ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart35f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (c... 910 0.0
2emb|X66012.1|TACATHBA T.aestivum mRNA 1 for cathepsin B (2529) 632 e-178
3emb|X66015.1|TACATHBC T.aestivum mRNA 3 for cathepsin B (2557) 462 e-127
4emb|X66014.1|TACATHBB T.aestivum mRNA 2 for cathepsin B (2077) 196 6e-47
5gb|BT016464.1| Zea mays clone Contig297 mRNA sequence 180 4e-42
6dbj|AK101093.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
7dbj|AK100225.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
8dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
9dbj|AK064820.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
10dbj|AK059697.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
11gb|AY916493.1| Oryza sativa (japonica cultivar-group) cathepsin ... 178 1e-41
12emb|X66013.1|TACATHBG T.aestivum gene for cathepsin B (Al16) 90 1e-14
13gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome... 86 2e-13
14dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 86 2e-13
15gb|AY112465.1| Zea mays CL31697_1 mRNA sequence 80 1e-11
16gb|AY450641.1| Solanum tuberosum cathepsin B-like cysteine prote... 72 2e-09
17gb|AY450638.1| Solanum tuberosum clone plbr2 cathepsin B-like cy... 72 2e-09
18gb|BT014624.1| Lycopersicon esculentum clone 134127R, mRNA sequence 64 6e-07
19gb|DQ492287.1| Nicotiana benthamiana cathepsin B (CathB) mRNA, c... 62 2e-06
20emb|X81995.1|NRCATHB N.rustica mRNA for cathepsin B-like cystein... 62 2e-06
21ref|XM_961657.1| PREDICTED: Tribolium castaneum similar to CG109... 50 0.009
22ref|XM_849967.1| PREDICTED: Canis familiaris similar to Cathepsi... 48 0.034
23emb|X66116.1|TAPCATHB T.aestivum promoter sequence of cathepsin ... 48 0.034
24gb|AF283476.1|AF283476 Ipomoea batatas cathepsin B-like cysteine... 48 0.034
25gb|AF101239.1|AF101239 Ipomoea batatas cathepsin B-like cysteine... 48 0.034
26ref|XM_969178.1| PREDICTED: Tribolium castaneum similar to cathe... 46 0.13
27gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 44 0.52
28emb|BX032301.1|CNS08X35 Single read from an extremity of a full-... 44 0.52
29gb|AF239268.1|AF239268 Fasciola gigantica cathepsin L (cat-L1F) ... 44 0.52
30dbj|D16823.1|SPESPCB S.peregrina mRNA for cathepsin B, complete cds 44 0.52
31gb|AY363262.1| Triatoma infestans cathepsin B-like proteinase (C... 42 2.1
32gb|AY553272.1| Triatoma vitticeps cathepsin B-like proteinase (C... 42 2.1
33gb|AY553271.1| Triatoma sordida cathepsin B-like proteinase (Cat... 42 2.1
34ref|XM_513780.1| PREDICTED: Pan troglodytes LOC457278 (LOC457278... 40 8.2
35gb|BC016058.1| Homo sapiens cathepsin K (pycnodysostosis), mRNA ... 40 8.2
36ref|NM_000396.2| Homo sapiens cathepsin K (pycnodysostosis) (CTS... 40 8.2
37ref|NM_001032812.1| Macaca mulatta cathepsin K (CTSK), mRNA 40 8.2
38emb|AL359455.22| Human DNA sequence from clone RP11-444K11 on ch... 40 8.2
39emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B... 40 8.2
40emb|AL035446.4|HS460G2 Human DNA sequence from clone RP3-460G2 o... 40 8.2
41emb|X82153.1|HSOC2RNA H.sapiens mRNA for cathepsin O 40 8.2
42emb|CR541719.1| Homo sapiens full open reading frame cDNA clone ... 40 8.2
43emb|CR541675.1| Homo sapiens full open reading frame cDNA clone ... 40 8.2
44emb|AJ583509.1| Diabrotica virgifera virgifera mRNA for cathepsi... 40 8.2
45gb|AC009320.7| Homo sapiens 12 BAC RP11-310I24 (Roswell Park Can... 40 8.2
46emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 i... 40 8.2
47gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytans... 40 8.2
48emb|CR626559.1| full-length cDNA clone CS0DI024YJ12 of Placenta ... 40 8.2
49emb|CR626142.1| full-length cDNA clone CS0DN002YD24 of Adult bra... 40 8.2
50emb|CR624019.1| full-length cDNA clone CS0DN002YH21 of Adult bra... 40 8.2
51emb|CR614321.1| full-length cDNA clone CS0DI069YM12 of Placenta ... 40 8.2
52emb|CR612623.1| full-length cDNA clone CS0DI018YG15 of Placenta ... 40 8.2
53emb|CR612492.1| full-length cDNA clone CS0DI033YH19 of Placenta ... 40 8.2
54emb|CR606929.1| full-length cDNA clone CS0DN002YF20 of Adult bra... 40 8.2
55emb|CR601270.1| full-length cDNA clone CS0DE008YM10 of Placenta ... 40 8.2
56emb|CR598542.1| full-length cDNA clone CS0DN002YO18 of Adult bra... 40 8.2
57emb|CR594213.1| full-length cDNA clone CS0DI009YN05 of Placenta ... 40 8.2
58gb|AF359422.1| Nicotiana tabacum cathepsin B-like cysteine prote... 40 8.2
59gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 40 8.2
60gb|S79895.1| OC2=cathepsin O2 [human, spleen, mRNA, 1482 nt] 40 8.2
61dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
62gb|AC092156.2| Homo sapiens BAC clone RP11-326J14 from 2, comple... 40 8.2
63gb|AC068195.6| Homo sapiens BAC clone RP11-114B24 from 2, comple... 40 8.2
64dbj|AP005719.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
65gb|AY892942.1| Synthetic construct Homo sapiens clone FLH135296.... 40 8.2
66gb|AY892941.1| Synthetic construct Homo sapiens clone FLH135294.... 40 8.2
67dbj|BS000063.1| Pan troglodytes chromosome 22 clone:PTB-428P03, ... 40 8.2
68gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clon... 40 8.2
69emb|AJ303304.1|HEC303304 Hepatitis C virus type 1b partial mRNA ... 40 8.2
70ref|XM_560519.1| Anopheles gambiae str. PEST ENSANGP00000028370 ... 40 8.2
71dbj|AK130134.1| Homo sapiens cDNA FLJ26624 fis, clone MPC03724, ... 40 8.2
72gb|AY893612.1| Synthetic construct Homo sapiens clone FLH131032.... 40 8.2
73dbj|AP005160.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
74gb|AF124092.1|AF124092 Macaca mulatta cathepsin K mRNA, complete... 40 8.2
75dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.2
76dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 8.2
77dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 8.2
78gb|DQ294220.1| Glossina morsitans morsitans TC1837 cathepsin F l... 40 8.2
79gb|AF070927.1|AF070927 Macaca fascicularis cathepsin K mRNA, com... 40 8.2
80gb|U20280.1|HSU20280 Human cathepsin X mRNA, complete cds 40 8.2
81emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chr... 40 8.2
82gb|U13665.1|HSU13665 Human cathepsin O (CTSO) mRNA, complete cds 40 8.2
83emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chro... 40 8.2
84dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 8.2
85dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 40 8.2
86dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 40 8.2
87dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC c... 40 8.2

