Clone Information

BLAST Search Result

Clone Name	bart33d05
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|BT016572.1\| Zea mays clone Contig405 mRNA sequence	230	4e-57
2	ref\|XM_474324.1\| Oryza sativa (japonica cultivar-group), predic...	204	2e-49
3	dbj\|AK102124.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	204	2e-49
4	ref\|XM_474393.1\| Oryza sativa (japonica cultivar-group), predic...	202	9e-49
5	gb\|AY110043.1\| Zea mays CL5496_1 mRNA sequence	194	2e-46
6	emb\|AL732344.3\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	170	3e-39
7	emb\|AL606457.3\|OSJN00002 Oryza sativa genomic DNA, chromosome 4,...	155	2e-34
8	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	155	2e-34
9	emb\|AL606641.3\|OSJN00074 Oryza sativa genomic DNA, chromosome 4,...	153	8e-34
10	emb\|AL732352.2\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	153	8e-34
11	gb\|AC129609.3\| Mus musculus BAC clone RP23-194H4 from chromosome...	48	0.033
12	emb\|CR936500.10\| Zebrafish DNA sequence from clone DKEY-274N8 in...	48	0.033
13	emb\|CR559944.12\| Zebrafish DNA sequence from clone CH211-10D19 i...	48	0.033
14	emb\|BX005211.21\| Zebrafish DNA sequence from clone CH211-128A7 i...	48	0.033
15	emb\|CR392344.7\| Zebrafish DNA sequence from clone CH211-239D11 i...	48	0.033
16	gb\|AC126615.7\| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Canc...	48	0.033
17	gb\|AC009093.10\| Homo sapiens chromosome 16 clone RP11-426C22, co...	48	0.033
18	gb\|AC060771.8\| Homo sapiens chromosome 17, clone RP11-169I9, com...	48	0.033
19	emb\|BX323835.9\| Zebrafish DNA sequence from clone DKEYP-22F6 in ...	48	0.033
20	gb\|AC138512.4\| Homo sapiens chromosome 16 clone RP11-93B18, comp...	48	0.033
21	gb\|AC134312.3\| Homo sapiens chromosome 16 clone RP11-863P13, com...	48	0.033
22	emb\|BX000984.7\| Zebrafish DNA sequence from clone CH211-157C7, c...	48	0.033
23	emb\|BX950195.14\| Zebrafish DNA sequence from clone CH211-232M10 ...	48	0.033
24	emb\|AL732354.2\| Oryza sativa genomic DNA, chromosome 4, BAC clon...	48	0.033
25	gb\|AC115341.6\| Rattus norvegicus 3 BAC CH230-248O1 (Children's H...	46	0.13
26	gb\|AC148006.4\| Mus musculus BAC clone RP23-298P21 from chromosom...	46	0.13
27	gb\|AC121935.3\| Mus musculus BAC clone RP24-207G22 from chromosom...	46	0.13
28	emb\|CR536619.20\| Zebrafish DNA sequence from clone CH211-194H19 ...	46	0.13
29	gb\|AC123826.4\| Mus musculus BAC clone RP24-97K3 from chromosome ...	46	0.13
30	emb\|CR931814.13\| Zebrafish DNA sequence from clone DKEY-236E8 in...	46	0.13
31	emb\|AL137850.12\| Human DNA sequence from clone RP11-56P10 on chr...	46	0.13
32	emb\|BX510998.12\| Zebrafish DNA sequence from clone CH211-272L18 ...	46	0.13
33	gb\|AC119396.3\| Homo sapiens chromosome 19 clone CTB-133G6, compl...	46	0.13
34	gb\|AC157322.5\| Mus musculus chromosome 19, clone RP23-241E11, co...	46	0.13
35	gb\|AC158800.6\| Mus musculus 10 BAC RP23-435N6 (Roswell Park Canc...	46	0.13
36	gb\|AC009041.10\| Homo sapiens chromosome 16 clone RP11-161M6, com...	46	0.13
37	gb\|AC105118.23\| Homo sapiens chromosome 8, clone RP11-909N17, co...	46	0.13
38	gb\|AC008276.4\| Homo sapiens BAC clone RP11-297I3 from 2, complet...	46	0.13
39	gb\|AC098874.6\| Homo sapiens BAC clone RP11-1299G23 from 2, compl...	46	0.13
40	emb\|BX001023.12\| Zebrafish DNA sequence from clone CH211-233F10 ...	46	0.13
41	dbj\|AP000879.4\| Homo sapiens genomic DNA, chromosome 11q, clone:...	46	0.13
42	gb\|AC144802.3\| Mus musculus BAC clone RP24-222O23 from 10, compl...	46	0.13
43	gb\|AC005361.1\| Homo sapiens chromosome 16, cosmid clone 352F10 (...	44	0.52
44	emb\|AL359960.23\| Human DNA sequence from clone RP11-298K24 on ch...	44	0.52
45	emb\|AL672311.26\| Human DNA sequence from clone RP13-167H21 on ch...	44	0.52
46	emb\|AL591916.8\| Human DNA sequence from clone RP11-168B8 on chro...	44	0.52
47	emb\|AL137077.31\| Human DNA sequence from clone RP11-11M20 on chr...	44	0.52
48	emb\|AL137248.21\| Human DNA sequence from clone RP11-316G23 on ch...	44	0.52
49	emb\|AL137251.5\| Human DNA sequence from clone RP1-141N5 on chrom...	44	0.52
50	emb\|AL118522.32\|HSDJ781B1 Human DNA sequence from clone RP4-781B...	44	0.52
51	emb\|AL079339.11\|HSJ906P16 Human DNA sequence from clone RP5-906P...	44	0.52
52	gb\|AC117945.2\| Homo sapiens chromosome 1 clone RP4-614N24, compl...	44	0.52
53	gb\|AC016587.9\| Homo sapiens chromosome 19 clone CTD-2632B17, com...	44	0.52
54	gb\|AC023699.4\| Drosophila melanogaster X BAC RP98-11K20 (Roswell...	44	0.52
55	emb\|BX470133.27\| Zebrafish DNA sequence from clone DKEY-169N7 in...	44	0.52
56	emb\|BX510911.10\| Zebrafish DNA sequence from clone CH211-150K17 ...	44	0.52
57	gb\|AC023708.4\| Drosophila melanogaster X BAC RP98-12B22 (Roswell...	44	0.52
58	gb\|BC113744.1\| Homo sapiens cDNA clone IMAGE:5762826, with appar...	44	0.52
59	gb\|AC037473.7\|AC037473 Homo sapiens chromosome 18, clone CTD-213...	44	0.52
60	dbj\|AK037755.1\| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	44	0.52
61	emb\|BX005074.10\| Zebrafish DNA sequence from clone CH211-146J7 i...	44	0.52
62	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	44	0.52
63	gb\|AC102738.9\| Mus musculus chromosome 3, clone RP24-303G10, com...	44	0.52
64	emb\|BX248418.16\| Zebrafish DNA sequence from clone DKEY-181I3 in...	44	0.52
65	emb\|CR847568.13\| Zebrafish DNA sequence from clone DKEYP-74C2 in...	44	0.52
66	gb\|AE003438.3\| Drosophila melanogaster chromosome X, section 22 ...	44	0.52
67	dbj\|AP001711.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	44	0.52
68	emb\|CR848750.27\| Zebrafish DNA sequence from clone RP71-4B23 in ...	44	0.52
69	emb\|CR847947.14\| Zebrafish DNA sequence from clone DKEY-56M16 in...	44	0.52
70	dbj\|AP000248.1\| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	44	0.52
71	dbj\|AP000210.1\| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	44	0.52
72	emb\|AL596062.13\| Mouse DNA sequence from clone RP23-284O21 on ch...	44	0.52
73	dbj\|AP003501.2\| Homo sapiens genomic DNA, chromosome 11q, clone:...	44	0.52
74	gb\|AY830944.1\| Poecilia reticulata microsatellite Pre17 sequence	42	2.0
75	gb\|AC165953.3\| Mus musculus BAC clone RP24-75N14 from chromosome...	42	2.0
76	gb\|AC139580.4\| Mus musculus BAC clone RP23-110M15 from chromosom...	42	2.0
77	gb\|CP000075.1\| Pseudomonas syringae pv. syringae B728a, complete...	42	2.0
78	gb\|AC093734.3\| Homo sapiens BAC clone RP11-16P10 from 7, complet...	42	2.0
79	gb\|AC025219.6\| Homo sapiens chromosome 15, clone RP11-276M12, co...	42	2.0
80	gb\|AC137749.11\| Mus musculus chromosome 6, clone RP23-69C16, com...	42	2.0
81	gb\|AC133088.3\| Mus musculus BAC clone RP24-138O17 from chromosom...	42	2.0
82	gb\|AC129337.4\| Mus musculus BAC clone RP23-123I14 from 1, comple...	42	2.0
83	emb\|BX005297.22\| Zebrafish DNA sequence from clone CH211-271B8 i...	42	2.0
84	emb\|CR318660.16\| Zebrafish DNA sequence from clone CH211-149I8 i...	42	2.0
85	emb\|BX928753.10\| Zebrafish DNA sequence from clone DKEY-5J3 in l...	42	2.0
86	emb\|CR762472.6\| Zebrafish DNA sequence from clone DKEY-75G19 in ...	42	2.0
87	emb\|Z94162.1\|HSN21F1 Human DNA sequence from clone LL22NC03-21F1...	42	2.0
88	emb\|Z84480.1\|HS418A9 Human DNA sequence from clone RP3-418A9 on ...	42	2.0
89	emb\|AL590989.15\| Human DNA sequence from clone RP11-149P14 on ch...	42	2.0
90	emb\|AL445933.32\| Human DNA sequence from clone RP11-486B10 on ch...	42	2.0
91	emb\|AL353691.12\| Human DNA sequence from clone RP5-1174J21 on ch...	42	2.0
92	emb\|AL121756.14\|HSDJ726C3 Human DNA sequence from clone RP4-726C...	42	2.0
93	emb\|AL008734.10\|HS324M8 Human DNA sequence from clone RP3-324M8 ...	42	2.0
94	emb\|BX927328.10\| Zebrafish DNA sequence from clone CH211-10M4 in...	42	2.0
95	emb\|CR394542.5\| Zebrafish DNA sequence from clone DKEY-91I10 in ...	42	2.0
96	emb\|AL954821.10\| Mouse DNA sequence from clone RP23-415G6 on chr...	42	2.0
97	emb\|AL954256.1\| Pan troglodytes chromosome 22 clone PTB-129I16 m...	42	2.0
98	emb\|BX569794.8\| Zebrafish DNA sequence from clone DKEYP-15B2 in ...	42	2.0
99	gb\|CP000076.1\| Pseudomonas fluorescens Pf-5, complete genome	42	2.0
100	emb\|BX957346.14\| Zebrafish DNA sequence from clone CH211-117K16 ...	42	2.0
101	gb\|AC011474.6\| Homo sapiens chromosome 19 clone CTC-525D6, compl...	42	2.0
102	gb\|AC103976.6\| Homo sapiens chromosome 15, clone RP11-121E15, co...	42	2.0
103	dbj\|AK142905.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	2.0
104	gb\|AC091654.4\| Homo sapiens BAC clone RP11-177C9 from 7, complet...	42	2.0
105	ref\|XM_938154.1\| PREDICTED: Homo sapiens patched domain containi...	42	2.0
106	ref\|XM_052561.8\| PREDICTED: Homo sapiens patched domain containi...	42	2.0
107	ref\|XM_677679.1\| PREDICTED: Danio rerio similar to CG32239-PA (L...	42	2.0
108	emb\|BX248512.14\| Zebrafish DNA sequence from clone CH211-284D12 ...	42	2.0
109	gb\|AC091939.3\| Homo sapiens chromosome 5 clone RP11-32D16, compl...	42	2.0
110	gb\|AC007217.5\| Homo sapiens chromosome 16 clone RP11-167B4, comp...	42	2.0
111	gb\|AF529518.1\| Acipenser fulvescens clone AfuG141 microsatellite...	42	2.0
112	gb\|AC006124.2\| Homo sapiens chromosome 19, cosmid R34739, comple...	42	2.0
113	dbj\|BA000012.4\| Mesorhizobium loti MAFF303099 DNA, complete genome	42	2.0
114	emb\|AL928887.13\| Zebrafish DNA sequence from clone CH211-136O14 ...	42	2.0
115	gb\|AC005775.1\|AC005775 Homo sapiens chromosome 19, cosmid F20237...	42	2.0
116	gb\|AC149294.8\| Mus musculus chromosome 15, clone RP24-389G21, co...	42	2.0
117	emb\|CR293523.11\| Zebrafish DNA sequence from clone DKEY-104J7 in...	42	2.0
118	emb\|CR388128.18\| Zebrafish DNA sequence from clone CH211-127B17 ...	42	2.0
119	emb\|BX293565.25\| Zebrafish DNA sequence from clone DKEY-268M13 i...	42	2.0
120	emb\|BX119988.9\| Zebrafish DNA sequence from clone CH211-184L6 in...	42	2.0
121	emb\|BX119983.4\| Zebrafish DNA sequence from clone CH211-198G9 in...	42	2.0
122	emb\|BX004817.8\| Zebrafish DNA sequence from clone DKEY-169B7, co...	42	2.0
123	emb\|BX950172.16\| Zebrafish DNA sequence from clone DKEY-20F24 in...	42	2.0
124	emb\|CR388001.36\| Zebrafish DNA sequence from clone CH211-279I17 ...	42	2.0
125	gb\|AC127328.6\| Mus musculus BAC clone RP23-259B8 from 6, complet...	42	2.0
126	emb\|AL935048.7\| Zebrafish DNA sequence from clone CH211-168M7, c...	42	2.0
127	emb\|AL670673.15\| Mouse DNA sequence from clone RP23-32L5 on chro...	42	2.0
128	emb\|BX897750.11\| Zebrafish DNA sequence from clone DKEY-278N18, ...	42	2.0
129	emb\|CR936437.14\| Zebrafish DNA sequence from clone CH211-197I23 ...	42	2.0
130	emb\|AL672259.9\| Mouse DNA sequence from clone RP23-169M4 on chro...	42	2.0
131	emb\|AL833787.8\| Mouse DNA sequence from clone RP23-228E2 on chro...	42	2.0
132	dbj\|AP003971.2\| Homo sapiens genomic DNA, chromosome 11q clone:R...	42	2.0
133	gb\|AC108402.12\| Mus musculus chromosome 3, clone RP24-141M5, com...	40	8.1
134	gb\|AC117698.19\| Mus musculus chromosome 5, clone RP23-451A12, co...	40	8.1
135	gb\|AC108429.11\| Mus musculus chromosome 7, clone RP23-161B5, com...	40	8.1
136	gb\|AC160972.4\| Mus musculus BAC clone RP24-571D21 from chromosom...	40	8.1
137	gb\|AC150385.2\| Branchiostoma floridae clone CH302-101G3, complet...	40	8.1
138	gb\|AC144927.5\| Mus musculus chromosome 5, clone RP23-464P20, com...	40	8.1
139	gb\|AC154516.2\| Mus musculus BAC clone RP24-83D23 from chromosome...	40	8.1
140	gb\|AC133286.15\| Mus musculus chromosome 1, clone RP24-358J4, com...	40	8.1
141	ref\|NM_183577.1\| Oryza sativa (japonica cultivar-group), predic...	40	8.1
142	gb\|AC122005.3\| Mus musculus chromosome 5 clone RP24-340B11, comp...	40	8.1
143	gb\|AC103624.9\| Mus musculus chromosome 5, clone RP24-258B22, com...	40	8.1
144	gb\|AC101684.13\| Mus musculus chromosome 1, clone RP23-187I13, co...	40	8.1
145	gb\|AC154387.2\| Mus musculus BAC clone RP23-10K1 from chromosome ...	40	8.1
146	gb\|AC139867.4\| Mus musculus BAC clone RP23-430P22 from chromosom...	40	8.1
147	gb\|AC165260.2\| Mus musculus BAC clone RP23-123E17 from chromosom...	40	8.1
148	gb\|AC152824.4\| Mus musculus BAC clone RP24-276N7 from chromosome...	40	8.1
149	gb\|AC159290.2\| Mus musculus BAC clone RP23-291I2 from chromosome...	40	8.1
150	ref\|XM_508962.1\| PREDICTED: Pan troglodytes nuclear matrix trans...	40	8.1
151	ref\|XM_480098.1\| Oryza sativa (japonica cultivar-group), mRNA	40	8.1
152	gb\|AC165317.8\| Mus musculus chromosome 5, clone RP23-265O20, com...	40	8.1
153	gb\|AC099707.14\| Mus musculus chromosome 1, clone RP23-329C7, com...	40	8.1
154	gb\|AC109201.12\| Mus musculus chromosome 15, clone RP23-18P10, co...	40	8.1
155	gb\|AC153526.13\| Mus musculus 10 BAC RP23-383C2 (Roswell Park Can...	40	8.1
156	gb\|AC104882.30\| Mus musculus chromosome 8, clone RP23-401L9, com...	40	8.1
157	gb\|AC102355.13\| Mus musculus chromosome 5, clone RP23-120C8, com...	40	8.1
158	gb\|AC112962.15\| Mus musculus chromosome 19, clone RP24-74N6, com...	40	8.1
159	gb\|AC166573.2\| Mus musculus BAC clone RP23-153H18 from chromosom...	40	8.1
160	gb\|AC138334.11\| Mus musculus chromosome 7, clone RP23-306H5, com...	40	8.1
161	gb\|AC153607.15\| Mus musculus 6 BAC RP23-100I21 (Roswell Park Can...	40	8.1
162	gb\|AC125735.1\| Leishmania major strain Friedlin chromosome 3, co...	40	8.1
163	gb\|AC115868.12\| Mus musculus chromosome 7, clone RP24-329F21, co...	40	8.1
164	gb\|AC119856.13\| Mus musculus chromosome 5, clone RP23-256B18, co...	40	8.1
165	gb\|AC158958.4\| Mus musculus chromosome 1, clone RP23-31E12, comp...	40	8.1
166	gb\|AC163998.2\| Mus musculus chromosome 15, clone RP24-326H11, co...	40	8.1
