ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart30b07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF112964.1|AF112964 Triticum aestivum small GTP-binding prote... 601 e-168
2gb|AY107131.1| Zea mays PCO080814 mRNA sequence 392 e-106
3emb|AJ292320.1|OSA292320 Oryza sativa mRNA for RAB5A protein 299 5e-78
4gb|AY029301.1| Oryza sativa small GTP-binding protein (rab5A) mR... 293 3e-76
5dbj|AK066784.1| Oryza sativa (japonica cultivar-group) cDNA clon... 293 3e-76
6dbj|AK061116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 293 3e-76
7gb|AY104686.1| Zea mays PCO088233 mRNA sequence 176 5e-41
8ref|XM_469184.1| Oryza sativa (japonica cultivar-group), mRNA 143 7e-31
9dbj|AK100036.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
10dbj|AK067459.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
11dbj|AK061203.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
12dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 127 4e-26
13gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 127 4e-26
14emb|AL713905.6|CNS07YQ5 Oryza sativa chromosome 12, . BAC OJ1584... 127 4e-26
15gb|M95071.1|MZEORFL Zea mays putative GTP-binding protein homolo... 105 2e-19
16ref|XM_511501.1| PREDICTED: Pan troglodytes similar to General c... 94 6e-16
17dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
18dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
19gb|BC106039.1| Homo sapiens RAB5C, member RAS oncogene family, t... 88 4e-14
20ref|NM_004583.2| Homo sapiens RAB5C, member RAS oncogene family ... 88 4e-14
21ref|NM_201434.1| Homo sapiens RAB5C, member RAS oncogene family ... 88 4e-14
22gb|BT019484.1| Homo sapiens RAB5C, member RAS oncogene family mR... 88 4e-14
23ref|XM_589241.2| PREDICTED: Bos taurus similar to Ras-related pr... 88 4e-14
24ref|XM_864602.1| PREDICTED: Bos taurus similar to Ras-related pr... 88 4e-14
25emb|CR724508.1|CNS0GLZ6 Tetraodon nigroviridis full-length cDNA 88 4e-14
26emb|CR860097.1| Pongo pygmaeus mRNA; cDNA DKFZp468C168 (from clo... 88 4e-14
27emb|CR626803.1| full-length cDNA clone CS0DI004YB12 of Placenta ... 88 4e-14
28emb|CR625641.1| full-length cDNA clone CS0DI053YE06 of Placenta ... 88 4e-14
29emb|CR625174.1| full-length cDNA clone CS0DI013YF02 of Placenta ... 88 4e-14
30emb|CR624854.1| full-length cDNA clone CS0DH002YK07 of T cells (... 88 4e-14
31emb|CR623581.1| full-length cDNA clone CS0DI044YG15 of Placenta ... 88 4e-14
32emb|CR622103.1| full-length cDNA clone CS0DI086YP22 of Placenta ... 88 4e-14
33emb|CR621567.1| full-length cDNA clone CS0DC023YN19 of Neuroblas... 88 4e-14
34emb|CR620573.1| full-length cDNA clone CS0DE008YO18 of Placenta ... 88 4e-14
35emb|CR620653.1| full-length cDNA clone CS0DF002YO05 of Fetal bra... 88 4e-14
36emb|CR617879.1| full-length cDNA clone CS0DD007YI09 of Neuroblas... 88 4e-14
37emb|CR617757.1| full-length cDNA clone CS0DI010YH11 of Placenta ... 88 4e-14
38emb|CR615479.1| full-length cDNA clone CS0DA009YL15 of Neuroblas... 88 4e-14
39emb|CR613867.1| full-length cDNA clone CS0DC028YA10 of Neuroblas... 88 4e-14
40emb|CR612483.1| full-length cDNA clone CS0DH005YE20 of T cells (... 88 4e-14
41emb|CR612169.1| full-length cDNA clone CS0DI006YD09 of Placenta ... 88 4e-14
42emb|CR611639.1| full-length cDNA clone CS0DE004YH07 of Placenta ... 88 4e-14
43emb|CR607787.1| full-length cDNA clone CS0DI010YF11 of Placenta ... 88 4e-14
44emb|CR607771.1| full-length cDNA clone CS0DI077YG09 of Placenta ... 88 4e-14
45emb|CR608029.1| full-length cDNA clone CS0DC015YE20 of Neuroblas... 88 4e-14
46emb|CR603551.1| full-length cDNA clone CS0DM007YF04 of Fetal liv... 88 4e-14
47emb|CR601486.1| full-length cDNA clone CS0DA006YF19 of Neuroblas... 88 4e-14
48emb|CR600565.1| full-length cDNA clone CS0DI075YN07 of Placenta ... 88 4e-14
49emb|CR600279.1| full-length cDNA clone CS0DB005YK02 of Neuroblas... 88 4e-14
50emb|CR599091.1| full-length cDNA clone CS0DI081YC13 of Placenta ... 88 4e-14
51emb|CR595237.1| full-length cDNA clone CL0BA011ZH04 of Placenta ... 88 4e-14
52emb|CR591906.1| full-length cDNA clone CS0DI042YG22 of Placenta ... 88 4e-14
53emb|CR591636.1| full-length cDNA clone CS0DI022YM14 of Placenta ... 88 4e-14
54gb|AF498938.1| Homo sapiens small GTP binding protein RAB5C (RAB... 88 4e-14
55emb|CR541901.1| Homo sapiens full open reading frame cDNA clone ... 88 4e-14
56gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, co... 88 4e-14
57gb|AF141304.1|AF141304 Homo sapiens small GTPase (RAB5C) mRNA, c... 88 4e-14
58gb|AY888260.1| Synthetic construct Homo sapiens clone FLH009616.... 88 4e-14
59dbj|AK025474.1| Homo sapiens cDNA: FLJ21821 fis, clone HEP01311,... 88 4e-14
60gb|AY893587.1| Synthetic construct Homo sapiens clone FLH130878.... 88 4e-14
61gb|AC003104.1|AC003104 Homo sapiens chromosome 17, clone HCIT48C... 88 4e-14
62gb|U18420.1|HSU18420 Human ras-related small GTP binding protein... 88 4e-14
63gb|U11293.1|HSU11293 Human Rab5c-like protein mRNA, complete cds 88 4e-14
64gb|DQ215564.1| Taeniopygia guttata clone 0061P0006C04 RAB5C memb... 86 1e-13
65emb|AJ437656.1|SCH437656 Simmondsia chinensis mRNA for Rab-relat... 86 1e-13
66emb|BX052472.1|CNS09CNG Single read from an extremity of a full-... 82 2e-12
67emb|BX032716.1|CNS08XEO Single read from an extremity of a full-... 82 2e-12
68emb|BX028733.1|CNS08UC1 Single read from an extremity of a full-... 82 2e-12
69emb|BX020822.1|CNS08O8A Single read from an extremity of a full-... 82 2e-12
70ref|XM_555603.1| Anopheles gambiae str. PEST ENSANGP00000027173 ... 82 2e-12
71ref|XM_317586.2| Anopheles gambiae str. PEST ENSANGP00000023894 ... 82 2e-12
72ref|XM_317587.2| Anopheles gambiae str. PEST ENSANGP00000023388 ... 82 2e-12
73ref|XM_317584.2| Anopheles gambiae str. PEST ENSANGP00000022645 ... 82 2e-12
74ref|XM_317588.2| Anopheles gambiae str. PEST ENSANGP00000010093 ... 82 2e-12
75ref|XM_317585.2| Anopheles gambiae str. PEST ENSANGP00000022624 ... 82 2e-12
76ref|NM_001034743.1| Bos taurus RAB5C, member RAS oncogene family... 80 9e-12
77emb|Z27110.1|CFRAB5C C.familiaris mRNA for Rab5c protein 80 9e-12
78ref|NM_001003261.1| Canis familiaris RAB5C, member RAS oncogene ... 80 9e-12
79gb|BT021518.1| Bos taurus RAB5C, member RAS oncogene family (RAB... 80 9e-12
80gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 78 4e-11
81gb|AC135792.3| Oryza sativa chromosome 3 BAC OSJNBa0056E06 genom... 78 4e-11
82dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
83ref|NM_001030328.2| Xenopus tropicalis RAB5A protein (RAB5A), mRNA 76 1e-10
84emb|CR761238.2| Xenopus tropicalis finished cDNA, clone TEgg117g03 76 1e-10
85emb|BX052473.1|CNS09CNH Single read from an extremity of a full-... 74 5e-10
86emb|BX028734.1|CNS08UC2 Single read from an extremity of a full-... 74 5e-10
87gb|BC047803.1| Danio rerio RAB5A, member RAS oncogene family, mR... 72 2e-09
88gb|BC063966.1| Danio rerio RAB5A, member RAS oncogene family, mR... 72 2e-09
89ref|XM_697418.1| PREDICTED: Danio rerio hypothetical protein LOC... 72 2e-09
90ref|NM_201485.1| Danio rerio RAB5A, member RAS oncogene family (... 72 2e-09
91gb|BC029678.1| Mus musculus RAB5C, member RAS oncogene family, m... 70 9e-09
92gb|BC023027.1| Mus musculus RAB5C, member RAS oncogene family, m... 70 9e-09
93gb|AY081181.1| Drosophila melanogaster clone LD03788 Rab5 mRNA, ... 70 9e-09
94gb|AY081180.1| Drosophila melanogaster clone GM02432 Rab5 mRNA, ... 70 9e-09
95emb|AJ721020.1| Gallus gallus mRNA for hypothetical protein, clo... 70 9e-09
96ref|NM_024456.1| Mus musculus RAB5C, member RAS oncogene family ... 70 9e-09
97ref|NM_164479.1| Drosophila melanogaster Rab-protein 5 CG3664-RF... 70 9e-09
98ref|NM_164478.1| Drosophila melanogaster Rab-protein 5 CG3664-RD... 70 9e-09
99ref|NM_164477.1| Drosophila melanogaster Rab-protein 5 CG3664-RC... 70 9e-09
