Clone Name | bart30b07 |
---|---|
Clone Library Name | barley_pub |
>gb|AF112964.1|AF112964 Triticum aestivum small GTP-binding protein (Sgp) mRNA, complete cds Length = 1136 Score = 601 bits (303), Expect = e-168 Identities = 342/355 (96%) Strand = Plus / Plus Query: 209 atggcggccaacgccggcgccggcgccggcggcagcaagatccgcaacgccaagctggtt 268 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 256 atggcggccaacgccggcgccggcgccggtggcagcaagatccgcaacgccaagctggtt 315 Query: 269 cttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaagggccag 328 ||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 316 cttctgggggatgtcggcaccggcaagtccagcctggtgctccggttcgtcaagggccag 375 Query: 329 ttcgtcgagttccaggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtc 388 |||||||||||||||||||| |||| |||||| |||||||||||||| |||||||||||| Sbjct: 376 ttcgtcgagttccaggaatcgaccatcggcgcggccttcttctcgcagaccctggcggtc 435 Query: 389 aacgacgagacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagc 448 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 436 aacgatgagacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagc 495 Query: 449 ctggcgcccatgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||||||||||||||| |||||||| ||||| ||||||||||| |||||||||||| Sbjct: 496 ctggcgcccatgtactaccgcggcgccgcggccgcgatcgtcgtctacgacatcaccaac 555 Query: 509 gcggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaaggga 563 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 556 gcggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaaggga 610 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 36 cacacacgcgagtcgccgagaagaaagccccaaacttt 73 ||||||| ||||||||| ||||||||||||||| |||| Sbjct: 55 cacacacccgagtcgccaagaagaaagccccaaccttt 92 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 151 agcgatcgatcggatcccgccggccggaggt 181 ||||||||||||||||||||| | ||||||| Sbjct: 199 agcgatcgatcggatcccgcccgtcggaggt 229
>gb|AY107131.1| Zea mays PCO080814 mRNA sequence Length = 559 Score = 392 bits (198), Expect = e-106 Identities = 294/326 (90%) Strand = Plus / Plus Query: 236 ggcggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaag 295 ||||||| |||||||||||||||||||||||||||||| |||||||| ||| |||||||| Sbjct: 181 ggcggcaacaagatccgcaacgccaagctggttcttcttggggacgtgggcgccggcaag 240 Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccacc 355 ||||||||||| ||||| || || || ||||||||||||||||||||||||||||||| | Sbjct: 241 tccagcctggtcctccggtttgtgaaaggccagttcgtcgagttccaggaatccaccatc 300 Query: 356 ggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatc 415 ||||| || ||||||||||| ||||||||||| ||||||||||||||||||||||| || Sbjct: 301 ggcgcggctttcttctcgcagaccctggcggtgaacgacgagacggtcaagttcgagata 360 Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475 ||||||||||| || |||||| ||||||||||| |||| |||||||| ||||| ||||| Sbjct: 361 tgggacacggcggggcaggagcggtaccacagcttggctcccatgtattaccggggcgct 420 Query: 476 gccgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaa 535 || || ||||| || ||||| |||||||| ||||||||||||||||| ||||| |||||| Sbjct: 421 gcggctgccatagttgtctacgacatcacgaacgcggcctcttttacgcgtgcgaagaaa 480 Query: 536 tgggttcaagaacttcaagcacaagg 561 |||||||||||||||||||||||||| Sbjct: 481 tgggttcaagaacttcaagcacaagg 506
>emb|AJ292320.1|OSA292320 Oryza sativa mRNA for RAB5A protein Length = 969 Score = 299 bits (151), Expect = 5e-78 Identities = 280/323 (86%) Strand = Plus / Plus Query: 239 ggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtcc 298 |||| |||||||||||||||||||||||||||||| || || || ||||| |||||||| Sbjct: 193 ggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtcg 252 Query: 299 agcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggc 358 ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| |||| Sbjct: 253 agcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcggc 312 Query: 359 gccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgg 418 || |||||||||||||| ||| ||||||| |||||||||||||| ||||||||||||||| Sbjct: 313 gcggccttcttctcgcagaccttggcggttaacgacgagacggtgaagttcgaaatctgg 372 Query: 419 gacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgcc 478 || || || || ||||||||||| || ||| |||| || |||||||| ||||| || || Sbjct: 373 gatactgcagggcaggagaggtatcatagcttggctccgatgtactatcgtggtgcggct 432 Query: 479 gccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatgg 538 ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| |||||| Sbjct: 433 gccgcaatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatgg 492 Query: 539 gttcaagaacttcaagcacaagg 561 ||||||||||||||||| ||||| Sbjct: 493 gttcaagaacttcaagcgcaagg 515
>gb|AY029301.1| Oryza sativa small GTP-binding protein (rab5A) mRNA, complete cds Length = 1125 Score = 293 bits (148), Expect = 3e-76 Identities = 280/324 (86%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||||||||||||||| || || || ||||| |||||||| Sbjct: 192 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 251 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| ||| Sbjct: 252 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 311 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 ||| |||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||| Sbjct: 312 cgcggccttcttctcgcagaccttggcggttaacgacgagacggtgaagttcgaaatctg 371 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || ||||||||||| || || |||| || |||||||| ||||| || || Sbjct: 372 ggatactgcagggcaggagaggtatcatggcttggctccgatgtactatcgtggtgcggc 431 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| ||||| Sbjct: 432 tgccgcaatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 491 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 492 ggttcaagaacttcaagcgcaagg 515
>dbj|AK066784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013078I11, full insert sequence Length = 1032 Score = 293 bits (148), Expect = 3e-76 Identities = 280/324 (86%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||||||||||||||| || || || ||||| |||||||| Sbjct: 125 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 184 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| ||| Sbjct: 185 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 244 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 ||| |||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||| Sbjct: 245 cgcggccttcttctcgcaaaccttggcggttaacgatgagacggtgaagttcgaaatctg 304 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || ||||||||||| || ||| |||| || |||||||| || || || || Sbjct: 305 ggatactgcagggcaggagaggtatcatagcttggctccgatgtactatcggggtgcggc 364 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| ||||| Sbjct: 365 tgccgcgatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 424 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 425 ggttcaagaacttcaagcgcaagg 448
>dbj|AK061116.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E04, full insert sequence Length = 1043 Score = 293 bits (148), Expect = 3e-76 Identities = 280/324 (86%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||||||||||||||| || || || ||||| |||||||| Sbjct: 193 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 252 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| ||| Sbjct: 253 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 312 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 ||| |||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||| Sbjct: 313 cgcggccttcttctcgcaaaccttggcggttaacgatgagacggtgaagttcgaaatctg 372 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || ||||||||||| || ||| |||| || |||||||| || || || || Sbjct: 373 ggatactgcagggcaggagaggtatcatagcttggctccgatgtactatcggggtgcggc 432 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| ||||| Sbjct: 433 tgccgcgatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 492 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 493 ggttcaagaacttcaagcgcaagg 516
>gb|AY104686.1| Zea mays PCO088233 mRNA sequence Length = 1239 Score = 176 bits (89), Expect = 5e-41 Identities = 260/317 (82%) Strand = Plus / Plus Query: 245 aagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtccagcctg 304 ||||||||||||||||||||||||||||| || || || ||| | ||||| || ||| || Sbjct: 215 aagatccgcaacgccaagctggttcttcttggagatgtgggcgctggcaaatctagcttg 274 Query: 305 gtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggcgccgcc 364 || || || || || ||||| ||||| || || ||||||||||| || | || || ||| Sbjct: 275 gttcttcggtttgttaagggacagtttgttgaattccaggaatcaacaattggagcagcc 334 Query: 365 ttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgggacacg 424 ||||| || || ||| | |||||||| || ||||| || ||||||||||||||||| || Sbjct: 335 ttcttttcccagaccttagcggtcaatgatgagactgttaagttcgaaatctgggatact 394 Query: 425 gccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgccgccgcc 484 ||||| ||||||||||| || ||| |||| ||||||||||| | || || || || ||| Sbjct: 395 gccgggcaggagaggtatcatagcttggctcccatgtactataggggtgcagctgctgcc 454 Query: 485 atcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatgggttcaa 544 || || |||||||||||||| || ||||||| || || ||||| ||||||||||||||| Sbjct: 455 attgttgtctatgacatcacaaatccggcctccttcacccgtgccaagaaatgggttcaa 514 Query: 545 gaacttcaagcacaagg 561 ||||||||||| ||||| Sbjct: 515 gaacttcaagctcaagg 531
>ref|XM_469184.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1046 Score = 143 bits (72), Expect = 7e-31 Identities = 261/324 (80%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || || Sbjct: 176 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 235 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||| ||||||| || || || || || ||||| || ||||| |||||||| || | || Sbjct: 236 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 295 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 || || || ||||| || ||| | || || || ||||| || || ||||| |||||||| Sbjct: 296 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 355 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || |||||||| || |||||| |||| ||||||||||| | || || || Sbjct: 356 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 415 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 || ||||| || |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 416 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 475 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 476 ggttcaagaacttcaagctcaagg 499
>dbj|AK100036.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013150K06, full insert sequence Length = 1046 Score = 143 bits (72), Expect = 7e-31 Identities = 261/324 (80%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || || Sbjct: 176 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 235 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||| ||||||| || || || || || ||||| || ||||| |||||||| || | || Sbjct: 236 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 295 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 || || || ||||| || ||| | || || || ||||| || || ||||| |||||||| Sbjct: 296 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 355 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || |||||||| || |||||| |||| ||||||||||| | || || || Sbjct: 356 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 415 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 || ||||| || |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 416 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 475 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 476 ggttcaagaacttcaagctcaagg 499
>dbj|AK067459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013107F02, full insert sequence Length = 891 Score = 143 bits (72), Expect = 7e-31 Identities = 261/324 (80%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || || Sbjct: 84 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 143 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||| ||||||| || || || || || ||||| || ||||| |||||||| || | || Sbjct: 144 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 203 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 || || || ||||| || ||| | || || || ||||| || || ||||| |||||||| Sbjct: 204 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 263 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || |||||||| || |||||| |||| ||||||||||| | || || || Sbjct: 264 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 323 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 || ||||| || |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 324 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 383 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 384 ggttcaagaacttcaagctcaagg 407
>dbj|AK061203.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-210-B04, full insert sequence Length = 1101 Score = 143 bits (72), Expect = 7e-31 Identities = 261/324 (80%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297 ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || || Sbjct: 201 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 260 Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357 ||| ||||||| || || || || || ||||| || ||||| |||||||| || | || Sbjct: 261 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 320 Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417 || || || ||||| || ||| | || || || ||||| || || ||||| |||||||| Sbjct: 321 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 380 Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477 ||| || || || |||||||| || |||||| |||| ||||||||||| | || || || Sbjct: 381 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 440 Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537 || ||||| || |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 441 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 500 Query: 538 ggttcaagaacttcaagcacaagg 561 |||||||||||||||||| ||||| Sbjct: 501 ggttcaagaacttcaagctcaagg 524