167	gb\|AY016023.1\| Sphoeroides nephelus alpha globin gene cluster, c...	40	8.1
168	gb\|AF326957.1\| Macropus eugenii microsatellite T47-2 sequence	40	8.1
169	gb\|AC102614.11\| Mus musculus chromosome 8, clone RP23-421L10, co...	40	8.1
170	gb\|AC004499.1\| Homo sapiens chromosome 20, BAC clone 104 (LBNL H...	40	8.1
171	gb\|AC004644.1\| Homo sapiens chromosome 16, cosmid clone 367E12 (...	40	8.1
172	gb\|AC165225.5\| Mus musculus chromosome 3, clone RP24-70J13, comp...	40	8.1
173	gb\|AY258856.1\| Xiphophorus maculatus microsatellite Msc025 sequence	40	8.1
174	gb\|AC116151.10\| Mus musculus chromosome 5, clone RP24-84G9, comp...	40	8.1
175	gb\|AC160993.5\| Mus musculus BAC clone RP23-159D11 from chromosom...	40	8.1
176	gb\|AC096684.3\| Takifugu rubripes clone 241N7, complete sequence	40	8.1
177	gb\|AC160471.10\| Mus musculus chromosome 7, clone RP23-432D9, com...	40	8.1
178	gb\|AC153152.4\| Mus musculus BAC clone RP23-78F1 from chromosome ...	40	8.1
179	gb\|AC165424.2\| Mus musculus BAC clone RP24-68L23 from chromosome...	40	8.1
180	gb\|AC164649.4\| Mus musculus BAC clone RP23-437D10 from chromosom...	40	8.1
181	gb\|AC165273.2\| Mus musculus BAC clone RP24-267I1 from chromosome...	40	8.1
182	gb\|AC158943.9\| Mus musculus chromosome 1, clone RP24-272N10, com...	40	8.1
183	gb\|AC165254.2\| Mus musculus BAC clone RP23-285H4 from chromosome...	40	8.1
184	gb\|CP000010.1\| Burkholderia mallei ATCC 23344 chromosome 1, comp...	40	8.1
185	gb\|AC115937.14\| Mus musculus chromosome 5, clone RP24-547J21, co...	40	8.1
186	gb\|AC139062.10\| Mus musculus chromosome 17, clone RP23-69L11, co...	40	8.1
187	gb\|AC118255.32\| Mus musculus chromosome 8, clone RP24-89A4, comp...	40	8.1
188	gb\|AY738117.1\| Homo sapiens matrix metalloproteinase 2 (gelatina...	40	8.1
189	gb\|AC008337.8\| Drosophila melanogaster clone BACR02B03, complete...	40	8.1
190	gb\|AC113104.15\| Mus musculus chromosome 18, clone RP23-321L15, c...	40	8.1
191	gb\|AE008650.1\| Rickettsia conorii str. Malish 7, section 82 of 1...	40	8.1
192	gb\|AC120176.7\| Mus musculus chromosome 18, clone RP24-494J20, co...	40	8.1
193	gb\|AC115508.5\| Rattus norvegicus 2 BAC CH230-355B17 (Children's ...	40	8.1
194	gb\|AC112633.6\| Rattus norvegicus 11 BAC CH230-200K21 (Children's...	40	8.1
195	gb\|AC108321.5\| Rattus norvegicus BAC CH230-261E4 (Children's Hos...	40	8.1
196	gb\|AC112898.5\| Rattus norvegicus 2 BAC CH230-157M2 (Children's H...	40	8.1
197	gb\|AC012376.12\| Drosophila melanogaster clone BACR48C12, complet...	40	8.1
198	gb\|AC115484.2\| Drosophila melanogaster clone BACR06K01, complete...	40	8.1
199	gb\|AC116705.11\| Mus musculus chromosome 5, clone RP23-26P10, com...	40	8.1
200	gb\|AC091454.2\| Mus musculus chromosome X, clones RP21-438P10, RP...	40	8.1
201	gb\|AC116856.8\| Mus musculus chromosome 14, clone RP24-403P16, co...	40	8.1
202	gb\|AC145748.4\| Mus musculus BAC clone RP23-31L10 from chromosome...	40	8.1
203	gb\|AC134553.5\| Mus musculus BAC clone RP24-280H19 from chromosom...	40	8.1
204	gb\|AC138654.4\| Mus musculus BAC clone RP23-344O11 from chromosom...	40	8.1
205	gb\|AC119892.10\| Mus musculus chromosome 12, clone RP24-224L20, c...	40	8.1
206	gb\|AC100893.13\| Mus musculus chromosome 8, clone RP23-68I8, comp...	40	8.1
207	ref\|XM_580342.2\| PREDICTED: Bos taurus similar to insulin-like g...	40	8.1
208	gb\|AC129040.5\| Rattus norvegicus 6 BAC CH230-372A13 (Children's ...	40	8.1
209	gb\|AC131336.9\| Mus musculus chromosome 1, clone RP23-96A20, comp...	40	8.1
210	ref\|NM_001039918.1\| Homo sapiens zinc finger protein 384 (ZNF384...	40	8.1
211	ref\|NM_133476.3\| Homo sapiens zinc finger protein 384 (ZNF384), ...	40	8.1
212	gb\|CP000124.1\| Burkholderia pseudomallei 1710b chromosome I, com...	40	8.1
213	gb\|AC158936.4\| Mus musculus chromosome 3, clone RP23-235P13, com...	40	8.1
214	gb\|AC147375.3\| Mus musculus BAC clone RP24-159O13 from chromosom...	40	8.1
215	gb\|AC110092.4\| Mus musculus BAC clone RP24-94E17 from chromosome...	40	8.1
216	gb\|AC129219.3\| Mus musculus BAC clone RP24-474C15 from chromosom...	40	8.1
217	gb\|AC147038.2\| Pan troglodytes BAC clone RP43-112D23 from 7, com...	40	8.1
218	gb\|CP000359.1\| Deinococcus geothermalis DSM 11300, complete genome	40	8.1
219	gb\|AC126941.3\| Mus musculus BAC clone RP23-133N24 from chromosom...	40	8.1
220	gb\|AC124749.5\| Mus musculus BAC clone RP23-262G23 from chromosom...	40	8.1
221	gb\|AC122302.4\| Mus musculus BAC clone RP23-276E10 from chromosom...	40	8.1
222	gb\|AC137980.4\| Mus musculus BAC clone RP24-69K24 from chromosome...	40	8.1
223	gb\|AC147163.2\| Mus musculus BAC clone RP24-317B17 from chromosom...	40	8.1
224	gb\|AC144776.2\| Mus musculus BAC clone RP23-357B5 from chromosome...	40	8.1
225	gb\|AC118546.80\| Mus musculus strain C57BL/6J clone rp23-346h22 m...	40	8.1
226	gb\|AC140042.19\| Mus musculus chromosome 5, clone RP23-437D10, co...	40	8.1
227	gb\|AC113028.15\| Mus musculus chromosome 5, clone RP23-205D3, com...	40	8.1
228	gb\|AC090432.3\| Mus musculus strain C57BL6/J chromosome 5 clone R...	40	8.1
229	gb\|AC144702.2\| Danio rerio clone CH211-138D14, complete sequence	40	8.1
230	gb\|AY386696.1\| Oryctolagus cuniculus clone 27N5, complete sequence	40	8.1
231	gb\|AC154605.2\| Mus musculus BAC clone RP23-348G3 from chromosome...	40	8.1
232	gb\|AC161217.7\| Mus musculus chromosome 8, clone RP23-80D9, compl...	40	8.1
233	gb\|AC166167.2\| Mus musculus BAC clone RP23-211D22 from chromosom...	40	8.1
234	gb\|AC161176.5\| Mus musculus chromosome 5, clone RP24-295A5, comp...	40	8.1
235	gb\|AC104868.8\| Mus musculus chromosome 1, clone RP24-532K6, comp...	40	8.1
236	gb\|DP000012.1\| Macropus eugenii target 1 genomic scaffold	40	8.1
237	gb\|AC163393.6\| Mus musculus chromosome 15, clone RP24-224P8, com...	40	8.1
238	gb\|AC166256.5\| Mus musculus BAC RP23-440F21 (Roswell Park Cance...	40	8.1
239	gb\|AC163903.4\| Mus musculus BAC clone RP24-314J18 from chromosom...	40	8.1
240	gb\|AC164637.3\| Mus musculus BAC clone RP23-128I20 from chromosom...	40	8.1
241	gb\|AC122282.5\| Mus musculus BAC clone RP23-240B12 from chromosom...	40	8.1
242	gb\|AC164103.5\| Mus musculus BAC clone RP23-427D2 from chromosome...	40	8.1
243	gb\|AC127027.13\| Mus musculus chromosome 5, clone RP23-236G19, co...	40	8.1
244	gb\|AC167229.4\| Mus musculus BAC RP24-337D17 (Roswell Park Cance...	40	8.1
245	gb\|AC121279.7\| Mus musculus chromosome 3, clone RP23-4F17, compl...	40	8.1
246	gb\|AC162914.2\| Mus musculus BAC clone RP23-401O13 from chromosom...	40	8.1
247	gb\|AC154508.2\| Mus musculus BAC clone RP24-96P6 from chromosome ...	40	8.1
248	gb\|AC157650.2\| Mus musculus BAC clone RP24-573N21 from chromosom...	40	8.1
249	gb\|AC153919.8\| Mus musculus 10 BAC RP23-91E23 (Roswell Park Canc...	40	8.1
250	gb\|AC119906.6\| Mus musculus chromosome 5, clone RP24-239D13, com...	40	8.1
251	gb\|AC137154.2\| Mus musculus BAC clone RP24-572L22 from chromosom...	40	8.1
252	gb\|AC122541.3\| Mus musculus BAC clone RP24-567D4 from chromosome...	40	8.1
253	gb\|AC159030.2\| Pan troglodytes BAC clone CH251-399F13 from chrom...	40	8.1
254	gb\|AC123866.4\| Mus musculus BAC clone RP23-124I3 from chromosome...	40	8.1
255	gb\|AC133937.3\| Mus musculus BAC clone RP24-486L5 from chromosome...	40	8.1
256	gb\|AC092482.71\| Mus musculus strain C57BL/6J clone rp23-60j11, c...	40	8.1
257	gb\|AC119219.6\| Mus musculus chromosome 12, clone RP24-201C18, co...	40	8.1
258	gb\|AC004111.1\| Homo sapiens BAC clone CTB-103H13 from 7, complet...	40	8.1
259	gb\|AC132122.2\| Mus musculus chromosome 7 clone RP24-78F23, compl...	40	8.1
260	gb\|AC004994.1\| Homo sapiens PAC clone RP5-1194E15 from 7, comple...	40	8.1
261	gb\|AC110253.10\| Mus musculus chromosome 5, clone RP23-270N2, com...	40	8.1
262	gb\|AC114676.7\| Mus musculus chromosome 5, clone RP24-211H1, comp...	40	8.1
263	gb\|AC145076.8\| Mus musculus chromosome 10, clone RP24-528G5, com...	40	8.1
264	gb\|AC115743.10\| Mus musculus chromosome 5, clone RP23-477P24, co...	40	8.1
265	gb\|AC105470.17\| Rattus norvegicus 10 BAC CH230-192N7 (Children's...	40	8.1
266	ref\|XM_862518.1\| PREDICTED: Canis familiaris similar to Zinc fin...	40	8.1
267	ref\|XM_862508.1\| PREDICTED: Canis familiaris similar to Zinc fin...	40	8.1
268	ref\|XM_862440.1\| PREDICTED: Canis familiaris similar to Zinc fin...	40	8.1
269	gb\|AC116552.2\| Homo sapiens chromosome 16 clone RP11-21B21, comp...	40	8.1
270	gb\|AC093536.4\| Homo sapiens chromosome 16 clone RP11-744D14, com...	40	8.1
271	gb\|AC124449.3\| Mus musculus BAC clone RP24-212N10 from chromosom...	40	8.1
272	gb\|AC133077.4\| Mus musculus BAC clone RP24-423E10 from chromosom...	40	8.1
273	gb\|AC134438.3\| Mus musculus BAC clone RP24-470G3 from chromosome...	40	8.1
274	gb\|AY261359.1\| Bovine herpesvirus 5 strain SV507/99, complete ge...	40	8.1
275	gb\|AY050668.1\| Homo sapiens PKC-potentiated PP1 inhibitory prote...	40	8.1
276	gb\|DQ483426.1\| Gymnogyps californianus clone 129H microsatellite...	40	8.1
277	gb\|DQ483416.1\| Gymnogyps californianus clone 119H microsatellite...	40	8.1
278	gb\|AY498860.1\| Homo sapiens tumor necrosis factor receptor super...	40	8.1
279	emb\|BX323566.13\| Zebrafish DNA sequence from clone DKEYP-67A8 in...	40	8.1
280	emb\|CR762443.6\| Zebrafish DNA sequence from clone DKEY-3A5 in li...	40	8.1
281	emb\|CR848707.6\| Zebrafish DNA sequence from clone CH211-276P5 in...	40	8.1
282	emb\|CR450748.10\| Zebrafish DNA sequence from clone CH211-157P5, ...	40	8.1
283	emb\|CT009638.5\| Zebrafish DNA sequence from clone CH73-162A18 in...	40	8.1
284	emb\|AL929319.4\| Zebrafish DNA sequence from clone CH211-59F17 in...	40	8.1
285	emb\|CT009567.9\| Mouse DNA sequence from clone RP23-50H13 on chro...	40	8.1
286	emb\|CR735143.13\| Zebrafish DNA sequence from clone CH211-244P16 ...	40	8.1
287	emb\|CR388016.11\| Zebrafish DNA sequence from clone DKEY-106M5 in...	40	8.1
288	emb\|CR388131.10\| Zebrafish DNA sequence from clone DKEY-114G9 in...	40	8.1
289	emb\|CR847804.27\| Zebrafish DNA sequence from clone DKEY-85C24 in...	40	8.1
290	emb\|AL021531.1\|FR151J19 Fugu rubripes cosmid 151J19 covering the...	40	8.1
291	gb\|AC123945.4\| Mus musculus BAC clone RP24-87G13 from chromosome...	40	8.1
292	gb\|AC122395.4\| Mus musculus BAC clone RP24-86H17 from chromosome...	40	8.1
293	emb\|CR626875.10\| Zebrafish DNA sequence from clone DKEY-31J4 in ...	40	8.1
294	emb\|CR769785.19\| Zebrafish DNA sequence from clone DKEY-1N3 in l...	40	8.1
295	emb\|BX957236.8\| Zebrafish DNA sequence from clone DKEY-178O3 in ...	40	8.1
296	emb\|CR936442.13\| Zebrafish DNA sequence from clone DKEY-266F7 in...	40	8.1
297	gb\|AC115881.8\| Mus musculus chromosome 6, clone RP24-365K16, com...	40	8.1
298	emb\|CR589948.8\| Zebrafish DNA sequence from clone CH211-160P12 i...	40	8.1
299	emb\|BX927339.16\| Zebrafish DNA sequence from clone CH211-251A10 ...	40	8.1
300	emb\|CR457463.6\| Zebrafish DNA sequence from clone DKEY-110G19 in...	40	8.1
301	gb\|AC110524.11\| Mus musculus chromosome 9, clone RP23-403L22, co...	40	8.1
302	emb\|CR394563.17\| Zebrafish DNA sequence from clone CH211-147P18,...	40	8.1
303	gb\|AC129200.4\| Mus musculus BAC clone RP24-221J22 from chromosom...	40	8.1
304	gb\|AC123848.4\| Mus musculus BAC clone RP23-459I1 from chromosome...	40	8.1
305	gb\|AC130539.3\| Mus musculus BAC clone RP23-455J15 from chromosom...	40	8.1
306	gb\|AC131705.4\| Mus musculus BAC clone RP24-130N16 from chromosom...	40	8.1
307	gb\|AC123924.4\| Mus musculus BAC clone RP24-292A3 from chromosome...	40	8.1
308	gb\|AC124416.4\| Mus musculus BAC clone RP24-308I2 from chromosome...	40	8.1
309	gb\|AC132272.3\| Mus musculus BAC clone RP24-339P23 from chromosom...	40	8.1
310	gb\|AC122015.3\| Mus musculus BAC clone RP24-358M18 from chromosom...	40	8.1
311	gb\|AC125150.3\| Mus musculus BAC clone RP24-354K9 from chromosome...	40	8.1
312	gb\|AC127553.3\| Mus musculus BAC clone RP24-553F11 from chromosom...	40	8.1
313	gb\|AC009135.12\| Homo sapiens chromosome 16 clone RP11-509E10, co...	40	8.1
314	gb\|AC129331.4\| Mus musculus BAC clone RP23-75C8 from chromosome ...	40	8.1
315	gb\|AC115117.5\| Mus musculus BAC clone RP23-76J12 from chromosome...	40	8.1
316	gb\|AC114000.5\| Mus musculus BAC clone RP23-161K1 from chromosome...	40	8.1
317	gb\|AC124777.4\| Mus musculus BAC clone RP23-90I17 from chromosome...	40	8.1
318	gb\|AC124520.4\| Mus musculus BAC clone RP23-395G14 from chromosom...	40	8.1
319	gb\|AC125065.3\| Mus musculus BAC clone RP23-430G6 from chromosome...	40	8.1
320	gb\|AC127359.4\| Mus musculus BAC clone RP23-110G23 from chromosom...	40	8.1
321	gb\|AC127358.3\| Mus musculus BAC clone RP23-109B9 from chromosome...	40	8.1
322	gb\|AC122214.4\| Mus musculus BAC clone RP23-104J10 from chromosom...	40	8.1
323	emb\|BX936408.10\| Zebrafish DNA sequence from clone CH211-195A15 ...	40	8.1
324	gb\|AC118245.17\| Mus musculus chromosome 6, clone RP23-292C5, com...	40	8.1
325	gb\|AC093516.5\| Homo sapiens chromosome 16 clone CTD-2537L13, com...	40	8.1
326	gb\|AC002492.1\|HUAC002492 Human Chromosome 16 BAC clone CIT987SK-...	40	8.1
327	gb\|AC004382.1\|HUAC004382 Homo sapiens Chromosome 16 BAC clone CI...	40	8.1
328	emb\|AL591788.1\|SME591788 Sinorhizobium meliloti 1021 complete ch...	40	8.1
329	gb\|AC002303.1\|HUAC002303 Homo sapiens Chromosome 16 BAC clone CI...	40	8.1
330	emb\|CR361555.8\| Zebrafish DNA sequence from clone CH211-215D20 i...	40	8.1
331	gb\|AC108780.10\| Mus musculus chromosome 14, clone RP23-445H16, c...	40	8.1
332	gb\|AC021744.14\| Homo sapiens chromosome 8, clone RP11-284H18, co...	40	8.1
333	gb\|AC015884.15\| Homo sapiens chromosome 17, clone RP11-216P6, co...	40	8.1