>emb|AJ310426.1|HVU310426 Hordeum vulgare mRNA for cathepsin B (cathB gene)
          Length = 1277

 Score =  910 bits (459), Expect = 0.0
 Identities = 459/459 (100%)
 Strand = Plus / Plus

                                                                       
Query: 144 ccccagctcgccggagcggcagggggaggccattccctaggaatcatccagaaaggcatc 203
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 131 ccccagctcgccggagcggcagggggaggccattccctaggaatcatccagaaaggcatc 190

                                                                       
Query: 204 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 263
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 atacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctc 250

                                                                       
Query: 264 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 323
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggt 310

                                                                       
Query: 324 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 383
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 311 ttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttc 370

                                                                       
Query: 384 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 443
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 gacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcac 430

                                                                       
Query: 444 tgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 503
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 431 tgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatccat 490

                                                                       
Query: 504 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 563
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 491 cacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgt 550

                                                  
Query: 564 ggtgatggttgtgatggaggatatcctatcagcgcatgg 602
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 551 ggtgatggttgtgatggaggatatcctatcagcgcatgg 589



 Score =  204 bits (103), Expect = 2e-49
 Identities = 106/107 (99%)
 Strand = Plus / Plus

                                                                       
Query: 20  agcagctacctcctccgcttgcttcctcctcccacccaccgtgcgtcgccgatcgaggac 79
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 7   agcagctacctcctccgcttgcttcctcctccctcccaccgtgcgtcgccgatcgaggac 66

                                                          
Query: 80  gaagatggggagcggcctgctcccgctggcgctgctcgtcgtcctct 126
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67  gaagatggggagcggcctgctcccgctggcgctgctcgtcgtcctct 113



to top

>emb|X66012.1|TACATHBA T.aestivum mRNA 1 for cathepsin B (2529)
          Length = 1065

 Score =  632 bits (319), Expect = e-178
 Identities = 376/395 (95%)
 Strand = Plus / Plus

                                                                       
Query: 201 atcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctac 260
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1   atcatacaaacggtcaacaaccaccccaacgccggatggacggctggacacaacccctac 60

                                                                       
Query: 261 ctcgccaattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctcca 320
           ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 61  ctcgcgaattacactattgagcaatttaagcatatgctgggagtgaagccaacgcctcca 120

                                                                       
Query: 321 ggtttactggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggag 380
           ||||||| ||||| |||||| |||||||||||| |||| || |||||||||||||||| |
Sbjct: 121 ggtttacgggctgctgttcgcaccaaaactcattcaagatcggagcagctcccaaaggtg 180

                                                                       
Query: 381 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 440
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ttcgacgccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggt 240

                                                                       
Query: 441 cactgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgcatc 500
           ||||| |||||||| ||||||||||| || |||||||| |||||||||||||||||||||
Sbjct: 241 cactgtggttcctgctgggcttttggtgccgtggagtgcctgcaagatcgtttctgcatc 300

                                                                       
Query: 501 catcacaacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatg 560
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 catcacaacatgaacattacactttctgccaatgacctagtggcttgctgtgggtttatg 360

                                              
Query: 561 tgtggtgatggttgtgatggaggatatcctatcag 595
           ||||| |||||||||||||||||||||||||||||
Sbjct: 361 tgtggcgatggttgtgatggaggatatcctatcag 395



to top

>emb|X66015.1|TACATHBC T.aestivum mRNA 3 for cathepsin B (2557)
          Length = 491

 Score =  462 bits (233), Expect = e-127
 Identities = 305/329 (92%)
 Strand = Plus / Plus

                                                                       
Query: 147 cagctcgccggagcggcagggggaggccattccctaggaatcatccagaaaggcatcata 206
           ||||||| ||| || ||| || ||| ||||||||||||||||||||||||||  ||||||
Sbjct: 163 cagctcgtcggtgcagcaaggagagaccattccctaggaatcatccagaaagatatcata 222

                                                                       
Query: 207 cagacggtcaacaaccatcccaacgccggatggacggctggacacaacccctacctcgcc 266
           || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 223 caaacggtcaacaaccaccccaacgccggatggacggctggacacaacccctacctcgcg 282

                                                                       
Query: 267 aattacactattgagcaatttaagcatatgctgggagtgaaaccaacacctccaggttta 326
           ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 283 aattacactattgagcaatttaagcatatgctgggagtgaagccaacgcctccaggttta 342

