ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart33b07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC113332.2| Oryza sativa (japonica cultivar-group) chromosome... 392 e-106
2gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome... 392 e-106
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
4dbj|AK065975.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
5ref|XM_475495.1| Oryza sativa (japonica cultivar-group), predic... 379 e-102
6gb|AY104790.1| Zea mays PCO093811 mRNA sequence 100 9e-18
7gb|BT016764.1| Zea mays clone Contig597 mRNA sequence 80 9e-12
8gb|AC131098.3| Homo sapiens BAC clone RP11-1226D22 from 4, compl... 46 0.12
9gb|AC155298.2| Mus musculus BAC clone RP24-245L7 from chromosome... 44 0.48
10emb|BX932566.1| Gallus gallus finished cDNA, clone ChEST635a2 44 0.48
11gb|AC135469.4| Mus musculus BAC clone RP24-406G8 from 13, comple... 44 0.48
12gb|DQ087591.1| Thunnus thynnus haplotype Tt119 control region, p... 42 1.9
13gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosom... 42 1.9
14gb|AY699929.1| Thunnus thynnus thynnus haplotype 42 control regi... 42 1.9
15emb|CR956354.1| Wallaby DNA sequence from clone GRWB-143H14, com... 42 1.9
16emb|BX323861.10| Zebrafish DNA sequence from clone CH211-209F23 ... 42 1.9
17gb|AC165369.3| Gallus gallus BAC clone CH261-58G18 from chromoso... 42 1.9
18gb|AF390433.1|AF390433 Thunnus thynnus haplotype 79 mitochondria... 42 1.9
19gb|AY650684.1| Thunnus thynnus voucher USC tthy140 control regio... 42 1.9
20gb|AY650642.1| Thunnus thynnus voucher UdG tt993 control region,... 42 1.9
21gb|AY650629.1| Thunnus thynnus voucher UdG tt923 control region,... 42 1.9
22gb|AY650597.1| Thunnus thynnus voucher UdG tt773 control region,... 42 1.9
23dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.9
24dbj|AP005688.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.9
25dbj|AP005646.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.9
26dbj|AB106301.1| Thunnus thynnus thynnus mitochondrial genes for ... 42 1.9
27dbj|AB106285.1| Thunnus thynnus thynnus mitochondrial genes for ... 42 1.9
28emb|CT573100.6| Mouse DNA sequence from clone RP23-218E7 on chro... 42 1.9
29gb|AC138388.3| Mus musculus BAC clone RP23-455J6 from 10, comple... 42 1.9
30emb|Y13759.1|ENY13759 Emericella nidulans abfB gene 42 1.9
31gb|AC163702.3| Gallus gallus BAC clone CH261-124A8 from chromoso... 42 1.9
32gb|AC160456.8| Mus musculus chromosome 8, clone RP23-121F17, com... 40 7.5
33gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 7.5
34gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, co... 40 7.5
35gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome... 40 7.5
36gb|AC005091.1| Homo sapiens BAC clone CTA-318C11 from 7, complet... 40 7.5
37gb|AC116392.12| Mus musculus chromosome 10, clone RP23-93D3, com... 40 7.5
38gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, com... 40 7.5
39gb|AC146239.3| Pan troglodytes BAC clone CH251-176K11 from Y, co... 40 7.5
40ref|XM_448424.1| Candida glabrata CBS138, CAGL0K04565g partial mRNA 40 7.5
41gb|AC134475.3| Mus musculus BAC clone RP23-251K17 from chromosom... 40 7.5
42gb|AC122459.2| Mus musculus BAC clone RP24-273F21 from chromosom... 40 7.5
43gb|AC158113.7| Mus musculus chromosome 7, clone RP23-227N6, comp... 40 7.5
44emb|AL845433.4| Human DNA sequence from clone RP11-674N8 on chro... 40 7.5
45emb|AL137787.11| Human DNA sequence from clone RP5-1070B1 on chr... 40 7.5
46emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I... 40 7.5
47emb|CR380957.1| Candida glabrata strain CBS138 chromosome K comp... 40 7.5
48dbj|BS000554.1| Pan troglodytes chromosome Y clone:PTB-334B21, c... 40 7.5
49gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 7.5
50gb|AC104018.3| Homo sapiens chromosome 8, clone RP11-354A14, com... 40 7.5
51gb|AC080145.8| Homo sapiens chromosome 15, clone CTD-2298D17, co... 40 7.5
52gb|AC091045.3| Homo sapiens chromosome 15 clone RP11-111A22 map ... 40 7.5
53ref|XM_660957.1| Cryptosporidium hominis TU502 pacman protein (C... 40 7.5
54gb|AC120137.16| Mus musculus chromosome 5, clone RP23-280O16, co... 40 7.5
55gb|AC004985.2| Homo sapiens PAC clone RP5-1165K10 from 7, comple... 40 7.5
56gb|AC108013.5| Homo sapiens BAC clone RP13-538M20 from 4, comple... 40 7.5
57gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, com... 40 7.5
58gb|AC092134.4| Homo sapiens chromosome 16 clone RP11-264M12, com... 40 7.5
59gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y... 40 7.5
60gb|AF447398.1| Peanut clump virus Ni segment RNA-2 coat protein,... 40 7.5
61emb|AJ333860.1|HSA333860 Homo sapiens genomic sequence surroundi... 40 7.5
62dbj|AK063647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.5
63emb|AL954673.5| Zebrafish DNA sequence from clone BUSM1-122B7 in... 40 7.5
64emb|AL132642.4|CNS01DT7 Human chromosome 14 DNA sequence BAC R-1... 40 7.5
65emb|AL079302.7|CNS00M8S Human chromosome 14 DNA sequence BAC R-1... 40 7.5
66emb|AL832032.2|HSM803339 Homo sapiens mRNA; cDNA DKFZp451P134 (f... 40 7.5
67emb|AL805976.12| Mouse DNA sequence from clone RP23-34H1 on chro... 40 7.5
68gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone ... 40 7.5
69emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chr... 40 7.5

