgacggcgacggc 18982639 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||| Sbjct: 7828545 ccgcggcggcgacggcgacggcga 7828568 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7690572 cgacggcgacggcgacggcg 7690553
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgagg 92 |||| |||||||||||||||||||||||| Sbjct: 18192376 cgacggcgacggcgacggcgacggcgagg 18192348 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagggg 94 ||||| |||||||||||||||| ||||||||| Sbjct: 6674614 gcgacagcgacggcgacggcgagggcgagggg 6674583 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 35331950 cgacggcgacggcgacggcgagg 35331928 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 33700283 cgacggcgacggcgacggcgagg 33700305 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 6226966 gcgacggcgacggcgacggcgag 6226988 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 619308 gcgacggcgacggcgacggcgacggcg 619334 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 34845682 gcgacggcgacggcgacggcga 34845703 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21213792 cggcgacggcgacggcgagggg 21213813 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 21213609 cggcgacggcgacggcgagggg 21213630 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9817752 cggcgacggcgacggcgagggg 9817773 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 9817683 cggcgacggcgacggcgagggg 9817704 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 9508881 gcgacggcgacggcgacggcga 9508902 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||| ||||||||| Sbjct: 7430492 gcgacggcgacggcgacggcaacggcgagg 7430463 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6172936 gcgacggcgacggcgacggcga 6172915 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 5776962 cgacggcgacggcgacggcgacggcg 5776987 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 ||||||||| |||||||||||||||| Sbjct: 5644469 cgaccgcgatggcgacggcgacggcg 5644494 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 2707256 cggcgacggcgacggcgagggg 2707277 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 619308 gcgacggcgacggcgacggcga 619329 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 540147 cgacggcgacggcgacggcgag 540126 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcg 83 ||||||||||||||||||||| Sbjct: 30233113 gcgaccgcgacggcgacggcg 30233133 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 26857675 gcgacggcgacggcgacggcg 26857695 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 23045080 cgacggcgacggcgacggcga 23045100 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20974754 gcgacggcgacggcgacggcg 20974774 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgag 91 ||||||||||||||||||||| Sbjct: 19857717 gacggcgacggcgacggcgag 19857697 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 10073935 ggcgacggcgacggcgagggg 10073915 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 accgcgacggcgacggcgacg 86 ||||||||||||||||||||| Sbjct: 8363822 accgcgacggcgacggcgacg 8363802 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 6172936 gcgacggcgacggcgacggcgacgg 6172912 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 5776962 cgacggcgacggcgacggcga 5776982 Score = 42.1 bits (21), Expect = 1.8 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Plus Query: 75 gcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||| |||||||||| Sbjct: 5351535 gcgacggcgacggcgaggaggaggaggag 5351563 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 4182139 gcgacggcgacggcgacggcg 4182119 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 34845682 gcgacggcgacggcgacggcgacg 34845705 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 32011354 gcgacggcgacggcgacggc 32011373 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgagggg 94 ||||||||||||||||||| |||| Sbjct: 26769269 gacggcgacggcgacggcgcgggg 26769246 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 22762004 gacggcgacggcgacggcga 22761985 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 acggcgacggcgacggcgagggga 95 |||||| ||||||||||||||||| Sbjct: 18580615 acggcggcggcgacggcgagggga 18580638 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 12144391 gcgacggcgacggcgacggc 12144410 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 9508881 gcgacggcgacggcgacggcgacg 9508904 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 7977673 cggcgacggcgacggcgagg 7977692 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 66 accgcgacggcgacggcgacggcg 89 |||||||||||||||||| ||||| Sbjct: 7567987 accgcgacggcgacggcggcggcg 7568010 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcga 84 ||||| |||||||||||||||||| Sbjct: 5639495 ccgcggccgcgacggcgacggcga 5639472 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 65 gaccgcgacggcgacggcgacggcgagg 92 |||| ||||||||||||||||| ||||| Sbjct: 5554914 gaccacgacggcgacggcgacgtcgagg 5554941 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 5228513 ccgcgacggcgacggcgacg 5228494 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcgag 91 ||||||||||||| |||||||||| Sbjct: 4595132 cgcgacggcgacgacgacggcgag 4595109 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 2773488 ccgcgacggcgacggcgacg 2773507 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 1333050 gcgacggcgacggcgacggc 1333031 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 59 ctccgcgaccgcgacggcgacggc 82 ||||||||||||| |||||||||| Sbjct: 489435 ctccgcgaccgcggcggcgacggc 489458
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 65 gaccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||||| Sbjct: 6024079 gaccgcgacggcgacggcgacggcg 6024055 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 39164254 ccgcgacggcgacggcgacggcga 39164277 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 38293383 gcgacggcgacggcgacggcgagg 38293360 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 21825484 gcgacggcgacggcgacggcgacggcga 21825457 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacg 86 ||||||| |||||||||||||||||| Sbjct: 39164254 ccgcgacggcgacggcgacggcgacg 39164279 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 31955218 cggcgacggcgacggcgagggg 31955239 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 26205816 cggcgacggcgacggcgagggg 26205837 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 26205633 cggcgacggcgacggcgagggg 26205654 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcgaggg 93 |||| ||||||||||||||||||||| Sbjct: 24188946 cgcgccggcgacggcgacggcgaggg 24188921 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 19484580 cggcgacggcgacggcgagggg 19484559 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 19484397 cggcgacggcgacggcgagggg 19484376 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||| ||||| Sbjct: 9857838 gcgacggcgacggcgacggcgacgacgagg 9857867 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 9250679 cgacggcgacggcgacggcgag 9250700 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 7048135 gcgacggcgacggcgacggcga 7048156 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 4972023 gcgacggcgacggcgacggcga 4972044 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 41964926 cgacggcgacggcgacggcga 41964946 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 30318161 cgacggcgacggcgacggcga 30318141 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 30035831 cgacggcgacggcgacggcga 30035851 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 21825478 gcgacggcgacggcgacggcgacgg 21825454 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 12787738 cgacggcgacggcgacggcga 12787718 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggc 88 |||| |||||||||||||||||||| Sbjct: 12787738 cgacggcgacggcgacggcgacggc 12787714 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 10162455 gcgacggcgacggcgacggcg 10162435 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5372785 gcgacggcgacggcgacggcg 5372805 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2984162 gcgacggcgacggcgacggcg 2984182 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2661710 gcgacggcgacggcgacggcg 2661690 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggag 96 ||||||||||| |||||||||||| Sbjct: 42233243 cggcgacggcgccggcgaggggag 42233220 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 42195255 cgacggcgacggcgacggcg 42195274 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacgg 87 |||| ||||||||||||||||||| Sbjct: 41964926 cgacggcgacggcgacggcgacgg 41964949 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 39771094 cggcgacggcgacggcgagg 39771113 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 39205183 gcgacggcgacggcgacggc 39205202 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 36540565 gacggcgacggcgacggcga 36540584 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 30582759 gacggcgacggcgacggcga 30582778 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 24736244 cggcgacggcgacggcgagg 24736263 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 21036524 cggcgacggcgacggcgagg 21036505 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||||||||||| |||||||||| Sbjct: 17556958 ccgcgacggcgactgcgacggcga 17556935 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 10162459 gacggcgacggcgacggcga 10162440 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 9679555 ccgcgacggcgacggcgacg 9679574 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcgag 91 |||| ||| ||||||||||||||||||| Sbjct: 5694094 cgacggcggcggcgacggcgacggcgag 5694121 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||||||| || ||||||||||||||| Sbjct: 5377494 gcgaccgcggcgacgacggcgacggcga 5377521 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 4972023 gcgacggcgacggcgacggcgacg 4972046 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 3957891 cgacggcgacggcgacggcg 3957910 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 1098702 cgacggcgacggcgacggcg 1098683
>gb|AC157658.2| Mus musculus BAC clone RP23-331E4 from chromosome 12, complete sequence Length = 203717 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 148719 gcgacggcgacggcgacggcgaggg 148743
>dbj|AP002093.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0466B10 Length = 151806 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 65 gaccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||||| Sbjct: 91967 gaccgcgacggcgacggcgacggcg 91943
>dbj|AP002092.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0031E09 Length = 176349 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 65 gaccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||||| Sbjct: 48436 gaccgcgacggcgacggcgacggcg 48412