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 127 bits (64), Expect = 4e-26 Identities = 139/164 (84%) Strand = Plus / Plus Query: 341 caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400 ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| |||||| Sbjct: 27058804 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 27058863 Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 || ||||||||||||||||| || || || ||||||||||| || ||| |||| || ||| Sbjct: 27058864 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 27058923 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 ||||| || || || || ||||| || || ||||| |||||||| Sbjct: 27058924 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 27058967 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Plus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 27059833 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 27059883 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 265 ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324 ||||||||| || || || ||||| |||||||| ||||| || ||||| || || ||||| Sbjct: 27058633 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 27058692 Query: 325 ccagttcgtcgagttccagg 344 |||||| || |||||||||| Sbjct: 27058693 ccagtttgttgagttccagg 27058712 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||||||||| Sbjct: 27058343 cggcaacaagatccgcaacgccaagctggt 27058372 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcggc 241 |||||||||||||||||||||| Sbjct: 16410306 cgccggcgccggcgccggcggc 16410285 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 219 acgccggcgccggcgccggcg 239 ||||||||||||||||||||| Sbjct: 2521791 acgccggcgccggcgccggcg 2521811 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 cggccaacgccggcgccggcgccg 236 |||||| ||||||||||||||||| Sbjct: 23920309 cggccaccgccggcgccggcgccg 23920286 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 16410287 cgccggcgccggcgccggcg 16410306 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 15805631 cgccggcgccggcgccggcg 15805650 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 15805650 cgccggcgccggcgccggcg 15805631 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 caccggcgccgccttcttct 371 |||||||||||||||||||| Sbjct: 10742157 caccggcgccgccttcttct 10742176 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 463 ctaccgtggcgccgccgccg 482 |||||||||||||||||||| Sbjct: 10206215 ctaccgtggcgccgccgccg 10206196 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 ctttctcctctcgatcgatc 89 |||||||||||||||||||| Sbjct: 2882799 ctttctcctctcgatcgatc 2882818 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 2521811 cgccggcgccggcgccggcg 2521792
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 127 bits (64), Expect = 4e-26 Identities = 139/164 (84%) Strand = Plus / Plus Query: 341 caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400 ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| |||||| Sbjct: 26984393 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 26984452 Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 || ||||||||||||||||| || || || ||||||||||| || ||| |||| || ||| Sbjct: 26984453 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 26984512 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 ||||| || || || || ||||| || || ||||| |||||||| Sbjct: 26984513 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 26984556 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Plus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 26985422 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 26985472 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 265 ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324 ||||||||| || || || ||||| |||||||| ||||| || ||||| || || ||||| Sbjct: 26984222 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 26984281 Query: 325 ccagttcgtcgagttccagg 344 |||||| || |||||||||| Sbjct: 26984282 ccagtttgttgagttccagg 26984301 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||||||||| Sbjct: 26983932 cggcaacaagatccgcaacgccaagctggt 26983961 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcggc 241 |||||||||||||||||||||| Sbjct: 16363539 cgccggcgccggcgccggcggc 16363518 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 219 acgccggcgccggcgccggcg 239 ||||||||||||||||||||| Sbjct: 2521735 acgccggcgccggcgccggcg 2521755 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 213 cggccaacgccggcgccggcgccg 236 |||||| ||||||||||||||||| Sbjct: 23848515 cggccaccgccggcgccggcgccg 23848492 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 16363520 cgccggcgccggcgccggcg 16363539 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 15758864 cgccggcgccggcgccggcg 15758883 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 15758883 cgccggcgccggcgccggcg 15758864 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 caccggcgccgccttcttct 371 |||||||||||||||||||| Sbjct: 10741856 caccggcgccgccttcttct 10741875 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 463 ctaccgtggcgccgccgccg 482 |||||||||||||||||||| Sbjct: 10206097 ctaccgtggcgccgccgccg 10206078 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 70 ctttctcctctcgatcgatc 89 |||||||||||||||||||| Sbjct: 2882743 ctttctcctctcgatcgatc 2882762 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 2521755 cgccggcgccggcgccggcg 2521736
>emb|AL713905.6|CNS07YQ5 Oryza sativa chromosome 12, . BAC OJ1584_D02 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 131300 Score = 127 bits (64), Expect = 4e-26 Identities = 139/164 (84%) Strand = Plus / Minus Query: 341 caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400 ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| |||||| Sbjct: 97433 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 97374 Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 || ||||||||||||||||| || || || ||||||||||| || ||| |||| || ||| Sbjct: 97373 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 97314 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 ||||| || || || || ||||| || || ||||| |||||||| Sbjct: 97313 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 97270 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| ||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 96404 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 96354 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 265 ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324 ||||||||| || || || ||||| |||||||| ||||| || ||||| || || ||||| Sbjct: 97604 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 97545 Query: 325 ccagttcgtcgagttccagg 344 |||||| || |||||||||| Sbjct: 97544 ccagtttgttgagttccagg 97525 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||||||||| Sbjct: 97894 cggcaacaagatccgcaacgccaagctggt 97865
>gb|M95071.1|MZEORFL Zea mays putative GTP-binding protein homolog mRNA, partial cds Length = 212 Score = 105 bits (53), Expect = 2e-19 Identities = 161/197 (81%) Strand = Plus / Plus Query: 245 aagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtccagcctg 304 ||||||||||||||||||||||||||||| || || || ||| | ||||| || ||| || Sbjct: 7 aagatccgcaacgccaagctggttcttcttggagatgtgggcgctggcaaatctagcttg 66 Query: 305 gtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggcgccgcc 364 || || || || || ||||| ||||| || || ||||||||||| || | || || ||| Sbjct: 67 gttcttcggtttgttaagggacagtttgttgaattccaggaatcaacaattggagcagcc 126 Query: 365 ttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgggacacg 424 ||||| || || ||| | |||||||| || ||||| || ||||||||||||||||| || Sbjct: 127 ttcttttcccagaccttagcggtcaatgatgagactgttaagttcgaaatctgggatact 186 Query: 425 gccggccaggagaggta 441 ||||| ||||||||||| Sbjct: 187 gccgggcaggagaggta 203
>ref|XM_511501.1| PREDICTED: Pan troglodytes similar to General control of amino acid synthesis protein 5-like 2 (Histone acetyltransferase GCN5) (mmGCN5) (LOC454678), mRNA Length = 1174 Score = 93.7 bits (47), Expect = 6e-16 Identities = 95/111 (85%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||| Sbjct: 293 acggtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggccccc 352 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 353 atgtactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 403
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| |||||||| || | ||||||||||| ||||||||||||||||| ||| Sbjct: 28267877 atctgggacaccgccggccaagaacgctaccacagccttgcgcccatgtactaccgcggc 28267936 Query: 473 gccgccgccgccatcgtcgtctatgacatc 502 || |||||||| |||||||||| |||||| Sbjct: 28267937 gcggccgccgctgtcgtcgtctacgacatc 28267966 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 207 ccatggcggccaacgccggcgccggc 232 ||||||||||||||| |||||||||| Sbjct: 6244224 ccatggcggccaacggcggcgccggc 6244249 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcggc 241 |||||||||||||||||||||| Sbjct: 1999465 cgccggcgccggcgccggcggc 1999486 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 27173925 cgccggcgccggcgccggcg 27173944 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 27173944 cgccggcgccggcgccggcg 27173925 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 24112004 cgccggcgccggcgccggcg 24112023 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 24112023 cgccggcgccggcgccggcg 24112004 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 cggcgccggcgccggcggca 242 |||||||||||||||||||| Sbjct: 7156761 cggcgccggcgccggcggca 7156780 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 6217606 cgccggcgccggcgccggcg 6217625 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 6217625 cgccggcgccggcgccggcg 6217606 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5442715 cgccggcgccggcgccggcg 5442734 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5442734 cgccggcgccggcgccggcg 5442715 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 1999484 cgccggcgccggcgccggcg 1999465
>dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0623A10 Length = 156517 Score = 91.7 bits (46), Expect = 2e-15 Identities = 79/90 (87%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| |||||||| || | ||||||||||| ||||||||||||||||| ||| Sbjct: 65906 atctgggacaccgccggccaagaacgctaccacagccttgcgcccatgtactaccgcggc 65965 Query: 473 gccgccgccgccatcgtcgtctatgacatc 502 || |||||||| |||||||||| |||||| Sbjct: 65966 gcggccgccgctgtcgtcgtctacgacatc 65995
>gb|BC106039.1| Homo sapiens RAB5C, member RAS oncogene family, transcript variant 2, mRNA (cDNA clone MGC:117217 IMAGE:4938169), complete cds Length = 1668 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 407 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 466 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 467 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 514
>ref|NM_004583.2| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 2, mRNA Length = 1674 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 408 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 467 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 468 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 515
>ref|NM_201434.1| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 1, mRNA Length = 1791 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 525 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 584 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 585 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 632
>gb|BT019484.1| Homo sapiens RAB5C, member RAS oncogene family mRNA, complete cds Length = 651 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315
>ref|XM_589241.2| PREDICTED: Bos taurus similar to Ras-related protein Rab-5A, transcript variant 1 (LOC539764), mRNA Length = 2076 Score = 87.7 bits (44), Expect = 4e-14 Identities = 86/100 (86%) Strand = Plus / Plus Query: 410 gaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgt 469 ||||| ||||| ||||| ||||| ||| ||||||||||||||||||||||||||||| | Sbjct: 388 gaaatatgggatacggctggccaagagcggtaccacagcctggcgcccatgtactacaga 447 Query: 470 ggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509 |||||| |||||||| ||||| || |||||||| |||| Sbjct: 448 ggcgcccaggccgccatagtcgtgtacgacatcacgaacg 487
>ref|XM_864602.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-5A, transcript variant 2 (LOC539764), mRNA Length = 2097 Score = 87.7 bits (44), Expect = 4e-14 Identities = 86/100 (86%) Strand = Plus / Plus Query: 410 gaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgt 469 ||||| ||||| ||||| ||||| ||| ||||||||||||||||||||||||||||| | Sbjct: 409 gaaatatgggatacggctggccaagagcggtaccacagcctggcgcccatgtactacaga 468 Query: 470 ggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509 |||||| |||||||| ||||| || |||||||| |||| Sbjct: 469 ggcgcccaggccgccatagtcgtgtacgacatcacgaacg 508
>emb|CR724508.1|CNS0GLZ6 Tetraodon nigroviridis full-length cDNA Length = 646 Score = 87.7 bits (44), Expect = 4e-14 Identities = 95/112 (84%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||||||||||||||||||| | |||||||| ||||| || Sbjct: 441 acggtgaagtttgagatctgggacacggccggccaggagcgctaccacagtctggctcct 500 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509 ||||| ||||| ||||| ||||||||||| ||||| |||||||| |||| Sbjct: 501 atgtattaccgaggcgcgcaggccgccatcgtggtctacgacatcacaaacg 552 Score = 58.0 bits (29), Expect = 3e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 ||||||||| |||||||||||||||||||||| || ||| ||| |||||||| Sbjct: 336 aagtccagcttggtgctccgcttcgtcaagggtcaattccacgaattccagga 388
>emb|CR860097.1| Pongo pygmaeus mRNA; cDNA DKFZp468C168 (from clone DKFZp468C168) Length = 1650 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 393 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 452 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 453 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 500
>emb|CR626803.1| full-length cDNA clone CS0DI004YB12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1558 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471
>emb|CR625641.1| full-length cDNA clone CS0DI053YE06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1577 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 366 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 425 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 426 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 473
>emb|CR625174.1| full-length cDNA clone CS0DI013YF02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1531 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 347 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 406 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 407 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 454