334	gb\|AC103968.11\| Homo sapiens chromosome 15, clone RP11-719C20, c...	40	8.1
335	gb\|AC124703.3\| Mus musculus BAC clone RP24-261G23 from chromosom...	40	8.1
336	gb\|AC126680.4\| Mus musculus BAC clone RP24-347B21 from chromosom...	40	8.1
337	gb\|AC123795.4\| Mus musculus BAC clone RP24-317K11 from chromosom...	40	8.1
338	gb\|AC122013.4\| Mus musculus BAC clone RP24-357P7 from chromosome...	40	8.1
339	gb\|AC124684.3\| Mus musculus BAC clone RP24-375D13 from chromosom...	40	8.1
340	gb\|AC126428.3\| Mus musculus BAC clone RP24-387B13 from chromosom...	40	8.1
341	gb\|AC124381.4\| Mus musculus BAC clone RP24-406E24 from chromosom...	40	8.1
342	gb\|AC140275.3\| Mus musculus BAC clone RP24-312F4 from chromosome...	40	8.1
343	gb\|AC123034.5\| Mus musculus BAC clone RP24-484E17 from chromosom...	40	8.1
344	gb\|AC123925.4\| Mus musculus BAC clone RP24-292N2 from chromosome...	40	8.1
345	gb\|AC079316.15\| Homo sapiens 12 BAC RP11-43D4 (Roswell Park Canc...	40	8.1
346	gb\|AC010178.40\| Homo sapiens 12 BAC RP11-303O9 (Roswell Park Can...	40	8.1
347	gb\|AC127253.3\| Mus musculus BAC clone RP24-281H12 from chromosom...	40	8.1
348	emb\|CR854834.11\| Zebrafish DNA sequence from clone DKEYP-92B10 i...	40	8.1
349	gb\|AC121809.3\| Mus musculus BAC clone RP23-451B23 from chromosom...	40	8.1
350	gb\|AC073864.29\| Homo sapiens 12 BAC RP11-227B21 (Roswell Park Ca...	40	8.1
351	gb\|AC122372.4\| Mus musculus BAC clone RP23-463P4 from chromosome...	40	8.1
352	gb\|AC121856.3\| Mus musculus BAC clone RP24-97G6 from chromosome ...	40	8.1
353	gb\|AC087386.7\| Homo sapiens chromosome 15, clone RP11-173D3, com...	40	8.1
354	gb\|AC124534.4\| Mus musculus BAC clone RP23-316G7 from chromosome...	40	8.1
355	emb\|BX664703.21\| Zebrafish DNA sequence from clone DKEYP-74A8 in...	40	8.1
356	emb\|CR450787.6\| Zebrafish DNA sequence from clone CH211-222O17 i...	40	8.1
357	gb\|AC068531.9\| Homo sapiens chromosome 17, clone RP11-463M16, co...	40	8.1
358	gb\|AC128739.4\| Mus musculus BAC clone RP24-168G14 from chromosom...	40	8.1
359	gb\|AC087430.3\| Homo sapiens chromosome 3 clone RP11-242C8 map 3p...	40	8.1
360	gb\|AC112793.5\| Mus musculus BAC clone RP23-410D16 from chromosom...	40	8.1
361	gb\|AC126674.3\| Mus musculus BAC clone RP23-364B6 from chromosome...	40	8.1
362	gb\|AC126263.4\| Mus musculus BAC clone RP23-359P12 from chromosom...	40	8.1
363	gb\|AC127335.4\| Mus musculus BAC clone RP23-150G24 from 8, comple...	40	8.1
364	gb\|AC124765.2\| Mus musculus BAC clone RP23-197D9 from 2, complet...	40	8.1
365	gb\|AC122248.5\| Mus musculus BAC clone RP23-156N18 from 7, comple...	40	8.1
366	gb\|AC124170.3\| Mus musculus BAC clone RP23-155H5 from 8, complet...	40	8.1
367	gb\|AC123057.4\| Mus musculus BAC clone RP23-184N6 from 3, complet...	40	8.1
368	emb\|CR792439.12\| Zebrafish DNA sequence from clone DKEYP-100A1 i...	40	8.1
369	gb\|AC124551.4\| Mus musculus BAC clone RP23-217K11 from 16, compl...	40	8.1
370	gb\|AC114919.5\| Mus musculus BAC clone RP23-102A8 from 18, comple...	40	8.1
371	gb\|AC124752.4\| Mus musculus BAC clone RP23-283G18 from 13, compl...	40	8.1
372	gb\|AC122807.3\| Mus musculus BAC clone RP23-297H3 from 8, complet...	40	8.1
373	emb\|CR382290.16\| Zebrafish DNA sequence from clone CH211-236D22 ...	40	8.1
374	emb\|CR555294.10\| Zebrafish DNA sequence from clone CH211-169P4 i...	40	8.1
375	gb\|AC122312.3\| Mus musculus BAC clone RP23-298K16 from 19, compl...	40	8.1
376	emb\|CR376783.22\| Zebrafish DNA sequence from clone DKEY-41N20 in...	40	8.1
377	emb\|BX890551.14\| Zebrafish DNA sequence from clone CH211-232K18,...	40	8.1
378	gb\|AC117199.3\| Mus musculus BAC clone RP23-134L22 from 10, compl...	40	8.1
379	gb\|AC112151.3\| Mus musculus BAC clone RP24-86M8 from 2, complete...	40	8.1
380	gb\|AC121859.2\| Mus musculus BAC clone RP24-104F15 from 6, comple...	40	8.1
381	gb\|AC117249.3\| Mus musculus BAC clone RP24-347M10 from 8, comple...	40	8.1
382	gb\|AC122048.2\| Mus musculus BAC clone RP24-456G2 from 2, complet...	40	8.1
383	gb\|AC098739.3\| Mus musculus BAC clone RP23-122G2 from 6, complet...	40	8.1
384	gb\|AC138228.10\| Mus musculus chromosome 17, clone RP23-304G12, c...	40	8.1
385	emb\|CR693293.2\|CNS0FXW9 Tetraodon nigroviridis full-length cDNA	40	8.1
386	gb\|AC017000.5\| Homo sapiens BAC clone RP11-42B7 from 7, complete...	40	8.1
387	gb\|AC093655.4\| Homo sapiens BAC clone RP11-424F6 from 7, complet...	40	8.1
388	gb\|AC073330.6\| Homo sapiens BAC clone RP11-409J21 from 7, comple...	40	8.1
389	gb\|AC011899.5\| Homo sapiens BAC clone RP11-452C13 from 7, comple...	40	8.1
390	gb\|AC074389.8\| Homo sapiens BAC clone RP11-510K8 from 7, complet...	40	8.1
391	gb\|AC021218.9\| Homo sapiens BAC clone RP11-525O1 from 7, complet...	40	8.1
392	gb\|AC073216.7\| Homo sapiens BAC clone RP11-521C10 from 7, comple...	40	8.1
393	gb\|AC073424.8\| Homo sapiens BAC clone RP11-653O17 from 7, comple...	40	8.1
394	gb\|AC099654.5\| Homo sapiens BAC clone RP11-1217F2 from 7, comple...	40	8.1
395	gb\|AC005099.2\| Homo sapiens BAC clone CTA-351J1 from 7, complete...	40	8.1
396	gb\|AC091685.4\| Homo sapiens BAC clone RP11-165H4 from 7, complet...	40	8.1
397	gb\|AC116128.15\| Mus musculus chromosome 19, clone RP23-95H3, com...	40	8.1
398	gb\|AC007030.3\| Homo sapiens PAC clone RP5-1112I4 from 7, complet...	40	8.1
399	gb\|AC007128.2\| Homo sapiens PAC clone RP4-594A5 from 7, complete...	40	8.1
400	gb\|AC006003.4\| Homo sapiens PAC clone RP4-782K24 from 7, complet...	40	8.1
401	emb\|CR665598.2\|CNS0FCJO Tetraodon nigroviridis full-length cDNA	40	8.1
402	gb\|AC115751.6\| Mus musculus chromosome 1, clone RP23-16I21, comp...	40	8.1
403	gb\|AC113301.7\| Mus musculus chromosome 8, clone RP23-430G7, comp...	40	8.1
404	gb\|AC152503.5\| Mus musculus BAC clone RP23-190G10 from chromosom...	40	8.1
405	gb\|AC104884.10\| Mus musculus chromosome 3, clone RP24-281E9, com...	40	8.1
406	gb\|AC120544.9\| Mus musculus chromosome 1, clone RP23-299N6, comp...	40	8.1
407	gb\|AC112683.10\| Mus musculus chromosome 17, clone RP23-332P1, co...	40	8.1
408	gb\|AC139214.12\| Mus musculus chromosome 17, clone RP23-345D6, co...	40	8.1
409	gb\|AC007861.5\| Homo sapiens chromosome 16 clone RP11-189E14, com...	40	8.1
410	emb\|BX927062.11\| Zebrafish DNA sequence from clone CH211-227N20 ...	40	8.1
411	emb\|CR759881.16\| Zebrafish DNA sequence from clone CH211-165K16 ...	40	8.1
412	gb\|AC159474.9\| Mus musculus 10 BAC RP23-28P17 (Roswell Park Canc...	40	8.1
413	gb\|AC138640.7\| Mus musculus chromosome 1, clone RP23-463G19, com...	40	8.1
414	emb\|BX901913.8\| Zebrafish DNA sequence from clone CH211-241E15 i...	40	8.1
415	gb\|AC159466.3\| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can...	40	8.1
416	emb\|AL163283.2\|HS21C083 Homo sapiens chromosome 21 segment HS21C083	40	8.1
417	gb\|AC138739.8\| Mus musculus chromosome 9, clone RP23-380A10, com...	40	8.1
418	gb\|AC151835.4\| Mus musculus BAC clone RP23-333J1 from chromosome...	40	8.1
419	gb\|AC166654.1\| Mus musculus BAC clone RP23-426B21 from chromosom...	40	8.1
420	gb\|AC110225.5\| Mus musculus chromosome 7, clone RP24-324L10, com...	40	8.1
421	emb\|BX927158.14\| Zebrafish DNA sequence from clone DKEY-106K1 in...	40	8.1
422	emb\|CR361556.8\| Zebrafish DNA sequence from clone DKEY-97G1 in l...	40	8.1
423	emb\|CR356222.24\| Zebrafish DNA sequence from clone DKEY-103J14 i...	40	8.1
424	emb\|BX537131.17\| Zebrafish DNA sequence from clone CH211-266K2 i...	40	8.1
425	emb\|BX248386.35\| Zebrafish DNA sequence from clone CH211-231M12,...	40	8.1
426	gb\|AC103576.8\| Rattus norvegicus 12 BAC CH230-63N13 (Children's ...	40	8.1
427	gb\|AC112342.14\| Rattus norvegicus 14 BAC CH230-253H12 (Children'...	40	8.1
428	gb\|AC118351.14\| Rattus norvegicus 1 BAC CH230-362O18 (Children's...	40	8.1
429	gb\|AC007607.6\| Homo sapiens chromosome 16 clone RP11-369H7, comp...	40	8.1
430	emb\|CR392025.7\| Zebrafish DNA sequence from clone CH211-248P17 i...	40	8.1
431	gb\|AC138364.8\| Mus musculus chromosome 7, clone RP23-243D10, com...	40	8.1
432	emb\|BX323862.18\| Zebrafish DNA sequence from clone DKEYP-97A5 in...	40	8.1
433	emb\|CR450835.4\| Zebrafish DNA sequence from clone CH211-179C12 i...	40	8.1
434	emb\|CR769786.9\| Zebrafish DNA sequence from clone DKEY-256I5 in ...	40	8.1
435	emb\|CR391930.9\| Zebrafish DNA sequence from clone CH211-154B16 i...	40	8.1
436	emb\|AL445199.37\| Human DNA sequence from clone RP13-439H18 on ch...	40	8.1
437	emb\|CR376844.12\| Zebrafish DNA sequence from clone DKEYP-51B7 in...	40	8.1
438	emb\|AL589702.8\| Human DNA sequence from clone RP5-907A6 on chrom...	40	8.1
439	emb\|Z97192.2\|HS29C18 Human DNA sequence from clone RP1-29C18 on ...	40	8.1
440	emb\|AL953854.21\| Human DNA sequence from clone RP11-211P14 on ch...	40	8.1
441	emb\|BX004827.18\| Human DNA sequence from clone RP13-391G2 on chr...	40	8.1
442	emb\|AL732314.18\| Human DNA sequence from clone RP13-465B17 on ch...	40	8.1
443	emb\|Z83846.1\|HS415G2 Human DNA sequence from clone CTA-415G2 on ...	40	8.1
444	emb\|Z82248.1\|HSN44A4 Human DNA sequence from clone LL22NC03-44A4...	40	8.1
445	emb\|BX649443.16\| Human DNA sequence from clone CTD-2589D3 on chr...	40	8.1
446	emb\|BX470150.13\| Zebrafish DNA sequence from clone DKEY-164K14 i...	40	8.1
447	emb\|BX927063.5\| Human DNA sequence from clone CITF22-118E8 on ch...	40	8.1
448	emb\|BX664730.2\| Human DNA sequence from clone RP11-118H15 on chr...	40	8.1
449	emb\|AL807752.10\| Human DNA sequence from clone RP11-229P13 on ch...	40	8.1
450	emb\|BX322234.7\| Human DNA sequence from clone XXyac-65C7_A on ch...	40	8.1
451	emb\|AL954685.6\| Human DNA sequence from clone RP11-237M21 on chr...	40	8.1
452	emb\|AL953883.5\| Human DNA sequence from clone RP11-246P17 on chr...	40	8.1
453	emb\|AL672277.20\| Human DNA sequence from clone RP11-309M23 on ch...	40	8.1
454	emb\|AL645924.13\| Human DNA sequence from clone RP11-503N18 on ch...	40	8.1
455	emb\|AL691415.17\| Human DNA sequence from clone RP11-172A6 on chr...	40	8.1
456	emb\|AL606510.10\| Human DNA sequence from clone RP11-435D11 on ch...	40	8.1
457	emb\|AL591890.31\| Human DNA sequence from clone RP11-54A22 on chr...	40	8.1
458	emb\|AL592309.24\| Human DNA sequence from clone RP11-293F5 on chr...	40	8.1
459	emb\|AL596210.20\| Human DNA sequence from clone RP11-92O17 on chr...	40	8.1
460	emb\|AL591502.10\| Human DNA sequence from clone RP11-199C17 on ch...	40	8.1
461	emb\|AL591415.9\| Human DNA sequence from clone RP11-520L11 on chr...	40	8.1
462	emb\|AL596452.2\| Human DNA sequence from clone RP11-776J12 on chr...	40	8.1
463	emb\|AL590235.23\| Human DNA sequence from clone RP11-529E10 on ch...	40	8.1
464	emb\|AL591122.20\| Human DNA sequence from clone RP11-415K20 on ch...	40	8.1
465	emb\|AL589733.20\| Human DNA sequence from clone RP11-164L23 on ch...	40	8.1
466	emb\|AL591063.6\| Human DNA sequence from clone RP11-535K1 on chro...	40	8.1
467	emb\|AL513343.22\| Human DNA sequence from clone RP11-90O23 on chr...	40	8.1
468	gb\|AC107742.10\| Mus musculus chromosome 15, clone RP23-331D7, co...	40	8.1
469	emb\|AL513164.13\| Human DNA sequence from clone RP11-400P17 on ch...	40	8.1
470	emb\|AL451164.13\| Human DNA sequence from clone RP11-298E9 on chr...	40	8.1
471	emb\|AL513324.9\| Human DNA sequence from clone RP11-355F22 on chr...	40	8.1
472	emb\|AL451107.6\| Human DNA sequence from clone RP11-14C22 on chro...	40	8.1
473	emb\|AL583784.3\| Human DNA sequence from clone RP11-442I9 on chro...	40	8.1
474	emb\|AL445235.30\| Human DNA sequence from clone RP1-65J11 on chro...	40	8.1
475	emb\|AL445931.29\| Human DNA sequence from clone RP11-374P20 on ch...	40	8.1
476	emb\|AL445543.20\| Human DNA sequence from clone RP11-4H20 on chro...	40	8.1
477	emb\|AL450345.6\| Human DNA sequence from clone RP11-300M24 on chr...	40	8.1
478	emb\|AL445263.6\| Human DNA sequence from clone RP11-227B14 on chr...	40	8.1
479	emb\|AL390994.30\| Human DNA sequence from clone RP11-190J18 on ch...	40	8.1
480	emb\|AL359963.29\| Human DNA sequence from clone RP11-18A3 on chro...	40	8.1
481	emb\|AL359815.26\| Human DNA sequence from clone RP11-63N8 on chro...	40	8.1
482	emb\|AL390236.21\| Human DNA sequence from clone RP11-380J17 on ch...	40	8.1
483	emb\|AL389916.15\| Human DNA sequence from clone RP11-470J18 on ch...	40	8.1
484	emb\|AL391097.13\| Human DNA sequence from clone RP11-15M15 on chr...	40	8.1
485	gb\|AF491780.1\| Homo sapiens neuregulin 1 (NRG1) gene, partial cd...	40	8.1
486	emb\|AL357934.29\| Human DNA sequence from clone RP11-565P9 on chr...	40	8.1
487	gb\|AC131572.4\| Homo sapiens chromosome 11, clone RP11-496I9, com...	40	8.1
488	gb\|DQ450324.1\| Drosophila melanogaster isolate tu1402102317 loze...	40	8.1
489	gb\|DQ450323.1\| Drosophila melanogaster isolate tu1402102316 loze...	40	8.1
490	gb\|DQ450322.1\| Drosophila melanogaster isolate tu1402102314 loze...	40	8.1
491	gb\|DQ450320.1\| Drosophila melanogaster isolate tu1402102310 loze...	40	8.1
492	gb\|DQ450319.1\| Drosophila melanogaster isolate bl3886 lozenge pr...	40	8.1
493	gb\|DQ450318.1\| Drosophila melanogaster isolate bl3875 lozenge pr...	40	8.1
494	gb\|DQ450317.1\| Drosophila melanogaster isolate bl3870 lozenge pr...	40	8.1
495	gb\|DQ450316.1\| Drosophila melanogaster isolate bl3864 lozenge pr...	40	8.1
496	gb\|DQ450315.1\| Drosophila melanogaster isolate bl3852 lozenge pr...	40	8.1
497	gb\|DQ450314.1\| Drosophila melanogaster isolate bl3844 lozenge pr...	40	8.1
498	gb\|DQ450313.1\| Drosophila melanogaster isolate bl3841 lozenge pr...	40	8.1
499	gb\|DQ450312.1\| Drosophila melanogaster isolate bl3839 lozenge pr...	40	8.1
500	gb\|DQ450311.1\| Drosophila melanogaster isolate bl1 lozenge prote...	40	8.1

