ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart34a10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, co... 1074 0.0
2dbj|AB086418.1| Hordeum vulgare gene for O-methyltransferase, pa... 180 3e-42
3dbj|AB086417.1| Hordeum vulgare gene for O-methyltransferase, pa... 180 3e-42
4gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltrans... 88 4e-14
5gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans... 76 1e-10
6ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
7dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
8dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
9gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 72 2e-09
10dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA... 72 2e-09
11dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
12dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
13gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 68 3e-08
14gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-... 68 3e-08
15gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 66 1e-07
16gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 66 1e-07
17emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf... 66 1e-07
18emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 64 5e-07
19gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl... 64 5e-07
20gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 60 8e-06
21gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 60 8e-06
22emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca... 60 8e-06
23gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 60 8e-06
24gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 60 8e-06
25emb|X80669.1|ZMMRFV3 Z.mays MRFV3 mRNA 58 3e-05
26gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 58 3e-05
27gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 58 3e-05
28gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 58 3e-05
29gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 58 3e-05
30gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 58 3e-05
31gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 58 3e-05
32gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 58 3e-05
33gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 58 3e-05
34gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 58 3e-05
35gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 58 3e-05
36gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 58 3e-05
37gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 58 3e-05
38gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 58 3e-05
39gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 58 3e-05
40gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 58 3e-05
41gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 58 3e-05
42gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 58 3e-05
43gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 58 3e-05
44gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 58 3e-05
45gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 58 3e-05
46gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 58 3e-05
47gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 58 3e-05
48gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 58 3e-05
49gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 58 3e-05
50gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 58 3e-05
51gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 58 3e-05
52gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 58 3e-05
53gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 58 3e-05
54gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 58 3e-05
55gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 58 3e-05
56gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 58 3e-05
57gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 58 3e-05
58gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 58 3e-05
59gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 58 3e-05
60gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 58 3e-05
61gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ... 56 1e-04
62gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,... 56 1e-04
63gb|AY555144.1| Vanilla planifolia caffeic acid O-methyltransfera... 48 0.032
64gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full ... 48 0.032
65gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 46 0.12
66gb|AC009372.6| Drosophila melanogaster 3L BAC RP98-48N4 (Roswell... 44 0.49
67ref|NM_140803.1| Drosophila melanogaster CG14073-RB, transcript ... 44 0.49
68gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66... 44 0.49
69dbj|AB093137.1| Mus musculus gene for liver type neutral ceramid... 44 0.49
70dbj|AB037111.1| Mus musculus LCDase mRNA for neutral ceramidase,... 44 0.49
71gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, c... 42 1.9
72gb|AC099783.2| Homo sapiens chromosome 3 clone RP11-115I24, comp... 42 1.9
73gb|AC092044.2| Homo sapiens chromosome 3 clone RP11-146E16, comp... 42 1.9
74dbj|AK166100.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 42 1.9
75gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, co... 42 1.9
76dbj|AK080951.1| Mus musculus 4 days neonate male adipose cDNA, R... 42 1.9
77dbj|AK046540.1| Mus musculus adult male adrenal gland cDNA, RIKE... 42 1.9
78dbj|AK042079.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 42 1.9
79dbj|AK034493.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 1.9
80dbj|AK041937.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 42 1.9
81dbj|AK047692.1| Mus musculus adult male corpus striatum cDNA, RI... 42 1.9
82gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 1.9
83dbj|AK217207.1| Mus musculus cDNA, clone:Y2G0141A19, strand:plus... 42 1.9
84gb|AC135321.2| Homo sapiens chromosome 3 clone RP11-733F11, comp... 42 1.9
85emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete ... 40 7.7
86emb|BX640431.1| Bordetella parapertussis strain 12822, complete ... 40 7.7
87emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 40 7.7
88gb|AC119677.2| Homo sapiens chromosome 1 clone RP5-1066H13, comp... 40 7.7
89gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 7.7
90dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 7.7
91gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, co... 40 7.7
92gb|AE004655.1| Pseudomonas aeruginosa PAO1, section 216 of 529 o... 40 7.7
93gb|AC174773.1| Gasterosteus aculeatus clone VMRC28-91K14, comple... 40 7.7
94emb|AL732572.10| Mouse DNA sequence from clone RP23-32C16 on chr... 40 7.7 
>dbj|AB086416.1| Hordeum vulgare mRNA for O-methyltransferase, complete cds
          Length = 1372