>emb|CR624854.1| full-length cDNA clone CS0DH002YK07 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1610 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 387 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 446 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 447 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 494
>emb|CR623581.1| full-length cDNA clone CS0DI044YG15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1576 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471
>emb|CR622103.1| full-length cDNA clone CS0DI086YP22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1568 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 350 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 409 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 410 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 457
>emb|CR621567.1| full-length cDNA clone CS0DC023YN19 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1565 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471
>emb|CR620573.1| full-length cDNA clone CS0DE008YO18 of Placenta of Homo sapiens (human) Length = 1661 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 417 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 476 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 477 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 524
>emb|CR620653.1| full-length cDNA clone CS0DF002YO05 of Fetal brain of Homo sapiens (human) Length = 1721 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 504 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 563 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 564 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 611
>emb|CR617879.1| full-length cDNA clone CS0DD007YI09 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1336 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 120 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 179 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 180 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 227
>emb|CR617757.1| full-length cDNA clone CS0DI010YH11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1598 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489
>emb|CR615479.1| full-length cDNA clone CS0DA009YL15 of Neuroblastoma of Homo sapiens (human) Length = 1607 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489
>emb|CR613867.1| full-length cDNA clone CS0DC028YA10 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1584 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489
>emb|CR612483.1| full-length cDNA clone CS0DH005YE20 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1414 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 217 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 276 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 277 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 324
>emb|CR612169.1| full-length cDNA clone CS0DI006YD09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1500 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 296 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 355 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 356 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 403
>emb|CR611639.1| full-length cDNA clone CS0DE004YH07 of Placenta of Homo sapiens (human) Length = 1602 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 374 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 433 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 434 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 481
>emb|CR607787.1| full-length cDNA clone CS0DI010YF11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1595 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489
>emb|CR607771.1| full-length cDNA clone CS0DI077YG09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1620 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 404 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 463 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 464 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 511
>emb|CR608029.1| full-length cDNA clone CS0DC015YE20 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1593 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 374 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 433 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 434 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 481
>emb|CR603551.1| full-length cDNA clone CS0DM007YF04 of Fetal liver of Homo sapiens (human) Length = 1599 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 387 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 446 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 447 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 494
>emb|CR601486.1| full-length cDNA clone CS0DA006YF19 of Neuroblastoma of Homo sapiens (human) Length = 1570 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 366 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 425 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 426 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 473
>emb|CR600565.1| full-length cDNA clone CS0DI075YN07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1599 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487
>emb|CR600279.1| full-length cDNA clone CS0DB005YK02 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 1591 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 376 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 435 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 483
>emb|CR599091.1| full-length cDNA clone CS0DI081YC13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1593 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487
>emb|CR595237.1| full-length cDNA clone CL0BA011ZH04 of Placenta of Homo sapiens (human) Length = 1632 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489
>emb|CR591906.1| full-length cDNA clone CS0DI042YG22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1589 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487
>emb|CR591636.1| full-length cDNA clone CS0DI022YM14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1590 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 376 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 435 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 483
>gb|AF498938.1| Homo sapiens small GTP binding protein RAB5C (RAB5C) mRNA, complete cds Length = 651 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315
>emb|CR541901.1| Homo sapiens full open reading frame cDNA clone RZPDo834B1233D for gene RAB5C, RAB5C, member RAS oncogene family; complete cds, incl. stopcodon Length = 651 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315
>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence Length = 174902 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Minus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 496 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 437 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 389
>gb|AF141304.1|AF141304 Homo sapiens small GTPase (RAB5C) mRNA, complete cds Length = 729 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 277 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 336 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 337 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 384
>gb|AY888260.1| Synthetic construct Homo sapiens clone FLH009616.01X RAB5C member RAS oncogene family (RAB5C) mRNA, complete cds Length = 651 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315
>dbj|AK025474.1| Homo sapiens cDNA: FLJ21821 fis, clone HEP01311, highly similar to HSU18420 Human ras-related small GTP binding protein Rab5 (rab5) mRNA Length = 2378 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 1112 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 1171 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 1172 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 1219
>gb|AY893587.1| Synthetic construct Homo sapiens clone FLH130878.01X RAB5C member RAS oncogene family (RAB5C) mRNA, complete cds Length = 651 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315
>gb|AC003104.1|AC003104 Homo sapiens chromosome 17, clone HCIT48C15, complete sequence Length = 100635 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 9561 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 9620 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 9621 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 9668
>gb|U18420.1|HSU18420 Human ras-related small GTP binding protein Rab5 (rab5) mRNA, complete cds Length = 1590 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 343 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 402 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 403 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 450
>gb|U11293.1|HSU11293 Human Rab5c-like protein mRNA, complete cds Length = 1529 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 283 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 342 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| |||||||||||||||||| Sbjct: 343 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 390
>gb|DQ215564.1| Taeniopygia guttata clone 0061P0006C04 RAB5C member RAS oncogene family-like mRNA, complete sequence Length = 1393 Score = 85.7 bits (43), Expect = 1e-13 Identities = 94/111 (84%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||||||||| || |||||| | |||||||||||||| ||| Sbjct: 349 acggtgaagtttgagatctgggacacggcggggcaggagcgataccacagcctggccccc 408 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||||||||| || || || |||||||| ||||| |||||||||||| Sbjct: 409 atgtactaccggggggctcaggcagccatcgtggtctacgacatcaccaac 459 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||||||||| || ||||| |||||||| |||||| ||||| |||||| Sbjct: 244 aagtccagcctggtcctgcgctttgtcaaggggcagttccacgagtaccagga 296
>emb|AJ437656.1|SCH437656 Simmondsia chinensis mRNA for Rab-related small GTP-binding protein (rab gene) Length = 837 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| ||||| ||||| ||||| || || ||||||||||| | |||| ||| Sbjct: 202 acggtgaagtttgaaatatgggatacggctggtcaagagaggtaccatattttggctccc 261 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517 ||||||||| | |||||||| || ||||| | |||||||||||||||| ||||| || Sbjct: 262 atgtactacagaggcgccgcagctgccattattgtctatgacatcaccagcgcggattca 321 Query: 518 tttacacgtgcaaagaaatgggttcaagaacttca 552 ||| ||| ||| ||||||||||| || |||||||| Sbjct: 322 tttgcacttgctaagaaatgggtacaggaacttca 356
>emb|BX052472.1|CNS09CNG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 560 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 619 Query: 464 taccg 468 ||||| Sbjct: 620 taccg 624 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 458 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 502
>emb|BX032716.1|CNS08XEO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 524 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 326 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 385 Query: 464 taccg 468 ||||| Sbjct: 386 taccg 390 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 224 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 268
>emb|BX028733.1|CNS08UC1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556 Query: 464 taccg 468 ||||| Sbjct: 557 taccg 561 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439
>emb|BX020822.1|CNS08O8A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 516 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 196 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 255 Query: 464 taccg 468 ||||| Sbjct: 256 taccg 260 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttc 331 |||||| | ||||||||||||||||||||| Sbjct: 94 ctggtgttacgcttcgtcaagggccagttc 123
>ref|XM_555603.1| Anopheles gambiae str. PEST ENSANGP00000027173 (ENSANGG00000007604), partial mRNA Length = 513 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 316 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 375 Query: 464 taccg 468 ||||| Sbjct: 376 taccg 380 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 214 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 258
>ref|XM_317586.2| Anopheles gambiae str. PEST ENSANGP00000023894 (ENSANGG00000007604), partial mRNA Length = 513 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 316 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 375 Query: 464 taccg 468 ||||| Sbjct: 376 taccg 380 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 214 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 258
>ref|XM_317587.2| Anopheles gambiae str. PEST ENSANGP00000023388 (ENSANGG00000007604), partial mRNA Length = 890 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 471 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 530 Query: 464 taccg 468 ||||| Sbjct: 531 taccg 535 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 369 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 413
>ref|XM_317584.2| Anopheles gambiae str. PEST ENSANGP00000022645 (ENSANGG00000007604), partial mRNA Length = 916 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556 Query: 464 taccg 468 ||||| Sbjct: 557 taccg 561 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439
>ref|XM_317588.2| Anopheles gambiae str. PEST ENSANGP00000010093 (ENSANGG00000007604), partial mRNA Length = 966 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 547 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 606 Query: 464 taccg 468 ||||| Sbjct: 607 taccg 611 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 445 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 489
>ref|XM_317585.2| Anopheles gambiae str. PEST ENSANGP00000022624 (ENSANGG00000007604), partial mRNA Length = 916 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| ||||||||||| |||||||||||||| Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556 Query: 464 taccg 468 ||||| Sbjct: 557 taccg 561 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439