                                                                       
Query: 327 ctggctggtgttcgaaccaaaactcatccaaggtcagagcagctcccaaaggagttcgac 386
           | ||||| |||||| |||||||||||| |||| || |||||||||||||||| |||||||
Sbjct: 343 cgggctgctgttcgcaccaaaactcattcaagatcggagcagctcccaaaggtgttcgac 402

                                                                       
Query: 387 gccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgc 446
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 403 gccaggtcgaaatggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgt 462

                                        
Query: 447 ggttcctgttgggcttttggagctgtgga 475
           |||||||| ||||||||||| || |||||
Sbjct: 463 ggttcctgctgggcttttggtgccgtgga 491



to top

>emb|X66014.1|TACATHBB T.aestivum mRNA 2 for cathepsin B (2077)
          Length = 1216

 Score =  196 bits (99), Expect = 6e-47
 Identities = 162/183 (88%)
 Strand = Plus / Plus

                                                                       
Query: 174 cattccctaggaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgcc 233
           ||||||||||||||||||||||| | |||||| |||||||||||||| |||||||| |||
Sbjct: 152 cattccctaggaatcatccagaaggacatcattcagacggtcaacaagcatcccaatgcc 211

                                                                       
Query: 234 ggatggacggctggacacaacccctacctcgccaattacactattgagcaatttaagcat 293
           || |||||||||||||||||||||||| | || || ||||||||||||||||| ||||||
Sbjct: 212 gggtggacggctggacacaacccctactttgcaaactacactattgagcaattcaagcat 271

                                                                       
Query: 294 atgctgggagtgaaaccaacacctccaggtttactggctggtgttcgaaccaaaactcat 353
           || ||||||||||| ||||| ||||| ||||| || ||||||||||  | ||||| ||||
Sbjct: 272 atcctgggagtgaagccaacgcctccgggtttgctcgctggtgttccgatcaaaattcat 331

              
Query: 354 cca 356
           |||
Sbjct: 332 cca 334



 Score =  178 bits (90), Expect = 1e-41
 Identities = 177/206 (85%)
 Strand = Plus / Plus

                                                                       
Query: 397 aatggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgcggttcctgtt 456
           |||||||| ||||||||||||||||||| |||||||||||||||||||| ||| ||||||
Sbjct: 372 aatggtccagttgcagcacaattgggaacatacttgatcaaggtcactgtggtgcctgtt 431

                                                                       
Query: 457 gggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaaca 516
           |||| ||||  || |||||   ||| || ||||||||||| || |||| |||||||| | 
Sbjct: 432 gggcctttgctgccgtggaagctctccaggatcgtttctgtattcatctcaacatgagcg 491

                                                                       
Query: 517 tttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtg 576
           | || ||||| | |||||||||| ||||||||||||| ||| ||||||||   |||||| 
Sbjct: 492 tctccctttcggtcaatgacctactggcttgctgtggttttctgtgtggtagcggttgta 551

                                     
Query: 577 atggaggatatcctatcagcgcatgg 602
           ||||||||||||||||||||||||||
Sbjct: 552 atggaggatatcctatcagcgcatgg 577



to top

>gb|BT016464.1| Zea mays clone Contig297 mRNA sequence
          Length = 1136

 Score =  180 bits (91), Expect = 4e-42
 Identities = 169/195 (86%)
 Strand = Plus / Plus

                                                                       
Query: 398 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactgcggttcctgttg 457
           ||||||| ||||||||||||||||||| |||||||||||||||||||| || || |||||
Sbjct: 164 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactgtggctcttgttg 223

                                                                       
Query: 458 ggcttttggagctgtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacat 517
           ||||||||| ||||||||||| || || || ||||| ||||| || | |||||||| |||
Sbjct: 224 ggcttttggtgctgtggagtgcctccaggaccgtttttgcattcacctcaacatgagcat 283

                                                                       
Query: 518 ttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtga 577
           || |||||| | |||||||||| |||| ||||| || |||||||| || ||||| |||||
Sbjct: 284 tttactttcagtcaatgacctactggcatgctgcggttttatgtgcggcgatgggtgtga 343

                          
Query: 578 tggaggatatcctat 592
           |||||| ||||||||
Sbjct: 344 tggaggctatcctat 358



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 281 gcaatttaagcatatgctgggagtgaaaccaacacc 316
           |||||||||||| || || |||||||||||| ||||
Sbjct: 47  gcaatttaagcacatacttggagtgaaaccagcacc 82



to top

>dbj|AK101093.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024N03, full
           insert sequence
          Length = 1437

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 540 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 599

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 600 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 659

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 660 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 719

             
Query: 593 ca 594
           ||
Sbjct: 720 ca 721



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 243
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 311 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 370

                                                                       
Query: 244 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 303
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 371 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 430

                        
Query: 304 tgaaaccaacacc 316
           |||| ||||||||
Sbjct: 431 tgaagccaacacc 443



to top

>dbj|AK100225.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047M19, full
           insert sequence
          Length = 1436

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 538 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 597

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 598 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 657

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 658 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 717

             
Query: 593 ca 594
           ||
Sbjct: 718 ca 719



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 243
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 309 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 368

                                                                       
Query: 244 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 303
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 369 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 428

                        
Query: 304 tgaaaccaacacc 316
           |||| ||||||||
Sbjct: 429 tgaagccaacacc 441



to top

>dbj|AK068459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013151C17, full
           insert sequence
          Length = 3464

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 669 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 728

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 729 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 788

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 789 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 848

             
Query: 593 ca 594
           ||
Sbjct: 849 ca 850



to top

>dbj|AK064820.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E23, full
           insert sequence
          Length = 1369

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 471 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 530

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 531 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 590

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 591 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 650

             
Query: 593 ca 594
           ||
Sbjct: 651 ca 652



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 243
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 242 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 301

                                                                       
Query: 244 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 303
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 302 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 361