>gb|BT016572.1| Zea mays clone Contig405 mRNA sequence
          Length = 1144

 Score =  230 bits (116), Expect = 4e-57
 Identities = 209/240 (87%)
 Strand = Plus / Plus

                                                                       
Query: 164 cggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctgg 223
           |||||||||||||||||||||||||| |||||||||||||||| ||||||| ||| ||||
Sbjct: 34  cggcggcgctcgcggtgacggacgaggtggccctgccgatccgggcggtgggggatctgg 93

                                                                       
Query: 224 cggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcg 283
           |||||||||||| |||||||||||||||||||| ||||||||| ||||||||  ||||||
Sbjct: 94  cggccgccgccgaggtctcgcgggaggaggtcgccgtcatcacccagtgcgcggcgctcg 153

                                                                       
Query: 284 gtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcataaaaaatg 343
           ||||||||||||||||||| || || || |  ||| | |||||| | | ||| ||||| |
Sbjct: 154 gtgggaagttgccttttgaagatgcatcagctggtgcggttcttgcagccattaaaaacg 213

                                                                       
Query: 344 tggagagctttggggataagttggttgctgaaattagccgagtgctgaaagctggtggaa 403
           |||| |||||  ||||  | |||||||||||||| || || |||||||||||||||||||
Sbjct: 214 tggaaagcttcagggagcaattggttgctgaaatcaggcgggtgctgaaagctggtggaa 273



 Score =  115 bits (58), Expect = 2e-22
 Identities = 103/118 (87%)
 Strand = Plus / Plus

                                                                       
Query: 438 tcagaagccaaacaattatatcgagcgccagctactcatgggtggttttgttgaagtgca 497
           ||||||||| |||| | |||| |||||| || |||| |||||||| |||| |||||||||
Sbjct: 308 tcagaagccgaacactgatattgagcgcaagttactgatgggtggatttgctgaagtgca 367

                                                                     
Query: 498 agcttctgctacaagctcgcaggatagcgtgcaatctgttaccatcaaggcaaagaag 555
           | |||||||| ||| |||||||||||||||||||||||||||  | ||||||||||||
Sbjct: 368 atcttctgctgcaaactcgcaggatagcgtgcaatctgttacagttaaggcaaagaag 425

to top

>ref|XM_474324.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  204 bits (103), Expect = 2e-49
 Identities = 163/183 (89%)
 Strand = Plus / Plus

                                                                       
Query: 153 ggcgacggctgcggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggt 212
           ||||||||  |||| ||||||||||||||||||||| |||||| ||||| | ||||||||
Sbjct: 6   ggcgacggtggcggaggcgctcgcggtgacggacgaactggccttgccgcttcgcgcggt 65

                                                                       
Query: 213 ggcggacctggcggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtg 272
           || ||| |||||||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 66  gggggatctggcggccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtg 125

                                                                       
Query: 273 cgccacgctcggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgt 332
           |||| |||| ||||||||||| ||||||||||| || || || |||||||||||| ||||
Sbjct: 126 cgcctcgcttggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgt 185

              
Query: 333 cat 335
           |||
Sbjct: 186 cat 188



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 96/112 (85%)
 Strand = Plus / Plus

                                                                       
Query: 484 tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttaccatc 543
           |||||||| ||||||||||||||| |||| || |||||||||| ||| |||||||| || 
Sbjct: 331 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttactatt 390

                                                               
Query: 544 aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
           ||||||||||||   || |||||  ||||||| ||||||||||| |||||||
Sbjct: 391 aaggcaaagaaggtctcttggagcttgggctcttccttccccctcaagaaag 442

to top

>dbj|AK102124.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033084O13, full
           insert sequence
          Length = 1379

 Score =  204 bits (103), Expect = 2e-49
 Identities = 163/183 (89%)
 Strand = Plus / Plus

                                                                       
Query: 153 ggcgacggctgcggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggt 212
           ||||||||  |||| ||||||||||||||||||||| |||||| ||||| | ||||||||
Sbjct: 85  ggcgacggtggcggaggcgctcgcggtgacggacgaactggccttgccgcttcgcgcggt 144

                                                                       
Query: 213 ggcggacctggcggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtg 272
           || ||| |||||||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 145 gggggatctggcggccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtg 204

                                                                       
Query: 273 cgccacgctcggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgt 332
           |||| |||| ||||||||||| ||||||||||| || || || |||||||||||| ||||
Sbjct: 205 cgcctcgcttggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgt 264

              
Query: 333 cat 335
           |||
Sbjct: 265 cat 267



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 96/112 (85%)
 Strand = Plus / Plus

                                                                       
Query: 484 tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttaccatc 543
           |||||||| ||||||||||||||| |||| || |||||||||| ||| |||||||| || 
Sbjct: 410 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttactatt 469

                                                               
Query: 544 aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
           ||||||||||||   || |||||  ||||||| ||||||||||| |||||||
Sbjct: 470 aaggcaaagaaggtctcttggagcttgggctcttccttccccctcaagaaag 521

to top

>ref|XM_474393.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 795

 Score =  202 bits (102), Expect = 9e-49
 Identities = 153/170 (90%)
 Strand = Plus / Plus

                                                                       
Query: 166 gcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctggcg 225
           |||||||||||||||||||||||||||||  ||||| |||||||||||| ||| ||||||
Sbjct: 16  gcggcgctcgcggtgacggacgagctggcgttgccgctccgcgcggtgggggatctggcg 75

                                                                       
Query: 226 gccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcggt 285
           |||||||| ||| |||||||||||||||| || |||||||||||||||||| |||| |||
Sbjct: 76  gccgccgcggggttctcgcgggaggaggtggtggtcatcacgcagtgcgcctcgcttggt 135

                                                             
Query: 286 gggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
           |||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 136 gggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 185



 Score =  103 bits (52), Expect = 6e-19
 Identities = 97/112 (86%)
 Strand = Plus / Plus

                                                                       
Query: 484 tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttaccatc 543
           |||||||| ||||||||||||||| |||| || |||||||||| ||| |||||||| || 
Sbjct: 328 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttactatt 387

                                                               
Query: 544 aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
           ||||||||||||   || ||||| |||||||| ||||||||||| |||||||
Sbjct: 388 aaggcaaagaaggtctcttggagcatgggctcttccttccccctcaagaaag 439

to top

>gb|AY110043.1| Zea mays CL5496_1 mRNA sequence
          Length = 1258

 Score =  194 bits (98), Expect = 2e-46
 Identities = 202/240 (84%)
 Strand = Plus / Plus

                                                                       
Query: 164 cggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctgg 223
           |||||||||||||||||||||||||| |||||||||||||||| |||||     | ||||
Sbjct: 74  cggcggcgctcgcggtgacggacgaggtggccctgccgatccgggcggtnnnnnatctgg 133

                                                                       
Query: 224 cggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcg 283
           |||||||||||| |||||||||||||||||||| ||||||||| ||||||||  ||||||
Sbjct: 134 cggccgccgccgaggtctcgcgggaggaggtcgccgtcatcacccagtgcgcggcgctcg 193

                                                                       
Query: 284 gtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcataaaaaatg 343
           ||||||||||||||||||| || || || || ||| | |||||| | |||||       |
Sbjct: 194 gtgggaagttgccttttgaagatgcatcagttggtgcggttcttgcagtcattnnnnncg 253

                                                                       
Query: 344 tggagagctttggggataagttggttgctgaaattagccgagtgctgaaagctggtggaa 403
           |||| |||||  ||||  | |||||||||||||| || || |||||||||||||||||||
Sbjct: 254 tggaaagcttgagggagcaattggttgctgaaatcagtcgggtgctgaaagctggtggaa 313



 Score =  113 bits (57), Expect = 7e-22
 Identities = 132/157 (84%)
 Strand = Plus / Plus

                                                                       
Query: 438 tcagaagccaaacaattatatcgagcgccagctactcatgggtggttttgttgaagtgca 497
           ||||||||| |||| | | || |||||| || |||| |||||||| |||| |||||||||
Sbjct: 348 tcagaagccgaacactgaaattgagcgcaagttactgatgggtggatttgctgaagtgca 407

                                                                       
Query: 498 agcttctgctacaagctcgcaggatagcgtgcaatctgttaccatcaaggcaaagaagcc 557
           | |||||||| ||| |||||||||||||||||||||||||||  | |||||||||||| |
Sbjct: 408 atcttctgctgcaaactcgcaggatagcgtgcaatctgttacagttaaggcaaagaaggc 467

                                                
Query: 558 atcctggagtatgggctcatccttccccctgaagaaa 594
              |||||| |||||||| || || ||||| ||||||
Sbjct: 468 tagctggagcatgggctcttcttttccccttaagaaa 504

to top

>emb|AL732344.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0403D02, complete
             sequence
          Length = 138387

 Score =  170 bits (86), Expect = 3e-39
 Identities = 122/134 (91%)
 Strand = Plus / Plus

                                                                         
Query: 153   ggcgacggctgcggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggt 212
             ||||||||| |||||||||||||||||||||||||| |||||| ||||| | ||||||||
Sbjct: 80299 ggcgacggcggcggcggcgctcgcggtgacggacgaactggccttgccgcttcgcgcggt 80358

                                                                         
Query: 213   ggcggacctggcggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtg 272
             || ||| |||||||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 80359 gggggatctggcggccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtg 80418

                           
Query: 273   cgccacgctcggtg 286
             |||| |||| ||||
Sbjct: 80419 cgcctcgcttggtg 80432



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                         
Query: 451   aattatatcgagcgccagctactcatgggtggttttgttgaagtgcaagcttctgctaca 510
             |||| ||| |||||| |||||||  | || || |||||||| ||||||||||||||| ||
Sbjct: 81309 aattctattgagcgcaagctactgttaggaggatttgttgacgtgcaagcttctgctgca 81368

                          
Query: 511   agctcgcaggata 523
             || ||||||||||
Sbjct: 81369 agttcgcaggata 81381



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 283   ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
             ||||||||||||||||||| ||| || || || |||||||||||| |||||||
Sbjct: 81068 ggtgggaagttgccttttgctgatgcatcagttggttctgttcttgctgtcat 81120



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 544   aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
             |||||||||||| | || ||||| |||||||| ||||||||||| |||||||
Sbjct: 81481 aaggcaaagaaggcctcttggagcatgggctcttccttccccctcaagaaag 81532

to top

>emb|AL606457.3|OSJN00002 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05,
             complete sequence
          Length = 164943

 Score =  155 bits (78), Expect = 2e-34
 Identities = 120/134 (89%)
 Strand = Plus / Plus

                                                                         
Query: 153   ggcgacggctgcggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggt 212
             ||||||||  |||| ||||||||||||||||||||| |||||| ||||| | ||||||||
Sbjct: 76466 ggcgacggtggcggaggcgctcgcggtgacggacgaactggccttgccgcttcgcgcggt 76525

                                                                         
Query: 213   ggcggacctggcggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtg 272
             || ||| |||||||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 76526 gggggatctggcggccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtg 76585

                           
Query: 273   cgccacgctcggtg 286
             |||| |||| ||||
Sbjct: 76586 cgcctcgcttggtg 76599



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                     
Query: 484   tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
             |||||||| ||||||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 77520 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttac 77575



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 283   ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
             ||||||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 77245 ggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 77297



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                 
Query: 544   aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
             ||||||||||||   || |||||  ||||||| ||||||||||| |||||||
Sbjct: 77658 aaggcaaagaaggtctcttggagcttgggctcttccttccccctcaagaaag 77709

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  155 bits (78), Expect = 2e-34
 Identities = 120/134 (89%)
 Strand = Plus / Plus

                                                                            
Query: 153      ggcgacggctgcggcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggt 212
                ||||||||  |||| ||||||||||||||||||||| |||||| ||||| | ||||||||
Sbjct: 34458981 ggcgacggtggcggaggcgctcgcggtgacggacgaactggccttgccgcttcgcgcggt 34459040

