Clone Name | bart33a11 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_479232.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1326 Score = 161 bits (81), Expect = 3e-36 Identities = 315/393 (80%) Strand = Plus / Plus Query: 149 atccatggctcggcccatgggatccagcggcttcgaggctgccctagccgtgtgccccgc 208 |||||||||| |||||| ||||| | |||||||||||| ||| ||||| |||||||| Sbjct: 96 atccatggcttggcccacgggatgcctcggcttcgaggccgccgccgccgtctgccccgc 155 Query: 209 cgccgcccaggcctacttcaagtactgcggtattgtatccggatgcacaaatgcgaaccc 268 ||| |||||| ||| ||||||| || ||||||||| | | |||| | |||| | Sbjct: 156 ggccttccaggcgtaccagaagtactacgatattgtatcagcgttttcaaacgtgaacac 215 Query: 269 aagggaagggttggcggatctttcacgaactatagataatatggaaggaatgagggatgg 328 | | ||||| ||||| || ||||||| | ||||||| ||||||||| ||||||||| Sbjct: 216 acgagaaggattggctgagctttcacaagttatagatggcatggaaggattgagggatgc 275 Query: 329 aatatttggtgatattcacaagctcatgtcagttcttgagttcgatgatgtgagccaatt 388 |||||| |||| || | |||||||||||||| |||||| || ||||||| || ||| Sbjct: 276 gatatttagtgacatccccaagctcatgtcagctcttgacttagatgatgctcaccgatt 335 Query: 389 taattccttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaatatcac 448 | | ||||||||||||||||||||||||||| || |||||||| |||||||| ||| | Sbjct: 336 cagtatcttctatgattttgtcttcttcatttcccgagaaaatggccaaaagaacatctc 395 Query: 449 tgttcagaaggctcttgcagcatggaggatagttcttcttggaaggttccgattgcttga 508 |||||||| ||| | | |||||||||||| ||||| ||| ||||| | |||||||| Sbjct: 396 tgttcagagagctgtgggagcatggaggatggttctaaatgggaggttttggttgcttga 455 Query: 509 ccggtggtgtaactttgttcagaagtaccaacg 541 | ||||||||||||||||| ||||||||||||| Sbjct: 456 caggtggtgtaactttgttgagaagtaccaacg 488
>dbj|AK066723.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013088A01, full insert sequence Length = 1386 Score = 161 bits (81), Expect = 3e-36 Identities = 315/393 (80%) Strand = Plus / Plus Query: 149 atccatggctcggcccatgggatccagcggcttcgaggctgccctagccgtgtgccccgc 208 |||||||||| |||||| ||||| | |||||||||||| ||| ||||| |||||||| Sbjct: 156 atccatggcttggcccacgggatgcctcggcttcgaggccgccgccgccgtctgccccgc 215 Query: 209 cgccgcccaggcctacttcaagtactgcggtattgtatccggatgcacaaatgcgaaccc 268 ||| |||||| ||| ||||||| || ||||||||| | | |||| | |||| | Sbjct: 216 ggccttccaggcgtaccagaagtactacgatattgtatcagcgttttcaaacgtgaacac 275 Query: 269 aagggaagggttggcggatctttcacgaactatagataatatggaaggaatgagggatgg 328 | | ||||| ||||| || ||||||| | ||||||| ||||||||| ||||||||| Sbjct: 276 acgagaaggattggctgagctttcacaagttatagatggcatggaaggattgagggatgc 335 Query: 329 aatatttggtgatattcacaagctcatgtcagttcttgagttcgatgatgtgagccaatt 388 |||||| |||| || | |||||||||||||| |||||| || ||||||| || ||| Sbjct: 336 gatatttagtgacatccccaagctcatgtcagctcttgacttagatgatgctcaccgatt 395 Query: 389 taattccttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaatatcac 448 | | ||||||||||||||||||||||||||| || |||||||| |||||||| ||| | Sbjct: 396 cagtatcttctatgattttgtcttcttcatttcccgagaaaatggccaaaagaacatctc 455 Query: 449 tgttcagaaggctcttgcagcatggaggatagttcttcttggaaggttccgattgcttga 508 |||||||| ||| | | |||||||||||| ||||| ||| ||||| | |||||||| Sbjct: 456 tgttcagagagctgtgggagcatggaggatggttctaaatgggaggttttggttgcttga 515 Query: 509 ccggtggtgtaactttgttcagaagtaccaacg 541 | ||||||||||||||||| ||||||||||||| Sbjct: 516 caggtggtgtaactttgttgagaagtaccaacg 548
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 395 cttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaa 442 ||||||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 26113039 cttctatgattttgtcttcttcatttcccgagaaaatggccaaaagaa 26112992 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Minus Query: 467 agcatggaggatagttcttcttggaaggttccgattgcttgaccggtggtgtaactttgt 526 |||||||||||| ||||| ||| ||||| | ||||||||| |||||||||||||||| Sbjct: 26112865 agcatggaggatggttctaaatgggaggttttggttgcttgacaggtggtgtaactttgt 26112806 Query: 527 t 527 | Sbjct: 26112805 t 26112805 Score = 40.1 bits (20), Expect = 7.6 Identities = 50/60 (83%) Strand = Plus / Minus Query: 149 atccatggctcggcccatgggatccagcggcttcgaggctgccctagccgtgtgccccgc 208 |||||||||| |||||| ||||| | |||||||||||| ||| ||||| |||||||| Sbjct: 26114335 atccatggcttggcccacgggatgcctcggcttcgaggccgccgccgccgtctgccccgc 26114276