                        
Query: 304 tgaaaccaacacc 316
           |||| ||||||||
Sbjct: 362 tgaagccaacacc 374



to top

>dbj|AK059697.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-C04, full
           insert sequence
          Length = 1565

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 470 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 529

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 530 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 589

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 590 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 649

             
Query: 593 ca 594
           ||
Sbjct: 650 ca 651



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 243
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 241 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 300

                                                                       
Query: 244 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 303
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 301 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 360

                        
Query: 304 tgaaaccaacacc 316
           |||| ||||||||
Sbjct: 361 tgaagccaacacc 373



to top

>gb|AY916493.1| Oryza sativa (japonica cultivar-group) cathepsin B-like cysteine
           protease mRNA, complete cds
          Length = 1475

 Score =  178 bits (90), Expect = 1e-41
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 413 cacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagctgt 472
           |||||||||||  ||||||||||| |||||||| || || |||||||| ||||| |||||
Sbjct: 492 cacaattgggaccatacttgatcagggtcactgtggctcgtgttgggcatttggtgctgt 551

                                                                       
Query: 473 ggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgccaa 532
           ||||||||| || |||||||||||||| |||  ||||||||||||||| || |||| |||
Sbjct: 552 ggagtgtctccaggatcgtttctgcattcatttcaacatgaacatttcgctatctgtcaa 611

                                                                       
Query: 533 tgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcctat 592
           |||||||||||| ||||| || || ||||| || ||||||||||||||||| ||||||||
Sbjct: 612 tgacctagtggcatgctgcggtttcatgtgcggcgatggttgtgatggaggctatcctat 671

             
Query: 593 ca 594
           ||
Sbjct: 672 ca 673



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 105/133 (78%)
 Strand = Plus / Plus

                                                                       
Query: 184 gaatcatccagaaaggcatcatacagacggtcaacaaccatcccaacgccggatggacgg 243
           ||||||||||| | | ||||||| || |  ||||||| |||||||| || || |||||||
Sbjct: 263 gaatcatccaggacgacatcataaaggcaatcaacaagcatcccaatgctggctggacgg 322

                                                                       
Query: 244 ctggacacaacccctacctcgccaattacactattgagcaatttaagcatatgctgggag 303
           ||| ||  || || ||| | || || || |||| || |||||| || ||||| || ||||
Sbjct: 323 ctgcacggaatccatactttgcaaactatactactgcgcaattcaaacatatccttggag 382

                        
Query: 304 tgaaaccaacacc 316
           |||| ||||||||
Sbjct: 383 tgaagccaacacc 395



to top

>emb|X66013.1|TACATHBG T.aestivum gene for cathepsin B (Al16)
          Length = 4792

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 66/73 (90%)
 Strand = Plus / Plus

                                                                        
Query: 530  caatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 589
            |||||||||| ||||||||||||| ||| ||||||||   |||||| |||||||||||||
Sbjct: 2484 caatgacctactggcttgctgtggttttctgtgtggtagcggttgtaatggaggatatcc 2543

                         
Query: 590  tatcagcgcatgg 602
            |||||||||||||
Sbjct: 2544 tatcagcgcatgg 2556



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                        
Query: 200  catcatacagacggtcaacaaccatcccaacgccggatggacggctggacacaaccccta 259
            |||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 1709 catcattcagacggtcaacaagcatcccaatgccgggtggacggctggacacaaccccta 1768

             
Query: 260  c 260
            |
Sbjct: 1769 c 1769



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                        
Query: 276  attgagcaatttaagcatatgctgggagtgaaaccaacacctccaggtttactggctggt 335
            ||||||||||| |||||||| ||||||||||| ||||| ||||| ||||| || ||||||
Sbjct: 1885 attgagcaattcaagcatatcctgggagtgaagccaacgcctccgggtttgctcgctggt 1944

                                 
Query: 336  gttcgaaccaaaactcatcca 356
            ||||  | ||||| |||||||
Sbjct: 1945 gttccgatcaaaattcatcca 1965



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 397  aatggtccggttgcagcacaattgggaaaatacttg 432
            |||||||| ||||||||||||||||||| |||||||
Sbjct: 2003 aatggtccagttgcagcacaattgggaacatacttg 2038



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 174  cattccctaggaatcatccag 194
            |||||||||||||||||||||
Sbjct: 1592 cattccctaggaatcatccag 1612



to top

>gb|AC132490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0570A02,
              complete sequence
          Length = 146541

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                          
Query: 512    gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 571
              ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || |||||
Sbjct: 110408 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 110467

                                     
Query: 572    ttgtgatggaggatatcctatca 594
              |||||||||||| ||||||||||
Sbjct: 110468 ttgtgatggaggctatcctatca 110490



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                          
Query: 438    ggtcactgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 497
              |||||||| || || |||||||| ||||| |||||||||||||| || ||||||||||||
Sbjct: 110229 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 110288

                             
Query: 498    atccatcacaacatg 512
              || |||  |||||||
Sbjct: 110289 attcatttcaacatg 110303



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                            
Query: 512      gaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatgg 571
                ||||||||| || |||| ||||||||||||||| ||||| || || ||||| || |||||
Sbjct: 14030331 gaacatttcgctatctgtcaatgacctagtggcatgctgcggtttcatgtgcggcgatgg 14030390

                                       
Query: 572      ttgtgatggaggatatcctatca 594
                |||||||||||| ||||||||||
Sbjct: 14030391 ttgtgatggaggctatcctatca 14030413



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 65/75 (86%)
 Strand = Plus / Plus

                                                                            
Query: 438      ggtcactgcggttcctgttgggcttttggagctgtggagtgtctgcaagatcgtttctgc 497
                |||||||| || || |||||||| ||||| |||||||||||||| || ||||||||||||
Sbjct: 14030152 ggtcactgtggctcgtgttgggcatttggtgctgtggagtgtctccaggatcgtttctgc 14030211