 Score = 1074 bits (542), Expect = 0.0
 Identities = 560/566 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 25  agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 84

                                                                       
Query: 61  cagccggcgtcatggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcgg 120
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 85  cagccggcgtcatggccaacgaggaggcgttaatgttcgcgctgcagctggcttcgtcgg 144

                                                                       
Query: 121 ctgtcctgccgatgacgcttcgcacttgcatcgagctgggcctgctggagaccctggtgg 180
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 145 ttgtcctgccgatgacgcttcgcacttgcatcgagctgggcctgctggagaccctggtgg 204

                                                                       
Query: 181 gcgccggtgggaagacgttgacgccggaagaggtagcggccaagcttccgtccaaagcgg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 gcgccggtgggaagacgttgacgccggaagaggtagcggccaagcttccgtccaaagcgg 264

                                                                       
Query: 241 agtccaacccggacgcggcgtccatggtggatcggttgctgcgggtactggcaacataca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 agtccaacccggacgcggcgtccatggtggatcggttgctgcgggtactggcaacataca 324

                                                                       
Query: 301 aggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtatggcg 360
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 aggtcgtttcgcgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtatggcg 384

                                                                       
Query: 361 ctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcgcccttct 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 385 ctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcgcccttct 444

                                                                       
Query: 421 gtctccttgcccagaacaagctcttcatggaggcctggtgtcacatgaaggacgcggtcc 480
           | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 445 gcctcctagcccagaacaagctcttcatggaggcctggtgtcacatgaaggacgcggtcc 504

                                                                       
Query: 481 ttgagggtggcagtgcattcaccaaggcattcggagcgtcgtggtttgactacgctggca 540
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 505 ttgagggtggcagtgcattcaccaaggcattcagagcgtcgtggtttgactacgctggca 564

                                     
Query: 541 cagatgatcacttcaatcacctcttt 566
           ||||||||||||||||||||||||||
Sbjct: 565 cagatgatcacttcaatcacctcttt 590
to top
>dbj|AB086418.1| Hordeum vulgare gene for O-methyltransferase, partial cds,
            isolate:1743
          Length = 1393

 Score =  180 bits (91), Expect = 3e-42
 Identities = 91/91 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1300 agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 1359

                                           
Query: 61   cagccggcgtcatggccaacgaggaggcgtt 91
            |||||||||||||||||||||||||||||||
Sbjct: 1360 cagccggcgtcatggccaacgaggaggcgtt 1390
to top
>dbj|AB086417.1| Hordeum vulgare gene for O-methyltransferase, partial cds,
            isolate:K305
          Length = 1395

 Score =  180 bits (91), Expect = 3e-42
 Identities = 91/91 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1302 agccgtcctctcaccacaaaggtttgcagtaacgcttaccaacagcagacgctagctagc 1361

                                           
Query: 61   cagccggcgtcatggccaacgaggaggcgtt 91
            |||||||||||||||||||||||||||||||
Sbjct: 1362 cagccggcgtcatggccaacgaggaggcgtt 1392
to top
>gb|AF033539.1|AF033539 Lolium perenne caffeic acid O-methyltransferase (OMT2) mRNA,
           complete cds
          Length = 1436

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 71  catggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgcc 130
           ||||||| |||| |||||||  |||||||| |||||||||||    |||||||| |||||
Sbjct: 74  catggccgacgaagaggcgtgcatgttcgctctgcagctggccaactcggctgtgctgcc 133

                                                                       
Query: 131 gatgacgcttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgg 190
           |||| || || | || | ||||||||||||||| |||||||| || ||||||||||| ||
Sbjct: 134 gatggcgattaggacatccatcgagctgggccttctggagactcttgtgggcgccggcgg 193

               
Query: 191 gaag 194
           ||||
Sbjct: 194 gaag 197



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 139/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcgcccttctgtct 424
           ||||||||||  ||||||| | |||||||||||||| | ||||||||| || |||  |||
Sbjct: 365 gccggtgtgccggtggctcgcccccaacgaggacggcgcctccatggccccgttcgctct 424

                                                                       
Query: 425 ccttgcccagaacaagctcttcatggaggcctggtgtcacatgaaggacgcggtccttga 484
           |||  ||||| ||    ||||||||||||| ||||| ||||||||||||||| |||| ||
Sbjct: 425 cctcacccaggaccgcgtcttcatggaggcgtggtgccacatgaaggacgcgatcctgga 484