>dbj|AP005066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0047E05 Length = 184323 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgagg 92 |||| |||||||||||||||||||||||| Sbjct: 115777 cgacggcgacggcgacggcgacggcgagg 115749
>dbj|AK107706.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-D04, full insert sequence Length = 667 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgagg 92 |||| |||||||||||||||||||||||| Sbjct: 430 cgacggcgacggcgacggcgacggcgagg 402
>dbj|AK107510.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-129-E10, full insert sequence Length = 734 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||||||||| Sbjct: 71 ccgcgacggcgacggcgacggcgacggcg 99 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 71 ccgcgacggcgacggcgacggcga 94
>ref|NM_011344.2| Mus musculus Sel1 (suppressor of lin-12) 1 homolog (C. elegans) (Sel1h), transcript variant 2, mRNA Length = 6150 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 81 gcgacggcgacggcgacggcgaggg 105
>ref|NM_001039089.1| Mus musculus Sel1 (suppressor of lin-12) 1 homolog (C. elegans) (Sel1h), transcript variant 1, mRNA Length = 6300 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 81 gcgacggcgacggcgacggcgaggg 105
>gb|AF063095.1|AF063095 Mus musculus SELlL (Sel1l) mRNA, complete cds Length = 3663 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 30 gcgacggcgacggcgacggcgaggg 54
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 ||||||||||||||||||||||||| Sbjct: 9719700 gcgacggcgacggcgacggcgaggg 9719676 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 25387944 cgcgacggcgacggcgacggcga 25387922 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 5985293 gcgacggcgacggcgacggcgag 5985271 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 27441414 gcgacggcgacggcgacggcga 27441435 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcgag 91 |||||| |||||||||||||||| |||||| Sbjct: 25387944 cgcgacggcgacggcgacggcgatggcgag 25387915 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 20054412 cggcgacggcgacggcgagggg 20054391 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 15682992 cggcgacggcgacggcgagggg 15683013 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 1925933 cgacggcgacggcgacggcgag 1925954 Score = 44.1 bits (22), Expect = 0.46 Identities = 31/34 (91%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggaggaggag 102 ||||||||||||||| ||||| ||||||||||| Sbjct: 1771914 gcgacggcgacggcggcggcggcgggaggaggag 1771947 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20571396 gcgacggcgacggcgacggcg 20571416 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 20054593 cggcgacggcgacggcgaggg 20054573 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 18562900 gcgacggcgacggcgacggcg 18562880 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 58 gctccgcgaccgcgacggcgacggcgacg 86 |||||||||| |||||||||||| ||||| Sbjct: 8890566 gctccgcgacggcgacggcgacgacgacg 8890594 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5283801 gcgacggcgacggcgacggcg 5283821 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 2772823 ggcgacggcgacggcgagggg 2772843 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 2772704 ggcgacggcgacggcgagggg 2772724 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||| Sbjct: 27441406 ccgcggcggcgacggcgacggcga 27441429 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 25409627 cgacggcgacggcgacggcg 25409646 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 25367831 cgacggcgacggcgacggcg 25367850 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 24894805 cgacggcgacggcgacggcg 24894824 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||| ||||||||| Sbjct: 23852925 cgcgacggcgacggcgaccgcgacggcg 23852952 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 23269184 gcgacggcgacggcgacggc 23269165 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacg 80 |||||||||||||||||||| Sbjct: 21372158 ccgcgaccgcgacggcgacg 21372177 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 20340556 cggcgacggcgacggcgagg 20340575 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 19141269 gcgacggcgacggcgacggc 19141288 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||| Sbjct: 7898632 ccgcggcggcgacggcgacggcga 7898655 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7760659 cgacggcgacggcgacggcg 7760640
>gb|AC105262.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1489_G03, complete sequence Length = 107870 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||||||||| Sbjct: 30348 ccgcgacggcgacggcgacggcgacggcg 30376 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 30348 ccgcgacggcgacggcgacggcga 30371
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 99012 gcgacggcgacggcgacggcgagg 99035
>ref|XM_483173.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1364 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 1198 gcgacggcgacggcgacggcgagg 1221
>ref|XM_464680.1| Oryza sativa (japonica cultivar-group), mRNA Length = 438 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagggg 94 ||||| |||||||||||||||| ||||||||| Sbjct: 137 gcgacagcgacggcgacggcgagggcgagggg 106
>gb|AY710430.1| Cryptococcus gattii strain WM276 MATalpha locus, complete sequence Length = 132746 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 123818 gcgacggcgacggcgacggcgacggcga 123791
>gb|AY710429.1| Cryptococcus gattii strain E566 MATa locus, complete sequence Length = 144400 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 135472 gcgacggcgacggcgacggcgacggcga 135445
>ref|XM_463319.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1122 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 918 gcgacggcgacggcgacggcgacggcga 945 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 924 gcgacggcgacggcgacggcgacgg 948
>ref|XM_469562.1| Oryza sativa (japonica cultivar-group), mRNA Length = 687 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||||||||||||| Sbjct: 663 cgcgacggcgacggcgacggcgacggcg 636 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 663 cgcgacggcgacggcgacggcga 641
>ref|XM_479245.1| Oryza sativa (japonica cultivar-group), mRNA Length = 513 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 74 gcgacggcgacggcgacggcgagg 97
>ref|XM_476515.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2097 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 268 gcgacggcgacggcgacggcgacggcga 295 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 262 gcgacggcgacggcgacggcgacggcga 289 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 257 cgacggcgacggcgacggcgacggcga 283
>gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, complete sequence Length = 268984 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||||| Sbjct: 10816 cgacggcgacggcgacggcgaggg 10793
>gb|AY023921.1| Oryza sativa microsatellite MRG6246 containing (ATCG)X7, closest to marker S13312, genomic sequence Length = 228 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 65 ccgcgacggcgacggcgacggcga 42 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcgacg 86 ||||||| |||||||||||||||||| Sbjct: 65 ccgcgacggcgacggcgacggcgacg 40
>gb|AC155164.5| Mus musculus BAC clone RP24-74L7 from chromosome 8, complete sequence Length = 193057 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 142959 gcgacggcgacggcgacggcgacggcga 142932 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 142953 gcgacggcgacggcgacggcgacggcga 142926 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 142947 gcgacggcgacggcgacggcgacggc 142922
>gb|AC097175.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1119_H02, complete sequence Length = 138584 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 119088 gcgacggcgacggcgacggcgacggcga 119115
>gb|AC137592.2| Oryza sativa (Japonica cultiva-group) chromosome 9 BAC clone OSJNBa0035B22, complete sequence Length = 155788 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 66 accgcgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||| ||||| Sbjct: 63568 accgcgacggcgacggcgacggtgaggg 63541
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1335967 gcgacggcgacggcgacggcgacggcga 1335994 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1335961 gcgacggcgacggcgacggcgacggcga 1335988 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1335955 gcgacggcgacggcgacggcgacggcga 1335982 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1335949 gcgacggcgacggcgacggcgacggcga 1335976 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1335943 gcgacggcgacggcgacggcgacggcga 1335970 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcga 90 ||||||||||||| ||||| |||||||||| Sbjct: 3165769 ccgcgaccgcgaccgcgaccgcgacggcga 3165798 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 181966 gcgacggcgacggcgacggcga 181945 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 2831759 gcgacggcgacggcgacggcg 2831779 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||| ||||| Sbjct: 1335973 gcgacggcgacggcgacggcgatggcga 1336000
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 2667260 gcgacggcgacggcgacggcgacggcga 2667287 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 3061530 gcgacggcgacggcgacggcgacggcg 3061556 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 3061530 gcgacggcgacggcgacggcga 3061551 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| || ||||||||||||||||||| Sbjct: 2667248 gcgacagcaacggcgacggcgacggcga 2667275 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcgacggc 88 |||||||||| ||||| ||||||||||| Sbjct: 1963014 ccgcgaccgcaacggcaacggcgacggc 1962987
>ref|XM_755768.1| Ustilago maydis 521 hypothetical protein (UM04714.1) partial mRNA Length = 1056 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1045 gcgacggcgacggcgacggcgacggcga 1018 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1039 gcgacggcgacggcgacggcgacggcga 1012 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 1033 gcgacggcgacggcgacggcgacggcg 1007
>gb|AC092720.4| Homo sapiens chromosome 16 clone RP11-482M8, complete sequence Length = 169214 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 23342 gcgacggcgacggcgacggcgacggcga 23369 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 23348 gcgacggcgacggcgacggcgacggcg 23374
>gb|AC120509.3| Oryza sativa chromosome 3 BAC OSJNBb0081K01 genomic sequence, complete sequence Length = 122496 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 15008 gcgacggcgacggcgacggcgagg 14985
>gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01 genomic sequence, complete sequence Length = 168759 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 167982 gcgacggcgacggcgacggcgagg 167959 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 74796 gcgacggcgacggcgacggcga 74817
>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217 (CG31217), and ultrabithorax (Ubx) genes, complete cds Length = 308092 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 18628 gcgacggcgacggcgacggcgacggcga 18601
>gb|AY077777.1| Pedicinus sp. B1371 18S small subunit ribosomal RNA gene, partial sequence Length = 2758 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1428 gcgacggcgacggcgacggcgacggcga 1401 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1422 gcgacggcgacggcgacggcgacggcga 1395 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1416 gcgacggcgacggcgacggcgacggcga 1389 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 1433 cgacggcgacggcgacggcgacggcga 1407
>dbj|AK132685.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4921526M11 product:G protein-coupled receptor kinase 2, groucho gene related (Drosophila), full insert sequence Length = 2410 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||||||||||||||| |||||||||| Sbjct: 302 gcgaccgcgacggcgacagcgacggcga 329
>dbj|AK078333.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:6530401I16 product:ELAV-LIKE PROTEIN 1 (HU-ANTIGEN R) (HUR) (ELAV-LIKE GENERIC PROTEIN) (MELG) homolog [Mus musculus], full insert sequence Length = 1820 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 403 gcgacggcgacggcgacggcgacggcga 376 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 397 gcgacggcgacggcgacggcgacggcga 370 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 391 gcgacggcgacggcgacggcgacggc 366
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III, complete sequence Length = 907057 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 88358 gcgacagcgacggcgacggcgacggcga 88385
>dbj|AK080365.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630073F18 product:ELAV-LIKE PROTEIN 1 (HU-ANTIGEN R) (HUR) (ELAV-LIKE GENERIC PROTEIN) (MELG), full insert sequence Length = 2426 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 45 gcgacggcgacggcgacggcgacggcga 18 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 39 gcgacggcgacggcgacggcgacggcga 12 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 33 gcgacggcgacggcgacggcgacggc 8
>dbj|AK034536.1| Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430002B02 product:ELAV-LIKE PROTEIN 1 (HU-ANTIGEN R) (HUR) (ELAV-LIKE GENERIC PROTEIN) (MELG) homolog [Mus musculus], full insert sequence Length = 2453 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 74 gcgacggcgacggcgacggcgacggcga 47 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 68 gcgacggcgacggcgacggcgacggcga 41 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 62 gcgacggcgacggcgacggcgacggc 37
>dbj|AK011870.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610203M07 product:ELAV-LIKE PROTEIN 1 (HU-ANTIGEN R) (HUR) (ELAV-LIKE GENERIC PROTEIN) (MELG) homolog [Mus musculus], full insert sequence Length = 1590 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 40 gcgacggcgacggcgacggcgacggcga 13 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 34 gcgacggcgacggcgacggcgacggcga 7 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 28 gcgacggcgacggcgacggcgacggc 3
>dbj|AK075818.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010107C19 product:ELAV-LIKE PROTEIN 1 (HU-ANTIGEN R) (HUR) (ELAV-LIKE GENERIC PROTEIN) (MELG) homolog [Mus musculus], full insert sequence Length = 1266 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 49 gcgacggcgacggcgacggcgacggcga 22 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 43 gcgacggcgacggcgacggcgacggcga 16 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 37 gcgacggcgacggcgacggcgacggc 12
>dbj|AK020792.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830025H08 product:G protein-coupled receptor kinase 2, groucho gene related (Drosophila), full insert sequence Length = 1226 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||||||||||||||| |||||||||| Sbjct: 302 gcgaccgcgacggcgacagcgacggcga 329
>dbj|AK078475.1| Mus musculus 12 days embryo female mullerian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6820406D08 product:G protein-coupled receptor kinase 2, groucho gene related (Drosophila), full insert sequence Length = 3106 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||||||||||||||| |||||||||| Sbjct: 173 gcgaccgcgacggcgacagcgacggcga 200
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 66 accgcgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||| ||||| Sbjct: 21858134 accgcgacggcgacggcgacggtgaggg 21858107 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcgag 91 |||||||||||||||||||||||| Sbjct: 6815575 cgcgacggcgacggcgacggcgag 6815552 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 5704728 gcgacagcgacggcgacggcgacggcga 5704755 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 3130163 gcgacggcgacggcgacggcgacggcg 3130189 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 18023028 cggcgacggcgacggcgagggg 18023049 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 18022845 cggcgacggcgacggcgagggg 18022866 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 13954537 gcgacggcgacggcgacggcga 13954558 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 11591022 cggcgacggcgacggcgagggg 11591043 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 11110918 cggcgacggcgacggcgagggg 11110897 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 11110793 cggcgacggcgacggcgagggg 11110772 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 11110660 cggcgacggcgacggcgagggg 11110639 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgagg 92 |||||||||||||||||||||| Sbjct: 7126036 gacggcgacggcgacggcgagg 7126015 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6749047 gcgacggcgacggcgacggcga 6749068 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4698429 cggcgacggcgacggcgagggg 4698450 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4698246 cggcgacggcgacggcgagggg 4698267 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 4046101 cggcgacggcgacggcgagggg 4046122 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 3130163 gcgacggcgacggcgacggcga 3130184 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 21782841 gcgacggcgacggcgacggcg 21782821 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 19796993 gcgacggcgacggcgacggcg 19797013 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 18565667 gcgacggcgacggcgacggcg 18565647 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgag 91 ||||||||||||||||||||| Sbjct: 18353414 gacggcgacggcgacggcgag 18353434 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 76 cgacggcgacggcgaggggag 96 ||||||||||||||||||||| Sbjct: 17827217 cgacggcgacggcgaggggag 17827197 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 16220536 gcgacggcgacggcgacggcg 16220516 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 14690090 gcgacggcgacggcgacggcg 14690070 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgag 91 ||||||||||||||||||||| Sbjct: 13955429 gacggcgacggcgacggcgag 13955449 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 12575374 gcgacggcgacggcgacggcg 12575394 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 7807182 gcgacggcgacggcgacggcg 7807162 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| ||||||||||| |||||||||| Sbjct: 5704691 cgcgacggcgacggcgacagcgacggcga 5704719 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 5633303 gcgacggcgacggcgacggcg 5633283 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 22124865 cgacggcgacggcgacggcg 22124846 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 18321193 cgcgacggcgacggcgacgg 18321174 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 17094029 cgacggcgacggcgacggcg 17094048 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 14128308 cgacggcgacggcgacggcg 14128289 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 14094970 gacggcgacggcgacggcga 14094989 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 10468104 cgacggcgacggcgacggcg 10468085 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7364385 cgacggcgacggcgacggcg 7364404 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7166270 cgacggcgacggcgacggcg 7166289 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 6749047 gcgacggcgacggcgacggcgacg 6749070 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 5764995 cggcgacggcgacggcgagg 5764976 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 5704734 gcgacggcgacggcgacggcgacg 5704757 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||| |||||||||||||||| Sbjct: 5704722 gcgacggcgacagcgacggcgacggcga 5704749 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 5704716 gcgacagcgacggcgacagcgacggcga 5704743 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 5704704 gcgacagcgacggcgacagcgacggcga 5704731 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 4879373 cggcgacggcgacggcgagg 4879354