>gb|AC113332.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1057_B02,
             complete sequence
          Length = 99795

 Score =  392 bits (198), Expect = e-106
 Identities = 345/394 (87%)
 Strand = Plus / Minus

                                                                         
Query: 145   ctgagctatggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggt 204
             |||||||||||||||||||||||||||||| |||||||||||||| || || ||||| ||
Sbjct: 12269 ctgagctatggacaacttgtggcatctcggggatgagttccgtgggcagtcgaaggtagt 12210

                                                                         
Query: 205   ggaggaccgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggc 264
             ||||||||| || ||||||||||||||||| ||| ||||||||||||  ||||| |||||
Sbjct: 12209 ggaggaccgtcagtggtctctcatgacatcgaagttggctgagatcaacaagtccaaggc 12150

                                                                         
Query: 265   tgagaggatgaatgactttgagtatgcaaggatgaacactgtccctgatgtgaagcaatg 324
              ||||||| ||||||  |||| |||||  ||||||||||  |||||||||| ||||||||
Sbjct: 12149 ggagaggacgaatgagcttgactatgcgcggatgaacaccatccctgatgtcaagcaatg 12090

                                                                         
Query: 325   ggataagctatcctaccaccaagaagacaacaagatggaccacctcaatcttggcctcat 384
             ||||||| |||||||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 12089 ggataaggtatcctaccaccaagatgagagcaagatggaccacctcaatcttggccttat 12030

                                                                         
Query: 385   gaacctggatcttaagatgaatgatctcaagatgaatgaggctgccatgaagtacccttt 444
             ||| || |||||||||||||| ||  ||| ||||||||| || || |||||| | |||||
Sbjct: 12029 gaatctagatcttaagatgaacgacatcaggatgaatgacgcagctatgaagaatccttt 11970

                                                                         
Query: 445   ccgcaacatggcctataacatgaatccgatgtaccccaagggaaacaatggtaatgtcaa 504
             ||||  ||||||||| |||||||||| | ||||||||||||||  |||||| ||||| ||
Sbjct: 11969 ccgcggcatggcctacaacatgaatcagctgtaccccaagggaggcaatggcaatgttaa 11910

                                               
Query: 505   ttcattcaagatgaatgttggggtcaacaaatat 538
              || ||||||||||||||||||||||||||||||
Sbjct: 11909 ctcgttcaagatgaatgttggggtcaacaaatat 11876



to top

>gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0010D04,
             complete sequence
          Length = 122599

 Score =  392 bits (198), Expect = e-106
 Identities = 345/394 (87%)
 Strand = Plus / Minus

                                                                         
Query: 145   ctgagctatggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggt 204
             |||||||||||||||||||||||||||||| |||||||||||||| || || ||||| ||
Sbjct: 95386 ctgagctatggacaacttgtggcatctcggggatgagttccgtgggcagtcgaaggtagt 95327

                                                                         
Query: 205   ggaggaccgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggc 264
             ||||||||| || ||||||||||||||||| ||| ||||||||||||  ||||| |||||
Sbjct: 95326 ggaggaccgtcagtggtctctcatgacatcgaagttggctgagatcaacaagtccaaggc 95267