                               
Query: 498      atccatcacaacatg 512
                || |||  |||||||
Sbjct: 14030212 attcatttcaacatg 14030226



to top

>gb|AY112465.1| Zea mays CL31697_1 mRNA sequence
          Length = 1472

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                           
Query: 398 atggtccggttgcagcacaattgggaaaatacttgatcaaggtcactg 445
           ||||||| ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 925 atggtcccgttgcagcacaattgggaacatacttgatcaaggtcactg 878



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 506 caacatgaacatttcactttctgccaatgacctagtggcttgctgtgggtttatgtgtgg 565
           |||||||| ||||| |||||| | |||||||||| |||| ||||| || |||||||| ||
Sbjct: 817 caacatgagcattttactttcagtcaatgacctactggcatgctgcggttttatgtgcgg 758

                                      
Query: 566 tgatggttgtgatggaggatatcctat 592
            ||||| ||||||||||| ||||||||
Sbjct: 757 cgatgggtgtgatggaggctatcctat 731



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 184  gaatcatccagaaaggcatcatacagacggtcaacaaccatccca 228
            ||||||||||| | | ||||||  |||| ||||||||||||||||
Sbjct: 1139 gaatcatccaggaggacatcatcgagacagtcaacaaccatccca 1095



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 276  attgagcaatttaagcatatgctgggagtgaaaccaacacc 316
            |||| |||||||||||| || || |||||||||||| ||||
Sbjct: 1047 attgcgcaatttaagcacatacttggagtgaaaccagcacc 1007



to top

>gb|AY450641.1| Solanum tuberosum cathepsin B-like cysteine proteinase mRNA,
           complete cds
          Length = 1262

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 408 tgcagcacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttgga 467
           |||||||||||||| ||||| || ||||| || || |||||||| |||||||||||||| 
Sbjct: 337 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 396

                                               
Query: 468 gctgtggagtgtctgcaagatcgtttctgcatccat 503
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 397 gctgttgagtcgctgtctgatcgtttctgtatccat 432



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 569 tggttgtgatggaggatatcctat 592
           |||||||||||| |||||||||||
Sbjct: 498 tggttgtgatggtggatatcctat 521



to top

>gb|AY450638.1| Solanum tuberosum clone plbr2 cathepsin B-like cysteine proteinase
           mRNA, partial cds
          Length = 655

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 408 tgcagcacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttgga 467
           |||||||||||||| ||||| || ||||| || || |||||||| |||||||||||||| 
Sbjct: 332 tgcagcacaattggaaaaattctggatcagggacattgcggttcttgttgggcttttggt 391

                                               
Query: 468 gctgtggagtgtctgcaagatcgtttctgcatccat 503
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 392 gctgttgagtcgctgtctgatcgtttctgtatccat 427



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 569 tggttgtgatggaggatatcctat 592
           |||||||||||| |||||||||||
Sbjct: 493 tggttgtgatggtggatatcctat 516



to top

>gb|BT014624.1| Lycopersicon esculentum clone 134127R, mRNA sequence
          Length = 1263

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 408 tgcagcacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttgga 467
           |||||||||||||| | ||| || ||||| || || |||||||| |||||||||||||| 
Sbjct: 376 tgcagcacaattggaagaattctagatcagggacattgcggttcttgttgggcttttggt 435

                                               
Query: 468 gctgtggagtgtctgcaagatcgtttctgcatccat 503
           ||||| ||||  |||   ||||||||||| ||||||
Sbjct: 436 gctgttgagtcgctgtctgatcgtttctgtatccat 471



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 569 tggttgtgatggaggatatcctat 592
           |||||||||||| |||||||||||
Sbjct: 537 tggttgtgatggtggatatcctat 560



to top

>gb|DQ492287.1| Nicotiana benthamiana cathepsin B (CathB) mRNA, complete cds
          Length = 1353

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 142/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 411 agcacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagct 470
           ||||| ||||||| ||| |||||||| || ||||| ||||| |||||||||||||| |||
Sbjct: 343 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 402

                                                                       
Query: 471 gtggagtgtctgcaagatcgtttctgcatccatcacaacatgaacatttcactttctgcc 530
           || ||||  |||   ||||||||||| || ||| |   | |||| || || || || || 
Sbjct: 403 gttgagtcactgtctgatcgtttctgtattcattatggcttgaatatctctctgtcagca 462

                                                                      
Query: 531 aatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 589
           ||||| ||  | || |||||||| ||| | ||||| |||||||||||||| ||||||||
Sbjct: 463 aatgatctcttagcatgctgtggctttttatgtggagatggttgtgatggtggatatcc 521



to top

>emb|X81995.1|NRCATHB N.rustica mRNA for cathepsin B-like cysteine proteinase
          Length = 1331

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 411 agcacaattgggaaaatacttgatcaaggtcactgcggttcctgttgggcttttggagct 470
           ||||| ||||||| ||| |||||||| || ||||| ||||| |||||||||||||| |||
Sbjct: 355 agcactattgggagaattcttgatcagggacactgtggttcttgttgggcttttggtgct 414

                  
Query: 471 gtggagt 477
           || ||||
Sbjct: 415 gttgagt 421



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 546 tgctgtgggtttatgtgtggtgatggttgtgatggaggatatcc 589
           |||||||| ||| | ||||| |||||||||||||| ||||||||
Sbjct: 490 tgctgtggctttttatgtggggatggttgtgatggtggatatcc 533



to top

>ref|XM_961657.1| PREDICTED: Tribolium castaneum similar to CG10992-PA (LOC655148),
           mRNA
          Length = 1072

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 442 actgcggttcctgttgggcttttgg 466
           |||||||||||||||||||||||||
Sbjct: 324 actgcggttcctgttgggcttttgg 348



to top

>ref|XM_849967.1| PREDICTED: Canis familiaris similar to Cathepsin L2 precursor
           (Cathepsin V) (Cathepsin U) (LOC612231), mRNA
          Length = 870