100ref|NM_164476.1| Drosophila melanogaster Rab-protein 5 CG3664-RB... 70 9e-09
101ref|NM_164475.1| Drosophila melanogaster Rab-protein 5 CG3664-RA... 70 9e-09
102ref|NM_078733.2| Drosophila melanogaster Rab-protein 5 CG3664-RE... 70 9e-09
103dbj|AK167599.1| Mus musculus 13 days pregnant adult female place... 70 9e-09
104dbj|AK172328.1| Mus musculus activated spleen cDNA, RIKEN full-l... 70 9e-09
105gb|AY060343.1| Drosophila melanogaster GH24702 full length cDNA 70 9e-09
106dbj|AK159832.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 70 9e-09
107dbj|AK170540.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 70 9e-09
108emb|CR388793.1| Gallus gallus finished cDNA, clone ChEST518p6 70 9e-09
109gb|BC027378.1| Mus musculus RAB5C, member RAS oncogene family, m... 70 9e-09
110dbj|AK089199.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 70 9e-09
111emb|BX950869.14| Zebrafish DNA sequence from clone CH211-1J13 in... 70 9e-09
112emb|AL591469.9| Mouse DNA sequence from clone RP23-390D17 on chr... 70 9e-09
113dbj|AB035671.1| Drosophila melanogaster mRNA for Rab5 protein, c... 70 9e-09
114dbj|AB035353.1| Drosophila melanogaster mRNA for Drab5, complete... 70 9e-09
115gb|BC056058.1| Xenopus laevis Rab-protein 5, mRNA (cDNA clone MG... 68 3e-08
116gb|BC045466.1| Danio rerio RAB5C, member RAS oncogene family, mR... 66 1e-07
117ref|XM_843712.1| PREDICTED: Canis familiaris similar to RAB17, m... 66 1e-07
118emb|X63875.1|NTRAB5 N.tabacum SR1 mRNA Nt-rab5 66 1e-07
119emb|BX039831.1|CNS092WB Single read from an extremity of a full-... 66 1e-07
120gb|BC065634.1| Danio rerio RAB5C, member RAS oncogene family, mR... 66 1e-07
121emb|BX005093.22| Zebrafish DNA sequence from clone CH211-210G13 ... 66 1e-07
122ref|XM_697428.1| PREDICTED: Danio rerio hypothetical protein LOC... 66 1e-07
123ref|NM_201501.1| Danio rerio RAB5C, member RAS oncogene family (... 66 1e-07
124emb|Y07811.1|GGRAB5CLP G.gallus mRNA for rab5C-like protein 62 2e-06
125ref|NM_204525.1| Gallus gallus RAB5C, member RAS oncogene family... 62 2e-06
126dbj|AK134691.1| Mus musculus adult male medulla oblongata cDNA, ... 62 2e-06
127ref|XM_213463.3| PREDICTED: Rattus norvegicus RAB5C, member RAS ... 62 2e-06
128gb|BT013315.1| Lycopersicon esculentum clone 135000F, mRNA sequence 60 8e-06
129gb|BT012776.1| Lycopersicon esculentum clone 113755R, mRNA sequence 60 8e-06
130ref|XM_749452.1| Aspergillus fumigatus Af293 RAB GTPase Ypt51 (A... 60 8e-06
131emb|CR665120.2|CNS0FC6E Tetraodon nigroviridis full-length cDNA 60 8e-06
132emb|AL590448.1|CNS07EGF chromosome VIII of strain GB-M1 of Encep... 60 8e-06
133gb|AY112178.1| Zea mays CL13607_1 mRNA sequence 60 8e-06
134ref|XM_778785.1| PREDICTED: Strongylocentrotus purpuratus simila... 58 3e-05
135ref|XM_777279.1| PREDICTED: Strongylocentrotus purpuratus simila... 58 3e-05
136emb|AJ296341.1|CIN296341 Cichorium intybus X cichorium endivia p... 58 3e-05
137emb|AJ296338.1|CIN296338 Cichorium intybus X cichorium endivia p... 58 3e-05
138ref|NM_133685.1| Mus musculus RAB31, member RAS oncogene family ... 56 1e-04
139gb|BC072360.1| Xenopus laevis hypothetical protein MGC83515, mRN... 56 1e-04
140emb|CT025302.2| Xenopus tropicalis finished cDNA, clone TNeu107b15 56 1e-04
141emb|BX511265.13| Zebrafish DNA sequence from clone RP71-45G20 in... 56 1e-04
142gb|BC013063.1| Mus musculus RAB31, member RAS oncogene family, m... 56 1e-04
143gb|BC066634.1| Danio rerio RAB5B, member RAS oncogene family, mR... 56 1e-04
144dbj|AK159095.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 56 1e-04
145dbj|AK156677.1| Mus musculus activated spleen cDNA, RIKEN full-l... 56 1e-04
146ref|XM_703529.1| PREDICTED: Danio rerio similar to RAB5A member ... 56 1e-04
147ref|XM_681894.1| PREDICTED: Danio rerio similar to RAB5A member ... 56 1e-04
148dbj|AK051270.1| Mus musculus 12 days embryo spinal ganglion cDNA... 56 1e-04
149ref|NM_212885.1| Danio rerio RAB5B, member RAS oncogene family (... 56 1e-04
150ref|XM_578804.1| PREDICTED: Rattus norvegicus similar to RAB17, ... 56 1e-04
151emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 i... 56 1e-04
152ref|XM_598573.2| PREDICTED: Bos taurus similar to RAS and EF han... 54 5e-04
153ref|XM_363259.1| Magnaporthe grisea 70-15 hypothetical protein (... 54 5e-04
154ref|XM_959718.1| Neurospora crassa OR74A hypothetical protein (N... 54 5e-04
155ref|XM_325074.1| Neurospora crassa OR74A hypothetical protein (N... 54 5e-04
156gb|BT012805.1| Lycopersicon esculentum clone 113821R, mRNA sequence 54 5e-04
157emb|BX842682.1| Neurospora crassa DNA linkage group I BAC contig... 54 5e-04
158ref|XM_228043.3| PREDICTED: Rattus norvegicus similar to RIKEN c... 54 5e-04
159ref|XM_527372.1| PREDICTED: Pan troglodytes similar to RIKEN cDN... 52 0.002
160ref|XM_878893.1| PREDICTED: Bos taurus similar to RAB5B, member ... 52 0.002
161ref|XM_585238.2| PREDICTED: Bos taurus similar to RAB5B, member ... 52 0.002
162ref|XM_878835.1| PREDICTED: Bos taurus similar to RAB5B, member ... 52 0.002
163ref|XM_878801.1| PREDICTED: Bos taurus similar to RAB5B, member ... 52 0.002
164ref|XM_866612.1| PREDICTED: Bos taurus similar to RAB5B, member ... 52 0.002
165ref|XM_604898.2| PREDICTED: Bos taurus similar to RAB6B, member ... 52 0.002
166ref|XM_848388.1| PREDICTED: Canis familiaris similar to RAB6B, m... 52 0.002
167ref|XM_851035.1| PREDICTED: Canis familiaris similar to RAB5B, m... 52 0.002
168ref|XM_531627.2| PREDICTED: Canis familiaris similar to RAB5B, m... 52 0.002
169emb|CR938123.1| Single read from an extremity of a full-length c... 52 0.002
170dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 52 0.002
171ref|XM_688516.1| PREDICTED: Danio rerio similar to Aldehyde dehy... 52 0.002
172gb|AC092186.1|AC092186 Drosophila melanogaster, chromosome 2L, r... 52 0.002
173tpg|BK000968.1| TPA: TPA_exp: Drosophila melanogaster CG4272 gen... 52 0.002
174emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, c... 52 0.002
175gb|AY104562.1| Zea mays PCO063085 mRNA sequence 52 0.002
176gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 ... 52 0.002
177gb|AC004315.1|AC004315 Drosophila melanogaster (P1 DS03279 (D209... 52 0.002
178ref|XM_450547.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.008
179gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W2... 50 0.008
180gb|AF320614.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-... 50 0.008
181gb|AF320613.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-... 50 0.008
182gb|AC104702.2| Drosophila melanogaster 3L BAC RP98-11B4 (Roswell... 50 0.008
183gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell... 50 0.008
184ref|NM_139854.1| Drosophila melanogaster CG8583-RA (CG8583), mRNA 50 0.008
185gb|BC094134.1| Xenopus laevis cDNA clone MGC:115056 IMAGE:695703... 50 0.008
186dbj|AK111872.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
187emb|X06333.1|ZMC1 Z.mays DNA for c1 locus 50 0.008
188dbj|AK104132.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
189dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.008
190gb|AY110109.1| Zea mays CL16448_2 mRNA sequence 50 0.008
191gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26... 50 0.008
192gb|BT001562.1| Drosophila melanogaster RE14391 full insert cDNA 50 0.008
193gb|AF015269.1|AF015269 Zea mays retrotransposon Magellan, comple... 50 0.008
194gb|AF015268.1|AF015268 Zea mays PL transcription factor (Pl) gen... 50 0.008
195gb|M37153.1|MZEMYBAA Z.mays c1 locus myb homologue cDNA, exons 1-3 50 0.008
196gb|BC013170.1| Mus musculus RAB17, member RAS oncogene family, m... 48 0.031
197gb|BC072698.1| Rattus norvegicus RAB31, member RAS oncogene fami... 48 0.031
198ref|NM_192276.1| Oryza sativa (japonica cultivar-group), predic... 48 0.031
199ref|XM_516181.1| PREDICTED: Pan troglodytes similar to RAB17, me... 48 0.031