                                                                            
Query: 213      ggcggacctggcggccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtg 272
                || ||| |||||||||||||| |||||||||||||||||||| || ||||||||||||||
Sbjct: 34459041 gggggatctggcggccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtg 34459100

                              
Query: 273      cgccacgctcggtg 286
                |||| |||| ||||
Sbjct: 34459101 cgcctcgcttggtg 34459114



 Score =  153 bits (77), Expect = 8e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                            
Query: 166      gcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctggcg 225
                |||||||||||||||||||||||||||||  ||||| |||||||||||| ||| ||||||
Sbjct: 34858017 gcggcgctcgcggtgacggacgagctggcgttgccgctccgcgcggtgggggatctggcg 34857958

                                                                            
Query: 226      gccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcggt 285
                |||||||| ||| |||||||||||||||| || |||||||||||||||||| |||| |||
Sbjct: 34857957 gccgccgcggggttctcgcgggaggaggtggtggtcatcacgcagtgcgcctcgcttggt 34857898

                 
Query: 286      g 286
                |
Sbjct: 34857897 g 34857897



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                        
Query: 484      tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
                |||||||| ||||||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 34856973 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttac 34856918



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                        
Query: 484      tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
                |||||||| ||||||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 34460035 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttac 34460090



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                     
Query: 283      ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
                ||||||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 34857248 ggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 34857196



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                     
Query: 283      ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
                ||||||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 34459760 ggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 34459812



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                    
Query: 544      aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
                ||||||||||||   || ||||| |||||||| ||||||||||| |||||||
Sbjct: 34856835 aaggcaaagaaggtctcttggagcatgggctcttccttccccctcaagaaag 34856784



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                    
Query: 544      aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
                ||||||||||||   || |||||  ||||||| ||||||||||| |||||||
Sbjct: 34460173 aaggcaaagaaggtctcttggagcttgggctcttccttccccctcaagaaag 34460224

to top

>emb|AL606641.3|OSJN00074 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06,
             complete sequence
          Length = 148023

 Score =  153 bits (77), Expect = 8e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                         
Query: 166   gcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctggcg 225
             |||||||||||||||||||||||||||||  ||||| |||||||||||| ||| ||||||
Sbjct: 64130 gcggcgctcgcggtgacggacgagctggcgttgccgctccgcgcggtgggggatctggcg 64071

                                                                         
Query: 226   gccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcggt 285
             |||||||| ||| |||||||||||||||| || |||||||||||||||||| |||| |||
Sbjct: 64070 gccgccgcggggttctcgcgggaggaggtggtggtcatcacgcagtgcgcctcgcttggt 64011

              
Query: 286   g 286
             |
Sbjct: 64010 g 64010



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 484   tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
             |||||||| ||||||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 63086 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttac 63031



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 283   ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
             ||||||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 63361 ggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 63309



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 544   aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
             ||||||||||||   || ||||| |||||||| ||||||||||| |||||||
Sbjct: 62948 aaggcaaagaaggtctcttggagcatgggctcttccttccccctcaagaaag 62897

to top

>emb|AL732352.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0124B04, complete
             sequence
          Length = 115564

 Score =  153 bits (77), Expect = 8e-34
 Identities = 110/121 (90%)
 Strand = Plus / Minus

                                                                         
Query: 166   gcggcgctcgcggtgacggacgagctggccctgccgatccgcgcggtggcggacctggcg 225
             |||||||||||||||||||||||||| ||  ||||| |||||||||||| ||| ||||||
Sbjct: 37663 gcggcgctcgcggtgacggacgagctagcgttgccgctccgcgcggtgggggatctggcg 37604

                                                                         
Query: 226   gccgccgccggggtctcgcgggaggaggtcgtcgtcatcacgcagtgcgccacgctcggt 285
             |||||||| |||||||||||||||||||| || |||||||||||||||||| |||| |||
Sbjct: 37603 gccgccgcgggggtctcgcgggaggaggtggtggtcatcacgcagtgcgcctcgcttggt 37544

              
Query: 286   g 286
             |
Sbjct: 37543 g 37543



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 484   tttgttgaagtgcaagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
             |||||||| ||||||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 36619 tttgttgacgtgcaagcttctgctgcaagttcccaggatagcgagcattctgttac 36564



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 283   ggtgggaagttgccttttgatgacgcgtccgtgggttctgttctttctgtcat 335
             ||||||||||| ||||||||||| || || || |||||||||||| |||||||
Sbjct: 36894 ggtgggaagttaccttttgatgatgcatcagttggttctgttcttgctgtcat 36842



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                 
Query: 544   aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
             ||||||||||||   || ||||| |||||||| ||||||||||| |||||||
Sbjct: 36481 aaggcaaagaaggtctcttggagcatgggctcttccttccccctcaagaaag 36430

to top

>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete sequence
          Length = 225829

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||||||||||
Sbjct: 30220 atccatcaacccatccatccatcc 30243

to top

>emb|CR936500.10| Zebrafish DNA sequence from clone DKEY-274N8 in linkage group 3,
             complete sequence
          Length = 86479

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| ||||||||||||||||||||
Sbjct: 54337 atccatccacccatccatccatccgttt 54310



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| | ||||||||||||||||||
Sbjct: 54612 atccatccatccatccatccatccgttt 54585

to top

>emb|CR559944.12| Zebrafish DNA sequence from clone CH211-10D19 in linkage group 13,
             complete sequence
          Length = 180933

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||||||||||
Sbjct: 75405 atccatcaacccatccatccatcc 75382



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 4     tccatcaacccatccatccatcc 26
             |||||||||||||||||||||||
Sbjct: 73677 tccatcaacccatccatccatcc 73655



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     atcaacccatccatccatcc 26
             ||||||||||||||||||||
Sbjct: 75196 atcaacccatccatccatcc 75177

to top

>emb|BX005211.21| Zebrafish DNA sequence from clone CH211-128A7 in linkage group 14,
             complete sequence
          Length = 191332

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||||||||||
Sbjct: 84312 atccatcaacccatccatccatcc 84335

to top

>emb|CR392344.7| Zebrafish DNA sequence from clone CH211-239D11 in linkage group 20
             Contains the 3' end of the gene for a novel protein
             similar to vertebrate X-ray repair complementing defective
             repair in Chinese hamster cells 5 (double-strand-break
             rejoining; Ku autoantigen, 80kDa) (XRCC5), the gene for a
             novel protein similar to vertebrate SWI/SNF related matrix
             associated actin dependent regulator of chromatin
             subfamily a-like 1 (SMARCAL1), two novel genes and three
             CpG islands, complete sequence
          Length = 150882

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| ||||||||||||||||||||
Sbjct: 38857 atccatccacccatccatccatccgttt 38884



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| | ||||||||||||||||||
Sbjct: 39930 atccatccatccatccatccatccgttt 39957



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 39758 atccatccacccatccatccatcc 39781



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| |||||| |||||||||||||
Sbjct: 39224 atccatccacccatacatccatccgttt 39251

to top

>gb|AC126615.7| Homo sapiens 12 BAC RP11-129B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 67557

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||||||||||
Sbjct: 48723 atccatcaacccatccatccatcc 48700

to top

>gb|AC009093.10| Homo sapiens chromosome 16 clone RP11-426C22, complete sequence
          Length = 207997

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||||||||||||||||||
Sbjct: 128310 atccatcaacccatccatccatcc 128287



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 128576 atccatcaacccatccatcc 128557



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 128439 atccatcaacccatccatcc 128420

to top

>gb|AC060771.8| Homo sapiens chromosome 17, clone RP11-169I9, complete sequence
          Length = 138969

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 3     atccatcaacccatccatccatccgttt 30
             ||||||| ||||||||||||||||||||
Sbjct: 65119 atccatccacccatccatccatccgttt 65092

to top

>emb|BX323835.9| Zebrafish DNA sequence from clone DKEYP-22F6 in linkage group 14,
             complete sequence
          Length = 172378

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||||||||||
Sbjct: 78797 atccatcaacccatccatccatcc 78820

to top

>gb|AC138512.4| Homo sapiens chromosome 16 clone RP11-93B18, complete sequence
          Length = 159064

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||||||||||||||||||
Sbjct: 125508 atccatcaacccatccatccatcc 125531



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 125375 atccatcaacccatccatcc 125394



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 125238 atccatcaacccatccatcc 125257

to top

>gb|AC134312.3| Homo sapiens chromosome 16 clone RP11-863P13, complete sequence
          Length = 205610

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||||||||||||||||||
Sbjct: 165146 atccatcaacccatccatccatcc 165123



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 165416 atccatcaacccatccatcc 165397



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      atccatcaacccatccatcc 22
              ||||||||||||||||||||
Sbjct: 165279 atccatcaacccatccatcc 165260

to top

>emb|BX000984.7| Zebrafish DNA sequence from clone CH211-157C7, complete sequence
          Length = 160029

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 1     agatccatcaacccatccatccatccgtttta 32
             ||||||||| |||||||||||||||| |||||
Sbjct: 99147 agatccatccacccatccatccatccatttta 99116

to top

>emb|BX950195.14| Zebrafish DNA sequence from clone CH211-232M10 in linkage group 19,
              complete sequence
          Length = 149624

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||||||||||||||||||
Sbjct: 145998 atccatcaacccatccatccatcc 146021

to top

>emb|AL732354.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0901F07, complete
              sequence
          Length = 110682

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                  
Query: 544    aaggcaaagaagccatcctggagtatgggctcatccttccccctgaagaaag 595
              ||||||||||||   || ||||| |||||||| ||||||||||| |||||||
Sbjct: 110557 aaggcaaagaaggtctcttggagcatgggctcttccttccccctcaagaaag 110506



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 497    aagcttctgctacaagctcgcaggatagcgtgcaatctgttac 539
              ||||||||||| |||| || |||||||||| ||| ||||||||
Sbjct: 110682 aagcttctgctgcaagttcccaggatagcgagcattctgttac 110640

to top

>gb|AC115341.6| Rattus norvegicus 3 BAC CH230-248O1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 237425

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 4      tccatcaacccatccatccatcc 26
              |||||||||||||||||||||||
Sbjct: 158426 tccatcaacccatccatccatcc 158448



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 158733 atccatccacccatccatccatcc 158756

to top

>gb|AC148006.4| Mus musculus BAC clone RP23-298P21 from chromosome 19, complete
             sequence
          Length = 209327

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 13493 atccatcaacccatccatccatc 13471



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 13469 atccatcaatccatccatccatcc 13446

to top

>gb|AC121935.3| Mus musculus BAC clone RP24-207G22 from chromosome 19, complete
             sequence
          Length = 158540

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 73321 atccatcaacccatccatccatc 73343



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 73345 atccatcaatccatccatccatcc 73368

to top

>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16,
              complete sequence
          Length = 179375

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 3      atccatcaacccatccatccatccgttttac 33
              ||||||| | |||||||||||||||||||||
Sbjct: 176021 atccatccatccatccatccatccgttttac 175991

to top

>gb|AC123826.4| Mus musculus BAC clone RP24-97K3 from chromosome 8, complete sequence
          Length = 188704

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 95565 atccatcaacccatccatccatc 95543



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 3     atccatcaacccatccatccat 24
             ||||||||||||||||||||||
Sbjct: 95797 atccatcaacccatccatccat 95776



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 3     atccatcaacccatccatccat 24
             ||||||||||||||||||||||
Sbjct: 95717 atccatcaacccatccatccat 95696



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 3     atccatcaacccatccatccat 24
             ||||||||||||||||||||||
Sbjct: 95637 atccatcaacccatccatccat 95616

to top

>emb|CR931814.13| Zebrafish DNA sequence from clone DKEY-236E8 in linkage group 5, complete
              sequence
          Length = 155089

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 3      atccatcaacccatccatccatccgtt 29
              ||||||| |||||||||||||||||||
Sbjct: 111648 atccatccacccatccatccatccgtt 111674

to top

>emb|AL137850.12| Human DNA sequence from clone RP11-56P10 on chromosome 9q31.3-33.3
              Contains the 3' end of the gene for a novel C2H2 type zinc
              finger protein, the AMBP gene for
              alpha-1-microglobulin/bikunin precursor, the gene for a
              novel protein similar to mouse kinesin 12 (LOC113220) and
              two CpG islands, complete sequence
          Length = 125842

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 3      atccatcaacccatccatccatc 25
              |||||||||||||||||||||||
Sbjct: 116981 atccatcaacccatccatccatc 116959

to top

>emb|BX510998.12| Zebrafish DNA sequence from clone CH211-272L18 in linkage group 12,
             complete sequence
          Length = 148753

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 3     atccatcaacccatccatccatccgtt 29
             ||||||||| |||||||||||||||||
Sbjct: 12455 atccatcaatccatccatccatccgtt 12481



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     tccatcaacccatccatccatccgt 28
             ||||||||||||||||||| |||||
Sbjct: 15678 tccatcaacccatccatccgtccgt 15702

to top

>gb|AC119396.3| Homo sapiens chromosome 19 clone CTB-133G6, complete sequence
          Length = 72539

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 4     tccatcaacccatccatccatcc 26
             |||||||||||||||||||||||
Sbjct: 30040 tccatcaacccatccatccatcc 30018



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 4     tccatcaacccatccatccatc 25
             ||||||||||||||||||||||
Sbjct: 30385 tccatcaacccatccatccatc 30364

to top

>gb|AC157322.5| Mus musculus chromosome 19, clone RP23-241E11, complete sequence
          Length = 201134

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 3      atccatcaacccatccatccatc 25
              |||||||||||||||||||||||
Sbjct: 158602 atccatcaacccatccatccatc 158580



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 158578 atccatcaatccatccatccatcc 158555

to top

>gb|AC158800.6| Mus musculus 10 BAC RP23-435N6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190805

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 4      tccatcaacccatccatccatcc 26
              |||||||||||||||||||||||
Sbjct: 134899 tccatcaacccatccatccatcc 134877

to top

>gb|AC009041.10| Homo sapiens chromosome 16 clone RP11-161M6, complete sequence
          Length = 162342

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 3      atccatcaacccatccatccatc 25
              |||||||||||||||||||||||
Sbjct: 103824 atccatcaacccatccatccatc 103846



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 105021 atccatccacccatccatccatcc 105044



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 103502 atccatcaatccatccatccatcc 103525



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 5      ccatcaacccatccatccatccgt 28
              ||||||| ||||||||||||||||
Sbjct: 103049 ccatcaatccatccatccatccgt 103072

to top

>gb|AC105118.23| Homo sapiens chromosome 8, clone RP11-909N17, complete sequence
          Length = 179941

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 62352 atccatcaacccatccatccatc 62374

to top

>gb|AC008276.4| Homo sapiens BAC clone RP11-297I3 from 2, complete sequence
          Length = 208477

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 42467 atccatcaacccatccatccatc 42489

to top

>gb|AC098874.6| Homo sapiens BAC clone RP11-1299G23 from 2, complete sequence
          Length = 136367

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 3     atccatcaacccatccatccatccgtt 29
             ||||||| |||||||||||||||||||
Sbjct: 18948 atccatctacccatccatccatccgtt 18922

to top

>emb|BX001023.12| Zebrafish DNA sequence from clone CH211-233F10 in linkage group 5,
             complete sequence
          Length = 168064

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 3     atccatcaacccatccatccatccgtt 29
             ||||||| |||||||||||||||||||
Sbjct: 20799 atccatccacccatccatccatccgtt 20773

to top

>dbj|AP000879.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-805J14, complete
             sequence
          Length = 169725

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 44936 atccatcaacccatccatccatc 44914



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 3     atccatcaacccatccatccatc 25
             |||||||||||||||||||||||
Sbjct: 44800 atccatcaacccatccatccatc 44778



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 120827 atccatccacccatccatccatcc 120804

to top

>gb|AC144802.3| Mus musculus BAC clone RP24-222O23 from 10, complete sequence
          Length = 154807

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 4     tccatcaacccatccatccatcc 26
             |||||||||||||||||||||||
Sbjct: 10705 tccatcaacccatccatccatcc 10683

to top

>gb|AC005361.1| Homo sapiens chromosome 16, cosmid clone 352F10 (LANL), complete
            sequence
          Length = 35677

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 5    ccatcaacccatccatccatcc 26
            ||||||||||||||||||||||
Sbjct: 4666 ccatcaacccatccatccatcc 4687

to top

>emb|AL359960.23| Human DNA sequence from clone RP11-298K24 on chromosome 10, complete
             sequence
          Length = 69113

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 30868 atccatccacccatccatccatccgt 30893

to top

>emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on chromosome X, complete
              sequence
          Length = 115998

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 3      atccatcaacccatccatccatccgt 28
              ||||||||| ||||||||||||||||
Sbjct: 113389 atccatcaatccatccatccatccgt 113414

to top

>emb|AL591916.8| Human DNA sequence from clone RP11-168B8 on chromosome 1 Contains the
             5' end of a novel gene (FLJ36179), complete sequence
          Length = 159159

