Clone Name	bart35g09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|NM_189772.1| Oryza sativa (japonica cultivar-group), predic...	664	0.0
2	dbj|AK070047.1| Oryza sativa (japonica cultivar-group) cDNA clon...	664	0.0
3	dbj|AK067525.1| Oryza sativa (japonica cultivar-group) cDNA clon...	664	0.0
4	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	301	1e-78
5	dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic D...	301	1e-78
6	ref|NM_148873.1| Arabidopsis thaliana beta-galactosidase/ hydrol...	88	4e-14
7	ref|NM_001035781.1| Arabidopsis thaliana beta-galactosidase/ hyd...	88	4e-14
8	gb|AY091780.1| Arabidopsis thaliana At3g54435 mRNA, complete cds	88	4e-14
9	emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, B...	80	9e-12
10	ref|XM_452194.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B14883g ...	48	0.032
11	gb|AY526090.1| Kluyveromyces marxianus beta-D-galactosidase gene...	48	0.032
12	emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	48	0.032
13	gb|M84410.1|YSKLAC4A Kluyveromyces lactis beta-D-galactosidase (...	48	0.032
14	gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, compl...	46	0.13
15	gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, com...	46	0.13
16	dbj|AP005354.2| Homo sapiens genomic DNA, chromosome 8q23, clone...	46	0.13
17	gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, com...	42	2.0
18	gb|AF488695.1| Cloning vector pCpG-LacZdeltaCpG, complete sequence	42	2.0
19	emb|AL390839.33| Human DNA sequence from clone RP11-214L19 on ch...	42	2.0
20	gb|AC023934.6| Homo sapiens chromosome 17, clone RP11-618P13, co...	42	2.0
21	gb|AC011193.3| Homo sapiens chromosome 17, clone RP11-521P1, com...	42	2.0
22	emb|CR338999.2| Gallus gallus finished cDNA, clone ChEST949j11	42	2.0
23	gb|AC016909.9| Homo sapiens BAC clone RP11-458A7 from 2, complet...	42	2.0
24	gb|AC002482.1|AC002482 Human BAC clone CTA-208O3, complete sequence	42	2.0
25	gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, co...	42	2.0
26	ref|NM_124314.1| Arabidopsis thaliana unknown protein AT5G49370 ...	40	7.8
27	gb|AC159245.2| Mus musculus BAC clone RP24-260B5 from chromosome...	40	7.8
28	gb|AE008449.1| Streptococcus pneumoniae R6 section 65 of 184 of ...	40	7.8
29	gb|AF486415.1| Lagotis stolonifera chloroplast tRNA-Leu (trnL) g...	40	7.8
30	gb|AY423129.1| Titanotrichum oldhamii isolate DNA-G37 tRNA-Leu (...	40	7.8
31	gb|AY623324.1| Nematanthus fritschii trnL-trnF intergenic spacer...	40	7.8
32	gb|AY623322.1| Cremersia patula trnL-trnF intergenic spacer, par...	40	7.8
33	gb|AY623321.1| Rhytidophyllum sp. 2-JFS-2004 trnL-trnF intergeni...	40	7.8
34	gb|AY623320.1| Rhytidophyllum sp. 1-JFS-2004 trnL-trnF intergeni...	40	7.8
35	gb|AY623319.1| Rhytidophyllum leucomallon trnL-trnF intergenic s...	40	7.8
36	gb|AY623318.1| Rhytidophyllum tomentosum trnL-trnF intergenic sp...	40	7.8
37	gb|AY623317.1| Gesneria pedicellaris trnL-trnF intergenic spacer...	40	7.8
38	gb|AY623316.1| Gesneria sp. JFS-2004 trnL-trnF intergenic spacer...	40	7.8
39	gb|AY623315.1| Gesneria viridiflora trnL-trnF intergenic spacer,...	40	7.8
40	gb|AY623314.1| Gesneria ventricosa trnL-trnF intergenic spacer, ...	40	7.8
41	gb|AY623305.1| Anodiscus xanthophyllus trnL-trnF intergenic spac...	40	7.8
42	gb|AY364307.1| Sinningia richii chloroplast trnL-trnF intergenic...	40	7.8
43	gb|AY364306.1| Sinningia speciosa chloroplast trnL-trnF intergen...	40	7.8
44	gb|AY364305.1| Alloplectus panamensis chloroplast trnL-trnF inte...	40	7.8
45	gb|AY364303.1| Nematanthus albus chloroplast trnL-trnF intergeni...	40	7.8
46	gb|AY364301.1| Rhytidophyllum auriculatum chloroplast trnL-trnF ...	40	7.8
47	gb|AY364299.1| Napeanthus macrostoma chloroplast trnL-trnF inter...	40	7.8
48	gb|AY364298.1| Napeanthus apodemus chloroplast trnL-trnF interge...	40	7.8
49	gb|AY264499.1| Lopezia laciniata trnL gene, partial sequence; tr...	40	7.8
50	gb|AY456395.1| 'Chlorella' ellipsoidea oxygen-evolving enhancer ...	40	7.8
51	ref|XM_547369.2| PREDICTED: Canis familiaris similar to Kinesin-...	40	7.8
52	gb|AC104914.9| Mus musculus chromosome 9, clone RP23-108E20, com...	40	7.8
53	gb|AC114002.4| Mus musculus BAC clone RP23-165H7 from 12, comple...	40	7.8
54	gb|AY047156.1| Alloplectus bolivianus chloroplast tRNA-Leu (trnL...	40	7.8
55	gb|AY047155.1| Neomortonia nummularia chloroplast tRNA-Leu (trnL...	40	7.8
56	gb|AY047153.1| Corytoplectus cutucuensis chloroplast tRNA-Leu (t...	40	7.8
57	gb|AY047152.1| Drymonia serrulata chloroplast tRNA-Leu (trnL) ge...	40	7.8
58	gb|AY047151.1| Columnea spathulata chloroplast tRNA-Leu (trnL) g...	40	7.8
59	gb|AY047147.1| Codonanthe carnosa chloroplast tRNA-Leu (trnL) ge...	40	7.8
60	gb|AY047146.1| Paradrymonia binata chloroplast tRNA-Leu (trnL) g...	40	7.8