200ref|XM_470371.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.031
201gb|BC074609.1| Xenopus tropicalis RAB30, member RAS oncogene fam... 48 0.031
202gb|AC118682.8| Mus musculus chromosome 1, clone RP23-448B17, com... 48 0.031
203ref|NM_145094.2| Rattus norvegicus RAB31, member RAS oncogene fa... 48 0.031
204gb|AY166852.2| Homo sapiens RAB41 mRNA, complete cds 48 0.031
205ref|XM_881629.1| PREDICTED: Bos taurus similar to Ras-related pr... 48 0.031
206ref|XM_868411.1| PREDICTED: Bos taurus similar to Ras-related pr... 48 0.031
207gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genom... 48 0.031
208gb|BC051071.1| Mus musculus RAB17, member RAS oncogene family, m... 48 0.031
209ref|NM_008998.2| Mus musculus RAB17, member RAS oncogene family ... 48 0.031
210gb|BC114066.1| Bos taurus RAB26, member RAS oncogene family, mRN... 48 0.031
211ref|NM_022449.1| Homo sapiens RAB17, member RAS oncogene family ... 48 0.031
212gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.031
213ref|XM_975892.1| PREDICTED: Mus musculus RAB17, member RAS oncog... 48 0.031
214ref|XM_741403.1| Aspergillus fumigatus Af293 ras-like GTP-bindin... 48 0.031
215gb|BC082988.1| Homo sapiens RAB43, member RAS oncogene family, m... 48 0.031
216gb|BC034011.1| Mus musculus cDNA clone IMAGE:4239538, **** WARNI... 48 0.031
217ref|XM_502830.1| Yarrowia lipolytica CLIB122, YALI0D14630g predi... 48 0.031
218emb|BX065790.1|CNS09MXE Single read from an extremity of a full-... 48 0.031
219emb|BX040474.1|CNS093E6 Single read from an extremity of a full-... 48 0.031
220emb|Z37503.1|VFRABGTPB V.faba mRNA for guanine nucleotide regula... 48 0.031
221emb|X70804.1|MMRAB17AA M.musculus rab17 mRNA 48 0.031
222emb|CR457282.1| Homo sapiens full open reading frame cDNA clone ... 48 0.031
223ref|NM_001006108.1| Xenopus tropicalis RAB30, member RAS oncogen... 48 0.031
224emb|AL136645.1|HSM801615 Homo sapiens mRNA; cDNA DKFZp564M1541 (... 48 0.031
225emb|BX323459.20| Zebrafish DNA sequence from clone DKEYP-27C11 i... 48 0.031
226dbj|AK128345.1| Homo sapiens cDNA FLJ46487 fis, clone THYMU3026783 48 0.031
227emb|CR626220.1| full-length cDNA clone CS0DI005YB17 of Placenta ... 48 0.031
228emb|CR624533.1| full-length cDNA clone CS0DI005YC13 of Placenta ... 48 0.031
229emb|CR621894.1| full-length cDNA clone CS0DI034YJ09 of Placenta ... 48 0.031
230emb|CR620019.1| full-length cDNA clone CS0DM014YA08 of Fetal liv... 48 0.031
231emb|CR606784.1| full-length cDNA clone CS0DI012YO06 of Placenta ... 48 0.031
232emb|CR600396.1| full-length cDNA clone CS0DI077YE10 of Placenta ... 48 0.031
233emb|CR596493.1| full-length cDNA clone CS0DC005YF10 of Neuroblas... 48 0.031
234emb|CR591120.1| full-length cDNA clone CS0DI072YL12 of Placenta ... 48 0.031
235dbj|AK022600.1| Homo sapiens cDNA FLJ12538 fis, clone NT2RM40003... 48 0.031
236gb|DQ427413.1| Sorghum propinquum locus CSU108 genomic sequence 48 0.031
237gb|DQ427412.1| Sorghum bicolor voucher PI585454 locus CSU108 gen... 48 0.031
238gb|DQ427411.1| Sorghum bicolor voucher PI267539 locus CSU108 gen... 48 0.031
239gb|DQ427410.1| Sorghum bicolor voucher PI267408 locus CSU108 gen... 48 0.031
240gb|DQ427409.1| Sorghum bicolor voucher PI221607 locus CSU108 gen... 48 0.031
241gb|DQ427408.1| Sorghum bicolor voucher PI152702 locus CSU108 gen... 48 0.031
242gb|DQ427407.1| Sorghum bicolor voucher NSL92371 locus CSU108 gen... 48 0.031
243gb|DQ427406.1| Sorghum bicolor voucher NSL87902 locus CSU108 gen... 48 0.031
244gb|DQ427405.1| Sorghum bicolor voucher NSL87666 locus CSU108 gen... 48 0.031
245gb|DQ427404.1| Sorghum bicolor voucher NSL77217 locus CSU108 gen... 48 0.031
246gb|DQ427403.1| Sorghum bicolor voucher NSL77034 locus CSU108 gen... 48 0.031
247gb|DQ427402.1| Sorghum bicolor voucher NSL56174 locus CSU108 gen... 48 0.031
248gb|DQ427401.1| Sorghum bicolor voucher NSL56003 locus CSU108 gen... 48 0.031
249gb|DQ427400.1| Sorghum bicolor voucher NSL55243 locus CSU108 gen... 48 0.031
250gb|DQ427399.1| Sorghum bicolor voucher NSL51365 locus CSU108 gen... 48 0.031
251gb|DQ427398.1| Sorghum bicolor voucher NSL51030 locus CSU108 gen... 48 0.031
252gb|DQ427397.1| Sorghum bicolor voucher NSL50875 locus CSU108 gen... 48 0.031
253gb|DQ427396.1| Sorghum bicolor voucher BTx623 locus CSU108 genom... 48 0.031
254ref|NM_170170.1| Drosophila melanogaster RabX4 CG31118-RA (RabX4... 48 0.031
255ref|XM_496163.2| PREDICTED: Homo sapiens similar to RAB41 protei... 48 0.031
256ref|XM_926288.1| PREDICTED: Homo sapiens similar to RAB41 protei... 48 0.031
257emb|CR533454.1| Homo sapiens full open reading frame cDNA clone ... 48 0.031
258gb|AC008923.9| Homo sapiens chromosome 5 clone CTD-2281D19, comp... 48 0.031
259dbj|AK009707.1| Mus musculus adult male tongue cDNA, RIKEN full-... 48 0.031
260ref|NG_005358.1| Homo sapiens RAB43 pseudogene (RAB43P) on chrom... 48 0.031
261dbj|AK075591.1| Mus musculus adult male kidney cDNA, RIKEN full-... 48 0.031
262gb|BT022967.1| Drosophila melanogaster IP11168 full insert cDNA 48 0.031
263dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
264dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
265dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
266gb|M79312.1|MUSRAB5C Mus musculus GTP-binding protein RAB5c mRNA... 48 0.031
267gb|AC008205.7|AC008205 Drosophila melanogaster, chromosome 3R, r... 48 0.031
268gb|DQ000572.1| Synthetic construct clone PSF:109843 DKFZp564M154... 48 0.031
269gb|AC104667.5| Homo sapiens BAC clone RP11-810D14 from 2, comple... 48 0.031
270gb|AC012186.8| Homo sapiens chromosome 16 clone RP11-93O14, comp... 48 0.031
271gb|AC092368.3| Homo sapiens chromosome 16 clone RP11-46D6, compl... 48 0.031
272ref|NM_205719.2| Danio rerio RAB22A, member RAS oncogene family ... 48 0.031
273gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genom... 48 0.031
274gb|AC108673.11| Homo sapiens 3 BAC RP11-434H6 (Roswell Park Canc... 48 0.031
275ref|XM_213475.3| PREDICTED: Rattus norvegicus similar to Ras-rel... 48 0.031
276dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
277gb|AF254800.1|AF254800 Rattus norvegicus GTP-binding protein Rab... 48 0.031
278dbj|AP003725.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
279dbj|AP003855.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
280dbj|AP005811.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.031
281emb|BX647412.1|HSM807557 Homo sapiens mRNA; cDNA DKFZp686B0936 (... 48 0.031
282ref|XM_320947.2| Anopheles gambiae str. PEST ENSANGP00000017643 ... 48 0.031
283dbj|AK110581.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.031
284ref|XM_309827.2| Anopheles gambiae str. PEST ENSANGP00000018266 ... 48 0.031
285gb|BC050426.1| Homo sapiens RAB17, member RAS oncogene family, m... 48 0.031
286gb|AY110177.1| Zea mays CL8907_1 mRNA sequence 48 0.031
287gb|AE003749.3| Drosophila melanogaster chromosome 3R, section 87... 48 0.031
288emb|CR405682.23| Zebrafish DNA sequence from clone DKEYP-67E6 in... 48 0.031
289emb|AL929467.6| Zebrafish DNA sequence from clone CH211-148E17, ... 48 0.031
290gb|BC062319.1| Homo sapiens RAB43, member RAS oncogene family, m... 48 0.031
291emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 48 0.031
292ref|NM_198490.1| Homo sapiens RAB43, member RAS oncogene family ... 48 0.031
293gb|U13170.1|CRU13170 Chlamydomonas reinhardtii YptC5 (yptC5) gen... 48 0.031
294gb|BC085393.1| Danio rerio RAB22A, member RAS oncogene family, m... 48 0.031
295dbj|D45418.1|HUMRAB11BA Human Rab11B mRNA 48 0.031
296dbj|AB032986.1| Homo sapiens mRNA for KIAA1160 protein, partial cds 48 0.031
297gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, c... 46 0.12
298ref|NM_012722.1| Rattus norvegicus elastin (Eln), mRNA 46 0.12
299ref|NM_118084.2| Arabidopsis thaliana ARA7; GTP binding AT4G1964... 46 0.12