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 26254511 gcgacggcgacggcgacggcgagg 26254534 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 22057336 gcgacggcgacggcgacggcgagg 22057313 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 17082626 ccgcgacggcgacggcgacggcga 17082649 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1637216 gcgacggcgacggcgacggcgacggcga 1637189 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1637210 gcgacggcgacggcgacggcgacggcga 1637183 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 29099349 cgacggcgacggcgacggcgagg 29099327 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 27008560 cgacggcgacggcgacggcgagg 27008538 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacgg 87 ||||||| ||||||||||||||||||| Sbjct: 17082626 ccgcgacggcgacggcgacggcgacgg 17082652 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 4434639 gcgacggcgacggcgacggcgag 4434617 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 1637221 cgacggcgacggcgacggcgacggcga 1637195 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 1088201 gcgacggcgacggcgacggcgag 1088179 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 27810535 cgacggcgacggcgacggcgacggcg 27810560 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 27694141 gcgacggcgacggcgacggcga 27694120 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 14427712 gcgacggcgacggcgacggcga 14427691 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6577448 gcgacggcgacggcgacggcga 6577469 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggaggaggag 102 ||||| ||||||||||||| |||||||||| Sbjct: 443780 cggcggcggcgacggcgagaggaggaggag 443751 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 27810535 cgacggcgacggcgacggcga 27810555 Score = 42.1 bits (21), Expect = 1.8 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Plus Query: 74 ggcgacggcgacggcgagg-ggaggagga 101 ||||||||||||||||||| ||||||||| Sbjct: 24931664 ggcgacggcgacggcgaggaggaggagga 24931692 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 15040872 gcgacggcgacggcgacggcg 15040892 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 12512384 gcgacggcgacggcgacggcg 12512364 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacg 86 |||||| |||||||||||||||||| Sbjct: 10087945 cgcgacagcgacggcgacggcgacg 10087969 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 8015071 gcgacggcgacggcgacggcg 8015091 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 4109721 gcgacggcgacggcgacggcg 4109701 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 3384285 cgacggcgacggcgacggcga 3384265 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 28332899 cggcgacggcgacggcgagg 28332918 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggggag 96 ||||||||||||||||| |||||| Sbjct: 28293069 cggcgacggcgacggcggggggag 28293046 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 24225375 gacggcgacggcgacggcga 24225394 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 23632246 cggcgacggcgacggcgagg 23632265 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||| ||||| Sbjct: 21707081 cgacggcgacggcgacggagaggg 21707104 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 21104919 cgcgacggcgacggcgacgg 21104938 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgagggg 94 ||||||| |||||||||||||||| Sbjct: 20152083 gacggcggcggcgacggcgagggg 20152106 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 14727606 cgacggcgacggcgacggcg 14727587 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 14427712 gcgacggcgacggcgacggcgacg 14427689 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 8129421 gacggcgacggcgacggcga 8129440 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 7871150 cgacggcgacggcgacggcg 7871169 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||| ||||||||||||||||| Sbjct: 6068168 gcgacgacgacggcgacggcgagg 6068191 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacgg 87 |||| ||||||||||||||||||| Sbjct: 3384285 cgacggcgacggcgacggcgacgg 3384262 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 3345866 cgacggcgacggcgacggcg 3345885 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 2602747 cgacggcgacggcgacggcg 2602766
>dbj|AP003334.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1114B07 Length = 148060 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 54777 gcgacggcgacggcgacggcgacggcga 54750 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 54771 gcgacggcgacggcgacggcgacgg 54747
>gb|BC042466.1| Homo sapiens, Similar to podocalyxin-like, clone IMAGE:5172924, mRNA Length = 6199 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 298 gcgacggcgacggcgacggcgacggcga 271 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 292 gcgacggcgacggcgacggcgacg 269
>gb|AC091532.13| Oryza sativa chromosome 3 BAC OSJNBa0078A17 genomic sequence, complete sequence Length = 147344 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcg 89 |||||| ||||||||||||||||||||| Sbjct: 42789 cgcgacggcgacggcgacggcgacggcg 42762 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 42789 cgcgacggcgacggcgacggcga 42767
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 1991688 gcgacggcgacggcgacggcgacggcga 1991661 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||| ||||||||||||| Sbjct: 4749347 gcgacggcgagggcgacggcgagg 4749324 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 75 gcgacggcgacggcgagggg 94 |||||||||||||||||||| Sbjct: 4698745 gcgacggcgacggcgagggg 4698764 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcgag 91 |||||||||||||||| ||||||| Sbjct: 354705 cgcgacggcgacggcgccggcgag 354728
>gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complete sequence Length = 105215 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||||| Sbjct: 27310 cgacggcgacggcgacggcgaggg 27287
>dbj|AP003313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0035F12 Length = 153439 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 40014 ccgcgacggcgacggcgacggcga 40037 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacg 86 ||||||| |||||||||||||||||| Sbjct: 40014 ccgcgacggcgacggcgacggcgacg 40039 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggc 88 |||||||||||||||||||| Sbjct: 80943 gcgacggcgacggcgacggc 80962
>dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1065E10 Length = 183580 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 54208 gcgacggcgacggcgacggcgagg 54185
>dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0455H11 Length = 101607 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 29139 gcgacggcgacggcgacggcgagg 29162
>dbj|AP005893.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0030K05 Length = 157835 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 139406 gcgacagcgacggcgacggcgacggcga 139433 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| ||||||||||| |||||||||| Sbjct: 139369 cgcgacggcgacggcgacagcgacggcga 139397 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 67981 gcgacggcgacggcgacggcg 67961 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 139412 gcgacggcgacggcgacggcgacg 139435 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||| |||||||||||||||| Sbjct: 139400 gcgacggcgacagcgacggcgacggcga 139427 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 139394 gcgacagcgacggcgacagcgacggcga 139421 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 139382 gcgacagcgacggcgacagcgacggcga 139409
>dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0701E06 Length = 123415 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 933 gcgacagcgacggcgacggcgacggcga 960 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 cgcgaccgcgacggcgacggcgacggcga 90 |||||| ||||||||||| |||||||||| Sbjct: 896 cgcgacggcgacggcgacagcgacggcga 924 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 61200 cggcgacggcgacggcgagg 61181 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 939 gcgacggcgacggcgacggcgacg 962 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||| |||||||||||||||| Sbjct: 927 gcgacggcgacagcgacggcgacggcga 954 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 921 gcgacagcgacggcgacagcgacggcga 948 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| ||||||||||| |||||||||| Sbjct: 909 gcgacagcgacggcgacagcgacggcga 936
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0026F07 Length = 137354 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 122564 gcgacggcgacggcgacggcgagg 122541
>dbj|AP006464.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1054C11 Length = 141529 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcgag 91 |||||||||||||||||||||||| Sbjct: 106912 cgcgacggcgacggcgacggcgag 106889 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 40384 gcgacggcgacggcgacggcga 40405 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 40384 gcgacggcgacggcgacggcgacg 40407
>dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1043F11 Length = 167137 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcgag 91 |||||||||||||||||||||||| Sbjct: 43470 cgcgacggcgacggcgacggcgag 43447
>dbj|AP006172.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0088O14 Length = 179483 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 105871 gcgacggcgacggcgacggcgacggcga 105844 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 105865 gcgacggcgacggcgacggcgacggcga 105838 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 105876 cgacggcgacggcgacggcgacggcga 105850
>dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0058I18 Length = 151453 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 10992 gcgacggcgacggcgacggcgagg 10969
>dbj|AP004315.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0571D04 Length = 149302 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 35752 ccgcgacggcgacggcgacggcga 35775 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacgg 87 ||||||| ||||||||||||||||||| Sbjct: 35752 ccgcgacggcgacggcgacggcgacgg 35778
>dbj|AP004261.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0013G11 Length = 151405 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 149380 gcgacggcgacggcgacggcgagg 149357
>dbj|AP004996.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0027A02 Length = 140402 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcgagggg 94 ||||| |||||||||||||||| ||||||||| Sbjct: 108989 gcgacagcgacggcgacggcgagggcgagggg 108958
>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1770_H02 Length = 170648 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Plus Query: 60 tccgcgaccgcgacggcgacggcgacggcgag 91 |||||||| |||||||||||| |||||||||| Sbjct: 2770 tccgcgacggcgacggcgacgacgacggcgag 2801 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggggag 96 ||||| |||||||||||||||||| Sbjct: 112148 cggcggcggcgacggcgaggggag 112171
>dbj|AP003857.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1014_E06 Length = 112241 Score = 48.1 bits (24), Expect = 0.029 Identities = 30/32 (93%) Strand = Plus / Plus Query: 60 tccgcgaccgcgacggcgacggcgacggcgag 91 |||||||| |||||||||||| |||||||||| Sbjct: 106114 tccgcgacggcgacggcgacgacgacggcgag 106145
>dbj|AK120035.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-C08, full insert sequence Length = 1004 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 124 gcgacggcgacggcgacggcgacggcga 97
>dbj|AK107539.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-129-H07, full insert sequence Length = 1363 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 1197 gcgacggcgacggcgacggcgagg 1220
>dbj|AK102845.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033110A12, full insert sequence Length = 1821 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 127 gcgacggcgacggcgacggcgagg 104