>ref|NM_001034743.1| Bos taurus RAB5C, member RAS oncogene family isoform b (RAB5C), mRNA Length = 1045 Score = 79.8 bits (40), Expect = 9e-12 Identities = 91/108 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 391 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 450 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| ||||| |||||||||||| Sbjct: 451 tactatcggggggcccaggctgccatcgtggtctacgacatcaccaac 498 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 ||||| |||||||| || ||||||||||||||||| |||||| ||||| |||||| Sbjct: 280 ggcaaatccagcctcgtcctccgcttcgtcaagggtcagttccacgagtaccagga 335
>emb|Z27110.1|CFRAB5C C.familiaris mRNA for Rab5c protein Length = 763 Score = 79.8 bits (40), Expect = 9e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || || |||||| |||| ||||||||||| ||||||||||| || || Sbjct: 322 atctgggacacagctggacaggagcggtatcacagcctggcccccatgtactatcggggg 381 Query: 473 gccgccgccgccatcgtcgtctatgacatcaccaac 508 ||| || |||||||| |||||||||||||||||| Sbjct: 382 gcccaggctgccatcgtggtctatgacatcaccaac 417
>ref|NM_001003261.1| Canis familiaris RAB5C, member RAS oncogene family (RAB5C), mRNA Length = 763 Score = 79.8 bits (40), Expect = 9e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || || |||||| |||| ||||||||||| ||||||||||| || || Sbjct: 322 atctgggacacagctggacaggagcggtatcacagcctggcccccatgtactatcggggg 381 Query: 473 gccgccgccgccatcgtcgtctatgacatcaccaac 508 ||| || |||||||| |||||||||||||||||| Sbjct: 382 gcccaggctgccatcgtggtctatgacatcaccaac 417
>gb|BT021518.1| Bos taurus RAB5C, member RAS oncogene family (RAB5C), mRNA, complete cds Length = 1045 Score = 79.8 bits (40), Expect = 9e-12 Identities = 91/108 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||||| Sbjct: 391 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 450 Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 ||||| || || ||| || |||||||| ||||| |||||||||||| Sbjct: 451 tactatcggggggcccaggctgccatcgtggtctacgacatcaccaac 498 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 ||||| |||||||| || ||||||||||||||||| |||||| ||||| |||||| Sbjct: 280 ggcaaatccagcctcgtcctccgcttcgtcaagggtcagttccacgagtaccagga 335
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Plus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| || |||||||||||||||||||||||||||||||| ||||| Sbjct: 25949684 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 25949734 Score = 58.0 bits (29), Expect = 3e-05 Identities = 83/101 (82%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| ||||||||||| || || || |||||||| || |||||| |||| ||||||||| Sbjct: 25948887 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 25948946 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 || | || || || || ||||| || |||||||||||||| Sbjct: 25948947 tataggggtgcggctgctgccatagttgtctatgacatcac 25948987 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 222 ccggcgccggcgccggcggcagca 245 |||||||||||||||||||||||| Sbjct: 35006709 ccggcgccggcgccggcggcagca 35006686 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 219 acgccggcgccggcgccggcggc 241 ||||||||||||||||||||||| Sbjct: 33690497 acgccggcgccggcgccggcggc 33690475 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtc 109 ||||||||||||||||||||||| Sbjct: 29709006 atccatccgtccgtccgtccgtc 29708984 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||| Sbjct: 12457412 ccggcgccggcgccggcggcagc 12457434 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 217 caacgccggcgccggcgccggcg 239 ||||||||||||||||||||||| Sbjct: 5609838 caacgccggcgccggcgccggcg 5609816 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 472 cgccgccgccgccatcgtcgtc 493 |||||||||||||||||||||| Sbjct: 27434878 cgccgccgccgccatcgtcgtc 27434857 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||| ||||| Sbjct: 25948031 cggcaacaagatccgcaacgccaaactggt 25948060 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggcagcaag 247 |||||||||||||||||||| ||||| Sbjct: 12643700 ccggcgccggcgccggcggcggcaag 12643725 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcggc 241 |||||||||||||||||||||| Sbjct: 3105099 cgccggcgccggcgccggcggc 3105078 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 283 cggcaccggcaagtccagcct 303 ||||||||||||||||||||| Sbjct: 21353801 cggcaccggcaagtccagcct 21353781 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 473 gccgccgccgccatcgtcgtc 493 ||||||||||||||||||||| Sbjct: 5412078 gccgccgccgccatcgtcgtc 5412098 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 219 acgccggcgccggcgccggcg 239 ||||||||||||||||||||| Sbjct: 5104482 acgccggcgccggcgccggcg 5104502 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcggc 241 ||||||||||||||||||||| Sbjct: 2862003 gccggcgccggcgccggcggc 2862023 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 470 ggcgccgccgccgccatcgtcgtct 494 ||||||||| ||||||||||||||| Sbjct: 965675 ggcgccgccaccgccatcgtcgtct 965651 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 acgccggcgccggcgccggc 238 |||||||||||||||||||| Sbjct: 34058122 acgccggcgccggcgccggc 34058103 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33690477 cgccggcgccggcgccggcg 33690496 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 ggcaccggcaagtccagcct 303 |||||||||||||||||||| Sbjct: 33634017 ggcaccggcaagtccagcct 33633998 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 ggcaccggcaagtccagcct 303 |||||||||||||||||||| Sbjct: 33629763 ggcaccggcaagtccagcct 33629744 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33527522 cgccggcgccggcgccggcg 33527541 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33527541 cgccggcgccggcgccggcg 33527522 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 212 gcggccaacgccggcgccggcgccggcg 239 ||||||| || ||||||||||||||||| Sbjct: 30349191 gcggccaccggcggcgccggcgccggcg 30349218 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 30242716 ccggcgccggcgccggcggc 30242735 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 470 ggcgccgccgccgccatcgtcgtc 493 ||||||||||||||| |||||||| Sbjct: 27111938 ggcgccgccgccgccgtcgtcgtc 27111961 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcgg 240 |||||||||||||||||||| Sbjct: 13577548 gccggcgccggcgccggcgg 13577567 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5609816 cgccggcgccggcgccggcg 5609835 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5104502 cgccggcgccggcgccggcg 5104483 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 4881950 ccggcgccggcgccggcggc 4881969 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 4731341 ccggcgccggcgccggcggc 4731360 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3637992 cgccggcgccggcgccggcg 3637973 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3637973 cgccggcgccggcgccggcg 3637992 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3105080 cgccggcgccggcgccggcg 3105099 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 gcgccggcgccggcggcagc 244 |||||||||||||||||||| Sbjct: 1652613 gcgccggcgccggcggcagc 1652594
>gb|AC135792.3| Oryza sativa chromosome 3 BAC OSJNBa0056E06 genomic sequence, complete sequence Length = 140720 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| || |||||||||||||||||||||||||||||||| ||||| Sbjct: 58236 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 58186 Score = 58.0 bits (29), Expect = 3e-05 Identities = 83/101 (82%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| ||||||||||| || || || |||||||| || |||||| |||| ||||||||| Sbjct: 59033 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 58974 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 || | || || || || ||||| || |||||||||||||| Sbjct: 58973 tataggggtgcggctgctgccatagttgtctatgacatcac 58933 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||| ||||| Sbjct: 59889 cggcaacaagatccgcaacgccaaactggt 59860
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 77.8 bits (39), Expect = 4e-11 Identities = 48/51 (94%) Strand = Plus / Plus Query: 511 ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||||||| || |||||||||||||||||||||||||||||||| ||||| Sbjct: 26040993 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 26041043 Score = 58.0 bits (29), Expect = 3e-05 Identities = 83/101 (82%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| ||||||||||| || || || |||||||| || |||||| |||| ||||||||| Sbjct: 26040196 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 26040255 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 || | || || || || ||||| || |||||||||||||| Sbjct: 26040256 tataggggtgcggctgctgccatagttgtctatgacatcac 26040296 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 222 ccggcgccggcgccggcggcagca 245 |||||||||||||||||||||||| Sbjct: 35096781 ccggcgccggcgccggcggcagca 35096758 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 219 acgccggcgccggcgccggcggc 241 ||||||||||||||||||||||| Sbjct: 33780969 acgccggcgccggcgccggcggc 33780947 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtc 109 ||||||||||||||||||||||| Sbjct: 29800428 atccatccgtccgtccgtccgtc 29800406 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||| Sbjct: 12454175 ccggcgccggcgccggcggcagc 12454197 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 217 caacgccggcgccggcgccggcg 239 ||||||||||||||||||||||| Sbjct: 5609051 caacgccggcgccggcgccggcg 5609029 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 472 cgccgccgccgccatcgtcgtc 493 |||||||||||||||||||||| Sbjct: 27526201 cgccgccgccgccatcgtcgtc 27526180 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 238 cggcagcaagatccgcaacgccaagctggt 267 ||||| |||||||||||||||||| ||||| Sbjct: 26039340 cggcaacaagatccgcaacgccaaactggt 26039369 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggcagcaag 247 |||||||||||||||||||| ||||| Sbjct: 12640463 ccggcgccggcgccggcggcggcaag 12640488 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcggc 241 |||||||||||||||||||||| Sbjct: 3105210 cgccggcgccggcgccggcggc 3105189 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 283 cggcaccggcaagtccagcct 303 ||||||||||||||||||||| Sbjct: 21346830 cggcaccggcaagtccagcct 21346810 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 473 gccgccgccgccatcgtcgtc 493 ||||||||||||||||||||| Sbjct: 5411293 gccgccgccgccatcgtcgtc 5411313 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 219 acgccggcgccggcgccggcg 239 ||||||||||||||||||||| Sbjct: 5103699 acgccggcgccggcgccggcg 5103719 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcggc 241 ||||||||||||||||||||| Sbjct: 2862114 gccggcgccggcgccggcggc 2862134 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 470 ggcgccgccgccgccatcgtcgtct 494 ||||||||| ||||||||||||||| Sbjct: 965673 ggcgccgccaccgccatcgtcgtct 965649 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 219 acgccggcgccggcgccggc 238 |||||||||||||||||||| Sbjct: 34148594 acgccggcgccggcgccggc 34148575 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33780949 cgccggcgccggcgccggcg 33780968 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 ggcaccggcaagtccagcct 303 |||||||||||||||||||| Sbjct: 33724489 ggcaccggcaagtccagcct 33724470 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 ggcaccggcaagtccagcct 303 |||||||||||||||||||| Sbjct: 33720235 ggcaccggcaagtccagcct 33720216 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33618013 cgccggcgccggcgccggcg 33617994 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 33617994 cgccggcgccggcgccggcg 33618013 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 212 gcggccaacgccggcgccggcgccggcg 239 ||||||| || ||||||||||||||||| Sbjct: 30440613 gcggccaccggcggcgccggcgccggcg 30440640 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 30334138 ccggcgccggcgccggcggc 30334157 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 470 ggcgccgccgccgccatcgtcgtc 493 ||||||||||||||| |||||||| Sbjct: 27203261 ggcgccgccgccgccgtcgtcgtc 27203284 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcgg 240 |||||||||||||||||||| Sbjct: 13573423 gccggcgccggcgccggcgg 13573442 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5609029 cgccggcgccggcgccggcg 5609048 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 5103719 cgccggcgccggcgccggcg 5103700 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 4881165 ccggcgccggcgccggcggc 4881184 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggc 241 |||||||||||||||||||| Sbjct: 4731456 ccggcgccggcgccggcggc 4731475 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3638084 cgccggcgccggcgccggcg 3638103 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3638103 cgccggcgccggcgccggcg 3638084 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 3105191 cgccggcgccggcgccggcg 3105210 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 225 gcgccggcgccggcggcagc 244 |||||||||||||||||||| Sbjct: 1652611 gcgccggcgccggcggcagc 1652592
>ref|NM_001030328.2| Xenopus tropicalis RAB5A protein (RAB5A), mRNA Length = 1003 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/110 (83%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||||||||| || ||||||||||| ||||| |||| ||| Sbjct: 414 acggtgaagtttgagatctgggacacggcagggcaggagaggtatcacagtttggccccc 473 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507 ||||||||||| || ||| || ||||| || || |||||||||||||| Sbjct: 474 atgtactaccgaggagcccaggcagccattgtagtttatgacatcaccaa 523 Score = 44.1 bits (22), Expect = 0.49 Identities = 34/38 (89%) Strand = Plus / Plus Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||| |||| || |||||||| ||||||||||| Sbjct: 309 aagtccagcttggtcctgcgcttcgttaagggccagtt 346
>emb|CR761238.2| Xenopus tropicalis finished cDNA, clone TEgg117g03 Length = 1003 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/110 (83%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||||||||| || ||||||||||| ||||| |||| ||| Sbjct: 414 acggtgaagtttgagatctgggacacggcagggcaggagaggtatcacagtttggccccc 473 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507 ||||||||||| || ||| || ||||| || || |||||||||||||| Sbjct: 474 atgtactaccgaggagcccaggcagccattgtagtttatgacatcaccaa 523 Score = 44.1 bits (22), Expect = 0.49 Identities = 34/38 (89%) Strand = Plus / Plus Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||| |||| || |||||||| ||||||||||| Sbjct: 309 aagtccagcttggtcctgcgcttcgttaagggccagtt 346