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           ||||||||||||| ||||| ||||||||||||
Sbjct: 380 atcaaggtcactgtggttcttgttgggctttt 411



to top

>emb|X66116.1|TAPCATHB T.aestivum promoter sequence of cathepsin B-like gene
          Length = 483

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 63  cgtcgccgatcgaggacgaagatg 86
           ||||||||||||||||||||||||
Sbjct: 460 cgtcgccgatcgaggacgaagatg 483



to top

>gb|AF283476.1|AF283476 Ipomoea batatas cathepsin B-like cysteine proteinase gene, complete
            cds
          Length = 3334

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 525  tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 584
            |||| |||||||||  | || |||||||| ||| |||| ||||| ||||||||||| || 
Sbjct: 1926 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 1985

                    
Query: 585  tatcctat 592
            ||||||||
Sbjct: 1986 tatcctat 1993



to top

>gb|AF101239.1|AF101239 Ipomoea batatas cathepsin B-like cysteine proteinase (CathB) mRNA,
           complete cds
          Length = 1248

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 525 tctgccaatgacctagtggcttgctgtgggtttatgtgtggtgatggttgtgatggagga 584
           |||| |||||||||  | || |||||||| ||| |||| ||||| ||||||||||| || 
Sbjct: 470 tctgtcaatgacctcttagcgtgctgtggctttttgtgcggtgaaggttgtgatggtggt 529

                   
Query: 585 tatcctat 592
           ||||||||
Sbjct: 530 tatcctat 537



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 429 cttgatcaaggtcactgcggttcctgttgggcttttgg 466
           |||||||| || ||||||||||| || |||||||||||
Sbjct: 374 cttgatcagggacactgcggttcttgctgggcttttgg 411



to top

>ref|XM_969178.1| PREDICTED: Tribolium castaneum similar to cathepsin B preproprotein
           (LOC663117), mRNA
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 453 tgttgggcttttggagctgtgga 475
           |||||||||||||||||||||||
Sbjct: 337 tgttgggcttttggagctgtgga 359



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 105     ctggcgctgctcgtcgtcctct 126
               ||||||||||||||||||||||
Sbjct: 3262884 ctggcgctgctcgtcgtcctct 3262905



to top

>emb|BX032301.1|CNS08X35 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 274

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 30  tcctccgcttgcttcctcctcc 51
           ||||||||||||||||||||||
Sbjct: 153 tcctccgcttgcttcctcctcc 174



to top

>gb|AF239268.1|AF239268 Fasciola gigantica cathepsin L (cat-L1F) mRNA, partial cds
          Length = 660

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 442 actgcggttcctgttgggcttt 463
           ||||||||||||||||||||||
Sbjct: 62  actgcggttcctgttgggcttt 83



to top

>dbj|D16823.1|SPESPCB S.peregrina mRNA for cathepsin B, complete cds
          Length = 1280

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 447 ggttcctgttgggcttttggagctgt 472
           ||||| ||||||||||||||||||||
Sbjct: 439 ggttcatgttgggcttttggagctgt 464



to top

>gb|AY363262.1| Triatoma infestans cathepsin B-like proteinase (CatB1) mRNA,
           complete cds
          Length = 1142

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 444 tgcggttcctgttgggcttttggagctgt 472
           |||||||| |||||||| |||||||||||
Sbjct: 351 tgcggttcttgttgggcatttggagctgt 379



to top

>gb|AY553272.1| Triatoma vitticeps cathepsin B-like proteinase (CatB1) mRNA,
           complete cds
          Length = 1132

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 444 tgcggttcctgttgggcttttggagctgt 472
           |||||||| |||||||| |||||||||||
Sbjct: 334 tgcggttcttgttgggcatttggagctgt 362



to top

>gb|AY553271.1| Triatoma sordida cathepsin B-like proteinase (CatB1) mRNA, complete
           cds
          Length = 1129

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 444 tgcggttcctgttgggcttttggagctgt 472
           |||||||| |||||||| |||||||||||
Sbjct: 349 tgcggttcttgttgggcatttggagctgt 377



to top

>ref|XM_513780.1| PREDICTED: Pan troglodytes LOC457278 (LOC457278), mRNA
          Length = 914

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 493 atcagggtcagtgtggttcctgttgggctttt 524



to top

>gb|BC016058.1| Homo sapiens cathepsin K (pycnodysostosis), mRNA (cDNA clone
           MGC:23107 IMAGE:4860926), complete cds
          Length = 1699

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 506 atcagggtcagtgtggttcctgttgggctttt 537



to top

>ref|NM_000396.2| Homo sapiens cathepsin K (pycnodysostosis) (CTSK), mRNA
          Length = 1702

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 519 atcagggtcagtgtggttcctgttgggctttt 550



to top

>ref|NM_001032812.1| Macaca mulatta cathepsin K (CTSK), mRNA
          Length = 1029

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442



to top

>emb|AL359455.22| Human DNA sequence from clone RP11-444K11 on chromosome 9 Contains part
             of the RGS3 gene for the regulator of G-protein signalling
             3 (C2PA, RGP3, FLJ20370, PDZ-RGS3), complete sequence
          Length = 85763

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    cttgcttcctcctcccaccc 56
             ||||||||||||||||||||
Sbjct: 49566 cttgcttcctcctcccaccc 49547



to top

>emb|AL109919.18|HSDJ258B3 Human DNA sequence from clone RP1-258B3 on chromosome 6q16.1-16.3
             Contains part of the GRIK2 gene for glutamate receptor
             ionotropic kainate 2, complete sequence
          Length = 147603

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 560   gtgtggtgatggttgtgatg 579
             ||||||||||||||||||||
Sbjct: 51980 gtgtggtgatggttgtgatg 51961



to top

>emb|AL035446.4|HS460G2 Human DNA sequence from clone RP3-460G2 on chromosome 6q24.1-24.3
             Contains a novel gene and part of a 40s ribosomal protein
             S3a (v-fos transformation effector protein 1)
             (RPS3A)(FTE1) pseudogene, complete sequence
          Length = 102552