61	gb|AY047145.1| Nautilocalyx melittifolius chloroplast tRNA-Leu (...	40	7.8
62	gb|AY047144.1| Chrysothemis pulchella chloroplast tRNA-Leu (trnL...	40	7.8
63	gb|AY047143.1| Sinningia lindleyi chloroplast tRNA-Leu (trnL) ge...	40	7.8
64	gb|AY047142.1| Sinningia incarnata chloroplast tRNA-Leu (trnL) g...	40	7.8
65	gb|AY047141.1| Sinningia cooperi chloroplast tRNA-Leu (trnL) gen...	40	7.8
66	gb|AY047140.1| Paliavana prasinata chloroplast tRNA-Leu (trnL) g...	40	7.8
67	gb|AY047139.1| Vanhouttea lanata chloroplast tRNA-Leu (trnL) gen...	40	7.8
68	gb|AY047138.1| Gloxinia sarmentiana chloroplast tRNA-Leu (trnL) ...	40	7.8
69	gb|AY047120.1| Eucodonia verticillata chloroplast tRNA-Leu (trnL...	40	7.8
70	gb|AY047119.1| Eucodonia andrieuxii chloroplast tRNA-Leu (trnL) ...	40	7.8
71	gb|AY047118.1| Rhytidophyllum vernicosum chloroplast tRNA-Leu (t...	40	7.8
72	gb|AY047117.1| Rhytidophyllum auriculatum chloroplast tRNA-Leu (...	40	7.8
73	gb|AY047116.1| Gesneria rupincola chloroplast tRNA-Leu (trnL) ge...	40	7.8
74	gb|AY047115.1| Rhytidophyllum tomentosum chloroplast tRNA-Leu (t...	40	7.8
75	gb|AY047114.1| Rhytidophyllum exsertum chloroplast tRNA-Leu (trn...	40	7.8
76	gb|AY047113.1| Gesneria citrina chloroplast tRNA-Leu (trnL) gene...	40	7.8
77	gb|AY047112.1| Gesneria ventricosa chloroplast tRNA-Leu (trnL) g...	40	7.8
78	gb|AY047111.1| Gesneria pedunculosa chloroplast tRNA-Leu (trnL) ...	40	7.8
79	gb|AY047109.1| Gesneria viridiflora chloroplast tRNA-Leu (trnL) ...	40	7.8
80	gb|AY047108.1| Gesneria pedicellaris chloroplast tRNA-Leu (trnL)...	40	7.8
81	gb|AY047107.1| Gesneria reticulata chloroplast tRNA-Leu (trnL) g...	40	7.8
82	gb|AY047106.1| Gesneria cuneifolia chloroplast tRNA-Leu (trnL) g...	40	7.8
83	gb|AY047104.1| Gesneria acaulis chloroplast tRNA-Leu (trnL) gene...	40	7.8
84	gb|AY047102.1| Reldia minutiflora chloroplast tRNA-Leu (trnL) ge...	40	7.8
85	gb|AY047101.1| Gasteranthus quitensis chloroplast tRNA-Leu (trnL...	40	7.8
86	emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on ch...	40	7.8
87	gb|AY702431.1| Pheidonocarpa corymbosa tRNA-Leu (trnL) gene and ...	40	7.8
88	gb|AY702394.1| Bellonia spinosa tRNA-Leu (trnL) gene, partial se...	40	7.8
89	gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequ...	40	7.8
90	gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete seq...	40	7.8
91	gb|AF482612.1| Columnea sp. Lindqvist and Albert 30 chloroplast ...	40	7.8
92	gb|AC159198.2| Mus musculus BAC clone RP23-388C15 from chromosom...	40	7.8
93	gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome	40	7.8
94	gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, com...	40	7.8
95	dbj|AB023034.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	7.8
96	emb|AJ492319.1|PPR492319 Paliavana prasinata chloroplast tRNA-Le...	40	7.8
97	emb|AJ492318.1|SCA492318 Sinningia cardinalis chloroplast tRNA-L...	40	7.8
98	emb|AJ492317.1|RTO492317 Rhytidophyllum tomentosum chloroplast t...	40	7.8
99	emb|AJ492314.1|CSA492314 Columnea sanguinea chloroplast tRNA-Leu...	40	7.8
100	emb|AJ492310.1|BME492310 Besleria melancholica chloroplast tRNA-...	40	7.8
101	emb|AJ492308.1|LAU492308 Lenbrassia australiana chloroplast tRNA...	40	7.8
102	emb|AJ439819.1|VGA439819 Vanhouttea gardneri chloroplast partial...	40	7.8
103	emb|AJ439818.1|VSP439818 Vanhouttea sp. Salimena Pires et al. AC...	40	7.8
104	emb|AJ439816.1|VLA439816 Vanhouttea lanata chloroplast partial t...	40	7.8
105	emb|AJ439815.1|VSP439815 Vanhouttea sp. Salimena Pires et al. AC...	40	7.8
106	emb|AJ439813.1|VSP439813 Vanhouttea sp. Leoni 4197 chloroplast p...	40	7.8
107	emb|AJ439805.1|SLA439805 Sinningia lateritia chloroplast partial...	40	7.8
108	emb|AJ439804.1|SPU439804 Sinningia pusilla chloroplast partial t...	40	7.8
109	emb|AJ439803.1|SAG439803 Sinningia aghensis chloroplast partial ...	40	7.8
110	emb|AJ439802.1|SIN439802 Sinningia incarnata chloroplast partial...	40	7.8
111	emb|AJ439801.1|SAL439801 Sinningia allagophylla chloroplast part...	40	7.8
112	emb|AJ439800.1|SCU439800 Sinningia curtiflora chloroplast partia...	40	7.8
113	emb|AJ439799.1|SCO439799 Sinningia cochlearis chloroplast partia...	40	7.8
114	emb|AJ439798.1|SVI439798 Sinningia villosa chloroplast partial t...	40	7.8
115	emb|AJ439797.1|SRI439797 Sinningia richii chloroplast partial tR...	40	7.8
116	emb|AJ439796.1|SGU439796 Sinningia guttata chloroplast partial t...	40	7.8
117	emb|AJ439795.1|SVA439795 Sinningia valsuganensis chloroplast par...	40	7.8
118	emb|AJ439794.1|SMI439794 Sinningia micans chloroplast partial tR...	40	7.8
119	emb|AJ439793.1|SSC439793 Sinningia sceptrum chloroplast partial ...	40	7.8
120	emb|AJ439792.1|SEL439792 Sinningia elatior chloroplast partial t...	40	7.8