                                                              
Query: 485 gggtggcagtgcattcaccaaggcattcggagcgtcgtggtttgactacgc 535
           ||| ||||| || |||  || ||| |||||  |||||||||| || |||||
Sbjct: 485 gggcggcagcgcgttccacagggcgttcgggacgtcgtggttcgagtacgc 535



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 247 acccggacgcggcgtccatggtggatcggttgctgcg 283
           |||||||||||||||||||| | |||||  |||||||
Sbjct: 247 acccggacgcggcgtccatgatagatcgcatgctgcg 283
to top
>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA,
           complete cds
          Length = 1436

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 352 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatgg 411
           |||| ||||| | ||||||||||||||  ||||| |||||||||||||||||||||||||
Sbjct: 393 ggtacggcgccgcgccggtgtgcaagttcctcacccccaacgaggacggtgtctccatgg 452

             
Query: 412 cg 413
           ||
Sbjct: 453 cg 454



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaag 194
           ||||||||| ||||| |||||||||||  ||| |||||| ||||||
Sbjct: 193 catcgagcttggcctcctggagaccctcatggccgccggcgggaag 238
to top
>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 421 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 468



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 74  ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 133
           |||| ||||||||||||  |||| ||||||||||||||| |||||| |  ||||||||||
Sbjct: 115 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 174

                 
Query: 134 gacgct 139
           ||||||
Sbjct: 175 gacgct 180
to top
>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 219 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 266
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                               
Query: 365     gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
               |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 3334155 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 3334108



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                           
Query: 74      ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 133
               |||| ||||||||||||  |||| ||||||||||||||| |||||| |  ||||||||||
Sbjct: 3334461 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 3334402

                     
Query: 134     gacgct 139
               ||||||
Sbjct: 3334401 gacgct 3334396
to top
>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
           mRNA, complete cds
          Length = 1190

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 353 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 400



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 74  ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 133
           |||| ||||||||||||  |||| ||||||||||||||| |||||| |  ||||||||||
Sbjct: 47  ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 106

                 
Query: 134 gacgct 139
           ||||||
Sbjct: 107 gacgct 112
to top
>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 39  gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 86
to top
>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                              
Query: 365    gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
              |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 111722 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 111675



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 74     ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 133
              |||| ||||||||||||  |||| ||||||||||||||| |||||| |  ||||||||||
Sbjct: 112028 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 111969

                    
Query: 134    gacgct 139
              ||||||
Sbjct: 111968 gacgct 111963
to top
>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
           insert sequence
          Length = 1425

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 365 gccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 421 gccggtgtgcaagtggctgacgcccaacgaggacggcgtctccatggc 468



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 74  ggccaacgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgat 133
           |||| ||||||||||||  |||| ||||||||||||||| |||||| |  ||||||||||
Sbjct: 115 ggccgacgaggaggcgtgcatgtacgcgctgcagctggcgtcgtcgtcgatcctgccgat 174

                 
Query: 134 gacgct 139
           ||||||
Sbjct: 175 gacgct 180
to top
>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
           complete cds
          Length = 1371

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 208
           ||||||||||||||| |||||||||||||||| |||||| || |||  | ||||||| | 
Sbjct: 181 catcgagctgggcctcctggagaccctggtggccgccggcggcaagctgctgacgcccgc 240

                                     
Query: 209 agaggtagcggccaagcttccgtcca 234
            ||||| || |||||||| |||||||
Sbjct: 241 cgaggtggctgccaagctcccgtcca 266



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 369 gtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 413
           ||||||||||  || || |||||||||||||| ||||||||||||
Sbjct: 395 gtgtgcaagttcctgacccccaacgaggacggcgtctccatggcg 439
to top
>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1430

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 352 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatgg 411
           |||| ||||| | ||||||||||||||  ||||| |||||||||||||| ||||||||||
Sbjct: 382 ggtacggcgccgcgccggtgtgcaagttcctcacccccaacgaggacggcgtctccatgg 441

             
Query: 412 cg 413
           ||
Sbjct: 442 cg 443



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaag 194
           ||||||||| ||||| |||||||||||| ||| |||||| ||||||
Sbjct: 185 catcgagcttggcctcctggagaccctgatggccgccggcgggaag 230
to top
>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1438