300gb|BC085910.1| Rattus norvegicus elastin, mRNA (cDNA clone MGC:9... 46 0.12
301gb|AC123952.5| Mus musculus BAC clone RP23-195B3 from chromosome... 46 0.12
302ref|XM_470590.1| Oryza sativa (japonica cultivar-group), predic... 46 0.12
303ref|XM_470050.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.12
304ref|NM_191928.1| Oryza sativa (japonica cultivar-group), predic... 46 0.12
305gb|AC164419.3| Mus musculus chromosome 5, clone RP23-309G12, com... 46 0.12
306gb|BC081187.1| Xenopus laevis MGC84419 protein, mRNA (cDNA clone... 46 0.12
307gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, comp... 46 0.12
308ref|XM_429101.1| PREDICTED: Gallus gallus similar to RAB11a, mem... 46 0.12
309gb|AC103550.13| Oryza sativa chromosome 3 BAC OSJNBa0079G12 geno... 46 0.12
310gb|AC102446.8| Mus musculus chromosome 5, clone RP24-201G17, com... 46 0.12
311gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 46 0.12
312gb|AC144824.2| Danio rerio clone CH211-172M22, complete sequence 46 0.12
313gb|AY815497.1| Schistosoma japonicum SJCHGC05511 protein mRNA, c... 46 0.12
314gb|AC159638.2| Mus musculus BAC clone RP24-78C16 from chromosome... 46 0.12
315gb|AC138737.10| Mus musculus chromosome 5, clone RP23-307F20, co... 46 0.12
316gb|AC158547.7| Mus musculus chromosome 3, clone RP23-477L20, com... 46 0.12
317gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome... 46 0.12
318gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosom... 46 0.12
319gb|AC122499.4| Mus musculus BAC clone RP24-407O20 from chromosom... 46 0.12
320emb|CR925737.7| Zebrafish DNA sequence from clone DKEY-263O8 in ... 46 0.12
321emb|CR450831.4| Zebrafish DNA sequence from clone CH211-79O8 in ... 46 0.12
322gb|AC107711.13| Mus musculus chromosome 14, clone RP23-291I12, c... 46 0.12
323emb|CR931792.9| Zebrafish DNA sequence from clone DKEY-180L1 in ... 46 0.12
324emb|BX005314.35| Zebrafish DNA sequence from clone CH211-155D24 ... 46 0.12
325emb|BX936329.9| Zebrafish DNA sequence from clone CH211-1F1 in l... 46 0.12
326emb|BX897684.8| Zebrafish DNA sequence from clone CH211-107A4 in... 46 0.12
327emb|BX897749.7| Zebrafish DNA sequence from clone DKEY-26L20 in ... 46 0.12
328gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome ... 46 0.12
329emb|BX539321.14| Zebrafish DNA sequence from clone CH211-223F3 i... 46 0.12
330gb|AC122913.4| Mus musculus BAC clone RP23-25J21 from 3, complet... 46 0.12
331gb|AC125409.3| Mus musculus BAC clone RP23-127O4 from 12, comple... 46 0.12
332emb|BX649478.11| Zebrafish DNA sequence from clone DKEY-149F22 i... 46 0.12
333emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in... 46 0.12
334emb|BX936420.9| Zebrafish DNA sequence from clone DKEY-7F16 in l... 46 0.12
335emb|CR713025.2|CNS0GD4D Tetraodon nigroviridis full-length cDNA 46 0.12
336emb|CR708753.2|CNS0G9TP Tetraodon nigroviridis full-length cDNA 46 0.12
337emb|CR707722.2|CNS0G912 Tetraodon nigroviridis full-length cDNA 46 0.12
338gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, com... 46 0.12
339emb|CR706288.2|CNS0G7X8 Tetraodon nigroviridis full-length cDNA 46 0.12
340gb|AC122734.6| Mus musculus chromosome 10, clone RP24-108E17, co... 46 0.12
341emb|CR383667.11| Zebrafish DNA sequence from clone CH211-229P19 ... 46 0.12
342emb|BX293991.12| Zebrafish DNA sequence from clone CH211-261I24 ... 46 0.12
343emb|BX908793.14| Zebrafish DNA sequence from clone DKEY-104G4 in... 46 0.12
344emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in ... 46 0.12
345emb|CR356222.24| Zebrafish DNA sequence from clone DKEY-103J14 i... 46 0.12
346gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho... 46 0.12
347emb|BX571952.13| Zebrafish DNA sequence from clone DKEY-35E8 in ... 46 0.12
348emb|BX276112.19| Zebrafish DNA sequence from clone CH211-220I12 ... 46 0.12
349gb|AC157319.2| Zea mays clone ZMMBBb-136E2, complete sequence 46 0.12
350emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chro... 46 0.12
351ref|XM_502517.1| Yarrowia lipolytica CLIB122, YALI0D07128g predi... 46 0.12
352gb|AC091537.2| Rattus norvegicus strain Brown Norway clone RP31-... 46 0.12
353emb|AL136100.12| Human DNA sequence from clone RP11-534P19 on ch... 46 0.12
354emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C... 46 0.12
355emb|AL121889.8|HS1076E17 Human DNA sequence from clone RP5-1076E... 46 0.12
356emb|AL096855.48|HS1115A15 Human DNA sequence from clone RP5-1115... 46 0.12
357gb|AC136475.7| Homo sapiens chromosome 11, clone RP11-326C3, com... 46 0.12
358emb|BX927275.8| Zebrafish DNA sequence from clone DKEY-108P14 in... 46 0.12
359emb|BX927311.7| Zebrafish DNA sequence from clone CH211-235E15 i... 46 0.12
360emb|CR536617.9| Zebrafish DNA sequence from clone CH211-276B5 in... 46 0.12
361emb|BX321904.19| Zebrafish DNA sequence from clone DKEY-279K15 i... 46 0.12
362gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genom... 46 0.12
363emb|BX322579.23| Zebrafish DNA sequence from clone CH211-3G21 in... 46 0.12
364emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in... 46 0.12
365emb|CR812469.6| Zebrafish DNA sequence from clone DKEY-286F3 in ... 46 0.12
366gb|AY063095.1| Arabidopsis thaliana putative small GTP-binding p... 46 0.12
367gb|AF370309.1| Arabidopsis thaliana putative small GTP-binding p... 46 0.12
368gb|AC164097.2| Mus musculus BAC clone RP23-141F18 from chromosom... 46 0.12
369gb|AC153815.7| Mus musculus 6 BAC RP23-205F19 (Roswell Park Canc... 46 0.12
370emb|AL596022.12| Zebrafish DNA sequence from clone BUSM1-107O16 ... 46 0.12
371emb|AL591492.11| Zebrafish DNA sequence from clone BUSM1-261O22 ... 46 0.12
372emb|AL161551.2|ATCHRIV51 Arabidopsis thaliana DNA chromosome 4, ... 46 0.12
373emb|AL021768.1|ATF24J7 Arabidopsis thaliana DNA chromosome 4, BA... 46 0.12
374gb|AC102586.14| Mus musculus chromosome 3, clone RP23-327I19, co... 46 0.12
375emb|CR352225.13| Zebrafish DNA sequence from clone CH211-110E21 ... 46 0.12
376emb|BX296544.8| Zebrafish DNA sequence from clone DKEYP-14B8 in ... 46 0.12
377emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 ... 46 0.12
378emb|CR407599.9| Zebrafish DNA sequence from clone CH211-273O22 i... 46 0.12
379emb|BX323864.8| Zebrafish DNA sequence from clone CH211-218K4 in... 46 0.12
380emb|BX510998.12| Zebrafish DNA sequence from clone CH211-272L18 ... 46 0.12
381emb|CR457462.13| Zebrafish DNA sequence from clone CH211-1O7 in ... 46 0.12
382emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 i... 46 0.12
383emb|CR387989.9| Zebrafish DNA sequence from clone DKEY-101P2 in ... 46 0.12
384emb|CR855273.7| Zebrafish DNA sequence from clone DKEYP-34E1 in ... 46 0.12
385emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on ch... 46 0.12
386emb|CR394562.10| Zebrafish DNA sequence from clone CH211-284D14 ... 46 0.12
387gb|AC131374.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.12
388emb|CR388169.7| Zebrafish DNA sequence from clone DKEYP-61H1 in ... 46 0.12
389emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in... 46 0.12
390emb|CR352253.9| Zebrafish DNA sequence from clone CH211-267D1 in... 46 0.12
391gb|AC125496.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.12
392emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 46 0.12
393emb|BX571838.9| Zebrafish DNA sequence from clone DKEY-205N7 in ... 46 0.12
394emb|BX324164.15| Zebrafish DNA sequence from clone DKEY-14D8 in ... 46 0.12
395emb|AL845301.15| Zebrafish DNA sequence from clone CH211-112M17 ... 46 0.12
396emb|CR352243.7| Zebrafish DNA sequence from clone DKEYP-117H8 in... 46 0.12
397emb|AL807378.5| Zebrafish DNA sequence from clone CH211-215A18 i... 46 0.12
398emb|CR759893.7| Zebrafish DNA sequence from clone DKEY-220K22 in... 46 0.12
399gb|AC150418.2| Branchiostoma floridae clone CH302-67G11, complet... 46 0.12