                                                                         
Query: 265   tgagaggatgaatgactttgagtatgcaaggatgaacactgtccctgatgtgaagcaatg 324
              ||||||| ||||||  |||| |||||  ||||||||||  |||||||||| ||||||||
Sbjct: 95266 ggagaggacgaatgagcttgactatgcgcggatgaacaccatccctgatgtcaagcaatg 95207

                                                                         
Query: 325   ggataagctatcctaccaccaagaagacaacaagatggaccacctcaatcttggcctcat 384
             ||||||| |||||||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 95206 ggataaggtatcctaccaccaagatgagagcaagatggaccacctcaatcttggccttat 95147

                                                                         
Query: 385   gaacctggatcttaagatgaatgatctcaagatgaatgaggctgccatgaagtacccttt 444
             ||| || |||||||||||||| ||  ||| ||||||||| || || |||||| | |||||
Sbjct: 95146 gaatctagatcttaagatgaacgacatcaggatgaatgacgcagctatgaagaatccttt 95087

                                                                         
Query: 445   ccgcaacatggcctataacatgaatccgatgtaccccaagggaaacaatggtaatgtcaa 504
             ||||  ||||||||| |||||||||| | ||||||||||||||  |||||| ||||| ||
Sbjct: 95086 ccgcggcatggcctacaacatgaatcagctgtaccccaagggaggcaatggcaatgttaa 95027

                                               
Query: 505   ttcattcaagatgaatgttggggtcaacaaatat 538
              || ||||||||||||||||||||||||||||||
Sbjct: 95026 ctcgttcaagatgaatgttggggtcaacaaatat 94993



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  392 bits (198), Expect = e-106
 Identities = 345/394 (87%)
 Strand = Plus / Minus

                                                                            
Query: 145      ctgagctatggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggt 204
                |||||||||||||||||||||||||||||| |||||||||||||| || || ||||| ||
Sbjct: 24409596 ctgagctatggacaacttgtggcatctcggggatgagttccgtgggcagtcgaaggtagt 24409537

                                                                            
Query: 205      ggaggaccgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggc 264
                ||||||||| || ||||||||||||||||| ||| ||||||||||||  ||||| |||||
Sbjct: 24409536 ggaggaccgtcagtggtctctcatgacatcgaagttggctgagatcaacaagtccaaggc 24409477

                                                                            
Query: 265      tgagaggatgaatgactttgagtatgcaaggatgaacactgtccctgatgtgaagcaatg 324
                 ||||||| ||||||  |||| |||||  ||||||||||  |||||||||| ||||||||
Sbjct: 24409476 ggagaggacgaatgagcttgactatgcgcggatgaacaccatccctgatgtcaagcaatg 24409417

                                                                            
Query: 325      ggataagctatcctaccaccaagaagacaacaagatggaccacctcaatcttggcctcat 384
                ||||||| |||||||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 24409416 ggataaggtatcctaccaccaagatgagagcaagatggaccacctcaatcttggccttat 24409357

                                                                            
Query: 385      gaacctggatcttaagatgaatgatctcaagatgaatgaggctgccatgaagtacccttt 444
                ||| || |||||||||||||| ||  ||| ||||||||| || || |||||| | |||||
Sbjct: 24409356 gaatctagatcttaagatgaacgacatcaggatgaatgacgcagctatgaagaatccttt 24409297

                                                                            
Query: 445      ccgcaacatggcctataacatgaatccgatgtaccccaagggaaacaatggtaatgtcaa 504
                ||||  ||||||||| |||||||||| | ||||||||||||||  |||||| ||||| ||
Sbjct: 24409296 ccgcggcatggcctacaacatgaatcagctgtaccccaagggaggcaatggcaatgttaa 24409237

                                                  
Query: 505      ttcattcaagatgaatgttggggtcaacaaatat 538
                 || ||||||||||||||||||||||||||||||
Sbjct: 24409236 ctcgttcaagatgaatgttggggtcaacaaatat 24409203



to top

>dbj|AK065975.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013045D18, full
           insert sequence
          Length = 1546

 Score =  392 bits (198), Expect = e-106
 Identities = 345/394 (87%)
 Strand = Plus / Plus

                                                                       
Query: 145 ctgagctatggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggt 204
           |||||||||||||||||||||||||||||| |||||||||||||| || || ||||| ||
Sbjct: 238 ctgagctatggacaacttgtggcatctcggggatgagttccgtgggcagtcgaaggtagt 297