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 5     ccatcaacccatccatccatcc 26
             ||||||||||||||||||||||
Sbjct: 35958 ccatcaacccatccatccatcc 35979



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     catcaacccatccatccatcc 26
             |||||||||||||||||||||
Sbjct: 35868 catcaacccatccatccatcc 35888



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 35713 atccatcaatccatccatccatcc 35736

to top

>emb|AL137077.31| Human DNA sequence from clone RP11-11M20 on chromosome 20 Contains the
             5' end of the TAF4 gene for TAF4 RNA polymerase II (TATA
             box binding protein (TBP)-associated factor, 135 kDa), an
             RPL17 (ribosomal protein L17) pseudogene, the C20orf40
             gene for a novel protein similar to Pleurodeles waltlii
             RAP55 protein and two CpG islands, complete sequence
          Length = 126712

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 97660 atccatcgacccatccatccatccgt 97635



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 97780 atccatctacccatccatccatcc 97757

to top

>emb|AL137248.21| Human DNA sequence from clone RP11-316G23 on chromosome 13q12.1-12.3,
            complete sequence
          Length = 186343

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 5    ccatcaacccatccatccatcc 26
            ||||||||||||||||||||||
Sbjct: 8916 ccatcaacccatccatccatcc 8937

to top

>emb|AL137251.5| Human DNA sequence from clone RP1-141N5 on chromosome 6 Contains the 3'
             end of the gene for KIAA1913 protein, complete sequence
          Length = 122354

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 330   tgtcataaaaaatgtggagagctttg 355
             ||||||||||||||||||| ||||||
Sbjct: 38184 tgtcataaaaaatgtggagtgctttg 38209

to top

>emb|AL118522.32|HSDJ781B1 Human DNA sequence from clone RP4-781B1 on chromosome 20 Contains the
             5' end of a novel gene, the KCNK15 gene for potassium
             channel subfamily K member 15, a novel gene, the RIMS4
             gene for regulating synaptic membrane exocytosis 4 and
             three CpG islands, complete sequence
          Length = 107109

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 26342 atccatccacccatccatccatccgt 26367

to top

>emb|AL079339.11|HSJ906P16 Human DNA sequence from clone RP5-906P16 on chromosome 20q13.12-13.2
             Contains ESTs, STSs and GSSs, complete sequence
          Length = 86719

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 5     ccatcaacccatccatccatcc 26
             ||||||||||||||||||||||
Sbjct: 64465 ccatcaacccatccatccatcc 64444



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     catcaacccatccatccatcc 26
             |||||||||||||||||||||
Sbjct: 64389 catcaacccatccatccatcc 64369



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     catcaacccatccatccatcc 26
             |||||||||||||||||||||
Sbjct: 64286 catcaacccatccatccatcc 64266

to top

>gb|AC117945.2| Homo sapiens chromosome 1 clone RP4-614N24, complete sequence
          Length = 160557

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 5     ccatcaacccatccatccatcc 26
             ||||||||||||||||||||||
Sbjct: 45572 ccatcaacccatccatccatcc 45593



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30294 atccatccacccatccatccatcc 30271



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30158 atccatccacccatccatccatcc 30135

to top

>gb|AC016587.9| Homo sapiens chromosome 19 clone CTD-2632B17, complete sequence
          Length = 155221

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 61362 atccatccacccatccatccatccgt 61337



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 60248 atccatctacccatccatccatcc 60225

to top

>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 177941

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     agatccatcaacccatccatccatccgttt 30
             ||||||||| | ||||||||||||||||||
Sbjct: 30014 agatccatctatccatccatccatccgttt 30043

to top

>emb|BX470133.27| Zebrafish DNA sequence from clone DKEY-169N7 in linkage group 9, complete
              sequence
          Length = 178929

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 3      atccatcaacccatccatccat 24
              ||||||||||||||||||||||
Sbjct: 147886 atccatcaacccatccatccat 147907

to top

>emb|BX510911.10| Zebrafish DNA sequence from clone CH211-150K17 in linkage group 10,
             complete sequence
          Length = 140584

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||||| ||||||||||||||||
Sbjct: 93378 atccatcaatccatccatccatccgt 93353

to top

>gb|AC023708.4| Drosophila melanogaster X BAC RP98-12B22 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 175355

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      agatccatcaacccatccatccatccgttt 30
              ||||||||| | ||||||||||||||||||
Sbjct: 168172 agatccatctatccatccatccatccgttt 168201

to top

>gb|BC113744.1| Homo sapiens cDNA clone IMAGE:5762826, with apparent retained intron
          Length = 3296

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 1    agatccatcaacccatccatccatcc 26
            ||||||||| ||||||||||||||||
Sbjct: 2117 agatccatccacccatccatccatcc 2092

to top

>gb|AC037473.7|AC037473 Homo sapiens chromosome 18, clone CTD-2130O13, complete sequence
          Length = 126976

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 5     ccatcaacccatccatccatcc 26
             ||||||||||||||||||||||
Sbjct: 66177 ccatcaacccatccatccatcc 66156

to top

>dbj|AK037755.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A130047A17 product:hypothetical protein,
            full insert sequence
          Length = 1477

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 3    atccatcaacccatccatccatccgt 28
            ||||||| ||||||||||||||||||
Sbjct: 1311 atccatccacccatccatccatccgt 1286

to top

>emb|BX005074.10| Zebrafish DNA sequence from clone CH211-146J7 in linkage group 8,
              complete sequence
          Length = 153989

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 3      atccatcaacccatccatccatccgtttta 32
              ||||||| | ||||||||||||||||||||
Sbjct: 125823 atccatccatccatccatccatccgtttta 125794

to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 205     cgcgcggtggcggacctggcggccgc 230
               ||||||||||||||||| ||||||||
Sbjct: 1786549 cgcgcggtggcggacctcgcggccgc 1786574

to top

>gb|AC102738.9| Mus musculus chromosome 3, clone RP24-303G10, complete sequence
          Length = 166697

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 4     tccatcaacccatccatccatc 25
             ||||||||||||||||||||||
Sbjct: 61944 tccatcaacccatccatccatc 61923

to top

>emb|BX248418.16| Zebrafish DNA sequence from clone DKEY-181I3 in linkage group 20,
              complete sequence
          Length = 152757

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 3      atccatcaacccatccatccatccgt 28
              ||||||||| ||||||||||||||||
Sbjct: 110838 atccatcaatccatccatccatccgt 110863

to top

>emb|CR847568.13| Zebrafish DNA sequence from clone DKEYP-74C2 in linkage group 3,
            complete sequence
          Length = 173689

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 3    atccatcaacccatccatccatccgtttta 32
            ||||||| | ||||||||||||||||||||
Sbjct: 9596 atccatccatccatccatccatccgtttta 9625



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 3    atccatcaacccatccatccatccgtttt 31
            ||||||| | |||||||||||||||||||
Sbjct: 9912 atccatccatccatccatccatccgtttt 9940



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 3    atccatcaacccatccatccatccgtttt 31
            ||||||| | |||||||||||||||||||
Sbjct: 9751 atccatccatccatccatccatccgtttt 9779

to top

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
             sequence
          Length = 299943

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     agatccatcaacccatccatccatccgttt 30
             ||||||||| | ||||||||||||||||||
Sbjct: 71901 agatccatctatccatccatccatccgttt 71930

to top

>dbj|AP001711.1| Homo sapiens genomic DNA, chromosome 21q, section 55/105
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 3    atccatcaacccatccatccatccgt 28
            ||||||| ||||||||||||||||||
Sbjct: 7716 atccatccacccatccatccatccgt 7691

to top

>emb|CR848750.27| Zebrafish DNA sequence from clone RP71-4B23 in linkage group 15,
             complete sequence
          Length = 148714

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                               
Query: 3     atccatcaacccatccatccatccgttttaccat 36
             ||||||| | ||||||||||||||||||| ||||
Sbjct: 88459 atccatccatccatccatccatccgtttttccat 88426



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 88809 atccatccacccatccatccatcc 88786

to top

>emb|CR847947.14| Zebrafish DNA sequence from clone DKEY-56M16 in linkage group 7, complete
              sequence
          Length = 205682

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 3      atccatcaacccatccatccatccgt 28
              ||||||||| ||||||||||||||||
Sbjct: 167625 atccatcaatccatccatccatccgt 167650

to top

>dbj|AP000248.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:P289H18, complete sequence
          Length = 146847

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 89800 atccatccacccatccatccatccgt 89775

to top

>dbj|AP000210.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             f43D11-119B8, segment 8/12, complete sequence
          Length = 100000

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 3     atccatcaacccatccatccatccgt 28
             ||||||| ||||||||||||||||||
Sbjct: 20704 atccatccacccatccatccatccgt 20679

to top

>emb|AL596062.13| Mouse DNA sequence from clone RP23-284O21 on chromosome 11, complete
              sequence
          Length = 155151

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 3      atccatcaacccatccatccatccgt 28
              ||||||| ||||||||||||||||||
Sbjct: 152348 atccatccacccatccatccatccgt 152323

to top

>dbj|AP003501.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-664I21, complete
             sequence
          Length = 186971

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1     agatccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||||
Sbjct: 13975 agatccatccacccatccatccatcc 13950

to top

>gb|AY830944.1| Poecilia reticulata microsatellite Pre17 sequence
          Length = 327

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 3   atccatcaacccatccatccatccgtttt 31
           ||||||| |||||||||||||||| ||||
Sbjct: 245 atccatccacccatccatccatccatttt 273

to top

>gb|AC165953.3| Mus musculus BAC clone RP24-75N14 from chromosome 17, complete sequence
          Length = 224622

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     catcaacccatccatccatcc 26
             |||||||||||||||||||||
Sbjct: 73072 catcaacccatccatccatcc 73052

to top

>gb|AC139580.4| Mus musculus BAC clone RP23-110M15 from chromosome 13, complete sequence
          Length = 205480

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 6      catcaacccatccatccatcc 26
              |||||||||||||||||||||
Sbjct: 194229 catcaacccatccatccatcc 194209

to top

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 263     tcacgcagtgcgccacgctcg 283
               |||||||||||||||||||||
Sbjct: 2970940 tcacgcagtgcgccacgctcg 2970920

to top

>gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complete sequence
          Length = 114085

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 3     atccatcaacccatccatccatccg 27
             ||||||| |||||||||||||||||
Sbjct: 84110 atccatccacccatccatccatccg 84134



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 84434 atccatccacccatccatccatcc 84457



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 84306 atccatccacccatccatccatcc 84329

to top

>gb|AC025219.6| Homo sapiens chromosome 15, clone RP11-276M12, complete sequence
          Length = 144244

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 3     atccatcaacccatccatccatccgtttt 31
             ||||||| | |||||||||||||||||||
Sbjct: 90145 atccatccatccatccatccatccgtttt 90173

to top

>gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, complete sequence
          Length = 293695

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      gatccatcaacccatccatccatcc 26
              |||||||| ||||||||||||||||
Sbjct: 105304 gatccatccacccatccatccatcc 105280

to top

>gb|AC133088.3| Mus musculus BAC clone RP24-138O17 from chromosome 7, complete sequence
          Length = 144376

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 3     atccatcaacccatccatccatccgtttt 31
             ||||||| |||||||||||||||| ||||
Sbjct: 89311 atccatccacccatccatccatccatttt 89283

to top

>gb|AC129337.4| Mus musculus BAC clone RP23-123I14 from 1, complete sequence
          Length = 184705

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 3     atccatcaacccatccatccatccgttttacca 35
             ||||||| | |||||||||||||| ||||||||
Sbjct: 92085 atccatccatccatccatccatccattttacca 92117

to top

>emb|BX005297.22| Zebrafish DNA sequence from clone CH211-271B8 in linkage group 3,
              complete sequence
          Length = 156906

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 6      catcaacccatccatccatcc 26
              |||||||||||||||||||||
Sbjct: 105536 catcaacccatccatccatcc 105556

to top

>emb|CR318660.16| Zebrafish DNA sequence from clone CH211-149I8 in linkage group 21,
              complete sequence
          Length = 162045

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 6      catcaacccatccatccatcc 26
              |||||||||||||||||||||
Sbjct: 116393 catcaacccatccatccatcc 116373

to top

>emb|BX928753.10| Zebrafish DNA sequence from clone DKEY-5J3 in linkage group 17, complete
              sequence
          Length = 159225

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 4      tccatcaacccatccatccatccgt 28
              |||||||| ||||||||||||||||
Sbjct: 156470 tccatcaatccatccatccatccgt 156494

to top

>emb|CR762472.6| Zebrafish DNA sequence from clone DKEY-75G19 in linkage group 1,
             complete sequence
          Length = 176472

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||| ||||||||||||||||
Sbjct: 82869 gatccatccacccatccatccatcc 82893



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||| ||||||||||||||||||
Sbjct: 82758 atccaccaacccatccatccatcc 82781

to top

>emb|Z94162.1|HSN21F1 Human DNA sequence from clone LL22NC03-21F1 on chromosome 22, complete
             sequence
          Length = 39212

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 3     atccatcaacccatccatcca 23
             |||||||||||||||||||||
Sbjct: 35251 atccatcaacccatccatcca 35271



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 35387 atccatcaatccatccatccatcc 35410

to top

>emb|Z84480.1|HS418A9 Human DNA sequence from clone RP3-418A9 on chromosome 6q21 Contains a
             pseudogene similar to calponin proteins, the 5' part of
             gene KIAA1028 and a CpG island, complete sequence
          Length = 121424

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 438   tcagaagccaaacaattatat 458
             |||||||||||||||||||||
Sbjct: 32850 tcagaagccaaacaattatat 32870

to top

>emb|AL590989.15| Human DNA sequence from clone RP11-149P14 on chromosome 1 Contains a
             pseudogene similar to part of cytochrome b, the 5' end of
             a novel gene and a CpG island, complete sequence
          Length = 110121

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 194   ccctgccgatccgcgcggtgg 214
             |||||||||||||||||||||
Sbjct: 86516 ccctgccgatccgcgcggtgg 86496

to top

>emb|AL445933.32| Human DNA sequence from clone RP11-486B10 on chromosome 1 Contains the
             EDN2 gene for endothelin 2, the 3' end of the HIVEP3 gene
             for human immunodeficiency virus type I enhancer binding
             protein 3 and a novel gene, complete sequence
          Length = 154153

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||||| ||||||||||||||
Sbjct: 55304 gatccatcaatccatccatccatcc 55328

to top

>emb|AL353691.12| Human DNA sequence from clone RP5-1174J21 on chromosome Xp11.3-21.2
             Contains part of the CASK gene for
             calcium/calmodulin-dependent serine protein kinase (MAGUK
             family) and a ribosomal protein S15a (RPS15A) pseudogene,
             complete sequence
          Length = 106605

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 3     atccatcaacccatccatccatccgtttt 31
             ||||||| | |||||||||||||||||||
Sbjct: 35265 atccatccatccatccatccatccgtttt 35293

to top

>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the
              C20orf185 gene for the possible ortholog of potential
              ligand_binding protein RYA3 (Rat), the C20orf186 gene for
              the possible ortholog of potential ligand_binding protein
              RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm
              associated antigen 4-like, a novel gene, a FAM16AX (family
              with sequence similarity 16, member A, X-linked)
              pseudogene, the BPIL3 gene for
              bactericidal/permeability-increasing protein-like 3 and a
              CpG island, complete sequence
          Length = 129502

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 5      ccatcaacccatccatccatc 25
              |||||||||||||||||||||
Sbjct: 105293 ccatcaacccatccatccatc 105313



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||||||||||||| ||||
Sbjct: 105335 atccatcaacccatccatctatcc 105358

to top

>emb|AL008734.10|HS324M8 Human DNA sequence from clone RP3-324M8 on chromosome 1p36.2-36.3
            Contains the 5' end of the gene for a novel SPRY domain
            containing protein and a CpG island, complete sequence
          Length = 85116

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 2    gatccatcaacccatccatccatcc 26
            |||||||| ||||||||||||||||
Sbjct: 9430 gatccatccacccatccatccatcc 9454



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 9483 atccatccacccatccatccatcc 9506

to top

>emb|BX927328.10| Zebrafish DNA sequence from clone CH211-10M4 in linkage group 17,
             complete sequence
          Length = 197949

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     tccatcaacccatccatccatccgt 28
             |||||||| ||||||||||||||||
Sbjct: 85546 tccatcaatccatccatccatccgt 85570

to top

>emb|CR394542.5| Zebrafish DNA sequence from clone DKEY-91I10 in linkage group 9,
           complete sequence
          Length = 193811

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 547 gcaaagaagccatcctggagt 567
           |||||||||||||||||||||
Sbjct: 517 gcaaagaagccatcctggagt 497

to top

>emb|AL954821.10| Mouse DNA sequence from clone RP23-415G6 on chromosome 11, complete
             sequence
          Length = 97532

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 3     atccatcaacccatccatcca 23
             |||||||||||||||||||||
Sbjct: 26402 atccatcaacccatccatcca 26422

to top

>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete
              sequence
          Length = 180777