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 96/117 (82%)
 Strand = Plus / Plus

                                                                       
Query: 297 tacaaggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtat 356
           ||||| ||||| |||||||| ||||| ||| ||   |||||  |||| ||||| || || 
Sbjct: 311 tacaacgtcgtgtcgtgcctggtggaggagggcaaggacggccgcctctcccggagctac 370

                                                                    
Query: 357 ggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 413
           ||||| | ||| ||||||||||  ||||| |||||||||||||| ||||||||||||
Sbjct: 371 ggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacggcgtctccatggcg 427
to top
>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1440

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 333 gacgggagcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaac 392
           |||||| |||| ||||| || || ||||| | ||| ||||||||||  ||||| ||||||
Sbjct: 356 gacgggcgcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaac 415

                                
Query: 393 gaggacggtgtctccatggcg 413
           |||||||| ||||||||||||
Sbjct: 416 gaggacggcgtctccatggcg 436
to top
>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 96/117 (82%)
 Strand = Plus / Plus

                                                                       
Query: 297 tacaaggtcgtttcgtgcctagtggatgagtgcgcagacgggagcctgtcccgcaggtat 356
           ||||| ||||| |||||||| ||||| ||| ||   |||||  |||| ||||| || || 
Sbjct: 144 tacaacgtcgtgtcgtgcctggtggaggagggcaaggacggccgcctctcccggagctac 203

                                                                    
Query: 357 ggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatggcg 413
           ||||| | ||| ||||||||||  ||||| |||||||||||||| ||||||||||||
Sbjct: 204 ggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacggcgtctccatggcg 260



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccgg 187
           ||||||||||||||| ||||||| |||||| | ||||||
Sbjct: 2   catcgagctgggcctcctggagatcctggtagccgccgg 40
to top
>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 373 gcaagtggctcactcccaacgaggacggtgtctccatggc 412
           ||||||||||||| |||||||||||||| |||||||||||
Sbjct: 436 gcaagtggctcacccccaacgaggacggcgtctccatggc 475



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| ||| || |  ||||||| |||||||
Sbjct: 142 acgaggaggcgtgcatgtacgcgatgcagctggcgtcggcgtccatcctgcccatgacgc 201

            
Query: 139 t 139
           |
Sbjct: 202 t 202
to top
>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
           gene, complete cds
          Length = 2012

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 373 gcaagtggctcactcccaacgaggacggtgtctccatggc 412
           ||||||||||||| |||||||||||||| |||||||||||
Sbjct: 332 gcaagtggctcacccccaacgaggacggcgtctccatggc 371



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| ||| || |  ||||||| |||||||
Sbjct: 38  acgaggaggcgtgcatgtacgcgatgcagctggcgtcggcgtccatcctgcccatgacgc 97

            
Query: 139 t 139
           |
Sbjct: 98  t 98
to top
>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA
           sequence
          Length = 1314

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 208
           |||||||||||| || |||||||||||||||| |||||| || |||  | ||||||| | 
Sbjct: 113 catcgagctgggtctcctggagaccctggtggccgccggcggcaagctgctgacgcccgc 172

                                     
Query: 209 agaggtagcggccaagcttccgtcca 234
            ||||| || |||||||| |||||||
Sbjct: 173 cgaggtggcagccaagctcccgtcca 198



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 342 ctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggt 401
           ||||||||  |||| ||||| | ||| ||||||||||  ||||| |||||||| ||||| 
Sbjct: 300 ctgtcccggcggtacggcgccgcgcccgtgtgcaagttcctcacccccaacgaagacggc 359

                       
Query: 402 gtctccatggcg 413
           ||||||||||||
Sbjct: 360 gtctccatggcg 371
to top
>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
           complete cds
          Length = 1446

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 340 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 399
           |||| ||||| || || ||||| | ||| ||||||||||  ||||| |||||||||||||
Sbjct: 337 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 396

                         
Query: 400 gtgtctccatggcg 413
           | ||||||||||||
Sbjct: 397 gcgtctccatggcg 410



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 122/155 (78%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||| ||||  |||||||| || ||||| ||||| ||| | ||||| ||||||||||
Sbjct: 82  acgaggacgcgtgcatgttcgccctccagctcgcttcctcgtcggtcctcccgatgacgc 141