                                                                       
Query: 205 ggaggaccgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggc 264
           ||||||||| || ||||||||||||||||| ||| ||||||||||||  ||||| |||||
Sbjct: 298 ggaggaccgtcagtggtctctcatgacatcgaagttggctgagatcaacaagtccaaggc 357

                                                                       
Query: 265 tgagaggatgaatgactttgagtatgcaaggatgaacactgtccctgatgtgaagcaatg 324
            ||||||| ||||||  |||| |||||  ||||||||||  |||||||||| ||||||||
Sbjct: 358 ggagaggacgaatgagcttgactatgcgcggatgaacaccatccctgatgtcaagcaatg 417

                                                                       
Query: 325 ggataagctatcctaccaccaagaagacaacaagatggaccacctcaatcttggcctcat 384
           ||||||| |||||||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 418 ggataaggtatcctaccaccaagatgagagcaagatggaccacctcaatcttggccttat 477

                                                                       
Query: 385 gaacctggatcttaagatgaatgatctcaagatgaatgaggctgccatgaagtacccttt 444
           ||| || |||||||||||||| ||  ||| ||||||||| || || |||||| | |||||
Sbjct: 478 gaatctagatcttaagatgaacgacatcaggatgaatgacgcagctatgaagaatccttt 537

                                                                       
Query: 445 ccgcaacatggcctataacatgaatccgatgtaccccaagggaaacaatggtaatgtcaa 504
           ||||  ||||||||| |||||||||| | ||||||||||||||  |||||| ||||| ||
Sbjct: 538 ccgcggcatggcctacaacatgaatcagctgtaccccaagggaggcaatggcaatgttaa 597

                                             
Query: 505 ttcattcaagatgaatgttggggtcaacaaatat 538
            || ||||||||||||||||||||||||||||||
Sbjct: 598 ctcgttcaagatgaatgttggggtcaacaaatat 631



to top

>ref|XM_475495.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 945

 Score =  379 bits (191), Expect = e-102
 Identities = 338/387 (87%)
 Strand = Plus / Plus

                                                                       
Query: 152 atggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggtggaggac 211
           ||||||||||||||||||||||| |||||||||||||| || || ||||| |||||||||
Sbjct: 1   atggacaacttgtggcatctcggggatgagttccgtgggcagtcgaaggtagtggaggac 60

                                                                       
Query: 212 cgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggctgagagg 271
           || || ||||||||||||||||| ||| ||||||||||||  ||||| ||||| ||||||
Sbjct: 61  cgtcagtggtctctcatgacatcgaagttggctgagatcaacaagtccaaggcggagagg 120

                                                                       
Query: 272 atgaatgactttgagtatgcaaggatgaacactgtccctgatgtgaagcaatgggataag 331
           | ||||||  |||| |||||  ||||||||||  |||||||||| |||||||||||||||
Sbjct: 121 acgaatgagcttgactatgcgcggatgaacaccatccctgatgtcaagcaatgggataag 180

                                                                       
Query: 332 ctatcctaccaccaagaagacaacaagatggaccacctcaatcttggcctcatgaacctg 391
            |||||||||||||||| || | ||||||||||||||||||||||||||| ||||| || 
Sbjct: 181 gtatcctaccaccaagatgagagcaagatggaccacctcaatcttggccttatgaatcta 240

                                                                       
Query: 392 gatcttaagatgaatgatctcaagatgaatgaggctgccatgaagtaccctttccgcaac 451
           |||||||||||||| ||  ||| ||||||||| || || |||||| | |||||||||  |
Sbjct: 241 gatcttaagatgaacgacatcaggatgaatgacgcagctatgaagaatcctttccgcggc 300

                                                                       
Query: 452 atggcctataacatgaatccgatgtaccccaagggaaacaatggtaatgtcaattcattc 511
           |||||||| |||||||||| | ||||||||||||||  |||||| ||||| || || |||
Sbjct: 301 atggcctacaacatgaatcagctgtaccccaagggaggcaatggcaatgttaactcgttc 360

                                      
Query: 512 aagatgaatgttggggtcaacaaatat 538
           |||||||||||||||||||||||||||
Sbjct: 361 aagatgaatgttggggtcaacaaatat 387



to top

>gb|AY104790.1| Zea mays PCO093811 mRNA sequence
          Length = 1604

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 110/130 (84%)
 Strand = Plus / Plus

                                                                       
Query: 147 gagctatggacaacttgtggcatctcggagatgagttccgtggtcaatcaaaggtggtgg 206
           |||||||||||| | |||||||||| || || ||| |||| || ||  | ||||||||||
Sbjct: 170 gagctatggacagcctgtggcatcttggggacgagctccgcgggcagcccaaggtggtgg 229