400gb|AC125418.3| Homo sapiens chromosome 15, clone CTD-3114C7, com... 46 0.12
401gb|AC123776.5| Homo sapiens chromosome 8, clone RP11-213I2, comp... 46 0.12
402emb|BX957314.11| Zebrafish DNA sequence from clone CH211-114K5 i... 46 0.12
403emb|CR753844.7| Zebrafish DNA sequence from clone DKEY-193H7 in ... 46 0.12
404emb|BX470065.7| Zebrafish DNA sequence from clone DKEY-105H11 in... 46 0.12
405emb|CR361551.8| Zebrafish DNA sequence from clone CH211-224M9 in... 46 0.12
406emb|BX537102.13| Zebrafish DNA sequence from clone DKEY-276L17 i... 46 0.12
407emb|BX005225.20| Zebrafish DNA sequence from clone DKEY-34L15 in... 46 0.12
408emb|CR548643.7| Zebrafish DNA sequence from clone CH211-217H15 i... 46 0.12
409emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, co... 46 0.12
410emb|BX005378.13| Zebrafish DNA sequence from clone DKEY-40H20 in... 46 0.12
411emb|BX664752.20| Zebrafish DNA sequence from clone DKEYP-111E5 i... 46 0.12
412emb|BX649557.8| Zebrafish DNA sequence from clone DKEYP-61G11 in... 46 0.12
413emb|BX322638.6| Zebrafish DNA sequence from clone DKEYP-114C5 in... 46 0.12
414emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 i... 46 0.12
415dbj|AB225965.1| Aspergillus oryzae cDNA, contig sequence: AoEST2821 46 0.12
416dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 46 0.12
417gb|AC079935.3| Genomic sequence for Oryza sativa (japonica culti... 46 0.12
418gb|DQ401678.1| Cycleptus elongatus microsatellite Ce13L sequence 46 0.12
419gb|AC091749.8| Oryza sativa chromosome 10 BAC OSJNBb0008A05 geno... 46 0.12
420emb|BX539348.8| Zebrafish DNA sequence from clone DKEY-273G16 in... 46 0.12
421emb|BX296542.12| Zebrafish DNA sequence from clone CH211-278C10 ... 46 0.12
422emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 ... 46 0.12
423emb|BX119930.5| Zebrafish DNA sequence from clone DKEY-18G4 in l... 46 0.12
424emb|BX537293.9| Zebrafish DNA sequence from clone DKEYP-40D11 in... 46 0.12
425emb|BX511223.6| Zebrafish DNA sequence from clone DKEYP-96B6 in ... 46 0.12
426emb|BX294178.13| Zebrafish DNA sequence from clone CH211-271C18 ... 46 0.12
427emb|BX470196.6| Zebrafish DNA sequence from clone CH211-157J23 i... 46 0.12
428emb|BX629345.5| Zebrafish DNA sequence from clone DKEY-148A13 in... 46 0.12
429emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 i... 46 0.12
430emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in... 46 0.12
431emb|BX510306.17| Zebrafish DNA sequence from clone CH211-195F19 ... 46 0.12
432emb|BX004763.9| Zebrafish DNA sequence from clone CH211-131K2, c... 46 0.12
433emb|BX539317.4| Zebrafish DNA sequence from clone DKEY-170L10 in... 46 0.12
434gb|AY052670.1| Arabidopsis thaliana AT4g19640/F24J7_190 mRNA, co... 46 0.12
435emb|BX537152.15| Zebrafish DNA sequence from clone DKEY-61N7 in ... 46 0.12
436gb|AC160052.2| Mus musculus BAC clone RP24-173L14 from chromosom... 46 0.12
437dbj|AK084979.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 46 0.12
438ref|NG_003253.1| Homo sapiens cytochrome c oxidase, subunit 8B p... 46 0.12
439gb|AC145619.4| Homo sapiens BAC clone RP11-722J20 from chromosom... 46 0.12
440emb|BX649377.8| Zebrafish DNA sequence from clone CH211-196J1 in... 46 0.12
441gb|AC148696.1| Macaca mulatta Major Histocompatibility Complex B... 46 0.12
442emb|BX120012.24| Zebrafish DNA sequence from clone CH211-205H19,... 46 0.12
443emb|BX248522.9| Zebrafish DNA sequence from clone CH211-113B2 in... 46 0.12
444emb|BX120000.8| Zebrafish DNA sequence from clone CH211-214C13 i... 46 0.12
445dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
446gb|AC069287.7| Homo sapiens BAC clone RP11-304M2 from 11, comple... 46 0.12
447gb|AC008306.3|AC008306 Drosophila melanogaster, chromosome 2R, r... 46 0.12
448emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 i... 46 0.12
449emb|BX005061.9| Zebrafish DNA sequence from clone CH211-158F5 in... 46 0.12
450emb|BX088526.6| Zebrafish DNA sequence from clone CH211-51H9 in ... 46 0.12
451gb|AC007472.6|AC007472 Drosophila melanogaster, chromosome 2R, r... 46 0.12
452dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 46 0.12
453emb|BX005074.10| Zebrafish DNA sequence from clone CH211-146J7 i... 46 0.12
454gb|AC021093.16|AC021093 Homo sapiens chromosome 8 clone RP11-213... 46 0.12
455gb|AC008282.4| Homo sapiens BAC clone RP11-516B14 from 2, comple... 46 0.12
456gb|AC154296.2| Mus musculus BAC clone RP23-424C4 from chromosome... 46 0.12
457gb|AC074264.3| Homo sapiens BAC clone RP11-410L9 from 2, complet... 46 0.12
458gb|AC010982.5| Homo sapiens BAC clone RP11-475I16 from 2, comple... 46 0.12
459gb|AC103776.3| Homo sapiens chromosome 8, clone RP11-42O14, comp... 46 0.12
460gb|AC156446.2| Volvox carteri clone JGIAOBO-29H23, complete sequ... 46 0.12
461emb|BX934641.1| Gallus gallus finished cDNA, clone ChEST386e2 46 0.12
462dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
463gb|AC019257.3| Homo sapiens chromosome 8, clone RP11-439C15, com... 46 0.12
464gb|AC098806.3| Takifugu rubripes clone 208D11, complete sequence 46 0.12
465gb|AC136373.5| Homo sapiens chromosome 8, clone CTD-2588I16, com... 46 0.12
466ref|XM_345479.2| PREDICTED: Rattus norvegicus RAB22A, member RAS... 46 0.12
467emb|BX571811.5| Zebrafish DNA sequence from clone CH211-194P6, c... 46 0.12
468emb|BX004974.21| Zebrafish DNA sequence from clone CH211-74A16 i... 46 0.12
469emb|BX004843.10| Zebrafish DNA sequence from clone CH211-165E15,... 46 0.12
470emb|BX248399.5| Zebrafish DNA sequence from clone CH211-233A1 in... 46 0.12
471emb|BX005481.11| Zebrafish DNA sequence from clone CH211-79C1 in... 46 0.12
472gb|M86376.1|RATTREL12 Rattus norvegicus tropoelastin (tropoelast... 46 0.12
473dbj|AP001800.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
474dbj|AP002835.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.12
475gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.12
476emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 i... 46 0.12
477gb|AC022308.17|AC022308 Homo sapiens chromosome 15 clone RP11-34... 46 0.12
478emb|BX119315.5| Zebrafish DNA sequence from clone CH211-215F22 i... 46 0.12
479dbj|AK197789.1| Mus musculus cDNA, clone:Y1G0126C17, strand:minu... 46 0.12
480dbj|AB075928.1| Danio rerio CNR family (zCNRv1, zCNRv2, zCNRv3, ... 46 0.12
481emb|BX004814.8| Zebrafish DNA sequence from clone CH211-103I6 in... 46 0.12
482emb|BX248325.7| Zebrafish DNA sequence from clone CH211-233I11 i... 46 0.12
483emb|BX005045.10| Zebrafish DNA sequence from clone CH211-69C9 in... 46 0.12
484emb|BX537130.6| Zebrafish DNA sequence from clone DKEY-104I23 in... 46 0.12
485emb|BX294375.7| Zebrafish DNA sequence from clone DKEY-176M20 in... 46 0.12
486emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in... 46 0.12
487emb|BX004992.13| Zebrafish DNA sequence from clone CH211-120E13 ... 46 0.12
488emb|BX072582.6| Zebrafish DNA sequence from clone DKEY-222O19 in... 46 0.12
489emb|BX296535.7| Zebrafish DNA sequence from clone CH211-234I2, c... 46 0.12
490emb|AL954130.8| Zebrafish DNA sequence from clone CH211-214D1 in... 46 0.12
491emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 ... 46 0.12
492emb|AL929322.6| Zebrafish DNA sequence from clone DKEY-10H23, co... 46 0.12
493emb|AL929128.4| Zebrafish DNA sequence from clone CH211-203P17 i... 46 0.12
494dbj|AK119350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.12
495dbj|AK111561.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.12
496ref|XM_556035.1| Anopheles gambiae str. PEST ENSANGP00000027264 ... 46 0.12
497ref|XM_315402.2| Anopheles gambiae str. PEST ENSANGP00000020903 ... 46 0.12
498dbj|AK104475.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.12
499dbj|AK103014.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.12
500dbj|AK071394.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.12