                                                                       
Query: 139 ttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgt 198
           |    |    ||||||||| ||||| ||||||| |||||||| |||||| || ||| || 
Sbjct: 142 tgaagaacgccatcgagcttggcctcctggagatcctggtggccgccggcggcaagtcgc 201

                                              
Query: 199 tgacgccggaagaggtagcggccaagcttccgtcc 233
           |||| |||   ||||| || |||||||| ||||||
Sbjct: 202 tgaccccgaccgaggtggccgccaagctcccgtcc 236
to top
>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 340 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 399
           |||| ||||| || || ||||| | ||| ||||||||||  ||||| |||||||||||||
Sbjct: 187 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 246

                         
Query: 400 gtgtctccatggcg 413
           | ||||||||||||
Sbjct: 247 gcgtctccatggcg 260



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttgacgccgga 208
           ||||||||||||||| ||||||| |||||||| |||||| || ||| || |||| |||  
Sbjct: 2   catcgagctgggccttctggagatcctggtggccgccggcggcaagtcgctgaccccgac 61

                                    
Query: 209 agaggtagcggccaagcttccgtcc 233
            ||||| || |||||||| ||||||
Sbjct: 62  cgaggtggccgccaagctcccgtcc 86
to top
>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA,
           complete cds
          Length = 1455

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 340 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 399
           |||| ||||| || || ||||| | ||| ||||||||||  ||||| |||||||||||||
Sbjct: 344 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 403

                         
Query: 400 gtgtctccatggcg 413
           | ||||||||||||
Sbjct: 404 gcgtctccatggcg 417



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 122/155 (78%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||| ||||  |||||||| || ||||| ||||| ||| | ||||| ||||||||||
Sbjct: 89  acgaggacgcgtgcatgttcgccctccagctcgcttcctcgtcggtcctcccgatgacgc 148

                                                                       
Query: 139 ttcgcacttgcatcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgt 198
           |    |    ||||||||| ||||| ||||||| |||||||| |||||| || ||| || 
Sbjct: 149 tgaagaacgccatcgagcttggcctcctggagatcctggtggccgccggcggcaagtcgc 208

                                              
Query: 199 tgacgccggaagaggtagcggccaagcttccgtcc 233
           |||| |||   ||||| || |||||||| ||||||
Sbjct: 209 tgaccccgaccgaggtggccgccaagctcccgtcc 243
to top
>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
           O-methyltransferase mRNA, complete cds
          Length = 1475

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 340 gcctgtcccgcaggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacg 399
           |||| ||||| || || ||||| | ||| ||||||||||  ||||| |||||||||||||
Sbjct: 363 gcctctcccggagctacggcgccgcgcccgtgtgcaagttcctcacccccaacgaggacg 422

                         
Query: 400 gtgtctccatggcg 413
           | ||||||||||||
Sbjct: 423 gcgtctccatggcg 436
to top
>emb|X80669.1|ZMMRFV3 Z.mays MRFV3 mRNA
          Length = 392

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 16  tgcaagtggctcacccccaacgaggacggcgtgtccatggc 56
to top
>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902

            
Query: 139 t 139
           |
Sbjct: 903 t 903
to top
>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1096 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1136



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 797 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 856

            
Query: 139 t 139
           |
Sbjct: 857 t 857
to top
>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070

             
Query: 139  t 139
            |
Sbjct: 1071 t 1071
to top
>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070

             
Query: 139  t 139
            |
Sbjct: 1071 t 1071
to top
>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902

            
Query: 139 t 139
           |
Sbjct: 903 t 903
to top
>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1210 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1250



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 911 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 970

            
Query: 139 t 139
           |
Sbjct: 971 t 971
to top
>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1161 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1201



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 862 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 921

            
Query: 139 t 139
           |
Sbjct: 922 t 922
to top
>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1142 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1182



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 843 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 902

            
Query: 139 t 139
           |
Sbjct: 903 t 903
to top
>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1310 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1350



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1011 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1070

             
Query: 139  t 139
            |
Sbjct: 1071 t 1071
to top
>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1588 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1628



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1289 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1348

             
Query: 139  t 139
            |
Sbjct: 1349 t 1349
to top
>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1129 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1169



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 830 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 889

            
Query: 139 t 139
           |
Sbjct: 890 t 890
to top
>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1129 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1169



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 830 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 889

            
Query: 139 t 139
           |
Sbjct: 890 t 890
to top
>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1524 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1564