>dbj|AK071266.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086J23, full insert sequence Length = 1288 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 66 accgcgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||| ||||| Sbjct: 71 accgcgacggcgacggcgacggtgaggg 98
>ref|NM_208607.1| Eremothecium gossypii ACL150Wp (ACL150W), mRNA Length = 660 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 614 gcgacagcgacggcgacggcgacggcga 641
>dbj|AK069938.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038I07, full insert sequence Length = 1539 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 126 gcgacggcgacggcgacggcgagg 149
>dbj|AK069319.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023018L01, full insert sequence Length = 2293 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 259 gcgacggcgacggcgacggcgacggcga 286 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 253 gcgacggcgacggcgacggcgacggcga 280 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 248 cgacggcgacggcgacggcgacggcga 274
>dbj|AK068238.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149J12, full insert sequence Length = 863 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcga 90 |||||||||||||||||||||||| Sbjct: 40 ccgcgacggcgacggcgacggcga 63 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacgg 87 ||||||| ||||||||||||||||||| Sbjct: 40 ccgcgacggcgacggcgacggcgacgg 66
>dbj|AK067029.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092P04, full insert sequence Length = 1294 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 159 gcgacggcgacggcgacggcgacggcga 132
>dbj|AK065163.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002C07, full insert sequence Length = 1312 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggag 96 ||||||||||||||||||||||| |||| Sbjct: 53 gcgacggcgacggcgacggcgagaggag 26
>dbj|AK063333.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-A04, full insert sequence Length = 1539 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 91 gcgacggcgacggcgacggcgagg 68
>dbj|AK059161.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-D06, full insert sequence Length = 1291 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Plus Query: 66 accgcgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||| ||||| Sbjct: 74 accgcgacggcgacggcgacggtgaggg 101
>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0519E12 Length = 152448 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 146369 gcgacggcgacggcgacggcgagg 146392
>gb|AY105763.1| Zea mays PCO101043 mRNA sequence Length = 877 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 198 gcgacggcgacggcgacggcgagg 175
>gb|AC151669.5| Mus musculus chromosome 5, clone RP23-44L13, complete sequence Length = 254022 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||||||||||||||| |||||||||| Sbjct: 152003 gcgaccgcgacggcgacagcgacggcga 151976
>dbj|AP004301.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0483E09 Length = 69300 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 46369 gcgacggcgacggcgacggcgacggcga 46342 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 46363 gcgacggcgacggcgacggcgacggcga 46336 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 46374 cgacggcgacggcgacggcgacggcga 46348
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 2574538 gcgacggcgacggcgacggcgacggcga 2574511 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 2574543 cgacggcgacggcgacggcgacggcga 2574517 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 2574532 gcgacggcgacggcgacggcgacggc 2574507 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1355540 gcgacggcgacggcgacggcg 1355520
>emb|AL713935.5|CNS07YPG Oryza sativa chromosome 12, . BAC OJ1427_C06 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 88558 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgagg 92 |||||||||||||||||||||||| Sbjct: 63245 gcgacggcgacggcgacggcgagg 63222
>emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327_A12 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 161806 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggag 96 ||||||||||||||||||||||| |||| Sbjct: 120835 gcgacggcgacggcgacggcgagaggag 120808
>emb|BX000502.2|CNS08CDS Oryza sativa chromosome 12, . BAC OSJNBb0041E01 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 132026 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 119224 gcgacggcgacggcgacggcgacggcga 119197 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 119218 gcgacggcgacggcgacggcgacggcga 119191 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 119212 gcgacggcgacggcgacggcgacggcg 119186 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 119263 gcgacggcgacggcgacggcg 119243
>emb|BX000504.2|CNS08CDU Oryza sativa chromosome 12, . BAC OJ1239_F07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 104307 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 45661 gcgacggcgacggcgacggcgacggcga 45634 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 45655 gcgacggcgacggcgacggcgacggcga 45628 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 45649 gcgacggcgacggcgacggcgacggcg 45623 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 45700 gcgacggcgacggcgacggcg 45680
>gb|U97519.1|HSU97519 Homo sapiens podocalyxin-like protein mRNA, complete cds Length = 5869 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 344 gcgacggcgacggcgacggcgacggcga 317 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 338 gcgacggcgacggcgacggcgacg 315
>gb|AC136284.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1739D07, from chromosome 3, complete sequence Length = 149539 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgaggg 93 |||||||||||||||||||||||| Sbjct: 81698 cgacggcgacggcgacggcgaggg 81675
>dbj|D17760.1|RICARF Oryza sativa (japonica cultivar-group) mRNA for ADP-ribosylation factor, complete cds Length = 1064 Score = 48.1 bits (24), Expect = 0.029 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcga 90 ||||| |||||||||||||||||||||| Sbjct: 146 gcgacggcgacggcgacggcgacggcga 119
>ref|NM_194928.1| Oryza sativa (japonica cultivar-group) putative amidase (OSJNAa0034B05.13), mRNA Length = 1644 Score = 46.1 bits (23), Expect = 0.12 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||||| |||||||||| Sbjct: 67 cggcgacggcgacggcgaggaggaggaggag 37
>ref|XM_469958.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1075 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 237 cgcgacggcgacggcgacggcga 215 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacgg 87 |||||| ||||||||||||||||||| Sbjct: 237 cgcgacggcgacggcgacggcgacgg 212
>ref|XM_507061.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1119_A01.20-1 patrial mRNA Length = 3178 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 137 cgacggcgacggcgacggcgagg 159
>ref|XM_479592.1| Oryza sativa (japonica cultivar-group), mRNA Length = 546 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 459 cgacggcgacggcgacggcgagg 481
>ref|NM_185924.2| Oryza sativa (japonica cultivar-group), mRNA Length = 2634 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 145 cgacggcgacggcgacggcgagg 167
>ref|XM_476885.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2259 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 650 gcgacggcgacggcgacggcgag 672
>ref|XM_476423.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1377 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 10 gcgacggcgacggcgacggcgag 32
>ref|XM_474579.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1116 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 537 cgacggcgacggcgacggcgagg 559
>gb|AC119290.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0037H06, complete sequence Length = 144457 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 85978 gcgacggcgacggcgacggcgacggcg 85952 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 85978 gcgacggcgacggcgacggcga 85957
>gb|BT018830.1| Zea mays clone EL01N0551C10.d mRNA sequence Length = 1363 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 482 cgacggcgacggcgacggcgagg 504
>gb|AY022079.1| Oryza sativa microsatellite MRG4404 containing (TC)X15, closest to marker R3324, genomic sequence Length = 230 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 30 cgacggcgacggcgacggcgagg 52
>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0004E08, complete sequence Length = 158294 Score = 46.1 bits (23), Expect = 0.12 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||||| |||||||||| Sbjct: 42362 cggcgacggcgacggcgaggaggaggaggag 42332 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 52695 gcgacggcgacggcgacggcg 52675 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 38272 gcgacggcgacggcgacggcg 38252
>gb|AC079843.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0013J21, complete sequence Length = 155290 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgaggg 93 ||||| |||||||||| |||||||||||||| Sbjct: 93681 gcgacggcgacggcgagggcgacggcgaggg 93711 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 93679 cggcgacggcgacggcgaggg 93699
>gb|AC108872.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBb0079P23, complete sequence Length = 125090 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 15389 cgcgacggcgacggcgacggcga 15367 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggcgag 91 |||||| |||||||||||||||| |||||| Sbjct: 15389 cgcgacggcgacggcgacggcgatggcgag 15360 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcg 89 |||||||||||||||||||| Sbjct: 37072 cgacggcgacggcgacggcg 37091
>gb|AC099308.2| Drosophila melanogaster clone BACR11M14, complete sequence Length = 173097 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 127971 gcgacggcgacggcgacggcgacggcg 127945 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 127971 gcgacggcgacggcgacggcga 127950
>gb|AC090871.11| Oryza sativa chromosome 3 BAC OSJNBb0060J21 genomic sequence, complete sequence Length = 162497 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 59949 cgcgacggcgacggcgacggcga 59927 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacgg 87 |||||| ||||||||||||||||||| Sbjct: 59949 cgcgacggcgacggcgacggcgacgg 59924
>ref|NM_001038640.1| Homo sapiens golgi autoantigen, golgin subfamily a, 6 (GOLGA6), mRNA Length = 3176 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 1826 ggaggaggagatgaaggtgaagctgctggag 1856