121	emb|AJ439791.1|SSP439791 Sinningia sp. Romero et al. 1709 chloro...	40	7.8
122	emb|AJ439790.1|SIA439790 Sinningia iarae chloroplast partial tRN...	40	7.8
123	emb|AJ439789.1|SRU439789 Sinningia rupicola chloroplast partial ...	40	7.8
124	emb|AJ439788.1|SGI439788 Sinningia gigantifolia chloroplast part...	40	7.8
125	emb|AJ439787.1|SCO439787 Sinningia concinna chloroplast partial ...	40	7.8
126	emb|AJ439786.1|SHA439786 Sinningia harleyi chloroplast partial t...	40	7.8
127	emb|AJ439785.1|SCA439785 Sinningia carangolensis chloroplast par...	40	7.8
128	emb|AJ439784.1|SCO439784 Sinningia conspicua chloroplast partial...	40	7.8
129	emb|AJ439783.1|SMA439783 Sinningia magnifica chloroplast partial...	40	7.8
130	emb|AJ439782.1|STU439782 Sinningia tuberosa chloroplast partial ...	40	7.8
131	emb|AJ439781.1|SNO439781 Sinningia nordestina chloroplast partia...	40	7.8
132	emb|AJ439780.1|SBA439780 Sinningia barbata chloroplast partial t...	40	7.8
133	emb|AJ439779.1|SSP439779 Sinningia speciosa chloroplast partial ...	40	7.8
134	emb|AJ439778.1|SHI439778 Sinningia hirsuta chloroplast partial t...	40	7.8
135	emb|AJ439777.1|SSE439777 Sinningia sellowii chloroplast partial ...	40	7.8
136	emb|AJ439776.1|SMA439776 Sinningia mauroana chloroplast partial ...	40	7.8
137	emb|AJ439775.1|SCA439775 Sinningia cardinalis chloroplast partia...	40	7.8
138	emb|AJ439774.1|STU439774 Sinningia tubiflora chloroplast partial...	40	7.8
139	emb|AJ439773.1|SKA439773 Sinningia kautskyi chloroplast partial ...	40	7.8
140	emb|AJ439772.1|SCA439772 Sinningia calcaria chloroplast partial ...	40	7.8
141	emb|AJ439771.1|SLE439771 Sinningia leopoldii chloroplast partial...	40	7.8
142	emb|AJ439770.1|SDO439770 Sinningia douglasii chloroplast partial...	40	7.8
143	emb|AJ439769.1|SST439769 Sinningia striata chloroplast partial t...	40	7.8
144	emb|AJ439768.1|SSP439768 Sinningia sp. Cervi et al. AC484 chloro...	40	7.8
145	emb|AJ439767.1|SNI439767 Sinningia nivalis chloroplast partial t...	40	7.8
146	emb|AJ439766.1|SIN439766 Sinningia insularis chloroplast partial...	40	7.8
147	emb|AJ439765.1|SWA439765 Sinningia warmingii chloroplast partial...	40	7.8
148	emb|AJ439764.1|SCO439764 Sinningia cooperi chloroplast partial t...	40	7.8
149	emb|AJ439763.1|SHA439763 Sinningia hatschbachii chloroplast part...	40	7.8
150	emb|AJ439762.1|SGL439762 Sinningia glazioviana chloroplast parti...	40	7.8
151	emb|AJ439761.1|SDE439761 Sinningia defoliata chloroplast partial...	40	7.8
152	emb|AJ439760.1|SLE439760 Sinningia leucotricha chloroplast parti...	40	7.8
153	emb|AJ439759.1|SMA439759 Sinningia macrostachya chloroplast part...	40	7.8
154	emb|AJ439758.1|SLI439758 Sinningia lineata chloroplast partial t...	40	7.8
155	emb|AJ439756.1|SBR439756 Sinningia brasiliensis chloroplast part...	40	7.8
156	emb|AJ439755.1|SRE439755 Sinningia reitzii chloroplast partial t...	40	7.8
157	emb|AJ439754.1|SBU439754 Sinningia bulbosa chloroplast partial t...	40	7.8
158	emb|AJ439753.1|SEU439753 Sinningia eumorpha chloroplast partial ...	40	7.8
159	emb|AJ439752.1|SMA439752 Sinningia macropoda chloroplast partial...	40	7.8
160	emb|AJ439751.1|SCA439751 Sinningia canescens chloroplast partial...	40	7.8
161	emb|AJ439750.1|SPI439750 Sinningia piresiana chloroplast partial...	40	7.8
162	emb|AJ439749.1|SMA439749 Sinningia macrophylla chloroplast parti...	40	7.8
163	emb|AJ439748.1|SAR439748 Sinningia araneosa chloroplast partial ...	40	7.8
164	emb|AJ439747.1|SLI439747 Sinningia lindleyi chloroplast partial ...	40	7.8
165	emb|AJ439746.1|SSP439746 Sinningia sp. Chautems Perret 99-051 ch...	40	7.8
166	emb|AJ439745.1|SSC439745 Sinningia schiffneri chloroplast partia...	40	7.8
167	emb|AJ439829.1|NME439829 Nautilocalyx melittifolius chloroplast ...	40	7.8
168	emb|AJ439825.1|NVI439825 Nematanthus villosus chloroplast partia...	40	7.8
169	emb|AJ439811.1|PCO439811 Paliavana sp. Leoni 1812 chloroplast pa...	40	7.8
170	emb|AJ439808.1|PSE439808 Paliavana sericiflora chloroplast parti...	40	7.8
171	emb|AJ439807.1|PTE439807 Paliavana tenuiflora chloroplast partia...	40	7.8
172	emb|AJ439806.1|PPR439806 Paliavana prasinata chloroplast partia...	40	7.8
173	emb|AJ439757.1|SAG439757 Sinningia aggregata chloroplast partial...	40	7.8
174	emb|AJ439826.1|CSE439826 Codonanthe serrulata chloroplast partia...	40	7.8
175	dbj|AP006108.1| Lotus japonicus genomic DNA, chromosome 4, clone...	40	7.8
176	emb|AJ492321.1|NRE492321 Napeanthus reitzii chloroplast tRNA-Leu...	40	7.8
177	emb|AJ492316.1|NVI492316 Nematanthus villosus chloroplast tRNA-L...	40	7.8
178	gb|AC152164.14| Mus musculus chromosome 8, clone RP24-118N20, co...	40	7.8
179	emb|AJ296522.1|VAR296522 Verbascum arcturus chloroplast tRNA-Leu...	40	7.8