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1225 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1284

             
Query: 139  t 139
            |
Sbjct: 1285 t 1285
to top
>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1125 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1165



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 826 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 885

            
Query: 139 t 139
           |
Sbjct: 886 t 886
to top
>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1487 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1527



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1188 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1247

             
Query: 139  t 139
            |
Sbjct: 1248 t 1248
to top
>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1524 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1564



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1225 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1284

             
Query: 139  t 139
            |
Sbjct: 1285 t 1285
to top
>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1391 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1431



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1092 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1151

             
Query: 139  t 139
            |
Sbjct: 1152 t 1152
to top
>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207

             
Query: 139  t 139
            |
Sbjct: 1208 t 1208
to top
>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207

             
Query: 139  t 139
            |
Sbjct: 1208 t 1208
to top
>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207

             
Query: 139  t 139
            |
Sbjct: 1208 t 1208
to top
>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1516 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1556



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1217 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1276

             
Query: 139  t 139
            |
Sbjct: 1277 t 1277
to top
>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1517 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1557



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1218 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1277

             
Query: 139  t 139
            |
Sbjct: 1278 t 1278
to top
>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1095 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1135



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 796 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 855

            
Query: 139 t 139
           |
Sbjct: 856 t 856
to top
>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1441 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1481



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1142 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1201

             
Query: 139  t 139
            |
Sbjct: 1202 t 1202
to top
>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1447 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1487



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1148 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1207

             
Query: 139  t 139
            |
Sbjct: 1208 t 1208
to top
>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1490 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1530



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1191 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1250

             
Query: 139  t 139
            |
Sbjct: 1251 t 1251
to top
>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1495 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1535



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1196 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1255

             
Query: 139  t 139
            |
Sbjct: 1256 t 1256
to top
>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1520 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1560



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1221 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1280

             
Query: 139  t 139
            |
Sbjct: 1281 t 1281
to top
>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1456 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1496



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1157 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1216

             
Query: 139  t 139
            |
Sbjct: 1217 t 1217
to top
>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 372  tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
            |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 1527 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 1567



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 79   acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
            ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 1228 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 1287

             
Query: 139  t 139
            |
Sbjct: 1288 t 1288
to top
>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
           cds
          Length = 2041

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 507 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 547



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 208 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 267

            
Query: 139 t 139
           |
Sbjct: 268 t 268
to top
>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene,
           complete cds
          Length = 2326

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227

            
Query: 139 t 139
           |
Sbjct: 228 t 228
to top
>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene,
           complete cds
          Length = 2074

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 528 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 568



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 229 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 288

            
Query: 139 t 139
           |
Sbjct: 289 t 289
to top
>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene,
           complete cds
          Length = 2326

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227

            
Query: 139 t 139
           |
Sbjct: 228 t 228
to top
>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 372 tgcaagtggctcactcccaacgaggacggtgtctccatggc 412
           |||||||||||||| |||||||||||||| || ||||||||
Sbjct: 467 tgcaagtggctcacccccaacgaggacggcgtgtccatggc 507



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcggctgtcctgccgatgacgc 138
           ||||||||||||  |||| |||| |||||||||| |||||| |  ||||||| |||||||
Sbjct: 168 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcgtccatcctgcccatgacgc 227

            
Query: 139 t 139
           |
Sbjct: 228 t 228
to top
>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 373 gcaagtggctcactcccaacgaggacggtgtctccatggc 412
           ||||||||||||| || ||||||||||| |||||||||||
Sbjct: 632 gcaagtggctcacccctaacgaggacggcgtctccatggc 671



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcg 119
           ||||||||||||  |||| |||| |||||||||| ||||||
Sbjct: 344 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcg 384
to top
>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 373 gcaagtggctcactcccaacgaggacggtgtctccatggc 412
           ||||||||||||| || ||||||||||| |||||||||||
Sbjct: 435 gcaagtggctcacccctaacgaggacggcgtctccatggc 474



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 79  acgaggaggcgttgatgttcgcgctgcagctggcttcgtcg 119
           ||||||||||||  |||| |||| |||||||||| ||||||
Sbjct: 147 acgaggaggcgtgcatgtacgcgatgcagctggcgtcgtcg 187
to top
>gb|AY555144.1| Vanilla planifolia caffeic acid O-methyltransferase mRNA, complete
           cds
          Length = 1219