                                                                       
Query: 207 aggaccgccaatggtctctcatgacatcaaagctggctgagatcacaaagtcaaaggctg 266
           |||||||||| |||||||||||||| || |||||||| |||||||| | ||| ||||  |
Sbjct: 230 aggaccgccagtggtctctcatgacgtccaagctggcggagatcaccaggtccaagggcg 289

                     
Query: 267 agaggatgaa 276
           ||||||||||
Sbjct: 290 agaggatgaa 299



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 497 aatgtcaattcattcaagatgaatgttggggtcaacaa 534
           ||||||||| | ||||||||||||||||| ||||||||
Sbjct: 487 aatgtcaatgcgttcaagatgaatgttggagtcaacaa 524



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 377 ggcctcatgaacctggatcttaagatgaa 405
           |||||||||||||||||||| ||||||||
Sbjct: 373 ggcctcatgaacctggatctcaagatgaa 401



to top

>gb|BT016764.1| Zea mays clone Contig597 mRNA sequence
          Length = 1573

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 197 aaggtggtggaggaccgccaatggtctctcatgacatcaaagctggctgagatcac 252
           |||||||||||||||||||| ||||| ||||||||||| |||||||| ||||||||
Sbjct: 166 aaggtggtggaggaccgccagtggtcgctcatgacatccaagctggcagagatcac 221



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 398 aagatgaatgatctcaagatgaatgaggc 426
           |||||||| |||||||||||||| |||||
Sbjct: 361 aagatgaacgatctcaagatgaacgaggc 389



to top

>gb|AC131098.3| Homo sapiens BAC clone RP11-1226D22 from 4, complete sequence
          Length = 71827

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 487   aaacaatggtaatgtcaattcattcaa 513
             |||||||||||| ||||||||||||||
Sbjct: 10747 aaacaatggtaaagtcaattcattcaa 10773



to top

>gb|AC155298.2| Mus musculus BAC clone RP24-245L7 from chromosome 13, complete sequence
          Length = 178609

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 68     tctcctctccttccccttcctc 89
              ||||||||||||||||||||||
Sbjct: 171613 tctcctctccttccccttcctc 171592



to top

>emb|BX932566.1| Gallus gallus finished cDNA, clone ChEST635a2
          Length = 703

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 74  ctccttccccttcctcgcagcg 95
           ||||||||||||||||||||||
Sbjct: 79  ctccttccccttcctcgcagcg 100



to top

>gb|AC135469.4| Mus musculus BAC clone RP24-406G8 from 13, complete sequence
          Length = 165641

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 68    tctcctctccttccccttcctc 89
             ||||||||||||||||||||||
Sbjct: 58134 tctcctctccttccccttcctc 58113



to top

>gb|DQ087591.1| Thunnus thynnus haplotype Tt119 control region, partial sequence;
           mitochondrial
          Length = 785

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 200 attcaagatgaatgttggggt 180



to top

>gb|AC160993.5| Mus musculus BAC clone RP23-159D11 from chromosome 16, complete
             sequence
          Length = 187536

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ctcctctccttccccttcctc 89
             |||||||||||||||||||||
Sbjct: 45751 ctcctctccttccccttcctc 45731



to top

>gb|AY699929.1| Thunnus thynnus thynnus haplotype 42 control region, complete
           sequence; mitochondrial
          Length = 865

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 200 attcaagatgaatgttggggt 180



to top

>emb|CR956354.1| Wallaby DNA sequence from clone GRWB-143H14, complete sequence
          Length = 120769

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    tctcctctccttccccttcct 88
             |||||||||||||||||||||
Sbjct: 18732 tctcctctccttccccttcct 18752



to top

>emb|BX323861.10| Zebrafish DNA sequence from clone CH211-209F23 in linkage group 2,
              complete sequence
          Length = 173663

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 77     cttccccttcctcgcagcgccctcc 101
              ||||||||||||||||||| |||||
Sbjct: 141956 cttccccttcctcgcagcgtcctcc 141980



to top

>gb|AC165369.3| Gallus gallus BAC clone CH261-58G18 from chromosome ul, complete sequence
          Length = 208903

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 225    tcatgacatcaaagctggctgagat 249
              |||||||||||||||| ||||||||
Sbjct: 187248 tcatgacatcaaagctagctgagat 187224



to top

>gb|AF390433.1|AF390433 Thunnus thynnus haplotype 79 mitochondrial control region, complete
           sequence
          Length = 861