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 3      atccatcaacccatccatccatccgttttaccatccg 39
              ||||||| | ||||||||||||||||||  |||||||
Sbjct: 134011 atccatccatccatccatccatccgtttatccatccg 134047



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 133999 atccatccacccatccatccatcc 134022



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 133903 atccatccacccatccatccatcc 133926

to top

>emb|BX569794.8| Zebrafish DNA sequence from clone DKEYP-15B2 in linkage group 6,
             complete sequence
          Length = 162388

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||||| ||||||||||||||
Sbjct: 60851 gatccatcaatccatccatccatcc 60875

to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 217    gacctggcggccgccgccggggtctcgcg 245
              ||||||| |||||||||||| ||||||||
Sbjct: 887056 gacctggaggccgccgccggcgtctcgcg 887084

to top

>emb|BX957346.14| Zebrafish DNA sequence from clone CH211-117K16 in linkage group 25,
             complete sequence
          Length = 149598

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 4     tccatcaacccatccatccatccgt 28
             |||||||| ||||||||||||||||
Sbjct: 74905 tccatcaatccatccatccatccgt 74881

to top

>gb|AC011474.6| Homo sapiens chromosome 19 clone CTC-525D6, complete sequence
          Length = 194718

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 3      atccatcaacccatccatcca 23
              |||||||||||||||||||||
Sbjct: 148746 atccatcaacccatccatcca 148726



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 149989 atccatcaatccatccatccatcc 149966

to top

>gb|AC103976.6| Homo sapiens chromosome 15, clone RP11-121E15, complete sequence
          Length = 182826

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 3      atccatcaacccatccatccatccgtttt 31
              ||||||| | |||||||||||||||||||
Sbjct: 137367 atccatccatccatccatccatccgtttt 137339

to top

>dbj|AK142905.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930044H21 product:unclassifiable, full
            insert sequence
          Length = 4929

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 2    gatccatcaacccatccatccatcc 26
            |||||||| ||||||||||||||||
Sbjct: 3444 gatccatccacccatccatccatcc 3420

to top

>gb|AC091654.4| Homo sapiens BAC clone RP11-177C9 from 7, complete sequence
          Length = 116507

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 3     atccatcaacccatccatccatccg 27
             ||||||| |||||||||||||||||
Sbjct: 67320 atccatccacccatccatccatccg 67344

to top

>ref|XM_938154.1| PREDICTED: Homo sapiens patched domain containing 2 (PTCHD2), mRNA
          Length = 5652

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 194 ccctgccgatccgcgcggtgg 214
           |||||||||||||||||||||
Sbjct: 246 ccctgccgatccgcgcggtgg 226

to top

>ref|XM_052561.8| PREDICTED: Homo sapiens patched domain containing 2 (PTCHD2), mRNA
          Length = 5649

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 194 ccctgccgatccgcgcggtgg 214
           |||||||||||||||||||||
Sbjct: 243 ccctgccgatccgcgcggtgg 223

to top

>ref|XM_677679.1| PREDICTED: Danio rerio similar to CG32239-PA (LOC555224), partial
           mRNA
          Length = 1728

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 547 gcaaagaagccatcctggagt 567
           |||||||||||||||||||||
Sbjct: 563 gcaaagaagccatcctggagt 583

to top

>emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 in linkage group 2,
             complete sequence
          Length = 146757

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||| ||||||||||||||||
Sbjct: 30355 gatccatccacccatccatccatcc 30331

to top

>gb|AC091939.3| Homo sapiens chromosome 5 clone RP11-32D16, complete sequence
          Length = 190346

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 3      atccatcaacccatccatccatccg 27
              ||||||| |||||||||||||||||
Sbjct: 145267 atccatccacccatccatccatccg 145291

to top

>gb|AC007217.5| Homo sapiens chromosome 16 clone RP11-167B4, complete sequence
          Length = 173929

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||| ||||||||||||||||
Sbjct: 34447 gatccatccacccatccatccatcc 34471

to top

>gb|AF529518.1| Acipenser fulvescens clone AfuG141 microsatellite sequence
          Length = 609

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 3   atccatcaacccatccatccatccg 27
           ||||||| |||||||||||||||||
Sbjct: 208 atccatccacccatccatccatccg 232



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 3   atccatcaacccatccatccatcc 26
           ||||||| ||||||||||||||||
Sbjct: 180 atccatccacccatccatccatcc 203

to top

>gb|AC006124.2| Homo sapiens chromosome 19, cosmid R34739, complete sequence
          Length = 32735

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     catcaacccatccatccatcc 26
             |||||||||||||||||||||
Sbjct: 30337 catcaacccatccatccatcc 30317



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 8655 atccatccacccatccatccatcc 8632



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 8108 atccatccacccatccatccatcc 8085



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 7968 atccatccacccatccatccatcc 7945

to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 158     cggctgcggcggcgctcgcgg 178
               |||||||||||||||||||||
Sbjct: 1029895 cggctgcggcggcgctcgcgg 1029875

to top

>emb|AL928887.13| Zebrafish DNA sequence from clone CH211-136O14 in linkage group 23,
              complete sequence
          Length = 174456

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 6      catcaacccatccatccatcc 26
              |||||||||||||||||||||
Sbjct: 147682 catcaacccatccatccatcc 147702

to top

>gb|AC005775.1|AC005775 Homo sapiens chromosome 19, cosmid F20237, complete sequence
          Length = 47991

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 6    catcaacccatccatccatcc 26
            |||||||||||||||||||||
Sbjct: 1008 catcaacccatccatccatcc 988

to top

>gb|AC149294.8| Mus musculus chromosome 15, clone RP24-389G21, complete sequence
          Length = 136530

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 3     atccatcaacccatccatccatccgtttt 31
             ||||||| |||||||||||||||| ||||
Sbjct: 24774 atccatccacccatccatccatccatttt 24746

to top

>emb|CR293523.11| Zebrafish DNA sequence from clone DKEY-104J7 in linkage group 7, complete
              sequence
          Length = 214581

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      gatccatcaacccatccatccatcc 26
              ||||||| |||||||||||||||||
Sbjct: 150166 gatccattaacccatccatccatcc 150142

to top

>emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 in linkage group 18,
              complete sequence
          Length = 180022

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 2      gatccatcaacccatccatccatcc 26
              |||||||| ||||||||||||||||
Sbjct: 125502 gatccatccacccatccatccatcc 125526



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 152446 atccatccacccatccatccatcc 152423

to top

>emb|BX293565.25| Zebrafish DNA sequence from clone DKEY-268M13 in linkage group 22,
              complete sequence
          Length = 160930

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 3      atccatcaacccatccatccatccgtttt 31
              ||||||| | |||||||||||||||||||
Sbjct: 113491 atccatccatccatccatccatccgtttt 113463

to top

>emb|BX119988.9| Zebrafish DNA sequence from clone CH211-184L6 in linkage group 18,
            complete sequence
          Length = 141930

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 4    tccatcaacccatccatccatccgt 28
            |||||| ||||||||||||||||||
Sbjct: 6410 tccatccacccatccatccatccgt 6386

to top

>emb|BX119983.4| Zebrafish DNA sequence from clone CH211-198G9 in linkage group 1,
              complete sequence
          Length = 172227

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      gatccatcaacccatccatccatcc 26
              |||||||| ||||||||||||||||
Sbjct: 120153 gatccatccacccatccatccatcc 120129

to top

>emb|BX004817.8| Zebrafish DNA sequence from clone DKEY-169B7, complete sequence
          Length = 174174

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             |||||||| ||||||||||||||||
Sbjct: 48073 gatccatccacccatccatccatcc 48049

to top

>emb|BX950172.16| Zebrafish DNA sequence from clone DKEY-20F24 in linkage group 6, complete
              sequence
          Length = 231139

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 6      catcaacccatccatccatcc 26
              |||||||||||||||||||||
Sbjct: 184696 catcaacccatccatccatcc 184676



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 184735 atccatcaatccatccatccatcc 184712

to top

>emb|CR388001.36| Zebrafish DNA sequence from clone CH211-279I17 in linkage group 22,
             complete sequence
          Length = 123028

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1     agatccatcaacccatccatccatc 25
             ||||||||||| |||||||||||||
Sbjct: 22022 agatccatcaatccatccatccatc 21998

to top

>gb|AC127328.6| Mus musculus BAC clone RP23-259B8 from 6, complete sequence
          Length = 186950

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      gatccatcaacccatccatccatcc 26
              |||||||| ||||||||||||||||
Sbjct: 161608 gatccatccacccatccatccatcc 161584

to top

>emb|AL935048.7| Zebrafish DNA sequence from clone CH211-168M7, complete sequence
          Length = 137662

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 547  gcaaagaagccatcctggagt 567
            |||||||||||||||||||||
Sbjct: 3093 gcaaagaagccatcctggagt 3113

to top

>emb|AL670673.15| Mouse DNA sequence from clone RP23-32L5 on chromosome 4, complete
             sequence
          Length = 202412

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 5     ccatcaacccatccatccatc 25
             |||||||||||||||||||||
Sbjct: 49136 ccatcaacccatccatccatc 49116

to top

>emb|BX897750.11| Zebrafish DNA sequence from clone DKEY-278N18, complete sequence
          Length = 182033

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 3      atccatcaacccatccatccatccgttttacca 35
              ||||||| | |||||||||||||||||| ||||
Sbjct: 129990 atccatccatccatccatccatccgtttaacca 130022



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 131602 atccatcaatccatccatccatcc 131625



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 131412 atccatccacccatccatccatcc 131435

to top

>emb|CR936437.14| Zebrafish DNA sequence from clone CH211-197I23 in linkage group 3,
             complete sequence
          Length = 96056

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 3     atccatcaacccatccatccatccgtttt 31
             ||||||| | |||||||||||||||||||
Sbjct: 17428 atccatccatccatccatccatccgtttt 17456



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 16112 atccatccacccatccatccatcc 16135

to top

>emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chromosome 2, complete
             sequence
          Length = 179832

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 2     gatccatcaacccatccatccatcc 26
             ||||||||||| |||||||||||||
Sbjct: 96314 gatccatcaacgcatccatccatcc 96338

to top

>emb|AL833787.8| Mouse DNA sequence from clone RP23-228E2 on chromosome 2, complete
             sequence
          Length = 237055

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 5     ccatcaacccatccatccatc 25
             |||||||||||||||||||||
Sbjct: 52664 ccatcaacccatccatccatc 52644



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 217747 atccatccacccatccatccatcc 217770



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||||||||||| ||||||
Sbjct: 52972 atccatcaacccatccaaccatcc 52949

to top

>dbj|AP003971.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-850O8, complete
             sequence
          Length = 147440

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     tccatcaacccatccatccatccgt 28
             |||||| ||||||||||||||||||
Sbjct: 99576 tccatccacccatccatccatccgt 99600



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     ccatcaacccatccatccatccgt 28
             ||||| ||||||||||||||||||
Sbjct: 99357 ccatccacccatccatccatccgt 99380



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 99327 atccatccacccatccatccatcc 99350

to top

>gb|AC108402.12| Mus musculus chromosome 3, clone RP24-141M5, complete sequence
          Length = 125057

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 103917 atccatccacccatccatccatcc 103940

to top

>gb|AC117698.19| Mus musculus chromosome 5, clone RP23-451A12, complete sequence
          Length = 180809

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 131980 atccatccacccatccatccatcc 132003



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 131964 atccatccacccatccatccatcc 131987



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 3524 atccatccacccatccatccatcc 3547

to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 72907 atccatccacccatccatccatcc 72884

to top

>gb|AC160972.4| Mus musculus BAC clone RP24-571D21 from chromosome 12, complete
             sequence
          Length = 184921

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 46060 atccatccacccatccatccatcc 46083

to top

>gb|AC150385.2| Branchiostoma floridae clone CH302-101G3, complete sequence
          Length = 121661

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 27378 atccatccacccatccatccatcc 27355

to top

>gb|AC144927.5| Mus musculus chromosome 5, clone RP23-464P20, complete sequence
          Length = 192593

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 65638 atccatctacccatccatccatcc 65615

to top

>gb|AC154516.2| Mus musculus BAC clone RP24-83D23 from chromosome 14, complete sequence
          Length = 216566

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 99860 atccatccacccatccatccatcc 99837

to top

>gb|AC133286.15| Mus musculus chromosome 1, clone RP24-358J4, complete sequence
          Length = 169772

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 66     tctgacccccacctcccctctccgcctt 93
              |||| ||||| |||||||||||||||||
Sbjct: 120569 tctgcccccctcctcccctctccgcctt 120596

to top

>ref|NM_183577.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 291

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 151 atggcgacggctgcggcggc 170
           ||||||||||||||||||||
Sbjct: 94  atggcgacggctgcggcggc 113

to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 155817 atccatccacccatccatccatcc 155840



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 77614 atccatccacccatccatccatcc 77637

to top

>gb|AC103624.9| Mus musculus chromosome 5, clone RP24-258B22, complete sequence
          Length = 172330

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 59601 atccatccacccatccatccatcc 59624

to top

>gb|AC101684.13| Mus musculus chromosome 1, clone RP23-187I13, complete sequence
          Length = 227440

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 66     tctgacccccacctcccctctccgcctt 93
              |||| ||||| |||||||||||||||||
Sbjct: 222355 tctgcccccctcctcccctctccgcctt 222382

to top

>gb|AC154387.2| Mus musculus BAC clone RP23-10K1 from chromosome 16, complete sequence
          Length = 212628

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 148428 atccatctacccatccatccatcc 148405

to top

>gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosome 1, complete sequence
          Length = 224730

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 77037 atccatccacccatccatccatcc 77060



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 26875 atccatccacccatccatccatcc 26898

to top

>gb|AC165260.2| Mus musculus BAC clone RP23-123E17 from chromosome 13, complete sequence
          Length = 209914

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 129193 atccatctacccatccatccatcc 129170

to top

>gb|AC152824.4| Mus musculus BAC clone RP24-276N7 from chromosome 5, complete sequence
          Length = 194291

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 69786 atccatccacccatccatccatcc 69809



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 69746 atccatccacccatccatccatcc 69769

to top

>gb|AC159290.2| Mus musculus BAC clone RP23-291I2 from chromosome 13, complete sequence
          Length = 231853

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 48915 atccatccacccatccatccatcc 48892



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 48859 atccatctacccatccatccatcc 48836

to top

>ref|XM_508962.1| PREDICTED: Pan troglodytes nuclear matrix transcription factor 4
           (LOC451790), mRNA
          Length = 2757

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 ggcgacggctgcggcggcgc 172
           ||||||||||||||||||||
Sbjct: 530 ggcgacggctgcggcggcgc 511

to top

>ref|XM_480098.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2538

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 153 ggcgacggctgcggcggcgc 172
           ||||||||||||||||||||
Sbjct: 15  ggcgacggctgcggcggcgc 34

to top

>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 146837 atccatcaatccatccatccatcc 146814

to top

>gb|AC099707.14| Mus musculus chromosome 1, clone RP23-329C7, complete sequence
          Length = 204557

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 189560 atccatccacccatccatccatcc 189537

to top

>gb|AC109201.12| Mus musculus chromosome 15, clone RP23-18P10, complete sequence
          Length = 213493

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 99625 atccatccacccatccatccatcc 99648

to top

>gb|AC153526.13| Mus musculus 10 BAC RP23-383C2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 200117

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 50817 atccatccacccatccatccatcc 50840



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 50561 atccatctacccatccatccatcc 50584

to top

>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence
          Length = 209525

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 178424 atccatccacccatccatccatcc 178447

to top

>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence
          Length = 194854

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 12943 atccatccacccatccatccatcc 12966

to top

>gb|AC112962.15| Mus musculus chromosome 19, clone RP24-74N6, complete sequence
          Length = 182999

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 48583 atccatccacccatccatccatcc 48606

to top

>gb|AC166573.2| Mus musculus BAC clone RP23-153H18 from chromosome 17, complete
             sequence
          Length = 193004

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 85288 atccatccacccatccatccatcc 85265

to top

>gb|AC138334.11| Mus musculus chromosome 7, clone RP23-306H5, complete sequence
          Length = 177803

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 31605 atccatccacccatccatccatcc 31582

to top

>gb|AC153607.15| Mus musculus 6 BAC RP23-100I21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 222828

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 71911 atccatccacccatccatccatcc 71888

to top

>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    tggcgacggctgcggcggcg 171
              ||||||||||||||||||||
Sbjct: 101294 tggcgacggctgcggcggcg 101275

to top

>gb|AC115868.12| Mus musculus chromosome 7, clone RP24-329F21, complete sequence
          Length = 181717

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 114700 atccatccacccatccatccatcc 114723

to top

>gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, complete sequence
          Length = 218174

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 133453 atccatcaatccatccatccatcc 133476



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 133301 atccatccacccatccatccatcc 133324

to top

>gb|AC158958.4| Mus musculus chromosome 1, clone RP23-31E12, complete sequence
          Length = 213244