---

>ref|NM_189772.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 3348

 Score =  664 bits (335), Expect = 0.0
 Identities = 443/479 (92%)
 Strand = Plus / Plus

                                                                        
Query: 97   atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156
            |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 1016 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 1075

                                                                        
Query: 157  aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216
            || | ||  |||||||||||||||||||| ||||||||||| |||| |||||||| ||||
Sbjct: 1076 aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 1135

                                                                        
Query: 217  attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276
            | |||||||||||||||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 1136 agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 1195

                                                                        
Query: 277  tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336
            ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1196 tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 1255

                                                                        
Query: 337  ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396
            | ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 1256 gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1315

                                                                        
Query: 397  tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456
            | |||||||||||||||   ||||| |||||||||||||||||||||||| | || ||||
Sbjct: 1316 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1375

                                                                        
Query: 457  tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516
            | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| |||
Sbjct: 1376 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1435

                                                                       
Query: 517  gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575
            |||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||||
Sbjct: 1436 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1494

---

>dbj|AK070047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038J20, full
            insert sequence
          Length = 3913

 Score =  664 bits (335), Expect = 0.0
 Identities = 443/479 (92%)
 Strand = Plus / Plus

                                                                        
Query: 97   atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156
            |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 1191 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 1250

                                                                        
Query: 157  aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216
            || | ||  |||||||||||||||||||| ||||||||||| |||| |||||||| ||||
Sbjct: 1251 aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 1310

                                                                        
Query: 217  attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276
            | |||||||||||||||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 1311 agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 1370

                                                                        
Query: 277  tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336
            ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1371 tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 1430

                                                                        
Query: 337  ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396
            | ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 1431 gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1490

                                                                        
Query: 397  tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456
            | |||||||||||||||   ||||| |||||||||||||||||||||||| | || ||||
Sbjct: 1491 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1550

                                                                        
Query: 457  tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516
            | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| |||
Sbjct: 1551 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1610

                                                                       
Query: 517  gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575
            |||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||||
Sbjct: 1611 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1669

---

>dbj|AK067525.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108P17, full
            insert sequence
          Length = 3268

 Score =  664 bits (335), Expect = 0.0
 Identities = 443/479 (92%)
 Strand = Plus / Plus

                                                                        
Query: 97   atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156
            |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 753  atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 812

                                                                        
Query: 157  aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216
            || | ||  |||||||||||||||||||| ||||||||||| |||| |||||||| ||||
Sbjct: 813  aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 872

                                                                        
Query: 217  attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276
            | |||||||||||||||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 873  agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 932

                                                                        
Query: 277  tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336
            ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 933  tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 992

                                                                        
Query: 337  ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396
            | ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 993  gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1052

                                                                        
Query: 397  tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456
            | |||||||||||||||   ||||| |||||||||||||||||||||||| | || ||||
Sbjct: 1053 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1112

                                                                        
Query: 457  tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516
            | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| |||
Sbjct: 1113 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1172

                                                                       
Query: 517  gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575
            |||||||||||||||||||||| |||||| ||||||||| | |||||||||||||||||
Sbjct: 1173 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1231

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  301 bits (152), Expect = 1e-78
 Identities = 191/204 (93%)
 Strand = Plus / Plus

                                                                            
Query: 166      acttatacactcttgttgttctccttaaagatgccaatgggaagcttattgattgtgaat 225
                |||||||||||||||||||| ||||||||||| |||| |||||||| ||||| |||||||
Sbjct: 41951015 acttatacactcttgttgttgtccttaaagattccaacgggaagctcattgagtgtgaat 41951074

                                                                            
Query: 226      catgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttgtcaatggat 285
                ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 41951075 catgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttgtcaatggat 41951134

                                                                            
Query: 286      ctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttgggaagacaa 345
                 |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 41951135 gtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttggaaagacaa 41951194

                                        
Query: 346      atttagaagcatgcatgatcaagg 369
                |||||||||| |||||||| ||||
Sbjct: 41951195 atttagaagcttgcatgattaagg 41951218



 Score =  280 bits (141), Expect = 5e-72
 Identities = 192/209 (91%)
 Strand = Plus / Plus

                                                                            
Query: 367      aggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcattaccccc 426
                ||||||||||||||||||||||||||||||| |||||||||||||||   ||||| ||||
Sbjct: 41951333 aggatctggttttgatgagacaaaacaacattaatgctgttagaaacagccattatcccc 41951392

                                                                            
Query: 427      aacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatgaagcca 486
                |||||||||||||||||||| | || ||||| ||||| ||||||||||||||||||||||
Sbjct: 41951393 aacatccaaggtggtatgagctgtgtgacatttttggactttatgtaattgatgaagcca 41951452

                                                                            
Query: 487      atatcgagacacatggctttgatgaaactagccatttcaaacatcctacactagaaccca 546
                | |||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||| 
Sbjct: 41951453 acatcgagacgcatggctttgatgaatctagccatttcaaacatcctacacttgaaccct 41951512

                                             
Query: 547      tctgggcaaattctatgcttgatcgtgtt 575
                ||||||||| | |||||||||||||||||
Sbjct: 41951513 tctgggcaagtgctatgcttgatcgtgtt 41951541



 Score =  107 bits (54), Expect = 4e-20
 Identities = 60/62 (96%)
 Strand = Plus / Plus

                                                                            
Query: 97       atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156
                |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 41950855 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 41950914

                  
Query: 157      aa 158
                ||
Sbjct: 41950915 aa 41950916

---

>dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431G06
          Length = 140466

 Score =  301 bits (152), Expect = 1e-78
 Identities = 191/204 (93%)
 Strand = Plus / Plus

                                                                         
Query: 166   acttatacactcttgttgttctccttaaagatgccaatgggaagcttattgattgtgaat 225
             |||||||||||||||||||| ||||||||||| |||| |||||||| ||||| |||||||
Sbjct: 53092 acttatacactcttgttgttgtccttaaagattccaacgggaagctcattgagtgtgaat 53151

                                                                         
Query: 226   catgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttgtcaatggat 285
             ||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 53152 catgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttgtcaatggat 53211

                                                                         
Query: 286   ctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttgggaagacaa 345
              |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 53212 gtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttggaaagacaa 53271

                                     
Query: 346   atttagaagcatgcatgatcaagg 369
             |||||||||| |||||||| ||||
Sbjct: 53272 atttagaagcttgcatgattaagg 53295



 Score =  280 bits (141), Expect = 5e-72
 Identities = 192/209 (91%)
 Strand = Plus / Plus

                                                                         
Query: 367   aggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcattaccccc 426
             ||||||||||||||||||||||||||||||| |||||||||||||||   ||||| ||||
Sbjct: 53410 aggatctggttttgatgagacaaaacaacattaatgctgttagaaacagccattatcccc 53469

                                                                         
Query: 427   aacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatgaagcca 486
             |||||||||||||||||||| | || ||||| ||||| ||||||||||||||||||||||
Sbjct: 53470 aacatccaaggtggtatgagctgtgtgacatttttggactttatgtaattgatgaagcca 53529

                                                                         
Query: 487   atatcgagacacatggctttgatgaaactagccatttcaaacatcctacactagaaccca 546
             | |||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||| 
Sbjct: 53530 acatcgagacgcatggctttgatgaatctagccatttcaaacatcctacacttgaaccct 53589

                                          
Query: 547   tctgggcaaattctatgcttgatcgtgtt 575
             ||||||||| | |||||||||||||||||
Sbjct: 53590 tctgggcaagtgctatgcttgatcgtgtt 53618



 Score =  107 bits (54), Expect = 4e-20
 Identities = 60/62 (96%)
 Strand = Plus / Plus

                                                                         
Query: 97    atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156
             |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||
Sbjct: 52932 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 52991

               
Query: 157   aa 158
             ||
Sbjct: 52992 aa 52993

---

>ref|NM_148873.1| Arabidopsis thaliana beta-galactosidase/ hydrolase, hydrolyzing
            O-glycosyl compounds AT3G54440 transcript variant
            AT3G54440.1 mRNA, complete cds
          Length = 3567