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 196 attcaagatgaatgttggggt 176



to top

>gb|AY650684.1| Thunnus thynnus voucher USC tthy140 control region, partial
           sequence; mitochondrial
          Length = 332

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 169 attcaagatgaatgttggggt 149



to top

>gb|AY650642.1| Thunnus thynnus voucher UdG tt993 control region, partial sequence;
           mitochondrial
          Length = 368

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 196 attcaagatgaatgttggggt 176



to top

>gb|AY650629.1| Thunnus thynnus voucher UdG tt923 control region, partial sequence;
           mitochondrial
          Length = 368

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 196 attcaagatgaatgttggggt 176



to top

>gb|AY650597.1| Thunnus thynnus voucher UdG tt773 control region, partial sequence;
           mitochondrial
          Length = 368

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 196 attcaagatgaatgttggggt 176



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 69       ctcctctccttccccttcctc 89
                |||||||||||||||||||||
Sbjct: 13891094 ctcctctccttccccttcctc 13891074



to top

>dbj|AP005688.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
            clone:OSJNBa0031J07
          Length = 172511

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 69   ctcctctccttccccttcctc 89
            |||||||||||||||||||||
Sbjct: 8314 ctcctctccttccccttcctc 8294



to top

>dbj|AP005646.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:B1077E08
          Length = 145275

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 69     ctcctctccttccccttcctc 89
              |||||||||||||||||||||
Sbjct: 145234 ctcctctccttccccttcctc 145214



to top

>dbj|AB106301.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp23
          Length = 1258

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 307 attcaagatgaatgttggggt 287



to top

>dbj|AB106285.1| Thunnus thynnus thynnus mitochondrial genes for tRNA-Thr, tRNA-Pro,
           D-loop, tRNA-Phe, 12S rRNA, partial and complete
           sequence, haplotype:Tth Hp3
          Length = 1258

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 508 attcaagatgaatgttggggt 528
           |||||||||||||||||||||
Sbjct: 307 attcaagatgaatgttggggt 287



to top

>emb|CT573100.6| Mouse DNA sequence from clone RP23-218E7 on chromosome 12, complete
              sequence
          Length = 183966

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     tctcctctccttccccttcct 88
              |||||||||||||||||||||
Sbjct: 146488 tctcctctccttccccttcct 146468



to top

>gb|AC138388.3| Mus musculus BAC clone RP23-455J6 from 10, complete sequence
          Length = 164600

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 294   ggatgaacactgtccctgatg 314
             |||||||||||||||||||||
Sbjct: 80055 ggatgaacactgtccctgatg 80075



to top

>emb|Y13759.1|ENY13759 Emericella nidulans abfB gene
          Length = 3141

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 288 atgcaaggatgaacactgtcc 308
           |||||||||||||||||||||
Sbjct: 379 atgcaaggatgaacactgtcc 399



to top

>gb|AC163702.3| Gallus gallus BAC clone CH261-124A8 from chromosome ul, complete
             sequence
          Length = 179537

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 225   tcatgacatcaaagctggctgagat 249
             |||||||||||||||| ||||||||
Sbjct: 43334 tcatgacatcaaagctagctgagat 43310



to top

>gb|AC160456.8| Mus musculus chromosome 8, clone RP23-121F17, complete sequence
          Length = 221841

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     ctcctctccttccccttcct 88
              ||||||||||||||||||||
Sbjct: 104766 ctcctctccttccccttcct 104747



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 226     catgacatcaaagctggctg 245
               ||||||||||||||||||||
Sbjct: 4820859 catgacatcaaagctggctg 4820840



to top

>gb|AC111058.10| Mus musculus chromosome 7, clone RP24-562C11, complete sequence
          Length = 211691

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 126910 tctcctctccttccccttcc 126891



to top

>gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome 15, complete
            sequence
          Length = 181742

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 68   tctcctctccttccccttcc 87
            ||||||||||||||||||||
Sbjct: 9118 tctcctctccttccccttcc 9137



to top

>gb|AC005091.1| Homo sapiens BAC clone CTA-318C11 from 7, complete sequence
          Length = 110535

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 416   atgaatgaggctgccatgaa 435
             ||||||||||||||||||||
Sbjct: 64327 atgaatgaggctgccatgaa 64308



to top

>gb|AC116392.12| Mus musculus chromosome 10, clone RP23-93D3, complete sequence
          Length = 275200

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 530    aacaaatatcccaataatca 549
              ||||||||||||||||||||
Sbjct: 114751 aacaaatatcccaataatca 114770



to top

>gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, complete sequence
          Length = 194849