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 384 actcccaacgaggacggtgtctccatggcgcc 415
           ||||||||| ||||||| ||||||||||||||
Sbjct: 355 actcccaaccaggacggcgtctccatggcgcc 386
to top
>gb|BT009359.1| Triticum aestivum clone wlm96.pk025.c3:fis, full insert mRNA
           sequence
          Length = 1308

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 369 gtgtgcaagtggctcactcccaacgaggacgg 400
           ||||| ||||||||||| ||||||||||||||
Sbjct: 420 gtgtgtaagtggctcacacccaacgaggacgg 451



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 149 catcgagctgggcctgctggagaccctggtgggcgccggtgggaagacgttg 200
           ||||||||||||| |||| |||| ||| ||||| ||||| ||||||| ||||
Sbjct: 206 catcgagctgggcatgctcgagatcctcgtgggtgccggcgggaagatgttg 257
to top
>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 352 ggtatggcgctgagccggtgtgcaagtggctcactcccaacgaggacggtgtctccatg 410
           |||| ||||| | ||| ||||||||||  ||||| |||||||||||||| || ||||||
Sbjct: 367 ggtacggcgccgcgcccgtgtgcaagtacctcacccccaacgaggacggcgtgtccatg 425
to top
>gb|AC009372.6| Drosophila melanogaster 3L BAC RP98-48N4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 175095

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 265   tggtggatcggttgctgcgggt 286
             ||||||||||||||||||||||
Sbjct: 78590 tggtggatcggttgctgcgggt 78569
to top
>ref|NM_140803.1| Drosophila melanogaster CG14073-RB, transcript variant B (CG14073),
           mRNA
          Length = 6922

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 265 tggtggatcggttgctgcgggt 286
           ||||||||||||||||||||||
Sbjct: 134 tggtggatcggttgctgcgggt 113
to top
>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete
              sequence
          Length = 294542

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 265    tggtggatcggttgctgcgggt 286
              ||||||||||||||||||||||
Sbjct: 183419 tggtggatcggttgctgcgggt 183440
to top
>dbj|AB093137.1| Mus musculus gene for liver type neutral ceramidase, promoter region
          Length = 1548

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 152  cgagctgggcctgctggagacc 173
            ||||||||||||||||||||||
Sbjct: 1425 cgagctgggcctgctggagacc 1446
to top
>dbj|AB037111.1| Mus musculus LCDase mRNA for neutral ceramidase, complete cds
          Length = 3108

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 152 cgagctgggcctgctggagacc 173
           ||||||||||||||||||||||
Sbjct: 125 cgagctgggcctgctggagacc 146
to top
>gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, complete sequence
          Length = 190974

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 152    cgagctgggcctgctggagac 172
              |||||||||||||||||||||
Sbjct: 108104 cgagctgggcctgctggagac 108124
to top
>gb|AC099783.2| Homo sapiens chromosome 3 clone RP11-115I24, complete sequence
          Length = 159870

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    ctcaccacaaaggtttgcagt 30
             |||||||||||||||||||||
Sbjct: 24222 ctcaccacaaaggtttgcagt 24202
to top
>gb|AC092044.2| Homo sapiens chromosome 3 clone RP11-146E16, complete sequence
          Length = 73569

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 10    ctcaccacaaaggtttgcagt 30
             |||||||||||||||||||||
Sbjct: 24222 ctcaccacaaaggtttgcagt 24202
to top
>dbj|AK166100.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
           library, clone:G730038N06 product:N-acylsphingosine
           amidohydrolase 2, full insert sequence
          Length = 1598

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 145 cgagctgggcctgctggagac 165
to top
>gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, complete sequence
          Length = 206879

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 152   cgagctgggcctgctggagac 172
             |||||||||||||||||||||
Sbjct: 29204 cgagctgggcctgctggagac 29184
to top
>dbj|AK080951.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
           enriched library, clone:B430217G19
           product:N-acylsphingosine amidohydrolase 2, full insert
           sequence
          Length = 3323

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 133 cgagctgggcctgctggagac 153
to top
>dbj|AK046540.1| Mus musculus adult male adrenal gland cDNA, RIKEN full-length
           enriched library, clone:B330020D04
           product:N-acylsphingosine amidohydrolase 2, full insert
           sequence
          Length = 4055

