>gb|BT018571.1| Zea mays clone EL01N0442H06.d mRNA sequence
          Length = 1324

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                        
Query: 153  tcgtgagcacactgatcatatcggagcacgaaggcgggctcgcgaagccatcttccctaa 212
            |||||||||| ||  || || ||||||||||||||||| |||  ||||| || || || |
Sbjct: 1233 tcgtgagcacgctcgtcgtagcggagcacgaaggcgggttcgtcaagccgtcgtcgctga 1174

                                                                        
Query: 213  gcgcgttggcggctgccgaggccatcgccaaagagaacaaggtggctcttcttctcggtg 272
            |||| ||||| ||||| |||||||| ||||| || ||||| ||  || | || || ||||
Sbjct: 1173 gcgcattggccgctgcggaggccattgccaaggacaacaaagtttctgtcctgctgggtg 1114

                                                      
Query: 273  gatccggaccgacgctgcacaaggctgcccagcatgccgcgt 314
            | ||||| ||| |||| |||||||| ||| | ||||||||||
Sbjct: 1113 gttccgggccggcgcttcacaaggccgccgaccatgccgcgt 1072

>gb|AY107426.1| Zea mays PCO089573 mRNA sequence
          Length = 686

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 153 tcgtgagcacactgatcatatcggagcacgaaggcgggctcgcgaagccatcttccctaa 212
           |||||||||| ||  || || ||||||||||||||||| |||  ||||| || || || |
Sbjct: 166 tcgtgagcacgctcgtcgtagcggagcacgaaggcgggttcgtcaagccgtcgtcgctga 225

                                                                       
Query: 213 gcgcgttggcggctgccgaggccatcgccaaagagaacaaggtggctcttcttctcggtg 272
           |||| ||||| || || |||||||| ||||| || ||||| ||  || | || || ||||
Sbjct: 226 gcgcattggccgccgcggaggccattgccaaggacaacaaagtttctgtcctgctgggtg 285

                                                     
Query: 273 gatccggaccgacgctgcacaaggctgcccagcatgccgcgt 314
           | ||||| ||| |||| |||||||| ||| | ||||||||||
Sbjct: 286 gttccgggccggcgcttcacaaggccgccgaccatgccgcgt 327

>ref|XM_470331.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1375

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggtc 331
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| |||||||| 
Sbjct: 342 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggta 401

                            
Query: 332 aatgaggttcttgttgc 348
              ||||||||||||||
Sbjct: 402 tccgaggttcttgttgc 418

>ref|XM_470330.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1437

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggtc 331
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| |||||||| 
Sbjct: 357 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggta 416

                            
Query: 332 aatgaggttcttgttgc 348
              ||||||||||||||
Sbjct: 417 tccgaggttcttgttgc 433

>dbj|AK105896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-F02, full
           insert sequence
          Length = 1368

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggtc 331
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| |||||||| 
Sbjct: 381 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggta 440

                            
Query: 332 aatgaggttcttgttgc 348
              ||||||||||||||
Sbjct: 441 tccgaggttcttgttgc 457

>dbj|AK098986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013093P06, full
           insert sequence
          Length = 1320

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggtc 331
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| |||||||| 
Sbjct: 369 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggta 428

                            
Query: 332 aatgaggttcttgttgc 348
              ||||||||||||||
Sbjct: 429 tccgaggttcttgttgc 445

>dbj|AK061773.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D01, full
           insert sequence
          Length = 1368

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggtc 331
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| |||||||| 
Sbjct: 381 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggta 440

                            
Query: 332 aatgaggttcttgttgc 348
              ||||||||||||||
Sbjct: 441 tccgaggttcttgttgc 457

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                           
Query: 272      ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggt 330
                |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| ||||||||
Sbjct: 34797038 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggt 34797096

>gb|AC092557.7| Oryza sativa chromosome 3 BAC OSJNBa0096I06 genomic sequence, complete
             sequence
          Length = 164352

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 272   ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggt 330
             |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| ||||||||
Sbjct: 65612 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggt 65554

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                           
Query: 272      ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggt 330
                |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| ||||||||
Sbjct: 34887110 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggt 34887168

>dbj|AK064539.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-112-A02, full
           insert sequence
          Length = 1585

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 272 ggatccggaccgacgctgcacaaggctgcccagcatgccgcgtctagccacccattggt 330
           |||||||| |||  ||| |||||||||||| ||||||| ||||| ||||| ||||||||
Sbjct: 769 ggatccgggccggggcttcacaaggctgccgagcatgctgcgtccagccatccattggt 711