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                        
Query: 302  aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361
            |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| ||||||||
Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405

                                                                        
Query: 362  gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421
            | |||||||| |  || |||||| | || | || |||||||| ||  |||||  ||||||
Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465

                                                                        
Query: 422  cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481
             || ||||||||  | |||||||| ||||| ||  | || ||  | ||  | || |||||
Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525

                                        
Query: 482  agccaatatcgagacacatggctttgat 509
            ||||||||| ||||||||||| ||||||
Sbjct: 1526 agccaatatagagacacatggttttgat 1553

---

>ref|NM_001035781.1| Arabidopsis thaliana beta-galactosidase/ hydrolase, hydrolyzing
            O-glycosyl compounds AT3G54440 transcript variant
            AT3G54440.2 mRNA, complete cds
          Length = 3604

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                        
Query: 302  aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361
            |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| ||||||||
Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405

                                                                        
Query: 362  gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421
            | |||||||| |  || |||||| | || | || |||||||| ||  |||||  ||||||
Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465

                                                                        
Query: 422  cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481
             || ||||||||  | |||||||| ||||| ||  | || ||  | ||  | || |||||
Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525

                                        
Query: 482  agccaatatcgagacacatggctttgat 509
            ||||||||| ||||||||||| ||||||
Sbjct: 1526 agccaatatagagacacatggttttgat 1553

---

>gb|AY091780.1| Arabidopsis thaliana At3g54435 mRNA, complete cds
          Length = 3568

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                        
Query: 302  aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361
            |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| ||||||||
Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405

                                                                        
Query: 362  gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421
            | |||||||| |  || |||||| | || | || |||||||| ||  |||||  ||||||
Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465

                                                                        
Query: 422  cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481
             || ||||||||  | |||||||| ||||| ||  | || ||  | ||  | || |||||
Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525

                                        
Query: 482  agccaatatcgagacacatggctttgat 509
            ||||||||| ||||||||||| ||||||
Sbjct: 1526 agccaatatagagacacatggttttgat 1553

---

>emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, BAC clone T14E10
          Length = 94911

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                         
Query: 302   aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361
             |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| ||||||||
Sbjct: 22173 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 22114

                     
Query: 362   gatcaagg 369
             | ||||||
Sbjct: 22113 ggtcaagg 22106



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 477   gatgaagccaatatcgagacacatggctttgat 509
             |||||||||||||| ||||||||||| ||||||
Sbjct: 21872 gatgaagccaatatagagacacatggttttgat 21840

---

>ref|XM_452194.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B14883g predicted mRNA
          Length = 3078

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 298  ttagaggtgtcaacagacatgagcatcatcca 329
            |||||||||||||||||||||| || ||||||
Sbjct: 1046 ttagaggtgtcaacagacatgatcaccatcca 1077

---

>gb|AY526090.1| Kluyveromyces marxianus beta-D-galactosidase gene, complete cds
          Length = 3155

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 298  ttagaggtgtcaacagacatgagcatcatcca 329
            |||||||||||||||||||||| || ||||||
Sbjct: 1063 ttagaggtgtcaacagacatgatcaccatcca 1094

---

>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1320834

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                               
Query: 298     ttagaggtgtcaacagacatgagcatcatcca 329
               |||||||||||||||||||||| || ||||||
Sbjct: 1311546 ttagaggtgtcaacagacatgatcaccatcca 1311577

---

>gb|M84410.1|YSKLAC4A Kluyveromyces lactis beta-D-galactosidase (LAC4) gene, complete cds
          Length = 3703

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 298  ttagaggtgtcaacagacatgagcatcatcca 329
            |||||||||||||||||||||| || ||||||
Sbjct: 1088 ttagaggtgtcaacagacatgatcaccatcca 1119

---

>gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, complete sequence
          Length = 150052

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 445   agttatgcgacatctttggtctttatg 471
             |||||||| ||||||||||||||||||
Sbjct: 96909 agttatgcaacatctttggtctttatg 96935

---

>gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, complete sequence
          Length = 178736

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 445    agttatgcgacatctttggtctttatg 471
              |||||||| ||||||||||||||||||
Sbjct: 150439 agttatgcaacatctttggtctttatg 150413

---

>dbj|AP005354.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1159C3, complete
             sequence
          Length = 133276

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 445   agttatgcgacatctttggtctttatg 471
             |||||||| ||||||||||||||||||
Sbjct: 49169 agttatgcaacatctttggtctttatg 49195

---

>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence
          Length = 187760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 247   atgtggtcctggcacacaagcagat 271
             |||||||||||||||||| ||||||
Sbjct: 42142 atgtggtcctggcacacatgcagat 42118

---

>gb|AF488695.1| Cloning vector pCpG-LacZdeltaCpG, complete sequence
          Length = 5239

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 475  ttgatgaagccaatatcgagacacatggc 503
            ||||||||||||| || ||||||||||||
Sbjct: 1769 ttgatgaagccaacattgagacacatggc 1797

---

>emb|AL390839.33| Human DNA sequence from clone RP11-214L19 on chromosome 1 Contains a
            novel gene, complete sequence
          Length = 92253

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 58   acttgaagacaaagccaaaac 78
            |||||||||||||||||||||
Sbjct: 3572 acttgaagacaaagccaaaac 3592

---

>gb|AC023934.6| Homo sapiens chromosome 17, clone RP11-618P13, complete sequence
          Length = 157069

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 184   ttctccttaaagatgccaatg 204
             |||||||||||||||||||||
Sbjct: 24641 ttctccttaaagatgccaatg 24661

---

>gb|AC011193.3| Homo sapiens chromosome 17, clone RP11-521P1, complete sequence
          Length = 181022

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 89     cccttgccatggttttcatgg 109
              |||||||||||||||||||||
Sbjct: 117815 cccttgccatggttttcatgg 117795

---

>emb|CR338999.2| Gallus gallus finished cDNA, clone ChEST949j11
          Length = 1218

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 379 tgatgagacaaaacaacatca 399
           |||||||||||||||||||||
Sbjct: 66  tgatgagacaaaacaacatca 86

---

>gb|AC016909.9| Homo sapiens BAC clone RP11-458A7 from 2, complete sequence
          Length = 155535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 498    catggctttgatgaaactagc 518
              |||||||||||||||||||||
Sbjct: 117050 catggctttgatgaaactagc 117070

---

>gb|AC002482.1|AC002482 Human BAC clone CTA-208O3, complete sequence
          Length = 107815

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 89    cccttgccatggttttcatgg 109
             |||||||||||||||||||||
Sbjct: 24992 cccttgccatggttttcatgg 25012

---

>gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, complete sequence
          Length = 192545