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 46724 tctcctctccttccccttcc 46705



to top

>gb|AC146239.3| Pan troglodytes BAC clone CH251-176K11 from Y, complete sequence
          Length = 180132

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 138162 tctcctctccttccccttcc 138143



to top

>ref|XM_448424.1| Candida glabrata CBS138, CAGL0K04565g partial mRNA
          Length = 1863

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 251 acaaagtcaaaggctgagag 270
           ||||||||||||||||||||
Sbjct: 427 acaaagtcaaaggctgagag 446



to top

>gb|AC134475.3| Mus musculus BAC clone RP23-251K17 from chromosome 7, complete sequence
          Length = 172237

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tcctctccttccccttcctc 89
              ||||||||||||||||||||
Sbjct: 131254 tcctctccttccccttcctc 131235



to top

>gb|AC122459.2| Mus musculus BAC clone RP24-273F21 from chromosome 15, complete sequence
          Length = 156807

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 141250 tctcctctccttccccttcc 141269



to top

>gb|AC158113.7| Mus musculus chromosome 7, clone RP23-227N6, complete sequence
          Length = 159400

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 126620 tctcctctccttccccttcc 126639



to top

>emb|AL845433.4| Human DNA sequence from clone RP11-674N8 on chromosome X Contains a
             chromobox homolog 5 (HP1 alpha homolog, Drosophila) (CBX5)
             pseudogene, the 5' end of the NHS gene for Nance-Horan
             syndrome (congenital cataracts and dental anomalies) and
             two CpG islands, complete sequence
          Length = 200476

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 217   atggtctctcatgacatcaa 236
             ||||||||||||||||||||
Sbjct: 57525 atggtctctcatgacatcaa 57544



to top

>emb|AL137787.11| Human DNA sequence from clone RP5-1070B1 on chromosome Xq22.1-23
             Contains the 3' end of a novel gene, a novel gene
             (KIAA1817) and the 5' end of the PRPS1  for phosphoribosyl
             pyrophosphate synthetase 1 (PRSI) gene, complete sequence
          Length = 89446

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 422   gaggctgccatgaagtaccc 441
             ||||||||||||||||||||
Sbjct: 13976 gaggctgccatgaagtaccc 13995



to top

>emb|AL050331.11|HSDJ486I3 Human DNA sequence from clone RP3-486I3 on chromosome 6q22.1-22.3
             Contains the 3' end of a novel gene, a novel gene, the
             gene for KIAA0721 (NAP (Nucleosome Assembly Protein)
             domain containing protein), a novel gene, an RPS5 (40S
             Ribosomal Protein S5) pseudogene, the TSPYL gene for
             TSPY-like (testis specific protein, Y-linked like), the 5'
             end of a novel gene, the 5' end of the SART gene for
             squamous cell carcinoma antigen recognised by T cell and
             two CpG islands, complete sequence
          Length = 118327

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 18856 tctcctctccttccccttcc 18837



to top

>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    acaaagtcaaaggctgagag 270
              ||||||||||||||||||||
Sbjct: 433345 acaaagtcaaaggctgagag 433326



to top

>dbj|BS000554.1| Pan troglodytes chromosome Y clone:PTB-334B21, complete sequences
          Length = 129327

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 35880 tctcctctccttccccttcc 35899



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 68       tctcctctccttccccttcc 87
                ||||||||||||||||||||
Sbjct: 16443079 tctcctctccttccccttcc 16443060



to top

>gb|AC104018.3| Homo sapiens chromosome 8, clone RP11-354A14, complete sequence
          Length = 186256

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     ctcctctccttccccttcct 88
              ||||||||||||||||||||
Sbjct: 106640 ctcctctccttccccttcct 106659



to top

>gb|AC080145.8| Homo sapiens chromosome 15, clone CTD-2298D17, complete sequence
          Length = 115632

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 312   atgtgaagcaatgggataag 331
             ||||||||||||||||||||
Sbjct: 57760 atgtgaagcaatgggataag 57741



to top

>gb|AC091045.3| Homo sapiens chromosome 15 clone RP11-111A22 map 15q14, complete sequence
          Length = 171947

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 67     gtctcctctccttccccttcctcgcagc 94
              |||| |||||||||||||||||| ||||
Sbjct: 115524 gtcttctctccttccccttcctcccagc 115497



to top

>ref|XM_660957.1| Cryptosporidium hominis TU502 pacman protein (Chro.80265), partial
            mRNA
          Length = 2205