>dbj|AP004260.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0011H09 Length = 147992 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 395 cttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaa 442 ||||||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 146601 cttctatgattttgtcttcttcatttcccgagaaaatggccaaaagaa 146554 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Minus Query: 467 agcatggaggatagttcttcttggaaggttccgattgcttgaccggtggtgtaactttgt 526 |||||||||||| ||||| ||| ||||| | ||||||||| |||||||||||||||| Sbjct: 146427 agcatggaggatggttctaaatgggaggttttggttgcttgacaggtggtgtaactttgt 146368 Query: 527 t 527 | Sbjct: 146367 t 146367 Score = 40.1 bits (20), Expect = 7.6 Identities = 50/60 (83%) Strand = Plus / Minus Query: 149 atccatggctcggcccatgggatccagcggcttcgaggctgccctagccgtgtgccccgc 208 |||||||||| |||||| ||||| | |||||||||||| ||| ||||| |||||||| Sbjct: 147897 atccatggcttggcccacgggatgcctcggcttcgaggccgccgccgccgtctgccccgc 147838
>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0519E12 Length = 152448 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 395 cttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaa 442 ||||||||||||||||||||||||||| || |||||||| |||||||| Sbjct: 4897 cttctatgattttgtcttcttcatttcccgagaaaatggccaaaagaa 4850 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/61 (85%) Strand = Plus / Minus Query: 467 agcatggaggatagttcttcttggaaggttccgattgcttgaccggtggtgtaactttgt 526 |||||||||||| ||||| ||| ||||| | ||||||||| |||||||||||||||| Sbjct: 4723 agcatggaggatggttctaaatgggaggttttggttgcttgacaggtggtgtaactttgt 4664 Query: 527 t 527 | Sbjct: 4663 t 4663 Score = 40.1 bits (20), Expect = 7.6 Identities = 50/60 (83%) Strand = Plus / Minus Query: 149 atccatggctcggcccatgggatccagcggcttcgaggctgccctagccgtgtgccccgc 208 |||||||||| |||||| ||||| | |||||||||||| ||| ||||| |||||||| Sbjct: 6193 atccatggcttggcccacgggatgcctcggcttcgaggccgccgccgccgtctgccccgc 6134
>gb|AC140025.7| Medicago truncatula clone mth2-11i16, complete sequence Length = 130592 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 396 ttctatgattttgtcttcttcatttctcgtgaaaatggacaaaagaatatca 447 |||||||| ||||| |||||||| | |||||||||||| |||||||| |||| Sbjct: 100587 ttctatgaatttgttttcttcatgtgtcgtgaaaatggtcaaaagaacatca 100638
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccaggcc 221 |||||| |||||||||||||||||||| Sbjct: 421717 gccgtgagccccgccgccgcccaggcc 421691
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccaggcc 221 |||||| |||||||||||||||||||| Sbjct: 71397 gccgtgagccccgccgccgcccaggcc 71371
>gb|AC126044.4| Mus musculus BAC clone RP23-12O8 from chromosome 1, complete sequence Length = 213412 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 310 tggaaggaatgagggatggaatattt 335 |||||||||||||||| ||||||||| Sbjct: 212152 tggaaggaatgagggaaggaatattt 212127
>gb|AC118477.14| Mus musculus chromosome 1, clone RP24-178B14, complete sequence Length = 191518 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 310 tggaaggaatgagggatggaatattt 335 |||||||||||||||| ||||||||| Sbjct: 132069 tggaaggaatgagggaaggaatattt 132094
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 206 cgccgccgcccaggcctacttc 227 |||||||||||||||||||||| Sbjct: 5879428 cgccgccgcccaggcctacttc 5879449
>gb|AC161225.14| Mus musculus chromosome 5, clone RP23-37G13, complete sequence Length = 165525 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gatagttcttcttggaaggtt 496 ||||||||||||||||||||| Sbjct: 16468 gatagttcttcttggaaggtt 16488
>gb|AC140291.2| Mus musculus BAC clone RP24-326N12 from chromosome 5, complete sequence Length = 167269 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 gatagttcttcttggaaggtt 496 ||||||||||||||||||||| Sbjct: 108886 gatagttcttcttggaaggtt 108906
>gb|AC120548.15| Mus musculus chromosome 17, clone RP23-211H11, complete sequence Length = 198829 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 387 tttaattccttctatgatttt 407 ||||||||||||||||||||| Sbjct: 11423 tttaattccttctatgatttt 11403
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29 Length = 313800 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 gccgccgcccaggcctacttc 227 ||||||||||||||||||||| Sbjct: 117170 gccgccgcccaggcctacttc 117190