>gb|AF112964.1|AF112964 Triticum aestivum small GTP-binding protein (Sgp) mRNA, complete
           cds
          Length = 1136

 Score =  601 bits (303), Expect = e-168
 Identities = 342/355 (96%)
 Strand = Plus / Plus

                                                                       
Query: 209 atggcggccaacgccggcgccggcgccggcggcagcaagatccgcaacgccaagctggtt 268
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 256 atggcggccaacgccggcgccggcgccggtggcagcaagatccgcaacgccaagctggtt 315

                                                                       
Query: 269 cttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaagggccag 328
           ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 316 cttctgggggatgtcggcaccggcaagtccagcctggtgctccggttcgtcaagggccag 375

                                                                       
Query: 329 ttcgtcgagttccaggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtc 388
           |||||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||||
Sbjct: 376 ttcgtcgagttccaggaatcgaccatcggcgcggccttcttctcgcagaccctggcggtc 435

                                                                       
Query: 389 aacgacgagacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagc 448
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 436 aacgatgagacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagc 495

                                                                       
Query: 449 ctggcgcccatgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||||||||||||||| |||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 496 ctggcgcccatgtactaccgcggcgccgcggccgcgatcgtcgtctacgacatcaccaac 555

                                                                  
Query: 509 gcggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaaggga 563
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 556 gcggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaaggga 610



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                
Query: 36 cacacacgcgagtcgccgagaagaaagccccaaacttt 73
          ||||||| ||||||||| ||||||||||||||| ||||
Sbjct: 55 cacacacccgagtcgccaagaagaaagccccaaccttt 92



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 151 agcgatcgatcggatcccgccggccggaggt 181
           ||||||||||||||||||||| | |||||||
Sbjct: 199 agcgatcgatcggatcccgcccgtcggaggt 229



to top

>gb|AY107131.1| Zea mays PCO080814 mRNA sequence
          Length = 559

 Score =  392 bits (198), Expect = e-106
 Identities = 294/326 (90%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaag 295
           ||||||| |||||||||||||||||||||||||||||| |||||||| ||| ||||||||
Sbjct: 181 ggcggcaacaagatccgcaacgccaagctggttcttcttggggacgtgggcgccggcaag 240

                                                                       
Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccacc 355
           ||||||||||| ||||| || || || ||||||||||||||||||||||||||||||| |
Sbjct: 241 tccagcctggtcctccggtttgtgaaaggccagttcgtcgagttccaggaatccaccatc 300

                                                                       
Query: 356 ggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatc 415
           ||||| || ||||||||||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 301 ggcgcggctttcttctcgcagaccctggcggtgaacgacgagacggtcaagttcgagata 360

                                                                       
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475
           ||||||||||| || |||||| ||||||||||| |||| |||||||| ||||| ||||| 
Sbjct: 361 tgggacacggcggggcaggagcggtaccacagcttggctcccatgtattaccggggcgct 420

                                                                       
Query: 476 gccgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaa 535
           || || ||||| || ||||| |||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 421 gcggctgccatagttgtctacgacatcacgaacgcggcctcttttacgcgtgcgaagaaa 480

                                     
Query: 536 tgggttcaagaacttcaagcacaagg 561
           ||||||||||||||||||||||||||
Sbjct: 481 tgggttcaagaacttcaagcacaagg 506



to top

>emb|AJ292320.1|OSA292320 Oryza sativa mRNA for RAB5A protein
          Length = 969

 Score =  299 bits (151), Expect = 5e-78
 Identities = 280/323 (86%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtcc 298
           |||| |||||||||||||||||||||||||||||| || || || ||||| |||||||| 
Sbjct: 193 ggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtcg 252

                                                                       
Query: 299 agcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggc 358
           ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| ||||
Sbjct: 253 agcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcggc 312

                                                                       
Query: 359 gccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgg 418
           || |||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||
Sbjct: 313 gcggccttcttctcgcagaccttggcggttaacgacgagacggtgaagttcgaaatctgg 372

                                                                       
Query: 419 gacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgcc 478
           || || || || ||||||||||| || ||| |||| || |||||||| ||||| || || 
Sbjct: 373 gatactgcagggcaggagaggtatcatagcttggctccgatgtactatcgtggtgcggct 432

                                                                       
Query: 479 gccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatgg 538
           ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| ||||||
Sbjct: 433 gccgcaatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatgg 492

                                  
Query: 539 gttcaagaacttcaagcacaagg 561
           ||||||||||||||||| |||||
Sbjct: 493 gttcaagaacttcaagcgcaagg 515



to top

>gb|AY029301.1| Oryza sativa small GTP-binding protein (rab5A) mRNA, complete cds
          Length = 1125

 Score =  293 bits (148), Expect = 3e-76
 Identities = 280/324 (86%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||||||||||||||| || || || ||||| ||||||||
Sbjct: 192 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 251

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| |||
Sbjct: 252 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 311

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
           ||| |||||||||||||| ||| ||||||| |||||||||||||| ||||||||||||||
Sbjct: 312 cgcggccttcttctcgcagaccttggcggttaacgacgagacggtgaagttcgaaatctg 371

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || ||||||||||| ||  || |||| || |||||||| ||||| || ||
Sbjct: 372 ggatactgcagggcaggagaggtatcatggcttggctccgatgtactatcgtggtgcggc 431

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 432 tgccgcaatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 491

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 492 ggttcaagaacttcaagcgcaagg 515



to top

>dbj|AK066784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013078I11, full
           insert sequence
          Length = 1032

 Score =  293 bits (148), Expect = 3e-76
 Identities = 280/324 (86%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||||||||||||||| || || || ||||| ||||||||
Sbjct: 125 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 184

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| |||
Sbjct: 185 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 244

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
           ||| |||||||||||||||||| ||||||| ||||| |||||||| ||||||||||||||
Sbjct: 245 cgcggccttcttctcgcaaaccttggcggttaacgatgagacggtgaagttcgaaatctg 304

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || ||||||||||| || ||| |||| || |||||||| || || || ||
Sbjct: 305 ggatactgcagggcaggagaggtatcatagcttggctccgatgtactatcggggtgcggc 364

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 365 tgccgcgatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 424

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 425 ggttcaagaacttcaagcgcaagg 448



to top

>dbj|AK061116.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E04, full
           insert sequence
          Length = 1043

 Score =  293 bits (148), Expect = 3e-76
 Identities = 280/324 (86%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||||||||||||||| || || || ||||| ||||||||
Sbjct: 193 cggcaacaagatccgcaacgccaagctggttcttcttggagatgtgggcacgggcaagtc 252