>ref|NM_018652.4| Homo sapiens golgin-like protein (GOLGA), mRNA Length = 3178 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 1826 ggaggaggagatgaaggtgaagctgctggag 1856
>ref|XM_532439.2| PREDICTED: Canis familiaris similar to CG10979-PA, transcript variant 4 (LOC475207), mRNA Length = 3294 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 426 gcgacggcgacggcgacggcgacggcg 400 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 426 gcgacggcgacggcgacggcga 405
>ref|XM_844414.1| PREDICTED: Canis familiaris similar to CG10979-PA, transcript variant 5 (LOC475207), mRNA Length = 2855 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 426 gcgacggcgacggcgacggcgacggcg 400 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 426 gcgacggcgacggcgacggcga 405
>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04, complete sequence Length = 164882 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 128700 gcgacggcgacggcgacggcgag 128678
>gb|AC092781.6| Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence Length = 134496 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcg 83 ||||||||||||||||||||||| Sbjct: 79083 ccgcgaccgcgacggcgacggcg 79061
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgaggg 93 ||||| |||||||||| |||||||||||||| Sbjct: 2115541 gcgacggcgacggcgagggcgacggcgaggg 2115571 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1391290 cggcgacggcgacggcgagggg 1391311 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 2115539 cggcgacggcgacggcgaggg 2115559 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1700310 gcgacggcgacggcgacggcg 1700290 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 2291989 gacggcgacggcgacggcga 2292008
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 2121733 ccgcgacggcgacggcgacggcg 2121711 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcgag 91 ||||||||||||||||||| |||| Sbjct: 2301039 cgcgacggcgacggcgacgacgag 2301062
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 33541 gcgacggcgacggcgacggcgacggcg 33567 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 33541 gcgacggcgacggcgacggcga 33562
>emb|AL662959.3|OSJN00160 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019G23, complete sequence Length = 150305 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 26866 cgacggcgacggcgacggcgagg 26844
>gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0034B05, complete sequence Length = 125655 Score = 46.1 bits (23), Expect = 0.12 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||||| |||||||||| Sbjct: 108017 cggcgacggcgacggcgaggaggaggaggag 107987 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 118350 gcgacggcgacggcgacggcg 118330 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 103927 gcgacggcgacggcgacggcg 103907
>tpg|BK003235.1| TPA: TPA_inf: Drosophila melanogaster HDC19904 (HDC19904) gene, complete cds Length = 941 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 755 gcgacggcgacggcgacggcgacggcg 781 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 755 gcgacggcgacggcgacggcga 776
>gb|AC118981.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0060E18, from chromosome 3, complete sequence Length = 147983 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 16291 gcgacggcgacggcgacggcgacggcg 16317 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 16291 gcgacggcgacggcgacggcga 16312 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 74717 gcgacggcgacggcgacggcg 74697 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 107444 gacggcgacggcgacggcga 107463
>ref|XM_934956.1| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein), transcript variant 2 (LOC653643), mRNA Length = 1116 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 552 ggaggaggagatgaaggtgaagctgctggag 582
>ref|XM_370876.3| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein), transcript variant 1 (LOC653643), mRNA Length = 3166 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 1820 ggaggaggagatgaaggtgaagctgctggag 1850
>ref|XM_934954.1| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein), transcript variant 2 (LOC653641), mRNA Length = 1113 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 552 ggaggaggagatgaaggtgaagctgctggag 582
>ref|XM_496076.2| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein), transcript variant 1 (LOC653641), mRNA Length = 3161 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 1820 ggaggaggagatgaaggtgaagctgctggag 1850
>ref|XM_934846.1| PREDICTED: Homo sapiens similar to Golgi autoantigen, golgin subfamily A member 6 (Golgin linked to PML) (Golgin-like protein), transcript variant 2 (LOC653625), mRNA Length = 1116 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 552 ggaggaggagatgaaggtgaagctgctggag 582
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 46.1 bits (23), Expect = 0.12 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||||| |||||||||| Sbjct: 3451233 cggcgacggcgacggcgaggaggaggaggag 3451203 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgaggg 93 ||||| |||||||||| |||||||||||||| Sbjct: 2115541 gcgacggcgacggcgagggcgacggcgaggg 2115571 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 2614358 gcgacggcgacggcgacggcga 2614337 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1391290 cggcgacggcgacggcgagggg 1391311 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20246325 gcgacggcgacggcgacggcg 20246345 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20141189 gcgacggcgacggcgacggcg 20141209 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 12941425 cggcgacggcgacggcgaggg 12941445 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 10729294 cgacggcgacggcgacggcga 10729314 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 10011523 gcgacggcgacggcgacggcg 10011543 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 accgcgacggcgacggcgacg 86 ||||||||||||||||||||| Sbjct: 4282004 accgcgacggcgacggcgacg 4282024 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 3461566 gcgacggcgacggcgacggcg 3461546 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 3447143 gcgacggcgacggcgacggcg 3447123 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 2115539 cggcgacggcgacggcgaggg 2115559 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1700310 gcgacggcgacggcgacggcg 1700290 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgag 91 |||| |||||| |||||||||||||||| Sbjct: 21647763 cgacagcgacgtcgacggcgacggcgag 21647736 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 20782500 cggcgacggcgacggcgagg 20782519 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 15284910 cggcgacggcgacggcgagg 15284891 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgaggggagga 98 |||||||||||||||||| |||||||| Sbjct: 8992096 gacggcgacggcgacggctgggggagga 8992069 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgaggggagga 98 |||||||||||||||||| |||||||| Sbjct: 8912964 gacggcgacggcgacggctgggggagga 8912937 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgagggg 94 ||||||||||||||||||| |||| Sbjct: 7666263 gacggcgacggcgacggcgcgggg 7666286 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 2614358 gcgacggcgacggcgacggcgacg 2614335 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 2291989 gacggcgacggcgacggcga 2292008
>gb|AF263742.1|AF263742 Homo sapiens golgin-like protein (GLP) mRNA, complete cds Length = 3178 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 93 ggaggaggagatgaagctgaagcagctggag 123 |||||||||||||||| |||||| ||||||| Sbjct: 1826 ggaggaggagatgaaggtgaagctgctggag 1856
>gb|AC134229.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1081D05, complete sequence Length = 99133 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 91788 gcgacggcgacggcgacggcgacggcg 91814 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 91788 gcgacggcgacggcgacggcga 91809
>dbj|AP003861.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1046_F10 Length = 118472 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 13358 gcgacggcgacggcgacggcgag 13336
>dbj|AP003822.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1316_A04 Length = 87144 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 73038 cgacggcgacggcgacggcgagg 73016
>dbj|AP004752.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0501G04 Length = 156603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 97361 gcgacggcgacggcgacggcgacggcg 97387 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 97361 gcgacggcgacggcgacggcga 97382 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgag 91 |||||||||||||||||||||| Sbjct: 18200 cgacggcgacggcgacggcgag 18179
>dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1119_A01 Length = 108727 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 82284 cgacggcgacggcgacggcgagg 82262
>dbj|AP003946.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1147_D11 Length = 138444 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 27790 cgacggcgacggcgacggcgacggcga 27764 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 27785 gcgacggcgacggcgacggcgacggc 27760
>dbj|AP004085.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1267_F10 Length = 162669 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 24353 gcgacggcgacggcgacggcgag 24375
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgac 85 ||||||||||||||||||||||| Sbjct: 3297794 gcgaccgcgacggcgacggcgac 3297816
>dbj|AP004792.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0505A04 Length = 159241 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 80099 cgacggcgacggcgacggcgacggcga 80125 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 80104 gcgacggcgacggcgacggcgacgg 80128
>dbj|AP003568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017B12 Length = 157424 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 24135 cgcgacggcgacggcgacggcga 24113 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggc 88 |||||| |||||||||||||||||||| Sbjct: 24135 cgcgacggcgacggcgacggcgacggc 24109
>dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0416A11 Length = 171519 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 151241 cgcgacggcgacggcgacggcga 151219 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacggc 88 |||||| |||||||||||||||||||| Sbjct: 151241 cgcgacggcgacggcgacggcgacggc 151215