>ref|XM_687476.1| PREDICTED: Danio rerio similar to centrosome-associated protein 350 (LOC564120), mRNA Length = 8789 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 230 gtactgcggtattgtatccgg 250 ||||||||||||||||||||| Sbjct: 898 gtactgcggtattgtatccgg 878
>emb|CR381643.18| Zebrafish DNA sequence from clone DKEY-39N1 in linkage group 8, complete sequence Length = 217745 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 230 gtactgcggtattgtatccgg 250 ||||||||||||||||||||| Sbjct: 124271 gtactgcggtattgtatccgg 124291
>gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome 8, complete sequence Length = 212711 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 gaaaatggacaaaagaatat 445 |||||||||||||||||||| Sbjct: 82878 gaaaatggacaaaagaatat 82897
>ref|XM_482548.1| Oryza sativa (japonica cultivar-group), mRNA Length = 411 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 104 cgactcctcggcggcgagcaccgg 127 |||||| ||||||||||||||||| Sbjct: 78 cgactcgtcggcggcgagcaccgg 101
>ref|NM_185121.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1575 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 168 gccgtgtaccccgccgccgcccag 145
>ref|XM_526039.1| PREDICTED: Pan troglodytes similar to striated muscle preferentially expressed protein (LOC470657), mRNA Length = 10911 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 3223 gccgtgagccccgccgccgcccag 3246
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 104 cgactcctcggcggcgagca 123 |||||||||||||||||||| Sbjct: 2109416 cgactcctcggcggcgagca 2109397
>gb|AY603755.1| Homo sapiens striated muscle preferentially expressed protein mRNA, partial cds Length = 9282 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 1252 gccgtgagccccgccgccgcccag 1275
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 34458904 gccgtgtaccccgccgccgcccag 34458927
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 26333 gccccgccgccgcccaggcc 26314
>gb|AC146849.1| Pan troglodytes BAC clone RP43-163I11 from 7, complete sequence Length = 147837 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 aggaatgagggatggaatatttgg 337 |||||||||||||||||| ||||| Sbjct: 100567 aggaatgagggatggaatctttgg 100590
>gb|AC124926.7| Rattus norvegicus X BAC CH230-155H3 (Children's Hospital Oakland Research Institute) complete sequence Length = 217309 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 404 ttttgtcttcttcatttctc 423 |||||||||||||||||||| Sbjct: 170208 ttttgtcttcttcatttctc 170227
>emb|AL132661.32|HSDJ345E4 Human DNA sequence from clone RP3-345E4 on chromosome 6q26-27 Contains the 5' end of a gene for a novel protein and 2 CpG islands, complete sequence Length = 108865 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 403 attttgtcttcttcatttct 422 |||||||||||||||||||| Sbjct: 60340 attttgtcttcttcatttct 60359
>emb|BX842578.1| Mycobacterium tuberculosis H37Rv complete genome; segment 7/13 Length = 346186 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 104 cgactcctcggcggcgagca 123 |||||||||||||||||||| Sbjct: 33492 cgactcctcggcggcgagca 33473
>emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 7/14 Length = 291050 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 104 cgactcctcggcggcgagca 123 |||||||||||||||||||| Sbjct: 188404 cgactcctcggcggcgagca 188385
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 207 gccgccgcccaggcctacttcaag 230 |||||||||||||||||| ||||| Sbjct: 665754 gccgccgcccaggcctacatcaag 665777 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 622092 gccccgccgccgcccaggcc 622073
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 ggtggtcgactcctcggcgg 117 |||||||||||||||||||| Sbjct: 3859914 ggtggtcgactcctcggcgg 3859933
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 4885407 gccccgccgccgcccaggcc 4885388
>dbj|AK128689.1| Homo sapiens cDNA FLJ46856 fis, clone UTERU3010409, highly similar to Aortic preferentially expressed protein 1 Length = 5120 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 1637 gccgtgagccccgccgccgcccag 1660