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 247    atgtggtcctggcacacaagcagat 271
              |||||||||||||||||| ||||||
Sbjct: 172907 atgtggtcctggcacacatgcagat 172883

---

>ref|NM_124314.1| Arabidopsis thaliana unknown protein AT5G49370 mRNA, complete cds
          Length = 357

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 464 tctttatgtaattgatgaag 483
           ||||||||||||||||||||
Sbjct: 186 tctttatgtaattgatgaag 205

---

>gb|AC159245.2| Mus musculus BAC clone RP24-260B5 from chromosome 12, complete sequence
          Length = 168773

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    aatccaaagctttggtctag 154
              ||||||||||||||||||||
Sbjct: 100608 aatccaaagctttggtctag 100589

---

>gb|AE008449.1| Streptococcus pneumoniae R6 section 65 of 184 of the complete
           genome
          Length = 11727

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 475 ttgatgaagccaatatcgagacac 498
           ||||||||||||||||| ||||||
Sbjct: 689 ttgatgaagccaatatcaagacac 666

---

>gb|AF486415.1| Lagotis stolonifera chloroplast tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer, partial sequence
          Length = 878

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 704 tattgattgtgaatcattccaa-tagggattc 674

---

>gb|AY423129.1| Titanotrichum oldhamii isolate DNA-G37 tRNA-Leu (trnL) gene and
           trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 881

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 723 tattgattgtgaatcattccaa-tagggattc 693

---

>gb|AY623324.1| Nematanthus fritschii trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 333

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 148 tattgattgtgaatcattccaa-tagggattc 118

---

>gb|AY623322.1| Cremersia patula trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 287

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 148 tattgattgtgaatcattccaa-tagggattc 118

---

>gb|AY623321.1| Rhytidophyllum sp. 2-JFS-2004 trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 338

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623320.1| Rhytidophyllum sp. 1-JFS-2004 trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 338

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623319.1| Rhytidophyllum leucomallon trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 311

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623318.1| Rhytidophyllum tomentosum trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 338

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623317.1| Gesneria pedicellaris trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 315

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623316.1| Gesneria sp. JFS-2004 trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 338

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623315.1| Gesneria viridiflora trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 338

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623314.1| Gesneria ventricosa trnL-trnF intergenic spacer, partial sequence;
           chloroplast
          Length = 341

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119

---

>gb|AY623305.1| Anodiscus xanthophyllus trnL-trnF intergenic spacer, partial
           sequence; chloroplast
          Length = 349

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 158 tattgattgtgaatcattccaa-tagggattc 128

---

>gb|AY364307.1| Sinningia richii chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 383

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 201 tattgattgtgaatcattccaa-tagggattc 171

---

>gb|AY364306.1| Sinningia speciosa chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 396

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 198 tattgattgtgaatcattccaa-tagggattc 168

---

>gb|AY364305.1| Alloplectus panamensis chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 391

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 193 tattgattgtgaatcattccaa-tagggattc 163

---

>gb|AY364303.1| Nematanthus albus chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 393

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 193 tattgattgtgaatcattccaa-tagggattc 163

---

>gb|AY364301.1| Rhytidophyllum auriculatum chloroplast trnL-trnF intergenic spacer
           and tRNA-Phe gene, partial sequence
          Length = 398

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164

---

>gb|AY364299.1| Napeanthus macrostoma chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 391

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164

---

>gb|AY364298.1| Napeanthus apodemus chloroplast trnL-trnF intergenic spacer and
           tRNA-Phe gene, partial sequence
          Length = 392

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164

---

>gb|AY264499.1| Lopezia laciniata trnL gene, partial sequence; trnL-trnF intergenic
           spacer region, complete sequence; and trnF gene, partial
           sequence; chloroplast genes for chloroplast products
          Length = 941

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 ttattgattgtgaatcatgc 230
           ||||||||||||||||||||
Sbjct: 773 ttattgattgtgaatcatgc 754

---

>gb|AY456395.1| 'Chlorella' ellipsoidea oxygen-evolving enhancer protein 1 mRNA,
           partial cds
          Length = 817

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 172 acactcttgttgttctcctt 191
           ||||||||||||||||||||
Sbjct: 353 acactcttgttgttctcctt 334

---

>ref|XM_547369.2| PREDICTED: Canis familiaris similar to Kinesin-like protein KIF14
           (LOC490248), mRNA
          Length = 5094

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 22  atttgaattcagatatgtca 41
           ||||||||||||||||||||
Sbjct: 224 atttgaattcagatatgtca 243

---

>gb|AC104914.9| Mus musculus chromosome 9, clone RP23-108E20, complete sequence
          Length = 260181

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     gaattcagatatgtcagatg 45
              ||||||||||||||||||||
Sbjct: 246716 gaattcagatatgtcagatg 246735

---

>gb|AC114002.4| Mus musculus BAC clone RP23-165H7 from 12, complete sequence
          Length = 200112

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 283  gatctcctgttgtaattaga 302
            ||||||||||||||||||||
Sbjct: 8671 gatctcctgttgtaattaga 8690

---

>gb|AY047156.1| Alloplectus bolivianus chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 861

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 709 tattgattgtgaatcattccaa-tagggattc 679

---

>gb|AY047155.1| Neomortonia nummularia chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 874

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>gb|AY047153.1| Corytoplectus cutucuensis chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 838

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 686 tattgattgtgaatcattccaa-tagggattc 656

---

>gb|AY047152.1| Drymonia serrulata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 878

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 726 tattgattgtgaatcattccaa-tagggattc 696

---

>gb|AY047151.1| Columnea spathulata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 883

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 731 tattgattgtgaatcattccaa-tagggattc 701

---

>gb|AY047147.1| Codonanthe carnosa chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707

---

>gb|AY047146.1| Paradrymonia binata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 859

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 707 tattgattgtgaatcattccaa-tagggattc 677

---

>gb|AY047145.1| Nautilocalyx melittifolius chloroplast tRNA-Leu (trnL) gene,
           partial sequence; and trnL-trnF intergenic spacer,
           complete sequence
          Length = 862

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 708 tattgattgtgaatcattccaa-tagggattc 678

---

>gb|AY047144.1| Chrysothemis pulchella chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 887

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 735 tattgattgtgaatcattccaa-tagggattc 705

---

>gb|AY047143.1| Sinningia lindleyi chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707

---

>gb|AY047142.1| Sinningia incarnata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 852

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 700 tattgattgtgaatcattccaa-tagggattc 670

---

>gb|AY047141.1| Sinningia cooperi chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 884

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047140.1| Paliavana prasinata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 738 tattgattgtgaatcattccaa-tagggattc 708

---

>gb|AY047139.1| Vanhouttea lanata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 889

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707

---

>gb|AY047138.1| Gloxinia sarmentiana chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 857