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||||| || ||||| || || ||||||||||| || ||||||||||| ||||||| |||
Sbjct: 253 gagcctcgttctccggtttgtgaagggccagtttgttgagttccaggagtccaccatcgg 312

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
           ||| |||||||||||||||||| ||||||| ||||| |||||||| ||||||||||||||
Sbjct: 313 cgcggccttcttctcgcaaaccttggcggttaacgatgagacggtgaagttcgaaatctg 372

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || ||||||||||| || ||| |||| || |||||||| || || || ||
Sbjct: 373 ggatactgcagggcaggagaggtatcatagcttggctccgatgtactatcggggtgcggc 432

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            ||||| || || ||||| |||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 433 tgccgcgatagttgtctacgacatcacaaatgcggcctctttcacacgtgcaaaaaaatg 492

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 493 ggttcaagaacttcaagcgcaagg 516



to top

>gb|AY104686.1| Zea mays PCO088233 mRNA sequence
          Length = 1239

 Score =  176 bits (89), Expect = 5e-41
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 245 aagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtccagcctg 304
           ||||||||||||||||||||||||||||| || || || ||| | ||||| || ||| ||
Sbjct: 215 aagatccgcaacgccaagctggttcttcttggagatgtgggcgctggcaaatctagcttg 274

                                                                       
Query: 305 gtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggcgccgcc 364
           || || || || || ||||| ||||| || || ||||||||||| || |  || || |||
Sbjct: 275 gttcttcggtttgttaagggacagtttgttgaattccaggaatcaacaattggagcagcc 334

                                                                       
Query: 365 ttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgggacacg 424
           ||||| || || ||| | |||||||| || ||||| || ||||||||||||||||| || 
Sbjct: 335 ttcttttcccagaccttagcggtcaatgatgagactgttaagttcgaaatctgggatact 394

                                                                       
Query: 425 gccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgccgccgcc 484
           ||||| ||||||||||| || ||| |||| |||||||||||  | || || || || |||
Sbjct: 395 gccgggcaggagaggtatcatagcttggctcccatgtactataggggtgcagctgctgcc 454

                                                                       
Query: 485 atcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatgggttcaa 544
           || || |||||||||||||| ||  ||||||| || || ||||| |||||||||||||||
Sbjct: 455 attgttgtctatgacatcacaaatccggcctccttcacccgtgccaagaaatgggttcaa 514

                            
Query: 545 gaacttcaagcacaagg 561
           ||||||||||| |||||
Sbjct: 515 gaacttcaagctcaagg 531



to top

>ref|XM_469184.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1046

 Score =  143 bits (72), Expect = 7e-31
 Identities = 261/324 (80%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || ||
Sbjct: 176 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 235

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||| ||||||| || || || || || ||||| || ||||| |||||||| || |  ||
Sbjct: 236 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 295

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
            || || || ||||| || ||| | || || || ||||| || || ||||| ||||||||
Sbjct: 296 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 355

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || |||||||| || |||||| |||| |||||||||||  | || || ||
Sbjct: 356 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 415

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            || ||||| || |||||||||||||| ||  |||||||||| || ||||||||||||||
Sbjct: 416 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 475

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 476 ggttcaagaacttcaagctcaagg 499



to top

>dbj|AK100036.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013150K06, full
           insert sequence
          Length = 1046

 Score =  143 bits (72), Expect = 7e-31
 Identities = 261/324 (80%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || ||
Sbjct: 176 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 235

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||| ||||||| || || || || || ||||| || ||||| |||||||| || |  ||
Sbjct: 236 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 295

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
            || || || ||||| || ||| | || || || ||||| || || ||||| ||||||||
Sbjct: 296 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 355

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || |||||||| || |||||| |||| |||||||||||  | || || ||
Sbjct: 356 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 415

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            || ||||| || |||||||||||||| ||  |||||||||| || ||||||||||||||
Sbjct: 416 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 475

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 476 ggttcaagaacttcaagctcaagg 499



to top

>dbj|AK067459.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013107F02, full
           insert sequence
          Length = 891

 Score =  143 bits (72), Expect = 7e-31
 Identities = 261/324 (80%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || ||
Sbjct: 84  cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 143

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||| ||||||| || || || || || ||||| || ||||| |||||||| || |  ||
Sbjct: 144 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 203

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
            || || || ||||| || ||| | || || || ||||| || || ||||| ||||||||
Sbjct: 204 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 263

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || |||||||| || |||||| |||| |||||||||||  | || || ||
Sbjct: 264 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 323

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            || ||||| || |||||||||||||| ||  |||||||||| || ||||||||||||||
Sbjct: 324 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 383

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 384 ggttcaagaacttcaagctcaagg 407



to top

>dbj|AK061203.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-210-B04, full
           insert sequence
          Length = 1101

 Score =  143 bits (72), Expect = 7e-31
 Identities = 261/324 (80%)
 Strand = Plus / Plus

                                                                       
Query: 238 cggcagcaagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtc 297
           ||||| |||||||||||||||||| ||||||||||| || || || ||| | || || ||
Sbjct: 201 cggcaacaagatccgcaacgccaaactggttcttcttggagatgtgggcgcaggaaaatc 260

                                                                       
Query: 298 cagcctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccgg 357
            ||| ||||||| || || || || || ||||| || ||||| |||||||| || |  ||
Sbjct: 261 tagcttggtgcttcgttttgtaaaaggacagtttgttgagtttcaggaatcgacaattgg 320

                                                                       
Query: 358 cgccgccttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctg 417
            || || || ||||| || ||| | || || || ||||| || || ||||| ||||||||
Sbjct: 321 agcagcatttttctcacagaccttagcagttaatgacgaaaccgtgaagtttgaaatctg 380

                                                                       
Query: 418 ggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgccgc 477
           ||| || || || |||||||| || |||||| |||| |||||||||||  | || || ||
Sbjct: 381 ggatacagctgggcaggagagatatcacagcttggctcccatgtactataggggtgcggc 440

                                                                       
Query: 478 cgccgccatcgtcgtctatgacatcaccaacgcggcctcttttacacgtgcaaagaaatg 537
            || ||||| || |||||||||||||| ||  |||||||||| || ||||||||||||||
Sbjct: 441 tgctgccatagttgtctatgacatcacgaatccggcctctttcacccgtgcaaagaaatg 500

                                   
Query: 538 ggttcaagaacttcaagcacaagg 561
           |||||||||||||||||| |||||
Sbjct: 501 ggttcaagaacttcaagctcaagg 524



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  127 bits (64), Expect = 4e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                            
Query: 341      caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400
                ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| ||||||
Sbjct: 27058804 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 27058863

                                                                            
Query: 401      gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
                || ||||||||||||||||| || || || ||||||||||| || ||| |||| || |||
Sbjct: 27058864 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 27058923

                                                            
Query: 461      tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
                ||||| || || || || ||||| || || ||||| ||||||||
Sbjct: 27058924 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 27058967



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 511      ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
                ||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 27059833 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 27059883



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                            
Query: 265      ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324
                ||||||||| || || || ||||| |||||||| ||||| || ||||| || || |||||
Sbjct: 27058633 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 27058692

                                    
Query: 325      ccagttcgtcgagttccagg 344
                |||||| || ||||||||||
Sbjct: 27058693 ccagtttgttgagttccagg 27058712



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 238      cggcagcaagatccgcaacgccaagctggt 267
                ||||| ||||||||||||||||||||||||
Sbjct: 27058343 cggcaacaagatccgcaacgccaagctggt 27058372



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 220      cgccggcgccggcgccggcggc 241
                ||||||||||||||||||||||
Sbjct: 16410306 cgccggcgccggcgccggcggc 16410285



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 219     acgccggcgccggcgccggcg 239
               |||||||||||||||||||||
Sbjct: 2521791 acgccggcgccggcgccggcg 2521811



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 213      cggccaacgccggcgccggcgccg 236
                |||||| |||||||||||||||||
Sbjct: 23920309 cggccaccgccggcgccggcgccg 23920286



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 16410287 cgccggcgccggcgccggcg 16410306



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 15805631 cgccggcgccggcgccggcg 15805650



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 15805650 cgccggcgccggcgccggcg 15805631



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 352      caccggcgccgccttcttct 371
                ||||||||||||||||||||
Sbjct: 10742157 caccggcgccgccttcttct 10742176



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 463      ctaccgtggcgccgccgccg 482
                ||||||||||||||||||||
Sbjct: 10206215 ctaccgtggcgccgccgccg 10206196



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 70      ctttctcctctcgatcgatc 89
               ||||||||||||||||||||
Sbjct: 2882799 ctttctcctctcgatcgatc 2882818



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 2521811 cgccggcgccggcgccggcg 2521792



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  127 bits (64), Expect = 4e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                            
Query: 341      caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400
                ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| ||||||
Sbjct: 26984393 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 26984452

                                                                            
Query: 401      gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
                || ||||||||||||||||| || || || ||||||||||| || ||| |||| || |||
Sbjct: 26984453 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 26984512

                                                            
Query: 461      tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
                ||||| || || || || ||||| || || ||||| ||||||||
Sbjct: 26984513 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 26984556