>dbj|AK126500.1| Homo sapiens cDNA FLJ44536 fis, clone UTERU3004992, highly similar to Aortic preferentially expressed protein 1 Length = 3874 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 1827 gccgtgagccccgccgccgcccag 1850
>dbj|AK097321.1| Homo sapiens cDNA FLJ40002 fis, clone STOMA2003646 Length = 2190 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 305 gccgtgagccccgccgccgcccag 282
>gb|AE011625.1| Xanthomonas axonopodis pv. citri str. 306, section 3 of 469 of the complete genome Length = 10597 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 3872 gccccgccgccgcccaggcc 3853
>gb|AC020708.6| Homo sapiens BAC clone RP11-425B17 from 4, complete sequence Length = 208360 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 tccttctatgattttgtctt 412 |||||||||||||||||||| Sbjct: 189792 tccttctatgattttgtctt 189773
>gb|AC096687.5| Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete sequence Length = 117505 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 67263 gccgtgtaccccgccgccgcccag 67240
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 104 cgactcctcggcggcgagcaccgg 127 |||||| ||||||||||||||||| Sbjct: 21020364 cgactcgtcggcggcgagcaccgg 21020341
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 34548976 gccgtgtaccccgccgccgcccag 34548999
>gb|AC158541.1| Pan troglodytes BAC clone CH251-19F24 from chromosome unknown, complete sequence Length = 186577 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 314 aggaatgagggatggaatatttgg 337 |||||||||||||||||| ||||| Sbjct: 95556 aggaatgagggatggaatctttgg 95533
>gb|AC053503.7| Homo sapiens BAC clone RP11-316O14 from 2, complete sequence Length = 183625 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 195 gccgtgtgccccgccgccgcccag 218 |||||| ||||||||||||||||| Sbjct: 106601 gccgtgagccccgccgccgcccag 106624
>gb|AC007183.4| Arabidopsis thaliana chromosome 1 BAC F9D18 sequence, complete sequence Length = 110000 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 ccggggttagggtttagggg 143 |||||||||||||||||||| Sbjct: 60092 ccggggttagggtttagggg 60111
>dbj|AP004666.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0431A03 Length = 149500 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 104 cgactcctcggcggcgagcaccgg 127 |||||| ||||||||||||||||| Sbjct: 86539 cgactcgtcggcggcgagcaccgg 86516
>dbj|AP005268.1| Pan troglodytes DNA, chromosome 7 clone:PTB-029M21, complete sequence Length = 154715 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 314 aggaatgagggatggaatatttgg 337 |||||||||||||||||| ||||| Sbjct: 8357 aggaatgagggatggaatctttgg 8334
>dbj|AK104819.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-A10, full insert sequence Length = 1572 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 193 gccgtgtaccccgccgccgcccag 170
>dbj|AK066888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013088J18, full insert sequence Length = 1600 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 195 gccgtgtgccccgccgccgcccag 218 ||||||| |||||||||||||||| Sbjct: 194 gccgtgtaccccgccgccgcccag 171
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 4888425 gccccgccgccgcccaggcc 4888406
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 gccccgccgccgcccaggcc 221 |||||||||||||||||||| Sbjct: 3673014 gccccgccgccgcccaggcc 3672995
>gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, complete sequence Length = 158740 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 gaaaatggacaaaagaatat 445 |||||||||||||||||||| Sbjct: 123665 gaaaatggacaaaagaatat 123684 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,784,711 Number of Sequences: 3902068 Number of extensions: 4784711 Number of successful extensions: 96124 Number of sequences better than 10.0: 51 Number of HSP's better than 10.0 without gapping: 51 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95416 Number of HSP's gapped (non-prelim): 703 length of query: 563 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 540 effective length of database: 17,143,297,704 effective search space: 9257380760160 effective search space used: 9257380760160 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)