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 705 tattgattgtgaatcattccaa-tagggattc 675

---

>gb|AY047120.1| Eucodonia verticillata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 894

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||| ||||| |||| |||||||||
Sbjct: 736 tattgattgtgcatcattccaaatagggattc 705

---

>gb|AY047119.1| Eucodonia andrieuxii chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 907

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||| ||||| |||| |||||||||
Sbjct: 749 tattgattgtgcatcattccaaatagggattc 718

---

>gb|AY047118.1| Rhytidophyllum vernicosum chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047117.1| Rhytidophyllum auriculatum chloroplast tRNA-Leu (trnL) gene,
           partial sequence; and trnL-trnF intergenic spacer,
           complete sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047116.1| Gesneria rupincola chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047115.1| Rhytidophyllum tomentosum chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047114.1| Rhytidophyllum exsertum chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047113.1| Gesneria citrina chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047112.1| Gesneria ventricosa chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047111.1| Gesneria pedunculosa chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047109.1| Gesneria viridiflora chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047108.1| Gesneria pedicellaris chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 829

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 671 tattgattgtgaatcattccaa-tagggattc 641

---

>gb|AY047107.1| Gesneria reticulata chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047106.1| Gesneria cuneifolia chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047104.1| Gesneria acaulis chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY047102.1| Reldia minutiflora chloroplast tRNA-Leu (trnL) gene, partial
           sequence; and trnL-trnF intergenic spacer, complete
           sequence
          Length = 854

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 703 tattgattgtgaatcattccaa-tagggattc 673

---

>gb|AY047101.1| Gasteranthus quitensis chloroplast tRNA-Leu (trnL) gene and
           trnL-trnF intergenic spacer, partial sequence
          Length = 866

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on chromosome 9 Contains the
             5' end of a novel gene (CGI-67), a novel gene, a novel
             gene (LOC138240) and a CpG island, complete sequence
          Length = 195844

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   ttggtggaaaagtggaaaat 137
             ||||||||||||||||||||
Sbjct: 34242 ttggtggaaaagtggaaaat 34223

---

>gb|AY702431.1| Pheidonocarpa corymbosa tRNA-Leu (trnL) gene and trnL-trnF
           intergenic spacer, complete sequence; chloroplast
          Length = 890

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702

---

>gb|AY702394.1| Bellonia spinosa tRNA-Leu (trnL) gene, partial sequence; and
           trnL-trnF intergenic spacer, complete sequence;
           chloroplast
          Length = 362

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 204 tattgattgtgaatcattccaa-tagggattc 174

---

>gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequence
          Length = 95814

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    aacttgaagacaaagccaaa 76
             ||||||||||||||||||||
Sbjct: 33856 aacttgaagacaaagccaaa 33875

---

>gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete sequence
          Length = 129121

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 107 tggttatgttcttggtggaaaagt 130
           |||||||||| |||||||||||||
Sbjct: 344 tggttatgtttttggtggaaaagt 321

---

>gb|AF482612.1| Columnea sp. Lindqvist and Albert 30 chloroplast tRNA-Leu (trnL)
           gene and trnL-trnF intergenic spacer region, partial
           sequence
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 702 tattgattgtgaatcattccaa-tagggattc 672

---

>gb|AC159198.2| Mus musculus BAC clone RP23-388C15 from chromosome 12, complete sequence
          Length = 213311

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 283    gatctcctgttgtaattaga 302
              ||||||||||||||||||||
Sbjct: 196702 gatctcctgttgtaattaga 196721

---

>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome
          Length = 2160842

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 475    ttgatgaagccaatatcgagacac 498
              ||||||||||||||||| ||||||
Sbjct: 768268 ttgatgaagccaatatcaagacac 768245

---

>gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, complete sequence
          Length = 172244

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    attcagatatgtcagatgct 47
             ||||||||||||||||||||
Sbjct: 16387 attcagatatgtcagatgct 16406

---

>dbj|AB023034.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K7J8
          Length = 56963

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 464   tctttatgtaattgatgaag 483
             ||||||||||||||||||||
Sbjct: 16386 tctttatgtaattgatgaag 16405

---

>emb|AJ492319.1|PPR492319 Paliavana prasinata chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 892

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ492318.1|SCA492318 Sinningia cardinalis chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 887

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ492317.1|RTO492317 Rhytidophyllum tomentosum chloroplast tRNA-Leu gene (partial),
           trnL-F intergenic spacer and tRNA-Phe gene (partial)
          Length = 912

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ492314.1|CSA492314 Columnea sanguinea chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 900

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 721 tattgattgtgaatcattccaa-tagggattc 691

---

>emb|AJ492310.1|BME492310 Besleria melancholica chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 881

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 709 tattgattgtgaatcattccaa-tagggattc 679

---

>emb|AJ492308.1|LAU492308 Lenbrassia australiana chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 971

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 758 tattgattgtgaatcattccaa-tagggattc 728

---

>emb|AJ439819.1|VGA439819 Vanhouttea gardneri chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 873

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 721 tattgattgtgaatcattccaa-tagggattc 691

---

>emb|AJ439818.1|VSP439818 Vanhouttea sp. Salimena Pires et al. AC501 chloroplast partial
           tRNA-Leu gene and trnL-trnF intergenic spacer
          Length = 877

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 725 tattgattgtgaatcattccaa-tagggattc 695

---

>emb|AJ439816.1|VLA439816 Vanhouttea lanata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439815.1|VSP439815 Vanhouttea sp. Salimena Pires et al. AC506 chloroplast partial
           tRNA-Leu gene and trnL-trnF intergenic spacer
          Length = 869

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686

---

>emb|AJ439813.1|VSP439813 Vanhouttea sp. Leoni 4197 chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 869

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686

---

>emb|AJ439805.1|SLA439805 Sinningia lateritia chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439804.1|SPU439804 Sinningia pusilla chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439803.1|SAG439803 Sinningia aghensis chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439802.1|SIN439802 Sinningia incarnata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 836

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 683 tattgattgtgaatcattccaa-tagggattc 653

---

>emb|AJ439801.1|SAL439801 Sinningia allagophylla chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 880

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697

---

>emb|AJ439800.1|SCU439800 Sinningia curtiflora chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 880

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697

---

>emb|AJ439799.1|SCO439799 Sinningia cochlearis chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439798.1|SVI439798 Sinningia villosa chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>emb|AJ439797.1|SRI439797 Sinningia richii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 866

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 713 tattgattgtgaatcattccaa-tagggattc 683

---

>emb|AJ439796.1|SGU439796 Sinningia guttata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439795.1|SVA439795 Sinningia valsuganensis chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 883

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 730 tattgattgtgaatcattccaa-tagggattc 700