>dbj|AP006056.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1172G12 Length = 171974 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 110866 cgacggcgacggcgacggcgacggcga 110840 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggc 88 ||||| |||||||||||||||||||| Sbjct: 110861 gcgacggcgacggcgacggcgacggc 110836
>dbj|AP004054.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1249_F12 Length = 133205 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 68690 cgacggcgacggcgacggcgagg 68712
>dbj|AP003835.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1506_G02 Length = 106742 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 74488 gcgacggcgacggcgacggcgag 74466
>dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1150_E04 Length = 130973 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 34467 cgacggcgacggcgacggcgagg 34445
>emb|AL713904.3|CNS07YQ4 Oryza sativa chromosome 12, . BAC OJ1306_H03 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 121563 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 40671 ccgcgacggcgacggcgacggcg 40693 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||| ||||| Sbjct: 40671 ccgcgacggcgacggcgacggcggcggcg 40699
>dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1200_C08 Length = 106214 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 47306 cgacggcgacggcgacggcgagg 47284
>dbj|AP005892.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0011D16 Length = 177329 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 6476 gcgacggcgacggcgacggcgacggcg 6502 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 6476 gcgacggcgacggcgacggcga 6497
>dbj|AP005727.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0038I09 Length = 153520 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 39826 gcgacggcgacggcgacggcgacggcg 39852 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 39826 gcgacggcgacggcgacggcga 39847
>dbj|AP005115.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0700F06 Length = 139277 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 31150 cgacggcgacggcgacggcgagg 31172
>dbj|AP005542.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0473D02 Length = 146185 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggggaggag 99 ||||||||||| |||||||||| |||||||| Sbjct: 65759 gcgacggcgactgcgacggcgacgggaggag 65729
>dbj|AK119567.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-A06, full insert sequence Length = 2871 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 352 gcgacggcgacggcgacggcgag 374
>dbj|AP004272.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0427D10 Length = 154192 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 11801 cgacggcgacggcgacggcgagg 11779
>dbj|AK111216.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-B05, full insert sequence Length = 2634 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 145 cgacggcgacggcgacggcgagg 167
>dbj|AK109899.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-F06, full insert sequence Length = 1497 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 991 gcgacggcgacggcgacggcgag 1013
>dbj|AK109215.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-D09, full insert sequence Length = 656 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 318 cgacggcgacggcgacggcgagg 340
>dbj|AK108384.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-E10, full insert sequence Length = 1075 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 237 cgcgacggcgacggcgacggcga 215 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacgg 87 |||||| ||||||||||||||||||| Sbjct: 237 cgcgacggcgacggcgacggcgacgg 212
>dbj|AK107711.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-D10, full insert sequence Length = 885 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 128 gcgacggcgacggcgacggcgag 106
>dbj|AK107254.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-125-G06, full insert sequence Length = 1377 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 10 gcgacggcgacggcgacggcgag 32
>dbj|AK101148.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026P12, full insert sequence Length = 2848 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 86 cgacggcgacggcgacggcgacggcga 60 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacgg 87 ||||| ||||||||||||||||||| Sbjct: 81 gcgacggcgacggcgacggcgacgg 57
>dbj|AK100450.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023090P15, full insert sequence Length = 1268 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 92 ccgcgacggcgacggcgacggcg 70 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||| ||||| Sbjct: 92 ccgcgacggcgacggcgacggcggcggcg 64
>dbj|AK072145.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123O13, full insert sequence Length = 3452 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 136 cgacggcgacggcgacggcgagg 158
>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2, fertilization-independent endosperm proteins, hypothetical protein, putative non-LTR retroelement reverse transcriptase, OCL5 protein, tryptophan synthase beta-subunit, hypothetical proteins, putative AP endonuclease, putative RNA polymerase II complex component SRB7, putative beta-1,3-glucanase, hypothetical protein, TNP2-like protein, hypothetical protein, putative phosphate/phosphoenolpyruvate translocator, putative protein, hypothetical proteins, putative galactosyltransferase family, hypothetical protein, putative cytochrome P450 family, putative lipid transfer protein, putative photoreceptor-interacting protein, and hypothetical protein genes, complete cds; and hypothetical protein gene, partial cds Length = 202197 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 124973 gcgacggcgacggcgacggcgacggcg 124947 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 124973 gcgacggcgacggcgacggcga 124952
>dbj|AK066151.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013056H03, full insert sequence Length = 2872 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 353 gcgacggcgacggcgacggcgag 375
>dbj|AK065905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013046I17, full insert sequence Length = 1514 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 154 cgacggcgacggcgacggcgagg 176
>dbj|AK062636.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-D02, full insert sequence Length = 890 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 508 cgacggcgacggcgacggcgagg 530
>dbj|AP004262.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0022B05 Length = 151317 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 85789 gcgacggcgacggcgacggcgag 85767
>gb|AY109640.1| Zea mays CL1711_1 mRNA sequence Length = 1547 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 1202 gcgacggcgacggcgacggcgag 1180
>gb|AY108456.1| Zea mays PCO091049 mRNA sequence Length = 753 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 53 gcgacggcgacggcgacggcgag 75 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 49 gacggcgacggcgacggcga 68
>gb|AY911415.1| Zea mays phosphoenolpyruvate carboxylase kinase 3 (PPCK3) mRNA, complete cds Length = 995 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 503 cgacggcgacggcgacggcgagg 525
>emb|AL442113.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0806H05, complete sequence Length = 102515 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 70 cgacggcgacggcgacggcgagg 92 ||||||||||||||||||||||| Sbjct: 65126 cgacggcgacggcgacggcgagg 65104
>gb|AE003570.4| Drosophila melanogaster chromosome X, section 69 of 74 of the complete sequence Length = 300051 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcg 89 ||||| ||||||||||||||||||||| Sbjct: 284724 gcgacggcgacggcgacggcgacggcg 284750 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 284724 gcgacggcgacggcgacggcga 284745
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggcgaggg 93 |||||||||||||||||| |||||||| Sbjct: 1991895 ccgcgacggcgacggcgaaggcgaggg 1991869 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcga 90 |||| |||||||||||||||||||||| Sbjct: 988259 cgacggcgacggcgacggcgacggcga 988233 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 622419 gcgacggcgacggcgacggcga 622440 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggc 88 ||||||||||||||||||||| Sbjct: 1380250 cgcgacggcgacggcgacggc 1380230 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 988254 gcgacggcgacggcgacggcgacg 988231
>gb|U95180.1|ZMU95180 Zea mays endosperm specific protein mRNA, complete cds Length = 1547 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 1202 gcgacggcgacggcgacggcgag 1180
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 46.1 bits (23), Expect = 0.12 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg-ggaggaggag 102 |||||||||||||||||||| |||||||||| Sbjct: 3451154 cggcgacggcgacggcgaggaggaggaggag 3451124 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacggcgaggg 93 ||||| |||||||||| |||||||||||||| Sbjct: 2115492 gcgacggcgacggcgagggcgacggcgaggg 2115522 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 2614309 gcgacggcgacggcgacggcga 2614288 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 1391287 cggcgacggcgacggcgagggg 1391308 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20257601 gcgacggcgacggcgacggcg 20257621 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 20152465 gcgacggcgacggcgacggcg 20152485 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 12948765 cggcgacggcgacggcgaggg 12948785 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 10735333 cgacggcgacggcgacggcga 10735353 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 10017562 gcgacggcgacggcgacggcg 10017582 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 accgcgacggcgacggcgacg 86 ||||||||||||||||||||| Sbjct: 4282825 accgcgacggcgacggcgacg 4282845 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 3461487 gcgacggcgacggcgacggcg 3461467 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 3447064 gcgacggcgacggcgacggcg 3447044 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 2115490 cggcgacggcgacggcgaggg 2115510 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcg 89 ||||||||||||||||||||| Sbjct: 1700261 gcgacggcgacggcgacggcg 1700241 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgag 91 |||| |||||| |||||||||||||||| Sbjct: 21659426 cgacagcgacgtcgacggcgacggcgag 21659399 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 20793764 cggcgacggcgacggcgagg 20793783 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagg 92 |||||||||||||||||||| Sbjct: 15293151 cggcgacggcgacggcgagg 15293132 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgaggggagga 98 |||||||||||||||||| |||||||| Sbjct: 8997235 gacggcgacggcgacggctgggggagga 8997208 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgaggggagga 98 |||||||||||||||||| |||||||| Sbjct: 8918103 gacggcgacggcgacggctgggggagga 8918076 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcgagggg 94 ||||||||||||||||||| |||| Sbjct: 7670462 gacggcgacggcgacggcgcgggg 7670485 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 2614309 gcgacggcgacggcgacggcgacg 2614286 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gacggcgacggcgacggcga 90 |||||||||||||||||||| Sbjct: 2291940 gacggcgacggcgacggcga 2291959