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 146 cgagctgggcctgctggagac 166
to top
>dbj|AK042079.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630056F24 product:unclassifiable, full
           insert sequence
          Length = 1900

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 172 cgagctgggcctgctggagac 192
to top
>dbj|AK034493.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330200A12
           product:N-acylsphingosine amidohydrolase 2, full insert
           sequence
          Length = 3384

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 187 cgagctgggcctgctggagac 207
to top
>dbj|AK041937.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630048A04 product:N-acylsphingosine
           amidohydrolase 2, full insert sequence
          Length = 3459

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 142 cgagctgggcctgctggagac 162
to top
>dbj|AK047692.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length
           enriched library, clone:C030011O21
           product:N-acylsphingosine amidohydrolase 2, full insert
           sequence
          Length = 1538

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 152 cgagctgggcctgctggagac 172
           |||||||||||||||||||||
Sbjct: 143 cgagctgggcctgctggagac 163
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 247     acccggacgcggcgtccatggtgga 271
               |||||||||||||| ||||||||||
Sbjct: 1536507 acccggacgcggcgcccatggtgga 1536483
to top
>dbj|AK217207.1| Mus musculus cDNA, clone:Y2G0141A19, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000025649, based on BLAT search
          Length = 194

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 476 ggtccttgagggtggcagtgc 496
           |||||||||||||||||||||
Sbjct: 91  ggtccttgagggtggcagtgc 71
to top
>gb|AC135321.2| Homo sapiens chromosome 3 clone RP11-733F11, complete sequence
          Length = 177164

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 10    ctcaccacaaaggtttgcagt 30
             |||||||||||||||||||||
Sbjct: 84292 ctcaccacaaaggtttgcagt 84312
to top
>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16
          Length = 348706

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    ctgctggagaccctggtgggcgcc 185
              |||||| |||||||||||||||||
Sbjct: 257321 ctgctgcagaccctggtgggcgcc 257344
to top
>emb|BX640431.1| Bordetella parapertussis strain 12822, complete genome; segment 9/14
          Length = 347894

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    ctgctggagaccctggtgggcgcc 185
              |||||| |||||||||||||||||
Sbjct: 329006 ctgctgcagaccctggtgggcgcc 329029
to top
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 162  ctgctggagaccctggtgggcgcc 185
            |||||| |||||||||||||||||
Sbjct: 3883 ctgctgcagaccctggtgggcgcc 3860
to top
>gb|AC119677.2| Homo sapiens chromosome 1 clone RP5-1066H13, complete sequence
          Length = 170397

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 415   ccttctgtctccttgcccag 434
             ||||||||||||||||||||
Sbjct: 55730 ccttctgtctccttgcccag 55711
to top
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 171     accctggtgggcgccggtgg 190
               ||||||||||||||||||||
Sbjct: 6921152 accctggtgggcgccggtgg 6921171
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 148     gcatcgagctgggcctgctg 167
               ||||||||||||||||||||
Sbjct: 2767680 gcatcgagctgggcctgctg 2767699
to top
>gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, complete sequence
          Length = 195448

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    ctcaccacaaaggtttgcag 29
             ||||||||||||||||||||
Sbjct: 75649 ctcaccacaaaggtttgcag 75668
to top
>gb|AE004655.1| Pseudomonas aeruginosa PAO1, section 216 of 529 of the complete
            genome
          Length = 10829

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 152  cgagctgggcctgctggaga 171
            ||||||||||||||||||||
Sbjct: 5993 cgagctgggcctgctggaga 5974
to top
>gb|AC174773.1| Gasterosteus aculeatus clone VMRC28-91K14, complete sequence
          Length = 153630

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 539   cacagatgatcacttcaatc 558
             ||||||||||||||||||||
Sbjct: 47923 cacagatgatcacttcaatc 47942
to top
>emb|AL732572.10| Mouse DNA sequence from clone RP23-32C16 on chromosome 2, complete
             sequence
          Length = 213704

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 417   ttctgtctccttgcccagaa 436
             ||||||||||||||||||||
Sbjct: 36227 ttctgtctccttgcccagaa 36246


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,226,075
Number of Sequences: 3902068
Number of extensions: 3226075
Number of successful extensions: 57117
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 94
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56660
Number of HSP's gapped (non-prelim): 455
length of query: 566
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 543
effective length of database: 17,143,297,704
effective search space: 9308810653272
effective search space used: 9308810653272
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top