>gb|BC035078.1| Homo sapiens mindbomb homolog 2 (Drosophila), mRNA (cDNA clone
           IMAGE:5260457)
          Length = 2768

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 86  atggcgggggcgctccggcgggg 108
           |||||||||||||||||||||||
Sbjct: 337 atggcgggggcgctccggcgggg 315

>emb|AL691432.53| Human DNA sequence from clone RP11-345P4 on chromosome 1, complete
             sequence
          Length = 186482

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 86    atggcgggggcgctccggcgggg 108
             |||||||||||||||||||||||
Sbjct: 36290 atggcgggggcgctccggcgggg 36312

>dbj|AK128553.1| Homo sapiens cDNA FLJ46712 fis, clone TRACH3016805, weakly  similar
           to Ankyrin 2
          Length = 4246

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 86  atggcgggggcgctccggcgggg 108
           |||||||||||||||||||||||
Sbjct: 7   atggcgggggcgctccggcgggg 29

>dbj|AB166789.1| Homo sapiens skeletrophin gene, promoter region
          Length = 496

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 86  atggcgggggcgctccggcgggg 108
           |||||||||||||||||||||||
Sbjct: 417 atggcgggggcgctccggcgggg 439

>gb|AC139758.3| Mus musculus BAC clone RP23-367E7 from chromosome 14, complete sequence
          Length = 210969

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 313    gtctagccacccattggtcaa 333
              |||||||||||||||||||||
Sbjct: 149289 gtctagccacccattggtcaa 149309

>gb|AC126243.3| Mus musculus BAC clone RP24-260I19 from chromosome 14, complete sequence
          Length = 180553

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 313    gtctagccacccattggtcaa 333
              |||||||||||||||||||||
Sbjct: 143462 gtctagccacccattggtcaa 143442

>gb|AF064528.1|AF064528 Rhodocista centenaria 3-methylcrotonyl-CoA carboxylase gene, partial
            cds; phototransducer (ptr) gene, complete cds; and
            unknown gene
          Length = 4743

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 85   gatggcgggggcgctccggcg 105
            |||||||||||||||||||||
Sbjct: 4018 gatggcgggggcgctccggcg 4038

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     gcgggcgtcggcggcgcatc 132
               ||||||||||||||||||||
Sbjct: 3542079 gcgggcgtcggcggcgcatc 3542098

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 113     gcgggcgtcggcggcgcatc 132
               ||||||||||||||||||||
Sbjct: 1868101 gcgggcgtcggcggcgcatc 1868082

>gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosome 14, complete
             sequence
          Length = 205141

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   gagaacaaggtggctcttct 264
             ||||||||||||||||||||
Sbjct: 65774 gagaacaaggtggctcttct 65755

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     tggcgatggcggcagcgttg 85
              ||||||||||||||||||||
Sbjct: 469045 tggcgatggcggcagcgttg 469064

>ref|XM_534184.2| PREDICTED: Canis familiaris similar to CG8257-PA (LOC476983), mRNA
          Length = 1992

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 ggcggggaagagcgggcgtc 121
           ||||||||||||||||||||
Sbjct: 342 ggcggggaagagcgggcgtc 323

>emb|AL512785.7| Human DNA sequence from clone RP11-565P22 on chromosome 1 Contains two
              novel genes, the 3' end of the gene for C-terminal PDZ
              domain ligand of neuronal nitric oxide synthase (CAPON), a
              novel gene (LOC284680), the EAT2 gene for SH2
              domain-containing molecule EAT2 and a CpG island, complete
              sequence
          Length = 116882

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 287    ctgcacaaggctgcccagca 306
              ||||||||||||||||||||
Sbjct: 110047 ctgcacaaggctgcccagca 110028

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete
             sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   gcgggcgtcggcggcgcatc 132
             ||||||||||||||||||||
Sbjct: 29098 gcgggcgtcggcggcgcatc 29079

>gb|AE012163.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 71 of
             460 of the complete genome
          Length = 13936

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 212   agcgcgttggcggctgccgaggcc 235
             ||||||||| ||||||||||||||
Sbjct: 11210 agcgcgttgccggctgccgaggcc 11233

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 212     agcgcgttggcggctgccgaggcc 235
               ||||||||| ||||||||||||||
Sbjct: 4254408 agcgcgttgccggctgccgaggcc 4254385

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   gcgggcgtcggcggcgcatc 132
             ||||||||||||||||||||
Sbjct: 30128 gcgggcgtcggcggcgcatc 30109


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,925,439
Number of Sequences: 3902068
Number of extensions: 1925439
Number of successful extensions: 37099
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36678
Number of HSP's gapped (non-prelim): 416
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)