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    gaagatggggagcggcctgc 99
             ||||||||||||||||||||
Sbjct: 86183 gaagatggggagcggcctgc 86202



to top

>emb|X82153.1|HSOC2RNA H.sapiens mRNA for cathepsin O
          Length = 1669

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 524 atcagggtcagtgtggttcctgttgggctttt 555



to top

>emb|CR541719.1| Homo sapiens full open reading frame cDNA clone RZPDo834E1237D for
           gene CTSK, cathepsin K (pycnodysostosis); complete cds,
           without stopcodon
          Length = 987

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>emb|CR541675.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0328D for
           gene CTSK, cathepsin K (pycnodysostosis); complete cds,
           incl. stopcodon
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>emb|AJ583509.1| Diabrotica virgifera virgifera mRNA for cathepsin B-like
           proteinase, clone DvRS6
          Length = 1230

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 444 tgcggttcctgttgggcttttggagctgtgga 475
           ||||| || ||||||||||||||||| |||||
Sbjct: 348 tgcgggtcatgttgggcttttggagcagtgga 379



to top

>gb|AC009320.7| Homo sapiens 12 BAC RP11-310I24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 57166

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 508   acatgaacatttcactttct 527
             ||||||||||||||||||||
Sbjct: 44278 acatgaacatttcactttct 44259



to top

>emb|BX470140.10| Zebrafish DNA sequence from clone CH211-238E6 in linkage group 4
            Contains the gene for a novel protein similar to
            vertebrate microphthalmia-associated transcription factor
            (MITF), six novel genes and two CpG islands, complete
            sequence
          Length = 148136

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 549  tgtgggtttatgtgtggtgatggt 572
            ||||||||||| ||||||||||||
Sbjct: 6032 tgtgggtttatatgtggtgatggt 6055



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 549  tgtgggtttatgtgtggtgatggt 572
            ||||||||||| ||||||||||||
Sbjct: 1589 tgtgggtttatatgtggtgatggt 1612



to top

>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent
             ansamitocin biosynthetic gene cluster I, partial sequence
          Length = 82746

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   tcccgctggcgctgctcgtc 119
             ||||||||||||||||||||
Sbjct: 43968 tcccgctggcgctgctcgtc 43949



to top

>emb|CR626559.1| full-length cDNA clone CS0DI024YJ12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1658

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 490 atcagggtcagtgtggttcctgttgggctttt 521



to top

>emb|CR626142.1| full-length cDNA clone CS0DN002YD24 of Adult brain of Homo sapiens
           (human)
          Length = 1619

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531



to top

>emb|CR624019.1| full-length cDNA clone CS0DN002YH21 of Adult brain of Homo sapiens
           (human)
          Length = 1563

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 422 atcagggtcagtgtggttcctgttgggctttt 453



to top

>emb|CR614321.1| full-length cDNA clone CS0DI069YM12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1527

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 424 atcagggtcagtgtggttcctgttgggctttt 455



to top

>emb|CR612623.1| full-length cDNA clone CS0DI018YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1583

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR612492.1| full-length cDNA clone CS0DI033YH19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR606929.1| full-length cDNA clone CS0DN002YF20 of Adult brain of Homo sapiens
           (human)
          Length = 1626

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 492 atcagggtcagtgtggttcctgttgggctttt 523



to top

>emb|CR601270.1| full-length cDNA clone CS0DE008YM10 of Placenta of Homo sapiens
           (human)
          Length = 1565

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR598542.1| full-length cDNA clone CS0DN002YO18 of Adult brain of Homo sapiens
           (human)
          Length = 1577

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 425 atcagggtcagtgtggttcctgttgggctttt 456



to top

>emb|CR594213.1| full-length cDNA clone CS0DI009YN05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1579

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 433 atcagggtcagtgtggttcctgttgggctttt 464



to top

>gb|AF359422.1| Nicotiana tabacum cathepsin B-like cysteine proteinase gene,
           partial cds
          Length = 731

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 441 cactgcggttcctgttgggcttttggagctgt 472
           ||||| ||||| |||||||||||||| |||||
Sbjct: 520 cactgtggttcttgttgggcttttggtgctgt 551



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    ggttgcagcacaattgggaa 424
              ||||||||||||||||||||
Sbjct: 546761 ggttgcagcacaattgggaa 546742



to top

>gb|S79895.1| OC2=cathepsin O2 [human, spleen, mRNA, 1482 nt]
          Length = 1482

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 536 atcagggtcagtgtggttcctgttgggctttt 567



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 28      cctcctccgcttgcttcctcctcc 51
               ||||||||||||||| ||||||||
Sbjct: 6636733 cctcctccgcttgctccctcctcc 6636756



to top

>gb|AC092156.2| Homo sapiens BAC clone RP11-326J14 from 2, complete sequence
          Length = 168610

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 38     ttgcttcctcctcccaccca 57
              ||||||||||||||||||||
Sbjct: 167966 ttgcttcctcctcccaccca 167985



to top

>gb|AC068195.6| Homo sapiens BAC clone RP11-114B24 from 2, complete sequence
          Length = 178147

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   ttgcttcctcctcccaccca 57
            ||||||||||||||||||||
Sbjct: 1337 ttgcttcctcctcccaccca 1356



to top

>dbj|AP005719.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1130E10
          Length = 151606

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 28    cctcctccgcttgcttcctcctcc 51
             ||||||||||||||| ||||||||
Sbjct: 29732 cctcctccgcttgctccctcctcc 29755



to top

>gb|AY892942.1| Synthetic construct Homo sapiens clone FLH135296.01L cathepsin K
           (CTSK) mRNA, partial cds
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|AY892941.1| Synthetic construct Homo sapiens clone FLH135294.01L cathepsin K
           (CTSK) mRNA, partial cds
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>dbj|BS000063.1| Pan troglodytes chromosome 22 clone:PTB-428P03, map 22, complete
             sequences
          Length = 136131