>emb|BX052473.1|CNS09CNH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 73.8 bits (37), Expect = 5e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||||||||||||||| || || || ||||| ||||||||||| |||||||||||||| Sbjct: 720 aagttcgaaatctgggaaactgctggacaggaaaggtaccacagtttggcgcccatgtac 661 Query: 464 taccg 468 ||||| Sbjct: 660 taccg 656 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 822 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 778
>emb|BX028734.1|CNS08UC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 73.8 bits (37), Expect = 5e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||||||||||||||| || || || ||||| ||||||||||| |||||||||||||| Sbjct: 715 aagttcgaaatctgggaaactgctggacaggaaaggtaccacagtttggcgcccatgtac 656 Query: 464 taccg 468 ||||| Sbjct: 655 taccg 651
>gb|BC047803.1| Danio rerio RAB5A, member RAS oncogene family, mRNA (cDNA clone MGC:56009 IMAGE:3819814), complete cds Length = 2408 Score = 71.9 bits (36), Expect = 2e-09 Identities = 126/156 (80%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456 |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| || Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457 Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516 |||||||||| | || ||| |||||||| || || |||||||||||||| | || || Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517 Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552 ||| || | |||||||| |||||| |||| ||||| Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553
>gb|BC063966.1| Danio rerio RAB5A, member RAS oncogene family, mRNA (cDNA clone MGC:77676 IMAGE:6997315), complete cds Length = 1858 Score = 71.9 bits (36), Expect = 2e-09 Identities = 126/156 (80%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456 |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| || Sbjct: 393 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 452 Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516 |||||||||| | || ||| |||||||| || || |||||||||||||| | || || Sbjct: 453 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 512 Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552 ||| || | |||||||| |||||| |||| ||||| Sbjct: 513 atttgcaagagcaaagaactgggttaaagagcttca 548
>ref|XM_697418.1| PREDICTED: Danio rerio hypothetical protein LOC554855 (LOC554855), mRNA Length = 2378 Score = 71.9 bits (36), Expect = 2e-09 Identities = 126/156 (80%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456 |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| || Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457 Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516 |||||||||| | || ||| |||||||| || || |||||||||||||| | || || Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517 Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552 ||| || | |||||||| |||||| |||| ||||| Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553
>ref|NM_201485.1| Danio rerio RAB5A, member RAS oncogene family (rab5a), mRNA Length = 2408 Score = 71.9 bits (36), Expect = 2e-09 Identities = 126/156 (80%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456 |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| || Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457 Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516 |||||||||| | || ||| |||||||| || || |||||||||||||| | || || Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517 Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552 ||| || | |||||||| |||||| |||| ||||| Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553
>gb|BC029678.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone MGC:36507 IMAGE:5368061), complete cds Length = 1587 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 346 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 405 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 406 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 456 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 238 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 279
>gb|BC023027.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone MGC:36517 IMAGE:5369566), complete cds Length = 1620 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 362 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 421 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 422 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 472 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 254 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 295
>gb|AY081181.1| Drosophila melanogaster clone LD03788 Rab5 mRNA, complete cds Length = 1736 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 461 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 519 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 359 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 402
>gb|AY081180.1| Drosophila melanogaster clone GM02432 Rab5 mRNA, complete cds Length = 886 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 377 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 435 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 275 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 318
>emb|AJ721020.1| Gallus gallus mRNA for hypothetical protein, clone 32j11 Length = 1090 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || ||||||||||| || ||||||||| | |||||||| ||||| ||| Sbjct: 347 acggtgaagtttgagatctgggacacagcaggccaggagcgataccacagtctggccccc 406 Query: 458 atgtactaccg 468 ||||||||||| Sbjct: 407 atgtactaccg 417 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 245 tccagcctggtgctgcgcttcgtcaaggggcagttccacgagtaccagga 294
>ref|NM_024456.1| Mus musculus RAB5C, member RAS oncogene family (Rab5c), mRNA Length = 1943 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 407 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 466 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 467 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 517 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 299 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 340
>ref|NM_164479.1| Drosophila melanogaster Rab-protein 5 CG3664-RF, transcript variant F (Rab5), mRNA Length = 1741 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 455 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 513 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 353 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 396
>ref|NM_164478.1| Drosophila melanogaster Rab-protein 5 CG3664-RD, transcript variant D (Rab5), mRNA Length = 1759 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 473 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 531 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 371 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 414
>ref|NM_164477.1| Drosophila melanogaster Rab-protein 5 CG3664-RC, transcript variant C (Rab5), mRNA Length = 2063 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 777 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 835 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 675 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 718
>ref|NM_164476.1| Drosophila melanogaster Rab-protein 5 CG3664-RB, transcript variant B (Rab5), mRNA Length = 1980 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 694 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 752 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 592 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 635
>ref|NM_164475.1| Drosophila melanogaster Rab-protein 5 CG3664-RA, transcript variant A (Rab5), mRNA Length = 1765 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 479 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 537 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 377 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 420
>ref|NM_078733.2| Drosophila melanogaster Rab-protein 5 CG3664-RE, transcript variant E (Rab5), mRNA Length = 1775 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 489 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 547 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 387 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 430
>dbj|AK167599.1| Mus musculus 13 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530024J05 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1877 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 396 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 455 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 456 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 506 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 288 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 329
>dbj|AK172328.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830201H23 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1580 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 353 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 412 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 413 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 463 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 245 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 286
>gb|AY060343.1| Drosophila melanogaster GH24702 full length cDNA Length = 2061 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 777 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 835 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 675 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 718
>dbj|AK159832.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420032F05 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1622 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 396 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 455 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 456 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 506 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 288 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 329
>dbj|AK170540.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630107G03 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1642 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 416 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 475 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 476 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 526 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 308 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 349
>emb|CR388793.1| Gallus gallus finished cDNA, clone ChEST518p6 Length = 669 Score = 69.9 bits (35), Expect = 9e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || ||||||||||| || ||||||||| | |||||||| ||||| ||| Sbjct: 312 acggtgaagtttgagatctgggacacagcaggccaggagcgataccacagtctggccccc 371 Query: 458 atgtactaccg 468 ||||||||||| Sbjct: 372 atgtactaccg 382 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 210 tccagcctggtgctgcgcttcgtcaaggggcagttccacgagtaccagga 259
>gb|BC027378.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone IMAGE:4951081), partial cds Length = 1528 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 168 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 227 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 228 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 278 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 60 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 101
>dbj|AK089199.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630036C17 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1943 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 407 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 466 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 467 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 517 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 299 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 340
>emb|BX950869.14| Zebrafish DNA sequence from clone CH211-1J13 in linkage group 19, complete sequence Length = 91362 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456 |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| || Sbjct: 52059 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 52118 Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507 |||||||||| | || ||| |||||||| || || |||||||||||||| Sbjct: 52119 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaa 52169
>emb|AL591469.9| Mouse DNA sequence from clone RP23-390D17 on chromosome 11, complete sequence Length = 168981 Score = 69.9 bits (35), Expect = 9e-09 Identities = 92/111 (82%) Strand = Plus / Minus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 129459 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 129400 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 129399 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 129349 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Minus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 130899 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 130858
>dbj|AB035671.1| Drosophila melanogaster mRNA for Rab5 protein, complete cds Length = 1377 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 478 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 536 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 376 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 419
>dbj|AB035353.1| Drosophila melanogaster mRNA for Drab5, complete cds Length = 1054 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462 |||||||| |||||||||||||| ||||||||| ||||||||||| | || |||||||| Sbjct: 507 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 565 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 405 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 448
>gb|BC056058.1| Xenopus laevis Rab-protein 5, mRNA (cDNA clone MGC:69022 IMAGE:4964226), complete cds Length = 2426 Score = 67.9 bits (34), Expect = 3e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || ||||||||||| || || ||||||||||||||||| |||| ||| Sbjct: 356 acggtgaagtttgagatctgggacaccgcagggcaggagaggtaccacagtttggccccc 415 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507 |||||||| || || ||| || ||||| || || |||||||||||||| Sbjct: 416 atgtactatcgaggagcccaggcggccattgtagtttatgacatcaccaa 465