>emb|AL772421.5|CNS08C9Z Oryza sativa chromosome 12, . BAC OJ1007_A12 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 130672 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 98484 cgcgacggcgacggcgacggcga 98506 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 108052 cgcgacggcgacggcgacgg 108071
>emb|AL772419.4|CNS08C9X Oryza sativa chromosome 12, . BAC OJ1115_G02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 112916 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 35981 cgcgacggcgacggcgacggcga 36003 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacgg 87 |||||||||||||||||||| Sbjct: 45549 cgcgacggcgacggcgacgg 45568
>emb|AL732532.4|CNS08C97 Oryza sativa chromosome 12, . BAC OSJNBa0027I07 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146366 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgag 91 ||||||||||||||||||||||| Sbjct: 70874 gcgacggcgacggcgacggcgag 70896
>emb|AL928754.2|CNS08CBR Oryza sativa chromosome 12, . BAC OSJNBa0056D07 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146686 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcg 89 ||||||||||||||||||||||| Sbjct: 16364 ccgcgacggcgacggcgacggcg 16386 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 61 ccgcgaccgcgacggcgacggcgacggcg 89 ||||||| ||||||||||||||| ||||| Sbjct: 16364 ccgcgacggcgacggcgacggcggcggcg 16392
>gb|AF058302.1|AF058302 Streptomyces roseofulvus frenolicin biosynthetic gene cluster, complete sequence Length = 25306 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 cgcgacggcgacggcgacggcga 90 ||||||||||||||||||||||| Sbjct: 13315 cgcgacggcgacggcgacggcga 13293 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 62 cgcgaccgcgacggcgacggcgacg 86 |||||| |||||||||||||||||| Sbjct: 13315 cgcgacggcgacggcgacggcgacg 13291
>gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, complete sequence Length = 149493 Score = 44.1 bits (22), Expect = 0.46 Identities = 31/34 (91%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcgaggggaggaggag 102 ||||||||||||||| ||||| ||||||||||| Sbjct: 138364 gcgacggcgacggcggcggcggcgggaggaggag 138397
>ref|NM_188577.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1677 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 863 gcgacggcgacggcgacggcga 884
>ref|NM_189680.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 732 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 211 gcgacggcgacggcgacggcga 190 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 211 gcgacggcgacggcgacggcgacg 188
>ref|XM_480252.1| Oryza sativa (japonica cultivar-group), mRNA Length = 417 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 238 cggcgacggcgacggcgagggg 259 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 54 cggcgacggcgacggcgagggg 75
>ref|XM_475579.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 567 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacggcgagg 92 ||||| |||||||||||||||||||| Sbjct: 38 ccgcgccggcgacggcgacggcgagg 63
>ref|NM_185044.1| Oryza sativa (japonica cultivar-group), mRNA Length = 891 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 878 gcgacggcgacggcgacggcga 857 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 878 gcgacggcgacggcgacggcgacg 855
>ref|XM_469835.1| Oryza sativa (japonica cultivar-group), mRNA Length = 945 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 313 gcgacggcgacggcgacggcga 334
>ref|XM_466233.1| Oryza sativa (japonica cultivar-group), mRNA Length = 483 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 218 cggcgacggcgacggcgagggg 239 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 35 cggcgacggcgacggcgagggg 56
>ref|XM_464540.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1437 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 1014 cgacggcgacggcgacggcgacggcg 1039 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 1014 cgacggcgacggcgacggcga 1034
>ref|XM_462659.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1395 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 905 cgacggcgacggcgacggcgacggcg 930 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 905 cgacggcgacggcgacggcga 925
>ref|XM_450584.1| Oryza sativa (japonica cultivar-group), mRNA Length = 864 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 539 cggcgacggcgacggcgagggg 518
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 67 ccgcgacggcgacggcgacggc 88 |||||||||||||||||||||| Sbjct: 3236606 ccgcgacggcgacggcgacggc 3236585 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ccgcgacggcgacggcgacg 86 |||||||||||||||||||| Sbjct: 1158272 ccgcgacggcgacggcgacg 1158291
>ref|NM_192354.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 510 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 293 cggcgacggcgacggcgagggg 314 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 110 cggcgacggcgacggcgagggg 131
>ref|NM_191319.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 402 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 183 cggcgacggcgacggcgagggg 204
>ref|NM_192747.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1056 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 68 cgcgacggcgacggcgacggcgaggg 93 |||| ||||||||||||||||||||| Sbjct: 25 cgcgccggcgacggcgacggcgaggg 50
>ref|XM_479414.1| Oryza sativa (japonica cultivar-group), mRNA Length = 966 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcg 89 |||| ||||||||||||||||||||| Sbjct: 913 cgacggcgacggcgacggcgacggcg 938 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 cgacggcgacggcgacggcga 90 ||||||||||||||||||||| Sbjct: 913 cgacggcgacggcgacggcga 933
>ref|XM_477786.1| Oryza sativa (japonica cultivar-group), mRNA Length = 558 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 400 gcgacggcgacggcgacggcga 421 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 400 gcgacggcgacggcgacggcgacg 423
>ref|NM_186151.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1707 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgaggggaggaggag 102 ||||| ||||||||||||| |||||||||| Sbjct: 222 cggcggcggcgacggcgagaggaggaggag 251
>gb|AC135918.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0115F21, complete sequence Length = 128493 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 84882 gcgacggcgacggcgacggcga 84861 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 84882 gcgacggcgacggcgacggcgacg 84859
>gb|DP000016.1| Pan troglodytes target 1 genomic scaffold Length = 1623484 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 415 ataaagaacttaaatttaaaag 436 |||||||||||||||||||||| Sbjct: 764245 ataaagaacttaaatttaaaag 764266
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 71 gacggcgacggcgacggcgaggggag 96 |||||||||| ||||||||||||||| Sbjct: 117322 gacggcgacgacgacggcgaggggag 117297
>gb|AC130597.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017K09, complete sequence Length = 155525 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcga 90 |||||||||||||||||||||| Sbjct: 51992 gcgacggcgacggcgacggcga 51971 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 63 gcgaccgcgacggcgacggcgacg 86 ||||| |||||||||||||||||| Sbjct: 51992 gcgacggcgacggcgacggcgacg 51969
>gb|AC134886.5| Oryza sativa chromosome 3 BAC OSJNBa0002D18 genomic sequence, complete sequence Length = 145714 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 89082 cggcgacggcgacggcgagggg 89061 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 74 ggcgacggcgacggcgagggg 94 ||||||||||||||||||||| Sbjct: 89189 ggcgacggcgacggcgagggg 89169 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 89152 cggcgacggcgacggcgaggg 89132
>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04, complete sequence Length = 88553 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 72 acggcgacggcgacggcgaggg 93 |||||||||||||||||||||| Sbjct: 52965 acggcgacggcgacggcgaggg 52944 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 69 gcgacggcgacggcgacggcgaggg 93 |||||||||||||||| |||||||| Sbjct: 52962 gcgacggcgacggcgagggcgaggg 52938
>gb|AC150698.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0072P10, complete sequence Length = 147540 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 124134 cggcgacggcgacggcgagggg 124113 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 73 cggcgacggcgacggcgaggg 93 ||||||||||||||||||||| Sbjct: 124315 cggcgacggcgacggcgaggg 124295
>gb|AC135431.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0683B12, complete sequence Length = 187523 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 166728 cggcgacggcgacggcgagggg 166749 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 73 cggcgacggcgacggcgagggg 94 |||||||||||||||||||||| Sbjct: 166545 cggcgacggcgacggcgagggg 166566
>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10, complete sequence Length = 140282 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 136620 cgaccacgacggcgacggcgacgccgaggg 136649 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 64 cgaccgcgacggcgacggcgacggcgaggg 93 ||||| ||||||||||||||||| |||||| Sbjct: 125264 cgaccacgacggcgacggcgacgccgaggg 125235 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,159,833 Number of Sequences: 3902068 Number of extensions: 6159833 Number of successful extensions: 172862 Number of sequences better than 10.0: 1142 Number of HSP's better than 10.0 without gapping: 1217 Number of HSP's successfully gapped in prelim test: 9 Number of HSP's that attempted gapping in prelim test: 147392 Number of HSP's gapped (non-prelim): 24666 length of query: 531 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 508 effective length of database: 17,143,297,704 effective search space: 8708795233632 effective search space used: 8708795233632 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