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 66   agtctcctctccttccccttcctc 89
            |||||||| |||||||||||||||
Sbjct: 1927 agtctcctgtccttccccttcctc 1904



to top

>gb|AC120137.16| Mus musculus chromosome 5, clone RP23-280O16, complete sequence
          Length = 181464

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     tcctctccttccccttcctc 89
              ||||||||||||||||||||
Sbjct: 131693 tcctctccttccccttcctc 131674



to top

>gb|AC004985.2| Homo sapiens PAC clone RP5-1165K10 from 7, complete sequence
          Length = 159507

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 149902 tctcctctccttccccttcc 149921



to top

>gb|AC108013.5| Homo sapiens BAC clone RP13-538M20 from 4, complete sequence
          Length = 118662

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 51366 tctcctctccttccccttcc 51385



to top

>gb|AC026423.9| Homo sapiens chromosome 16 clone CTD-2169M19, complete sequence
          Length = 116130

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    tcctctccttccccttcctc 89
             ||||||||||||||||||||
Sbjct: 65941 tcctctccttccccttcctc 65960



to top

>gb|AC092134.4| Homo sapiens chromosome 16 clone RP11-264M12, complete sequence
          Length = 159925

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 57577 tctcctctccttccccttcc 57558



to top

>gb|AC007244.2|AC007244 Homo sapiens BAC clone RP11-207L19 from Y, complete sequence
          Length = 184977

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    tctcctctccttccccttcc 87
             ||||||||||||||||||||
Sbjct: 37977 tctcctctccttccccttcc 37996



to top

>gb|AF447398.1| Peanut clump virus Ni segment RNA-2 coat protein, P37, P47, P14, and
            P17 genes, complete cds
          Length = 4305

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 67   gtctcctctccttccccttc 86
            ||||||||||||||||||||
Sbjct: 3083 gtctcctctccttccccttc 3064



to top

>emb|AJ333860.1|HSA333860 Homo sapiens genomic sequence surrounding NotI site, clone NL6-LK6R
          Length = 820

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 69  ctcctctccttccccttcct 88
           ||||||||||||||||||||
Sbjct: 108 ctcctctccttccccttcct 127



to top

>dbj|AK063647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-118-H12, full
           insert sequence
          Length = 588

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 69  ctcctctccttccccttcct 88
           ||||||||||||||||||||
Sbjct: 259 ctcctctccttccccttcct 240



to top

>emb|AL954673.5| Zebrafish DNA sequence from clone BUSM1-122B7 in linkage group 20,
             complete sequence
          Length = 84303

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   accaagaagacaacaagatg 361
             ||||||||||||||||||||
Sbjct: 33217 accaagaagacaacaagatg 33198



to top

>emb|AL132642.4|CNS01DT7 Human chromosome 14 DNA sequence BAC R-131H24 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 182643

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     ctcctctccttccccttcct 88
              ||||||||||||||||||||
Sbjct: 159679 ctcctctccttccccttcct 159660



to top

>emb|AL079302.7|CNS00M8S Human chromosome 14 DNA sequence BAC R-1089B7 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 204230

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    ctcctctccttccccttcct 88
             ||||||||||||||||||||
Sbjct: 11488 ctcctctccttccccttcct 11469



to top

>emb|AL832032.2|HSM803339 Homo sapiens mRNA; cDNA DKFZp451P134 (from clone DKFZp451P134)
          Length = 6110

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 67   gtctcctctccttccccttcctcgcagc 94
            |||| |||||||||||||||||| ||||
Sbjct: 4119 gtcttctctccttccccttcctcccagc 4146



to top

>emb|AL805976.12| Mouse DNA sequence from clone RP23-34H1 on chromosome 4, complete
              sequence
          Length = 192098

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     tctcctctccttccccttcc 87
              ||||||||||||||||||||
Sbjct: 123197 tctcctctccttccccttcc 123216



to top

>gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone rp23-403l21, complete
             sequence
          Length = 189517

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    tcctctccttccccttcctc 89
             ||||||||||||||||||||
Sbjct: 29903 tcctctccttccccttcctc 29884



to top

>emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chromosome 11, complete
             sequence
          Length = 151207

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 496   taatgtcaattcattcaagatgaa 519
             |||||||| |||||||||||||||
Sbjct: 10943 taatgtcacttcattcaagatgaa 10966


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,779,462
Number of Sequences: 3902068
Number of extensions: 4779462
Number of successful extensions: 95927
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95651
Number of HSP's gapped (non-prelim): 276
length of query: 554
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 531
effective length of database: 17,143,297,704
effective search space: 9103091080824
effective search space used: 9103091080824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top