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 557   tatgtgtggtgatggttgtg 576
             ||||||||||||||||||||
Sbjct: 74570 tatgtgtggtgatggttgtg 74589



to top

>gb|AF240629.1|AF240629 Homo sapiens chromosome 21 map 21q21 clone B47C12, complete sequence
          Length = 151696

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 557   tatgtgtggtgatggttgtg 576
             ||||||||||||||||||||
Sbjct: 73704 tatgtgtggtgatggttgtg 73723



to top

>emb|AJ303304.1|HEC303304 Hepatitis C virus type 1b partial mRNA for p7/NS2 protein
           (e2(p7)-NS2 gene), clone B236b12
          Length = 212

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 95  cctgctcccgctggcgctgc 114
           ||||||||||||||||||||
Sbjct: 74  cctgctcccgctggcgctgc 93



to top

>ref|XM_560519.1| Anopheles gambiae str. PEST ENSANGP00000028370
           (ENSANGG00000022283), partial mRNA
          Length = 297

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 acactattgagcaatttaag 290
           ||||||||||||||||||||
Sbjct: 167 acactattgagcaatttaag 186



to top

>dbj|AK130134.1| Homo sapiens cDNA FLJ26624 fis, clone MPC03724, highly similar to
           Cathepsin K precursor (EC 3.4.22.38)
          Length = 1601

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 443 atcagggtcagtgtggttcctgttgggctttt 474



to top

>gb|AY893612.1| Synthetic construct Homo sapiens clone FLH131032.01X cathepsin K
           (CTSK) mRNA, complete cds
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>dbj|AP005160.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0031C24
          Length = 194111

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 28     cctcctccgcttgcttcctcctcc 51
              ||||||||||||||| ||||||||
Sbjct: 148827 cctcctccgcttgctccctcctcc 148850



to top

>gb|AF124092.1|AF124092 Macaca mulatta cathepsin K mRNA, complete cds
          Length = 1029

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 411 atcagggtcagtgtggttcctgttgggctttt 442



to top

>dbj|AP001679.1| Homo sapiens genomic DNA, chromosome 21q, section 23/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 557    tatgtgtggtgatggttgtg 576
              ||||||||||||||||||||
Sbjct: 259595 tatgtgtggtgatggttgtg 259614



to top

>dbj|AP006199.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-482B5, complete
              sequence
          Length = 188161

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 560    gtgtggtgatggttgtgatg 579
              ||||||||||||||||||||
Sbjct: 134332 gtgtggtgatggttgtgatg 134351



to top

>dbj|AP006196.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-347H8, complete
            sequence
          Length = 181660

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 560  gtgtggtgatggttgtgatg 579
            ||||||||||||||||||||
Sbjct: 8674 gtgtggtgatggttgtgatg 8693



to top

>gb|DQ294220.1| Glossina morsitans morsitans TC1837 cathepsin F like protease mRNA,
            complete cds
          Length = 1738

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 433  atcaaggtcactgcggttcctgttgggctttt 464
            |||||||| | |||||||| ||||||||||||
Sbjct: 1102 atcaaggtaattgcggttcatgttgggctttt 1133



to top

>gb|AF070927.1|AF070927 Macaca fascicularis cathepsin K mRNA, complete cds
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 395 atcagggtcagtgtggttcctgttgggctttt 426



to top

>gb|U20280.1|HSU20280 Human cathepsin X mRNA, complete cds
          Length = 1597

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 413 atcagggtcagtgtggttcctgttgggctttt 444



to top

>emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chromosome X, complete
             sequence
          Length = 169331

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 545   ttgctgtgggtttatgtgtg 564
             ||||||||||||||||||||
Sbjct: 79928 ttgctgtgggtttatgtgtg 79947



to top

>gb|U13665.1|HSU13665 Human cathepsin O (CTSO) mRNA, complete cds
          Length = 1661

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 433 atcaaggtcactgcggttcctgttgggctttt 464
           |||| ||||| || ||||||||||||||||||
Sbjct: 500 atcagggtcagtgtggttcctgttgggctttt 531



to top

>emb|AL929125.1| Mouse DNA sequence from clone RP23-262O4 on chromosome 2, complete
             sequence
          Length = 183595

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 563   tggtgatggttgtgatggag 582
             ||||||||||||||||||||
Sbjct: 75985 tggtgatggttgtgatggag 75966



to top

>dbj|AP000957.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B781M3,
             LL56-APP region, complete sequence
          Length = 190937

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 557   tatgtgtggtgatggttgtg 576
             ||||||||||||||||||||
Sbjct: 31684 tatgtgtggtgatggttgtg 31703



to top

>dbj|AP002529.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 2/4
          Length = 300000

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 560   gtgtggtgatggttgtgatg 579
             ||||||||||||||||||||
Sbjct: 44075 gtgtggtgatggttgtgatg 44094



to top

>dbj|AB041731.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:706L14, complete
              sequence
          Length = 156242

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 560    gtgtggtgatggttgtgatg 579
              ||||||||||||||||||||
Sbjct: 137302 gtgtggtgatggttgtgatg 137321



to top

>dbj|AB042031.1| Homo sapiens genomic DNA, chromosome 6q21, BAC clone:515A4, complete
             sequence
          Length = 194732

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 560   gtgtggtgatggttgtgatg 579
             ||||||||||||||||||||
Sbjct: 33999 gtgtggtgatggttgtgatg 34018


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,824,405
Number of Sequences: 3902068
Number of extensions: 4824405
Number of successful extensions: 100006
Number of sequences better than 10.0: 87
Number of HSP's better than 10.0 without gapping: 87
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99757
Number of HSP's gapped (non-prelim): 245
length of query: 602
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 579
effective length of database: 17,143,297,704
effective search space: 9925969370616
effective search space used: 9925969370616
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top