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 135934 atccatccacccatccatccatcc 135957

to top

>gb|AC163998.2| Mus musculus chromosome 15, clone RP24-326H11, complete sequence
          Length = 153996

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 116798 atccatccacccatccatccatcc 116775

to top

>gb|AY016023.1| Sphoeroides nephelus alpha globin gene cluster, complete sequence
          Length = 167215

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 40504 atccatccacccatccatccatcc 40527



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 40309 atccatccacccatccatccatcc 40332



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 40221 atccatccacccatccatccatcc 40244

to top

>gb|AF326957.1| Macropus eugenii microsatellite T47-2 sequence
          Length = 325

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 3   atccatcaacccatccatccatcc 26
           ||||||| ||||||||||||||||
Sbjct: 199 atccatccacccatccatccatcc 176

to top

>gb|AC102614.11| Mus musculus chromosome 8, clone RP23-421L10, complete sequence
          Length = 197194

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 117743 atccatcaatccatccatccatcc 117766

to top

>gb|AC004499.1| Homo sapiens chromosome 20, BAC clone 104 (LBNL H109), complete
             sequence
          Length = 100452

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 45061 atccatccacccatccatccatcc 45084

to top

>gb|AC004644.1| Homo sapiens chromosome 16, cosmid clone 367E12 (LANL), complete
             sequence
          Length = 39338

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 27061 atccatcaatccatccatccatcc 27038

to top

>gb|AC165225.5| Mus musculus chromosome 3, clone RP24-70J13, complete sequence
          Length = 205069

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 156697 atccatccacccatccatccatcc 156674

to top

>gb|AY258856.1| Xiphophorus maculatus microsatellite Msc025 sequence
          Length = 669

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 3   atccatcaacccatccatccatcc 26
           ||||||| ||||||||||||||||
Sbjct: 140 atccatccacccatccatccatcc 117

to top

>gb|AC116151.10| Mus musculus chromosome 5, clone RP24-84G9, complete sequence
          Length = 204954

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 65493 atccatccacccatccatccatcc 65516

to top

>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete sequence
          Length = 187536

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 164282 atccatccacccatccatccatcc 164305

to top

>gb|AC096684.3| Takifugu rubripes clone 241N7, complete sequence
          Length = 84793

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 13513 atccatccacccatccatccatcc 13490



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 13457 atccatccacccatccatccatcc 13434



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 13437 atccatccacccatccatccatcc 13414



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 13421 atccatccacccatccatccatcc 13398



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 13306 atccatccacccatccatccatcc 13283

to top

>gb|AC160471.10| Mus musculus chromosome 7, clone RP23-432D9, complete sequence
          Length = 222272

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 57467 atccatccacccatccatccatcc 57444

to top

>gb|AC153152.4| Mus musculus BAC clone RP23-78F1 from chromosome 12, complete sequence
          Length = 184523

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 36822 atccatccacccatccatccatcc 36845

to top

>gb|AC165424.2| Mus musculus BAC clone RP24-68L23 from chromosome 17, complete sequence
          Length = 178781

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 148302 atccatcaatccatccatccatcc 148279

to top

>gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosome 5, complete sequence
          Length = 215766

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 69764 atccatctacccatccatccatcc 69787

to top

>gb|AC165273.2| Mus musculus BAC clone RP24-267I1 from chromosome 13, complete sequence
          Length = 190600

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              |||||| |||||||||||||||||
Sbjct: 100672 atccataaacccatccatccatcc 100695

to top

>gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, complete sequence
          Length = 186003

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80772 atccatccacccatccatccatcc 80749



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80488 atccatccacccatccatccatcc 80465



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80416 atccatccacccatccatccatcc 80393



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80396 atccatccacccatccatccatcc 80373



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80344 atccatccacccatccatccatcc 80321



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80236 atccatctacccatccatccatcc 80213



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80124 atccatccacccatccatccatcc 80101



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80088 atccatccacccatccatccatcc 80065

to top

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 221447 atccatcaatccatccatccatcc 221424

to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 154    gcgacggctgcggcggcgctcgcg 177
              |||||||| |||||||||||||||
Sbjct: 925754 gcgacggccgcggcggcgctcgcg 925731

to top

>gb|AC115937.14| Mus musculus chromosome 5, clone RP24-547J21, complete sequence
          Length = 215400

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 111090 atccatcaatccatccatccatcc 111113



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 84236 atccatctacccatccatccatcc 84213

to top

>gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, complete sequence
          Length = 136224

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 67241 atccatccacccatccatccatcc 67264

to top

>gb|AC118255.32| Mus musculus chromosome 8, clone RP24-89A4, complete sequence
          Length = 200858

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 96837 atccatccacccatccatccatcc 96860

to top

>gb|AY738117.1| Homo sapiens matrix metalloproteinase 2 (gelatinase A, 72kDa
             gelatinase, 72kDa type IV collagenase) (MMP2) gene,
             complete cds
          Length = 31017

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 16814 atccatctacccatccatccatcc 16837

to top

>gb|AC008337.8| Drosophila melanogaster clone BACR02B03, complete sequence
          Length = 169680

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 77498 atccatccacccatccatccatcc 77475

to top

>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 196028 atccatccacccatccatccatcc 196051



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 195980 atccatccacccatccatccatcc 196003



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 195956 atccatccacccatccatccatcc 195979

to top

>gb|AE008650.1| Rickettsia conorii str. Malish 7, section 82 of 114 of the complete
           genome
          Length = 10029

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 503 ctgctacaagctcgcaggat 522
           ||||||||||||||||||||
Sbjct: 746 ctgctacaagctcgcaggat 727

to top

>gb|AC120176.7| Mus musculus chromosome 18, clone RP24-494J20, complete sequence
          Length = 162180

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 123161 atccatccacccatccatccatcc 123138

to top

>gb|AC115508.5| Rattus norvegicus 2 BAC CH230-355B17 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 209019

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 31281 atccatccacccatccatccatcc 31258



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30829 atccatctacccatccatccatcc 30806



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30737 atccatccacccatccatccatcc 30714



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30633 atccatccacccatccatccatcc 30610



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30613 atccatccacccatccatccatcc 30590

to top

>gb|AC112633.6| Rattus norvegicus 11 BAC CH230-200K21 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 230130

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 222791 atccatccacccatccatccatcc 222814

to top

>gb|AC108321.5| Rattus norvegicus BAC CH230-261E4 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 196424

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 114489 atccatccacccatccatccatcc 114512

to top

>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 213379

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 125761 atccatccacccatccatccatcc 125784



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 125697 atccatccacccatccatccatcc 125720

to top

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 29711 atccatccacccatccatccatcc 29688

to top

>gb|AC115484.2| Drosophila melanogaster clone BACR06K01, complete sequence
          Length = 168504

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 10631 atccatcaatccatccatccatcc 10608

to top

>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence
          Length = 213155

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 20322 atccatccacccatccatccatcc 20299



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 20282 atccatccacccatccatccatcc 20259

to top

>gb|AC091454.2| Mus musculus chromosome X, clones RP21-438P10, RP21-382F2, RP21-118B24,
              Map qA7.1, complete sequences
          Length = 393632

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 267256 atccatccacccatccatccatcc 267279

to top

>gb|AC116856.8| Mus musculus chromosome 14, clone RP24-403P16, complete sequence
          Length = 196560

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 46020 atccatcaatccatccatccatcc 46043

to top

>gb|AC145748.4| Mus musculus BAC clone RP23-31L10 from chromosome 5, complete sequence
          Length = 220208

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 114607 atccatccacccatccatccatcc 114630

to top

>gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosome 12, complete
             sequence
          Length = 168895

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 13512 atccatcaatccatccatccatcc 13535

to top

>gb|AC138654.4| Mus musculus BAC clone RP23-344O11 from chromosome 5, complete sequence
          Length = 198036

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 76619 atccatccacccatccatccatcc 76596

to top

>gb|AC119892.10| Mus musculus chromosome 12, clone RP24-224L20, complete sequence
          Length = 153665

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 57204 atccatccacccatccatccatcc 57181

to top

>gb|AC100893.13| Mus musculus chromosome 8, clone RP23-68I8, complete sequence
          Length = 253420

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 80422 atccatccacccatccatccatcc 80445

to top

>ref|XM_580342.2| PREDICTED: Bos taurus similar to insulin-like growth factor binding
           protein 7 (predicted) (LOC538438), partial mRNA
          Length = 521

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  gctcgcaggggccgcaggcg 116
           ||||||||||||||||||||
Sbjct: 141 gctcgcaggggccgcaggcg 122

to top

>gb|AC129040.5| Rattus norvegicus 6 BAC CH230-372A13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 176067

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 118890 atccatccacccatccatccatcc 118913

to top

>gb|AC131336.9| Mus musculus chromosome 1, clone RP23-96A20, complete sequence
          Length = 121355

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     atcaacccatccatccatcc 26
             ||||||||||||||||||||
Sbjct: 75868 atcaacccatccatccatcc 75887

to top

>ref|NM_001039918.1| Homo sapiens zinc finger protein 384 (ZNF384), transcript variant
           4, mRNA
          Length = 3069

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 ggcgacggctgcggcggcgc 172
           ||||||||||||||||||||
Sbjct: 259 ggcgacggctgcggcggcgc 240

to top

>ref|NM_133476.3| Homo sapiens zinc finger protein 384 (ZNF384), transcript variant
           2, mRNA
          Length = 3117

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 ggcgacggctgcggcggcgc 172
           ||||||||||||||||||||
Sbjct: 259 ggcgacggctgcggcggcgc 240

to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 154     gcgacggctgcggcggcgctcgcg 177
               |||||||| |||||||||||||||
Sbjct: 1968393 gcgacggccgcggcggcgctcgcg 1968370

to top

>gb|AC158936.4| Mus musculus chromosome 3, clone RP23-235P13, complete sequence
          Length = 160709

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 132831 atccatccacccatccatccatcc 132854

to top

>gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosome 12, complete sequence
          Length = 176510

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 133328 atccatccacccatccatccatcc 133305

to top

>gb|AC110092.4| Mus musculus BAC clone RP24-94E17 from chromosome 14, complete sequence
          Length = 184368

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 64393 atccatccacccatccatccatcc 64416

to top

>gb|AC129219.3| Mus musculus BAC clone RP24-474C15 from chromosome 14, complete sequence
          Length = 195935

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 177540 atccatccacccatccatccatcc 177517

to top

>gb|AC147038.2| Pan troglodytes BAC clone RP43-112D23 from 7, complete sequence
          Length = 192615

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 86418 atccatcaatccatccatccatcc 86395

to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    ggcggcgctcgcggtgacgg 184
              ||||||||||||||||||||
Sbjct: 165302 ggcggcgctcgcggtgacgg 165321

to top

>gb|AC126941.3| Mus musculus BAC clone RP23-133N24 from chromosome 7, complete sequence
          Length = 196621

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 169926 atccatccacccatccatccatcc 169949

to top

>gb|AC124749.5| Mus musculus BAC clone RP23-262G23 from chromosome 5, complete sequence
          Length = 209986

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 179738 atccatccacccatccatccatcc 179761

to top

>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete
             sequence
          Length = 172985

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 94714 atccatccacccatccatccatcc 94691

to top

>gb|AC137980.4| Mus musculus BAC clone RP24-69K24 from chromosome 9, complete sequence
          Length = 221263

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 180288 atccatccacccatccatccatcc 180265

to top

>gb|AC147163.2| Mus musculus BAC clone RP24-317B17 from chromosome Y, complete sequence
          Length = 208700

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 169810 atccatccacccatccatccatcc 169833

to top

>gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome 16, complete sequence
          Length = 190860

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 94132 atccatccacccatccatccatcc 94155



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 94108 atccatccacccatccatccatcc 94131

to top

>gb|AC118546.80| Mus musculus strain C57BL/6J clone rp23-346h22 map 17, complete
             sequence
          Length = 223070

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 30036 atccatccacccatccatccatcc 30059

to top

>gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, complete sequence
          Length = 215786

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 146004 atccatctacccatccatccatcc 145981

to top

>gb|AC113028.15| Mus musculus chromosome 5, clone RP23-205D3, complete sequence
          Length = 275646

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 228019 atccatccacccatccatccatcc 228042



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 134955 atccatccacccatccatccatcc 134978

to top

>gb|AC090432.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-454P8, complete
             sequence
          Length = 148344

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 97489 atccatccacccatccatccatcc 97512

to top

>gb|AC144702.2| Danio rerio clone CH211-138D14, complete sequence
          Length = 192101

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 119754 atccatccacccatccatccatcc 119777

to top

>gb|AY386696.1| Oryctolagus cuniculus clone 27N5, complete sequence
          Length = 146676

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 63948 atccatccacccatccatccatcc 63925

to top

>gb|AC154605.2| Mus musculus BAC clone RP23-348G3 from chromosome 16, complete sequence
          Length = 191050

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 339   aaatgtggagagctttgggg 358
             ||||||||||||||||||||
Sbjct: 18017 aaatgtggagagctttgggg 17998

to top

>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence
          Length = 234127

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 119868 atccatccacccatccatccatcc 119845



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 18440 atccatccacccatccatccatcc 18463



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 18136 atccatccacccatccatccatcc 18159

to top

>gb|AC166167.2| Mus musculus BAC clone RP23-211D22 from chromosome 13, complete sequence
          Length = 200448

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 152329 atccatcaatccatccatccatcc 152352

to top

>gb|AC161176.5| Mus musculus chromosome 5, clone RP24-295A5, complete sequence
          Length = 157001

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 58844 atccatccacccatccatccatcc 58867

to top

>gb|AC104868.8| Mus musculus chromosome 1, clone RP24-532K6, complete sequence
          Length = 182376

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 85114 atccatccacccatccatccatcc 85137

to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 3       atccatcaacccatccatccatcc 26
               ||||||||| ||||||||||||||
Sbjct: 1886736 atccatcaatccatccatccatcc 1886759

to top

>gb|AC163393.6| Mus musculus chromosome 15, clone RP24-224P8, complete sequence
          Length = 167152

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 39668 atccatcaatccatccatccatcc 39691

to top

>gb|AC166256.5| Mus musculus  BAC RP23-440F21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 181903

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 139732 atccatccacccatccatccatcc 139755

to top

>gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosome 17, complete
             sequence
          Length = 197522

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||||| ||||||||||||||
Sbjct: 98837 atccatcaatccatccatccatcc 98814

to top

>gb|AC164637.3| Mus musculus BAC clone RP23-128I20 from chromosome 13, complete sequence
          Length = 222651

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 194813 atccatccacccatccatccatcc 194790

to top

>gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosome 5, complete sequence
          Length = 227388

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 191455 atccatccacccatccatccatcc 191478



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 191439 atccatccacccatccatccatcc 191462



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 191423 atccatccacccatccatccatcc 191446



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 191399 atccatctacccatccatccatcc 191422

to top

>gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome 5, complete sequence
          Length = 188588

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||||| ||||||||||||||
Sbjct: 123122 atccatcaatccatccatccatcc 123145



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 74242 atccatctacccatccatccatcc 74219

to top

>gb|AC127027.13| Mus musculus chromosome 5, clone RP23-236G19, complete sequence
          Length = 195654

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 150466 atccatccacccatccatccatcc 150489

to top

>gb|AC167229.4| Mus musculus  BAC RP24-337D17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 197711

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 140140 atccatccacccatccatccatcc 140163

to top

>gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, complete sequence
          Length = 207763

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 35401 atccatccacccatccatccatcc 35424

to top

>gb|AC162914.2| Mus musculus BAC clone RP23-401O13 from chromosome 6, complete sequence
          Length = 194892

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 87185 atccatccacccatccatccatcc 87208

to top

>gb|AC154508.2| Mus musculus BAC clone RP24-96P6 from chromosome 16, complete
            sequence
          Length = 214625

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    atccatcaacccatccatccatcc 26
            ||||||| ||||||||||||||||
Sbjct: 4782 atccatccacccatccatccatcc 4759

to top

>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete
             sequence
          Length = 186859

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 61471 atccatccacccatccatccatcc 61448



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 61447 atccatccacccatccatccatcc 61424

to top

>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 264561

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 186952 atccatccacccatccatccatcc 186929



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      atccatcaacccatccatccatcc 26
              ||||||| ||||||||||||||||
Sbjct: 177189 atccatccacccatccatccatcc 177166

to top

>gb|AC119906.6| Mus musculus chromosome 5, clone RP24-239D13, complete sequence
          Length = 257203

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 3     atccatcaacccatccatccatcc 26
             ||||||| ||||||||||||||||
Sbjct: 69600 atccatccacccatccatccatcc 69623


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,672,349
Number of Sequences: 3902068
Number of extensions: 5672349
Number of successful extensions: 343507
Number of sequences better than 10.0: 1477
Number of HSP's better than 10.0 without gapping: 1477
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 291392
Number of HSP's gapped (non-prelim): 42869
length of query: 595
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 572
effective length of database: 17,143,297,704
effective search space: 9805966286688
effective search space used: 9805966286688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result