>gb|BC045466.1| Danio rerio RAB5C, member RAS oncogene family, mRNA (cDNA clone MGC:55826 IMAGE:3817929), complete cds Length = 2268 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 |||||||||||||||||||| ||||||||||| |||||||| Sbjct: 430 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 470 Score = 44.1 bits (22), Expect = 0.49 Identities = 70/86 (81%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475 |||||||||||||| |||||| |||| ||||| |||| || ||||| ||| | || ||| Sbjct: 556 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 615 Query: 476 gccgccgccatcgtcgtctatgacat 501 || |||||||||||||| ||||| Sbjct: 616 caggcagccatcgtcgtctacgacat 641
>ref|XM_843712.1| PREDICTED: Canis familiaris similar to RAB17, member RAS oncogene family (LOC607120), mRNA Length = 939 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagc 448 ||||| || ||||||||||||||||||||||||| |||||||||| Sbjct: 499 aagtttgagatctgggacacggccggccaggagaagtaccacagc 543
>emb|X63875.1|NTRAB5 N.tabacum SR1 mRNA Nt-rab5 Length = 712 Score = 65.9 bits (33), Expect = 1e-07 Identities = 120/149 (80%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||| || || || |||||||||||||||||| | ||||| Sbjct: 270 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccacagcttagcgcct 329 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517 ||||||||| | || || || || || ||| |||| ||||||||||| | | | | || Sbjct: 330 atgtactacagaggtgctgcagctgctatcatcgtgtatgacatcacaagcactgaatca 389 Query: 518 tttacacgtgcaaagaaatgggttcaaga 546 || |||| |||||||||||||||||||| Sbjct: 390 cttgcacgagcaaagaaatgggttcaaga 418
>emb|BX039831.1|CNS092WB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 619 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 |||||||||||||||||||| || || ||||| || ||| |||| |||||||||||||| Sbjct: 494 aagttcgaaatctgggacactgctggacaggaaagatacgacagtttggcgcccatgtac 553 Query: 464 taccg 468 ||||| Sbjct: 554 taccg 558 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346 |||||| | ||||||||||||||||||||| ||||| ||||||| Sbjct: 392 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 436
>gb|BC065634.1| Danio rerio RAB5C, member RAS oncogene family, mRNA (cDNA clone MGC:77261 IMAGE:6964045), complete cds Length = 2278 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 |||||||||||||||||||| ||||||||||| |||||||| Sbjct: 385 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 425 Score = 44.1 bits (22), Expect = 0.49 Identities = 70/86 (81%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475 |||||||||||||| |||||| |||| ||||| |||| || ||||| ||| | || ||| Sbjct: 511 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 570 Query: 476 gccgccgccatcgtcgtctatgacat 501 || |||||||||||||| ||||| Sbjct: 571 caggcagccatcgtcgtctacgacat 596
>emb|BX005093.22| Zebrafish DNA sequence from clone CH211-210G13 in linkage group 3, complete sequence Length = 155392 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 |||||||||||||||||||| ||||||||||| |||||||| Sbjct: 38155 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 38115 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| || ||||||||||||||||| |||||| |||| ||||| |||| || ||||| Sbjct: 32674 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 32615 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacat 501 ||| | || ||| || |||||||||||||| ||||| Sbjct: 32614 tacagaggagcccaggcagccatcgtcgtctacgacat 32577
>ref|XM_697428.1| PREDICTED: Danio rerio hypothetical protein LOC554438 (LOC554438), mRNA Length = 2246 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 |||||||||||||||||||| ||||||||||| |||||||| Sbjct: 432 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 472 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| || ||||||||||||||||| |||||| |||| ||||| |||| || ||||| Sbjct: 546 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 605 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacat 501 ||| | || ||| || |||||||||||||| ||||| Sbjct: 606 tacagaggagcccaggcagccatcgtcgtctacgacat 643
>ref|NM_201501.1| Danio rerio RAB5C, member RAS oncogene family (rab5c), mRNA Length = 2268 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 |||||||||||||||||||| ||||||||||| |||||||| Sbjct: 430 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 470 Score = 44.1 bits (22), Expect = 0.49 Identities = 70/86 (81%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475 |||||||||||||| |||||| |||| ||||| |||| || ||||| ||| | || ||| Sbjct: 556 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 615 Query: 476 gccgccgccatcgtcgtctatgacat 501 || |||||||||||||| ||||| Sbjct: 616 caggcagccatcgtcgtctacgacat 641
>emb|Y07811.1|GGRAB5CLP G.gallus mRNA for rab5C-like protein Length = 1278 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| ||||| ||||| ||||| || |||||| |||| ||||||||||| ||| Sbjct: 212 acggtgaagtttgaaatatgggatacggcaggacaggagcggtatcacagcctggcaccc 271 Query: 458 atgtactaccg 468 ||||| ||||| Sbjct: 272 atgtattaccg 282
>ref|NM_204525.1| Gallus gallus RAB5C, member RAS oncogene family (RAB5C), mRNA Length = 1278 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| ||||| ||||| ||||| || |||||| |||| ||||||||||| ||| Sbjct: 212 acggtgaagtttgaaatatgggatacggcaggacaggagcggtatcacagcctggcaccc 271 Query: 458 atgtactaccg 468 ||||| ||||| Sbjct: 272 atgtattaccg 282
>dbj|AK134691.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330525E15 product:RAB5C, member RAS oncogene family, full insert sequence Length = 1829 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || Sbjct: 346 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 405 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || |||| || |||||||||||||||||| Sbjct: 406 atgtactatcggggggcccaagcatccattgtggtctatgacatcaccaac 456 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 238 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 279
>ref|XM_213463.3| PREDICTED: Rattus norvegicus RAB5C, member RAS oncogene family (predicted) (Rab5c_predicted), mRNA Length = 1878 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||||||||| || ||||||||||| || || || ||| | || ||||||||||| || Sbjct: 404 acggtcaagtttgagatctgggacacagctgggcaagagcgatatcacagcctggccccg 463 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508 |||||||| || || ||| || ||||| || |||||||||||||||||| Sbjct: 464 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 514 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331 ||||| ||||||||||| |||||||| |||||||| |||||| Sbjct: 296 ggcaaatccagcctggtcctccgctttgtcaaggggcagttc 337
>gb|BT013315.1| Lycopersicon esculentum clone 135000F, mRNA sequence Length = 1546 Score = 60.0 bits (30), Expect = 8e-06 Identities = 120/150 (80%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||| || || || |||||||||||||| ||| | ||||| Sbjct: 214 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccatagcttagcgcct 273 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517 ||||| ||| | || || || || || || |||||||||||||||||| | | | || Sbjct: 274 atgtattacaggggtgctgcagcagctattatcgtctatgacatcaccagcactgattca 333 Query: 518 tttacacgtgcaaagaaatgggttcaagaa 547 ||| |||| |||||||||||||| |||||| Sbjct: 334 tttgcacgggcaaagaaatgggtgcaagaa 363
>gb|BT012776.1| Lycopersicon esculentum clone 113755R, mRNA sequence Length = 1003 Score = 60.0 bits (30), Expect = 8e-06 Identities = 120/150 (80%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || |||||||| || || || |||||||||||||| ||| | ||||| Sbjct: 212 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccatagcttagcgcct 271 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517 ||||| ||| | || || || || || || |||||||||||||||||| | | | || Sbjct: 272 atgtattacaggggtgctgcagcagctattatcgtctatgacatcaccagcactgattca 331 Query: 518 tttacacgtgcaaagaaatgggttcaagaa 547 ||| |||| |||||||||||||| |||||| Sbjct: 332 tttgcacgggcaaagaaatgggtgcaagaa 361
>ref|XM_749452.1| Aspergillus fumigatus Af293 RAB GTPase Ypt51 (Afu3g10740) partial mRNA Length = 789 Score = 60.0 bits (30), Expect = 8e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 402 tcaagttcgaaatctgggacacggccggccagga 435 |||||||||||||||||||||| ||||||||||| Sbjct: 191 tcaagttcgaaatctgggacacagccggccagga 224
>emb|CR665120.2|CNS0FC6E Tetraodon nigroviridis full-length cDNA Length = 877 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactac 466 ||||||||||||||||| || ||| | |||||||| ||||| |||||||||||| Sbjct: 396 atctgggacacggccgggcaagagcgctaccacagtctggcacccatgtactac 449
>emb|AL590448.1|CNS07EGF chromosome VIII of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 238147 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 402 tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctg 451 |||||||||| || |||||||| || ||||||||||||||| |||||||| Sbjct: 86931 tcaagttcgagatatgggacactgcaggccaggagaggtacaacagcctg 86980
>gb|AY112178.1| Zea mays CL13607_1 mRNA sequence Length = 614 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 524 cgtgcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||| |||||||||||||||||||||||||| ||||| Sbjct: 612 cgtgcgaagaaatgggttcaagaacttcaagcccaagg 575
>ref|XM_778785.1| PREDICTED: Strongylocentrotus purpuratus similar to Ras-related protein Rab-5C (RAB5L) (L1880) (LOC578627), mRNA Length = 1106 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| |||||||||||||| ||||| || ||| | ||||||||| |||| || |||||| Sbjct: 465 aagtttgaaatctgggacacagccggacaagagcgttaccacagcttggcacctatgtac 524 Query: 464 taccg 468 ||||| Sbjct: 525 taccg 529
>ref|XM_777279.1| PREDICTED: Strongylocentrotus purpuratus similar to RAB5B, member RAS oncogene family (LOC577021), mRNA Length = 1933 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| |||||||||||||| ||||| || ||| | ||||||||| |||| || |||||| Sbjct: 58 aagtttgaaatctgggacacagccggacaagagcgttaccacagcttggcacctatgtac 117 Query: 464 taccg 468 ||||| Sbjct: 118 taccg 122
>emb|AJ296341.1|CIN296341 Cichorium intybus X cichorium endivia partial ggtp1 gene for GTP binding protein, exons 1-3 Length = 467 Score = 58.0 bits (29), Expect = 3e-05 Identities = 101/125 (80%) Strand = Plus / Plus Query: 342 aggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacgg 401 ||||||| || | ||||||||||||||| ||||||||| | ||||| ||||| | |||| Sbjct: 159 aggaatcgacaatcggcgccgccttcttttcgcaaaccttagcggtaaacgatgcaacgg 218 Query: 402 tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgt 461 | || || || || ||||| ||||| || || || ||||| || ||| |||| ||||||| Sbjct: 219 tgaaatttgagatatgggatacggcgggtcaagaaaggtatcatagcttggctcccatgt 278 Query: 462 actac 466 ||||| Sbjct: 279 actac 283
>emb|AJ296338.1|CIN296338 Cichorium intybus X cichorium endivia partial ggtp0 gene for GTP bindinf protein, exons 1-3 Length = 466 Score = 58.0 bits (29), Expect = 3e-05 Identities = 101/125 (80%) Strand = Plus / Plus Query: 342 aggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacgg 401 ||||||| || | ||||||||||||||| ||||||||| | ||||| ||||| | |||| Sbjct: 158 aggaatcgacaatcggcgccgccttcttttcgcaaaccttagcggtaaacgatgcaacgg 217 Query: 402 tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgt 461 | || || || || ||||| ||||| || || || ||||| || ||| |||| ||||||| Sbjct: 218 tgaaatttgagatatgggatacggcgggtcaagaaaggtatcatagcttggctcccatgt 277 Query: 462 actac 466 ||||| Sbjct: 278 actac 282
>ref|NM_133685.1| Mus musculus RAB31, member RAS oncogene family (Rab31), mRNA Length = 3416 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || ||||||||| ||| |||| |||||| || ||||||||||| || Sbjct: 312 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 371 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | || || ||| || |||||||||||||||| Sbjct: 372 tctgctgcagccgtcatcgtctatgacatcac 403
>gb|BC072360.1| Xenopus laevis hypothetical protein MGC83515, mRNA (cDNA clone MGC:83515 IMAGE:4755502), complete cds Length = 1293 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||||||||||||||||| Sbjct: 310 atctgggacacggccggccaggagaggt 337
>emb|CT025302.2| Xenopus tropicalis finished cDNA, clone TNeu107b15 Length = 1312 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||||||||||||||||| Sbjct: 296 atctgggacacggccggccaggagaggt 323
>emb|BX511265.13| Zebrafish DNA sequence from clone RP71-45G20 in linkage group 9, complete sequence Length = 183988 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 156346 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 156291 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 158739 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 158698
>gb|BC013063.1| Mus musculus RAB31, member RAS oncogene family, mRNA (cDNA clone MGC:7715 IMAGE:3497938), complete cds Length = 3416 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || ||||||||| ||| |||| |||||| || ||||||||||| || Sbjct: 312 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 371 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | || || ||| || |||||||||||||||| Sbjct: 372 tctgctgcagccgtcatcgtctatgacatcac 403
>gb|BC066634.1| Danio rerio RAB5B, member RAS oncogene family, mRNA (cDNA clone MGC:76978 IMAGE:6525746), complete cds Length = 2364 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 372 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 427 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 245 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 286
>dbj|AK159095.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420001G12 product:Similar to RAB31, member RAS oncogene family, full insert sequence Length = 3364 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || ||||||||| ||| |||| |||||| || ||||||||||| || Sbjct: 272 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 331 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | || || ||| || |||||||||||||||| Sbjct: 332 tctgctgcagccgtcatcgtctatgacatcac 363
>dbj|AK156677.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830037B14 product:Similar to RAB31, member RAS oncogene family, full insert sequence Length = 3474 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || ||||||||| ||| |||| |||||| || ||||||||||| || Sbjct: 384 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 443 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | || || ||| || |||||||||||||||| Sbjct: 444 tctgctgcagccgtcatcgtctatgacatcac 475