---

>emb|AJ439794.1|SMI439794 Sinningia micans chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439793.1|SSC439793 Sinningia sceptrum chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 836

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 683 tattgattgtgaatcattccaa-tagggattc 653

---

>emb|AJ439792.1|SEL439792 Sinningia elatior chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 837

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 684 tattgattgtgaatcattccaa-tagggattc 654

---

>emb|AJ439791.1|SSP439791 Sinningia sp. Romero et al. 1709 chloroplast partial tRNA-Leu gene
           and trnL-trnF intergenic spacer
          Length = 870

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 717 tattgattgtgaatcattccaa-tagggattc 687

---

>emb|AJ439790.1|SIA439790 Sinningia iarae chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439789.1|SRU439789 Sinningia rupicola chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439788.1|SGI439788 Sinningia gigantifolia chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 855

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 703 tattgattgtgaatcattccaa-tagggattc 673

---

>emb|AJ439787.1|SCO439787 Sinningia concinna chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 880

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439786.1|SHA439786 Sinningia harleyi chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 866

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 713 tattgattgtgaatcattccaa-tagggattc 683

---

>emb|AJ439785.1|SCA439785 Sinningia carangolensis chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 885

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 730 tattgattgtgaatcattccaa-tagggattc 700

---

>emb|AJ439784.1|SCO439784 Sinningia conspicua chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 865

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 712 tattgattgtgaatcattccaa-tagggattc 682

---

>emb|AJ439783.1|SMA439783 Sinningia magnifica chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439782.1|STU439782 Sinningia tuberosa chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 873

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439781.1|SNO439781 Sinningia nordestina chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>emb|AJ439780.1|SBA439780 Sinningia barbata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439779.1|SSP439779 Sinningia speciosa chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>emb|AJ439778.1|SHI439778 Sinningia hirsuta chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439777.1|SSE439777 Sinningia sellowii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 880

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697

---

>emb|AJ439776.1|SMA439776 Sinningia mauroana chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439775.1|SCA439775 Sinningia cardinalis chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439774.1|STU439774 Sinningia tubiflora chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439773.1|SKA439773 Sinningia kautskyi chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 873

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439772.1|SCA439772 Sinningia calcaria chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439771.1|SLE439771 Sinningia leopoldii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439770.1|SDO439770 Sinningia douglasii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439769.1|SST439769 Sinningia striata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 866

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439768.1|SSP439768 Sinningia sp. Cervi et al. AC484 chloroplast partial tRNA-Leu gene
           and trnL-trnF intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439767.1|SNI439767 Sinningia nivalis chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439766.1|SIN439766 Sinningia insularis chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439765.1|SWA439765 Sinningia warmingii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 880

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697

---

>emb|AJ439764.1|SCO439764 Sinningia cooperi chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439763.1|SHA439763 Sinningia hatschbachii chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439762.1|SGL439762 Sinningia glazioviana chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439761.1|SDE439761 Sinningia defoliata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 870

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 717 tattgattgtgaatcattccaa-tagggattc 687

---

>emb|AJ439760.1|SLE439760 Sinningia leucotricha chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439759.1|SMA439759 Sinningia macrostachya chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439758.1|SLI439758 Sinningia lineata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439756.1|SBR439756 Sinningia brasiliensis chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439755.1|SRE439755 Sinningia reitzii chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439754.1|SBU439754 Sinningia bulbosa chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439753.1|SEU439753 Sinningia eumorpha chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 865

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 712 tattgattgtgaatcattccaa-tagggattc 682

---

>emb|AJ439752.1|SMA439752 Sinningia macropoda chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439751.1|SCA439751 Sinningia canescens chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439750.1|SPI439750 Sinningia piresiana chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 867

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439749.1|SMA439749 Sinningia macrophylla chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>emb|AJ439748.1|SAR439748 Sinningia araneosa chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 874

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439747.1|SLI439747 Sinningia lindleyi chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439746.1|SSP439746 Sinningia sp. Chautems Perret 99-051 chloroplast partial tRNA-Leu
           gene and trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439745.1|SSC439745 Sinningia schiffneri chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685

---

>emb|AJ439829.1|NME439829 Nautilocalyx melittifolius chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 869

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>emb|AJ439825.1|NVI439825 Nematanthus villosus chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 873

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>emb|AJ439811.1|PCO439811 Paliavana sp. Leoni 1812 chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 869

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686

---

>emb|AJ439808.1|PSE439808 Paliavana sericiflora chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 872

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439807.1|PTE439807 Paliavana tenuiflora chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439806.1|PPR439806 Paliavana  prasinata chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 873

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690

---

>emb|AJ439757.1|SAG439757 Sinningia aggregata chloroplast partial tRNA-Leu gene and trnL-trnF
           intergenic spacer
          Length = 875

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692

---

>emb|AJ439826.1|CSE439826 Codonanthe serrulata chloroplast partial tRNA-Leu gene and
           trnL-trnF intergenic spacer
          Length = 868

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684

---

>dbj|AP006108.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT11O06, TM0194,
             complete sequence
          Length = 108277

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   cactcttgttgttctcctta 192
             ||||||||||||||||||||
Sbjct: 66730 cactcttgttgttctcctta 66749



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   cactcttgttgttctcctta 192
             ||||||||||||||||||||
Sbjct: 55827 cactcttgttgttctcctta 55846

---

>emb|AJ492321.1|NRE492321 Napeanthus reitzii chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 882

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 710 tattgattgtgaatcattccaa-tagggattc 680

---

>emb|AJ492316.1|NVI492316 Nematanthus villosus chloroplast tRNA-Leu gene (partial), trnL-F
           intergenic spacer and tRNA-Phe gene (partial)
          Length = 892

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689

---

>gb|AC152164.14| Mus musculus chromosome 8, clone RP24-118N20, complete sequence
          Length = 185586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 275   tgtcaatggatctcctgttg 294
             ||||||||||||||||||||
Sbjct: 73009 tgtcaatggatctcctgttg 72990

---

>emb|AJ296522.1|VAR296522 Verbascum arcturus chloroplast tRNA-Leu (UAA) gene
          Length = 948

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                           
Query: 212 tattgattgtgaatcatgccaagtagggattc 243
           ||||||||||||||||| |||| |||||||||
Sbjct: 751 tattgattgtgaatcat-ccaaatagggattc 721


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,540,498
Number of Sequences: 3902068
Number of extensions: 5540498
Number of successful extensions: 109276
Number of sequences better than 10.0: 180
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 136
Number of HSP's that attempted gapping in prelim test: 109149
Number of HSP's gapped (non-prelim): 263
length of query: 575
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 552
effective length of database: 17,143,297,704
effective search space: 9463100332608
effective search space used: 9463100332608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---