>ref|XM_703529.1| PREDICTED: Danio rerio similar to RAB5A member RAS oncogene family, transcript variant 2 (LOC573322), mRNA Length = 729 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 406 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 461 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 279 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 320
>ref|XM_681894.1| PREDICTED: Danio rerio similar to RAB5A member RAS oncogene family, transcript variant 1 (LOC573322), mRNA Length = 684 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 361 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 416 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 234 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 275
>dbj|AK051270.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130027D07 product:GTP-BINDING PROTEIN RAB0 homolog [Rattus norvegicus], full insert sequence Length = 3392 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || ||||||||| ||| |||| |||||| || ||||||||||| || Sbjct: 303 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 362 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | || || ||| || |||||||||||||||| Sbjct: 363 tctgctgcagccgtcatcgtctatgacatcac 394
>ref|NM_212885.1| Danio rerio RAB5B, member RAS oncogene family (rab5b), mRNA Length = 2364 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 372 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 427 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 245 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 286
>ref|XM_578804.1| PREDICTED: Rattus norvegicus similar to RAB17, member RAS oncogene family (LOC503269), mRNA Length = 1143 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| ||||||||||||| |||||||||| Sbjct: 712 atctgggacacagccggccaggagaagtaccacagc 747
>emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 in linkage group 9, complete sequence Length = 211682 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471 |||||||| ||||| || ||| | ||||||||| |||| ||||||||||||||||| Sbjct: 207698 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 207753 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330 ||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 205304 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 205345
>ref|XM_598573.2| PREDICTED: Bos taurus similar to RAS and EF hand domain containing (LOC520334), mRNA Length = 2367 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 414 tctgggacacggccggccaggagaggtaccacagc 448 |||||||||| || ||||||||||||||||||||| Sbjct: 1958 tctgggacacagctggccaggagaggtaccacagc 1992
>ref|XM_363259.1| Magnaporthe grisea 70-15 hypothetical protein (MG01185.4) partial mRNA Length = 774 Score = 54.0 bits (27), Expect = 5e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 |||||||||||||| ||||||||||| || |||||||| || ||| | ||||| ||| Sbjct: 310 acggtcaagttcgagatctgggacacagctggccaggaaagatacaagtctctggctccc 369 Query: 458 atgtactaccg 468 ||||||||||| Sbjct: 370 atgtactaccg 380
>ref|XM_959718.1| Neurospora crassa OR74A hypothetical protein (NCU00895.1) partial mRNA Length = 663 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggag 436 |||||||||||||| |||||||| || |||||||||||| Sbjct: 202 acggtcaagttcgagatctgggataccgccggccaggag 240
>ref|XM_325074.1| Neurospora crassa OR74A hypothetical protein (NCU00895.1) partial mRNA Length = 663 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggag 436 |||||||||||||| |||||||| || |||||||||||| Sbjct: 202 acggtcaagttcgagatctgggataccgccggccaggag 240
>gb|BT012805.1| Lycopersicon esculentum clone 113821R, mRNA sequence Length = 978 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 527 gcaaagaaatgggttcaagaacttcaagcacaagg 561 ||||| ||||||||||| ||||||||||||||||| Sbjct: 472 gcaaaaaaatgggttcaggaacttcaagcacaagg 506
>emb|BX842682.1| Neurospora crassa DNA linkage group I BAC contig B13C5 Length = 116467 Score = 54.0 bits (27), Expect = 5e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggag 436 |||||||||||||| |||||||| || |||||||||||| Sbjct: 108053 acggtcaagttcgagatctgggataccgccggccaggag 108091
>ref|XM_228043.3| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 9830134C10 gene (LOC309649), mRNA Length = 2094 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 416 tgggacacggccggccaggagaggtaccacagcct 450 |||||||||||||| || ||||||||||||||||| Sbjct: 1762 tgggacacggccggacaagagaggtaccacagcct 1796
>ref|XM_527372.1| PREDICTED: Pan troglodytes similar to RIKEN cDNA 9830134C10 gene (LOC471993), mRNA Length = 3732 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 414 tctgggacacggccggccaggagaggtaccacag 447 ||||||||||||| ||||| |||||||||||||| Sbjct: 2402 tctgggacacggctggccaagagaggtaccacag 2435
>ref|XM_878893.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family, transcript variant 6 (LOC539150), mRNA Length = 1103 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429 Query: 461 tactac 466 |||||| Sbjct: 430 tactac 435
>ref|XM_585238.2| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family, transcript variant 1 (LOC539150), mRNA Length = 3351 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429 Query: 461 tactac 466 |||||| Sbjct: 430 tactac 435
>ref|XM_878835.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family, transcript variant 5 (LOC539150), mRNA Length = 3324 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429 Query: 461 tactac 466 |||||| Sbjct: 430 tactac 435
>ref|XM_878801.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family, transcript variant 4 (LOC539150), mRNA Length = 1064 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429 Query: 461 tactac 466 |||||| Sbjct: 430 tactac 435
>ref|XM_866612.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family, transcript variant 3 (LOC539150), mRNA Length = 3300 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429 Query: 461 tactac 466 |||||| Sbjct: 430 tactac 435
>ref|XM_604898.2| PREDICTED: Bos taurus similar to RAB6B, member RAS oncogene family (LOC526526), partial mRNA Length = 956 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 414 tctgggacacggccggccaggagaggtaccacagcctg 451 |||||||||| |||||||||||||||| || ||||||| Sbjct: 68 tctgggacacagccggccaggagaggttccgcagcctg 105
>ref|XM_848388.1| PREDICTED: Canis familiaris similar to RAB6B, member RAS oncogene family (LOC610830), mRNA Length = 983 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 414 tctgggacacggccggccaggagaggtaccacagcctg 451 |||||||||| |||||||||||||||| || ||||||| Sbjct: 185 tctgggacacagccggccaggagaggttccgcagcctg 222
>ref|XM_851035.1| PREDICTED: Canis familiaris similar to RAB5B, member RAS oncogene family, transcript variant 3 (LOC474394), mRNA Length = 1296 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 371 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 430 Query: 461 tactac 466 |||||| Sbjct: 431 tactac 436
>ref|XM_531627.2| PREDICTED: Canis familiaris similar to RAB5B, member RAS oncogene family, transcript variant 1 (LOC474394), mRNA Length = 1406 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460 |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| |||||| Sbjct: 371 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 430 Query: 461 tactac 466 |||||| Sbjct: 431 tactac 436
>emb|CR938123.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YJ18AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 852 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 411 aaatctgggacacggccggccaggag 436 |||||||||||||||||||||||||| Sbjct: 383 aaatctgggacacggccggccaggag 408
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 Length = 2661830 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagag 438 |||||||||||||||||| ||||| || ||||| |||||||| Sbjct: 2001899 gacggtcaagttcgaaatatgggataccgccggtcaggagag 2001940
>ref|XM_688516.1| PREDICTED: Danio rerio similar to Aldehyde dehydrogenase 7 family, member A1 (LOC573432), mRNA Length = 960 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463 ||||| || ||||||||||||||||| |||||| |||| ||||| |||| || ||||| Sbjct: 832 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 891 Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacat 501 ||| | || ||| || |||||||||||||| ||||| Sbjct: 892 tacagaggagcccaggcagccatcgtcgtctacgacat 929
>gb|AC092186.1|AC092186 Drosophila melanogaster, chromosome 2L, region 22D-22E, BAC clone BACR22P10, complete sequence Length = 184650 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggta 441 |||||||| |||||||||||||| ||||||||| |||| Sbjct: 119882 aagttcgagatctgggacacggctggccaggagcggta 119845 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Minus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 119984 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 119941
>tpg|BK000968.1| TPA: TPA_exp: Drosophila melanogaster CG4272 gene, partial sequence; and Rab5 (Rab5) gene, complete cds Length = 6778 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 404 aagttcgaaatctgggacacggccggccaggagaggta 441 |||||||| |||||||||||||| ||||||||| |||| Sbjct: 4359 aagttcgagatctgggacacggctggccaggagcggta 4396 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Plus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 4257 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 4300
>emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, complete sequence Length = 192029 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 80 tcgatcgatccatccgtccgtccgtccgtc 109 |||||| ||||||||||||||||||||||| Sbjct: 100238 tcgatccatccatccgtccgtccgtccgtc 100267 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 87 atccatccgtccgtccgtccgtc 109 ||||||||||||||||||||||| Sbjct: 100637 atccatccgtccgtccgtccgtc 100659 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 83 atcgatccatccgtccgtccgtccgtc 109 |||||||||||| |||||||||||||| Sbjct: 100237 atcgatccatccatccgtccgtccgtc 100263 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 87 atccatccgtccgtccgtccgtc 109 ||||||||||||||||||||||| Sbjct: 100025 atccatccgtccgtccgtccgtc 100047
>gb|AY104562.1| Zea mays PCO063085 mRNA sequence Length = 1170 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtac 442 ||||||||||| |||||||||||||||||| Sbjct: 450 atctgggacaccgccggccaggagaggtac 479
>gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 of 83 of the complete sequence Length = 303641 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggta 441 |||||||| |||||||||||||| ||||||||| |||| Sbjct: 130091 aagttcgagatctgggacacggctggccaggagcggta 130054 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Minus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 130193 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 130150
>gb|AC004315.1|AC004315 Drosophila melanogaster (P1 DS03279 (D209)) DNA sequence, complete sequence Length = 35867 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 404 aagttcgaaatctgggacacggccggccaggagaggta 441 |||||||| |||||||||||||| ||||||||| |||| Sbjct: 23383 aagttcgagatctgggacacggctggccaggagcggta 23346 Score = 48.1 bits (24), Expect = 0.031 Identities = 39/44 (88%) Strand = Plus / Minus Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345 |||||||| |||||||||||||| |||||| ||||| |||||| Sbjct: 23485 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 23442
>ref|XM_450547.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1200 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggta 441 ||||||||||| ||||||||||||||||| Sbjct: 318 atctgggacaccgccggccaggagaggta 346
>gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W22 allele, complete cds Length = 961 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcggcagca 245 ||||||||||||||||||||||||| Sbjct: 396 gccggcgccggcgccggcggcagca 420
>gb|AF320614.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1170 allele, complete cds Length = 6669 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||||| Sbjct: 2922 cgccggcgccggcgccggcggcagc 2946 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 2941 cgccggcgccggcgccggcg 2922
>gb|AF320613.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1162 allele, complete cds Length = 6666 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||||| Sbjct: 2924 cgccggcgccggcgccggcggcagc 2948 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 2943 cgccggcgccggcgccggcg 2924
>gb|AC104702.2| Drosophila melanogaster 3L BAC RP98-11B4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 153146 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtcgc 111 ||||||||||||||||||||||||| Sbjct: 110213 atccatccgtccgtccgtccgtcgc 110189
>gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169425 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtcgc 111 ||||||||||||||||||||||||| Sbjct: 31664 atccatccgtccgtccgtccgtcgc 31640
>ref|NM_139854.1| Drosophila melanogaster CG8583-RA (CG8583), mRNA Length = 2942 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtcgc 111 ||||||||||||||||||||||||| Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630
>gb|BC094134.1| Xenopus laevis cDNA clone MGC:115056 IMAGE:6957039, complete cds Length = 1610 Score = 50.1 bits (25), Expect = 0.008 Identities = 58/69 (84%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| ||||| || ||||||||||| || || || ||| | ||||||||||| ||||| Sbjct: 314 acggtgaagtttgagatctgggacacagcgggacaagagcgctaccacagccttgcgcct 373 Query: 458 atgtactac 466 ||||||||| Sbjct: 374 atgtactac 382
>dbj|AK111872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040K07, full insert sequence Length = 1205 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggta 441 ||||||||||| ||||||||||||||||| Sbjct: 393 atctgggacaccgccggccaggagaggta 421
>emb|X06333.1|ZMC1 Z.mays DNA for c1 locus Length = 4060 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||||| Sbjct: 1663 cgccggcgccggcgccggcggcagc 1687 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 1682 cgccggcgccggcgccggcg 1663
>dbj|AK104132.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-D05, full insert sequence Length = 1098 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggta 441 ||||||||||| ||||||||||||||||| Sbjct: 325 atctgggacaccgccggccaggagaggta 353
>dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092H24, full insert sequence Length = 1200 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggta 441 ||||||||||| ||||||||||||||||| Sbjct: 318 atctgggacaccgccggccaggagaggta 346
>gb|AY110109.1| Zea mays CL16448_2 mRNA sequence Length = 958 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggta 441 ||||||||||| ||||||||||||||||| Sbjct: 265 atctgggacaccgccggccaggagaggta 293
>gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26 of 83 of the complete sequence Length = 269948 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtcgc 111 ||||||||||||||||||||||||| Sbjct: 154765 atccatccgtccgtccgtccgtcgc 154741
>gb|BT001562.1| Drosophila melanogaster RE14391 full insert cDNA Length = 2957 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 87 atccatccgtccgtccgtccgtcgc 111 ||||||||||||||||||||||||| Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630
>gb|AF015269.1|AF015269 Zea mays retrotransposon Magellan, complete sequence, and PL transcription factor (Pl) gene, complete cds Length = 3218 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcggcagca 245 ||||||||||||||||||||||||| Sbjct: 2584 gccggcgccggcgccggcggcagca 2608
>gb|AF015268.1|AF015268 Zea mays PL transcription factor (Pl) gene, promoter and complete cds Length = 1900 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 221 gccggcgccggcgccggcggcagca 245 ||||||||||||||||||||||||| Sbjct: 1266 gccggcgccggcgccggcggcagca 1290
>gb|M37153.1|MZEMYBAA Z.mays c1 locus myb homologue cDNA, exons 1-3 Length = 4059 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 220 cgccggcgccggcgccggcggcagc 244 ||||||||||||||||||||||||| Sbjct: 1663 cgccggcgccggcgccggcggcagc 1687 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 cgccggcgccggcgccggcg 239 |||||||||||||||||||| Sbjct: 1682 cgccggcgccggcgccggcg 1663
>gb|BC013170.1| Mus musculus RAB17, member RAS oncogene family, mRNA (cDNA clone MGC:6497 IMAGE:2648145), complete cds Length = 1653 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 454 atctgggacacagccggccaggagaagtacca 485
>gb|BC072698.1| Rattus norvegicus RAB31, member RAS oncogene family, mRNA (cDNA clone MGC:91462 IMAGE:7105732), complete cds Length = 3335 Score = 48.1 bits (24), Expect = 0.031 Identities = 75/92 (81%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || || |||||| ||| ||| |||||| |||||||| ||||| ||| Sbjct: 265 atctgggacaccgctggtcaggagcggttccattccctggctcccatgtattaccgaggc 324 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | ||||| ||| || | |||||||||||||| Sbjct: 325 tcggccgcagccgtcatagtctatgacatcac 356
>ref|NM_192276.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1542 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 283 cggcaccggcaagtccagcctggt 306 |||||||||||||||||||||||| Sbjct: 741 cggcaccggcaagtccagcctggt 764
>ref|XM_516181.1| PREDICTED: Pan troglodytes similar to RAB17, member RAS oncogene family (LOC460049), mRNA Length = 2145 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 1072 atctgggacacagctggccaggagaagtaccacagc 1107
>ref|XM_470371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 627 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 222 ccggcgccggcgccggcggcagca 245 |||||||||||||||||||||||| Sbjct: 141 ccggcgccggcgccggcggcagca 164
>gb|BC074609.1| Xenopus tropicalis RAB30, member RAS oncogene family, mRNA (cDNA clone MGC:69471 IMAGE:5336103), complete cds Length = 1414 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||| ||||||||||||| Sbjct: 356 atctgggacacggctggccaggagaggt 383
>gb|AC118682.8| Mus musculus chromosome 1, clone RP23-448B17, complete sequence Length = 195334 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 60547 atctgggacacagccggccaggagaagtacca 60578
>ref|NM_145094.2| Rattus norvegicus RAB31, member RAS oncogene family (Rab31), mRNA Length = 3335 Score = 48.1 bits (24), Expect = 0.031 Identities = 75/92 (81%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472 ||||||||||| || || |||||| ||| ||| |||||| |||||||| ||||| ||| Sbjct: 265 atctgggacaccgctggtcaggagcggttccattccctggctcccatgtattaccgaggc 324 Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504 | ||||| ||| || | |||||||||||||| Sbjct: 325 tcggccgcagccgtcatagtctatgacatcac 356
>gb|AY166852.2| Homo sapiens RAB41 mRNA, complete cds Length = 1538 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 504 atctgggacacggccggccaggag 527
>ref|XM_881629.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-26, transcript variant 3 (LOC515675), mRNA Length = 2821 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||| ||||||||||||| Sbjct: 151 atctgggacacggctggccaggagaggt 178
>ref|XM_868411.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-26, transcript variant 2 (LOC515675), mRNA Length = 2915 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||| ||||||||||||| Sbjct: 349 atctgggacacggctggccaggagaggt 376
>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence, complete sequence Length = 130272 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 222 ccggcgccggcgccggcggcagca 245 |||||||||||||||||||||||| Sbjct: 7610 ccggcgccggcgccggcggcagca 7587
>gb|BC051071.1| Mus musculus RAB17, member RAS oncogene family, mRNA (cDNA clone MGC:58945 IMAGE:6307319), complete cds Length = 1801 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 581 atctgggacacagccggccaggagaagtacca 612
>ref|NM_008998.2| Mus musculus RAB17, member RAS oncogene family (Rab17), mRNA Length = 1788 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 606 atctgggacacagccggccaggagaagtacca 637
>gb|BC114066.1| Bos taurus RAB26, member RAS oncogene family, mRNA (cDNA clone MGC:137742 IMAGE:8165990), complete cds Length = 1933 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||| ||||||||||||| Sbjct: 509 atctgggacacggctggccaggagaggt 536
>ref|NM_022449.1| Homo sapiens RAB17, member RAS oncogene family (RAB17), mRNA Length = 1982 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 857 atctgggacacagctggccaggagaagtaccacagc 892
>gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10, complete sequence Length = 143073 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 416 tgggacacggccggccaggagaggtacc 443 |||||||| ||||||||||||||||||| Sbjct: 66934 tgggacaccgccggccaggagaggtacc 66907
>ref|XM_975892.1| PREDICTED: Mus musculus RAB17, member RAS oncogene family, transcript variant 2 (Rab17), mRNA Length = 1154 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 588 atctgggacacagccggccaggagaagtacca 619
>ref|XM_741403.1| Aspergillus fumigatus Af293 ras-like GTP-binding protein (Afu4g03100) partial mRNA Length = 885 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 184 atctgggacacggccggccaggag 207
>gb|BC082988.1| Homo sapiens RAB43, member RAS oncogene family, mRNA (cDNA clone IMAGE:5738096), **** WARNING: chimeric clone **** Length = 2983 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 288 atctgggacacggccggccaggag 311
>gb|BC034011.1| Mus musculus cDNA clone IMAGE:4239538, **** WARNING: chimeric clone **** Length = 4908 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 570 atctgggacacagccggccaggagaagtacca 601
>ref|XM_502830.1| Yarrowia lipolytica CLIB122, YALI0D14630g predicted mRNA Length = 651 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 193 atctgggacacggccggccaggag 216
>emb|BX065790.1|CNS09MXE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 436 atctgggacacggccggccaggag 459
>emb|BX040474.1|CNS093E6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC11BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 774 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 419 atctgggacacggccggccaggag 442
>emb|Z37503.1|VFRABGTPB V.faba mRNA for guanine nucleotide regulatory protein Length = 873 Score = 48.1 bits (24), Expect = 0.031 Identities = 123/156 (78%) Strand = Plus / Plus Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457 ||||| || ||||| || |||||||| || || || ||||| ||||| ||| |||| ||| Sbjct: 278 acggtgaaattcgagatttgggacacagcggggcaagagagataccatagcttggctccc 337 Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517 ||||| ||| | ||||| || || || ||| | |||||||||||||| | | | | || Sbjct: 338 atgtattacagaggcgctgctgctgctatcattgtctatgacatcactagctcagattca 397 Query: 518 tttacacgtgcaaagaaatgggttcaagaacttcaa 553 |||||||| || || || ||||||||||| |||||| Sbjct: 398 tttacacgagctaaaaagtgggttcaagagcttcaa 433
>emb|X70804.1|MMRAB17AA M.musculus rab17 mRNA Length = 645 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtacca 444 ||||||||||| ||||||||||||| |||||| Sbjct: 211 atctgggacacagccggccaggagaagtacca 242
>emb|CR457282.1| Homo sapiens full open reading frame cDNA clone RZPDo834E039D for gene RAB17, RAB17, member RAS oncogene family; complete cds, incl. stopcodon Length = 639 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 211 atctgggacacagctggccaggagaagtaccacagc 246
>ref|NM_001006108.1| Xenopus tropicalis RAB30, member RAS oncogene family (rsb30), mRNA Length = 1414 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggt 440 |||||||||||||| ||||||||||||| Sbjct: 356 atctgggacacggctggccaggagaggt 383
>emb|AL136645.1|HSM801615 Homo sapiens mRNA; cDNA DKFZp564M1541 (from clone DKFZp564M1541) Length = 1608 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 481 atctgggacacagctggccaggagaagtaccacagc 516
>emb|BX323459.20| Zebrafish DNA sequence from clone DKEYP-27C11 in linkage group 6, complete sequence Length = 168538 Score = 48.1 bits (24), Expect = 0.031 Identities = 48/56 (85%) Strand = Plus / Minus Query: 449 ctggcgcccatgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504 ||||| |||||||||||| | ||| | || || |||||| |||||||||||||||| Sbjct: 143227 ctggctcccatgtactacagaggctctgctgcggccatcatcgtctatgacatcac 143172
>dbj|AK128345.1| Homo sapiens cDNA FLJ46487 fis, clone THYMU3026783 Length = 4272 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 322 atctgggacacggccggccaggag 345
>emb|CR626220.1| full-length cDNA clone CS0DI005YB17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1511 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 419 atctgggacacagctggccaggagaagtaccacagc 454
>emb|CR624533.1| full-length cDNA clone CS0DI005YC13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1528 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 437 atctgggacacagctggccaggagaagtaccacagc 472
>emb|CR621894.1| full-length cDNA clone CS0DI034YJ09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1519 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 429 atctgggacacagctggccaggagaagtaccacagc 464
>emb|CR620019.1| full-length cDNA clone CS0DM014YA08 of Fetal liver of Homo sapiens (human) Length = 1500 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 512 atctgggacacggccggccaggag 535
>emb|CR606784.1| full-length cDNA clone CS0DI012YO06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1471 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 409 atctgggacacagctggccaggagaagtaccacagc 444
>emb|CR600396.1| full-length cDNA clone CS0DI077YE10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1508 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 413 atctgggacacagctggccaggagaagtaccacagc 448
>emb|CR596493.1| full-length cDNA clone CS0DC005YF10 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1627 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggag 436 |||||||||||||||||||||||| Sbjct: 503 atctgggacacggccggccaggag 526
>emb|CR591120.1| full-length cDNA clone CS0DI072YL12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1542 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 448 atctgggacacagctggccaggagaagtaccacagc 483
>dbj|AK022600.1| Homo sapiens cDNA FLJ12538 fis, clone NT2RM4000356, moderately similar to RAS-RELATED PROTEIN RAB-17 Length = 1982 Score = 48.1 bits (24), Expect = 0.031 Identities = 33/36 (91%) Strand = Plus / Plus Query: 413 atctgggacacggccggccaggagaggtaccacagc 448 ||||||||||| || |||||||||| |||||||||| Sbjct: 857 atctgggacacagctggccaggagaagtaccacagc 892
>gb|DQ427413.1| Sorghum propinquum locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427412.1| Sorghum bicolor voucher PI585454 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427411.1| Sorghum bicolor voucher PI267539 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427410.1| Sorghum bicolor voucher PI267408 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427409.1| Sorghum bicolor voucher PI221607 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427408.1| Sorghum bicolor voucher PI152702 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427407.1| Sorghum bicolor voucher NSL92371 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427406.1| Sorghum bicolor voucher NSL87902 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427405.1| Sorghum bicolor voucher NSL87666 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427404.1| Sorghum bicolor voucher NSL77217 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427403.1| Sorghum bicolor voucher NSL77034 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427402.1| Sorghum bicolor voucher NSL56174 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427401.1| Sorghum bicolor voucher NSL56003 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427400.1| Sorghum bicolor voucher NSL55243 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59
>gb|DQ427399.1| Sorghum bicolor voucher NSL51365 locus CSU108 genomic sequence Length = 695 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 244 caagatccgcaacgccaagctggt 267 |||||||||||||||||||||||| Sbjct: 36 caagatccgcaacgccaagctggt 59 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,964,263 Number of Sequences: 3902068 Number of extensions: 4964263 Number of successful extensions: 191796 Number of sequences better than 10.0: 1551 Number of HSP's better than 10.0 without gapping: 1621 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 150581 Number of HSP's gapped (non-prelim): 39809 length of query: 563 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 540 effective length of database: 17,143,297,704 effective search space: 9257380760160 effective search space used: 9257380760160 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)