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 511      ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
                ||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 26985422 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 26985472



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                            
Query: 265      ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324
                ||||||||| || || || ||||| |||||||| ||||| || ||||| || || |||||
Sbjct: 26984222 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 26984281

                                    
Query: 325      ccagttcgtcgagttccagg 344
                |||||| || ||||||||||
Sbjct: 26984282 ccagtttgttgagttccagg 26984301



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 238      cggcagcaagatccgcaacgccaagctggt 267
                ||||| ||||||||||||||||||||||||
Sbjct: 26983932 cggcaacaagatccgcaacgccaagctggt 26983961



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 220      cgccggcgccggcgccggcggc 241
                ||||||||||||||||||||||
Sbjct: 16363539 cgccggcgccggcgccggcggc 16363518



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 219     acgccggcgccggcgccggcg 239
               |||||||||||||||||||||
Sbjct: 2521735 acgccggcgccggcgccggcg 2521755



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 213      cggccaacgccggcgccggcgccg 236
                |||||| |||||||||||||||||
Sbjct: 23848515 cggccaccgccggcgccggcgccg 23848492



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 16363520 cgccggcgccggcgccggcg 16363539



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 15758864 cgccggcgccggcgccggcg 15758883



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 15758883 cgccggcgccggcgccggcg 15758864



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 352      caccggcgccgccttcttct 371
                ||||||||||||||||||||
Sbjct: 10741856 caccggcgccgccttcttct 10741875



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 463      ctaccgtggcgccgccgccg 482
                ||||||||||||||||||||
Sbjct: 10206097 ctaccgtggcgccgccgccg 10206078



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 70      ctttctcctctcgatcgatc 89
               ||||||||||||||||||||
Sbjct: 2882743 ctttctcctctcgatcgatc 2882762



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 2521755 cgccggcgccggcgccggcg 2521736



to top

>emb|AL713905.6|CNS07YQ5 Oryza sativa chromosome 12, . BAC OJ1584_D02 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 131300

 Score =  127 bits (64), Expect = 4e-26
 Identities = 139/164 (84%)
 Strand = Plus / Minus

                                                                         
Query: 341   caggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacg 400
             ||||| ||||||| |||||| |||||||||||||||||| ||||||| ||||| ||||||
Sbjct: 97433 caggagtccaccatcggcgcggccttcttctcgcaaaccttggcggttaacgatgagacg 97374

                                                                         
Query: 401   gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
             || ||||||||||||||||| || || || ||||||||||| || ||| |||| || |||
Sbjct: 97373 gtgaagttcgaaatctgggatactgcagggcaggagaggtatcatagcttggctccgatg 97314

                                                         
Query: 461   tactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
             ||||| || || || || ||||| || || ||||| ||||||||
Sbjct: 97313 tactatcggggtgcggctgccgcgatagttgtctacgacatcac 97270



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                                
Query: 511   ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
             ||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 96404 ggcctctttcacacgtgcaaaaaaatgggttcaagaacttcaagcgcaagg 96354



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                         
Query: 265   ggttcttctaggggacgtcggcaccggcaagtccagcctggtgctccgcttcgtcaaggg 324
             ||||||||| || || || ||||| |||||||| ||||| || ||||| || || |||||
Sbjct: 97604 ggttcttcttggagatgtgggcacgggcaagtcgagcctcgttctccggtttgtgaaggg 97545

                                 
Query: 325   ccagttcgtcgagttccagg 344
             |||||| || ||||||||||
Sbjct: 97544 ccagtttgttgagttccagg 97525



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 238   cggcagcaagatccgcaacgccaagctggt 267
             ||||| ||||||||||||||||||||||||
Sbjct: 97894 cggcaacaagatccgcaacgccaagctggt 97865



to top

>gb|M95071.1|MZEORFL Zea mays putative GTP-binding protein homolog mRNA, partial cds
          Length = 212

 Score =  105 bits (53), Expect = 2e-19
 Identities = 161/197 (81%)
 Strand = Plus / Plus

                                                                       
Query: 245 aagatccgcaacgccaagctggttcttctaggggacgtcggcaccggcaagtccagcctg 304
           ||||||||||||||||||||||||||||| || || || ||| | ||||| || ||| ||
Sbjct: 7   aagatccgcaacgccaagctggttcttcttggagatgtgggcgctggcaaatctagcttg 66

                                                                       
Query: 305 gtgctccgcttcgtcaagggccagttcgtcgagttccaggaatccaccaccggcgccgcc 364
           || || || || || ||||| ||||| || || ||||||||||| || |  || || |||
Sbjct: 67  gttcttcggtttgttaagggacagtttgttgaattccaggaatcaacaattggagcagcc 126

                                                                       
Query: 365 ttcttctcgcaaaccctggcggtcaacgacgagacggtcaagttcgaaatctgggacacg 424
           ||||| || || ||| | |||||||| || ||||| || ||||||||||||||||| || 
Sbjct: 127 ttcttttcccagaccttagcggtcaatgatgagactgttaagttcgaaatctgggatact 186

                            
Query: 425 gccggccaggagaggta 441
           ||||| |||||||||||
Sbjct: 187 gccgggcaggagaggta 203



to top

>ref|XM_511501.1| PREDICTED: Pan troglodytes similar to General control of amino acid
           synthesis protein 5-like 2 (Histone acetyltransferase
           GCN5) (mmGCN5) (LOC454678), mRNA
          Length = 1174

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 95/111 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || || |||||| |||| ||||||||||| |||
Sbjct: 293 acggtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggccccc 352

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 353 atgtactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 403



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Plus

                                                                            
Query: 413      atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
                ||||||||||| |||||||| ||  | ||||||||||| ||||||||||||||||| |||
Sbjct: 28267877 atctgggacaccgccggccaagaacgctaccacagccttgcgcccatgtactaccgcggc 28267936

                                              
Query: 473      gccgccgccgccatcgtcgtctatgacatc 502
                || ||||||||  |||||||||| ||||||
Sbjct: 28267937 gcggccgccgctgtcgtcgtctacgacatc 28267966



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 207     ccatggcggccaacgccggcgccggc 232
               ||||||||||||||| ||||||||||
Sbjct: 6244224 ccatggcggccaacggcggcgccggc 6244249



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 220     cgccggcgccggcgccggcggc 241
               ||||||||||||||||||||||
Sbjct: 1999465 cgccggcgccggcgccggcggc 1999486



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 27173925 cgccggcgccggcgccggcg 27173944



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 27173944 cgccggcgccggcgccggcg 27173925



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 24112004 cgccggcgccggcgccggcg 24112023



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 24112023 cgccggcgccggcgccggcg 24112004



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 223     cggcgccggcgccggcggca 242
               ||||||||||||||||||||
Sbjct: 7156761 cggcgccggcgccggcggca 7156780



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 6217606 cgccggcgccggcgccggcg 6217625



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 6217625 cgccggcgccggcgccggcg 6217606



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5442715 cgccggcgccggcgccggcg 5442734



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5442734 cgccggcgccggcgccggcg 5442715



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 1999484 cgccggcgccggcgccggcg 1999465



to top

>dbj|AP005395.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0623A10
          Length = 156517

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 79/90 (87%)
 Strand = Plus / Plus

                                                                         
Query: 413   atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
             ||||||||||| |||||||| ||  | ||||||||||| ||||||||||||||||| |||
Sbjct: 65906 atctgggacaccgccggccaagaacgctaccacagccttgcgcccatgtactaccgcggc 65965

                                           
Query: 473   gccgccgccgccatcgtcgtctatgacatc 502
             || ||||||||  |||||||||| ||||||
Sbjct: 65966 gcggccgccgctgtcgtcgtctacgacatc 65995



to top

>gb|BC106039.1| Homo sapiens RAB5C, member RAS oncogene family, transcript variant
           2, mRNA (cDNA clone MGC:117217 IMAGE:4938169), complete
           cds
          Length = 1668

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 407 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 466

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 467 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 514



to top

>ref|NM_004583.2| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript
           variant 2, mRNA
          Length = 1674

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 408 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 467

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 468 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 515



to top

>ref|NM_201434.1| Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript
           variant 1, mRNA
          Length = 1791

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 525 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 584

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 585 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 632



to top

>gb|BT019484.1| Homo sapiens RAB5C, member RAS oncogene family mRNA, complete cds
          Length = 651

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315



to top

>ref|XM_589241.2| PREDICTED: Bos taurus similar to Ras-related protein Rab-5A,
           transcript variant 1 (LOC539764), mRNA
          Length = 2076

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 410 gaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgt 469
           ||||| ||||| ||||| ||||| ||| ||||||||||||||||||||||||||||| | 
Sbjct: 388 gaaatatgggatacggctggccaagagcggtaccacagcctggcgcccatgtactacaga 447

                                                   
Query: 470 ggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509
           ||||||   |||||||| ||||| || |||||||| ||||
Sbjct: 448 ggcgcccaggccgccatagtcgtgtacgacatcacgaacg 487



to top

>ref|XM_864602.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-5A,
           transcript variant 2 (LOC539764), mRNA
          Length = 2097

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 410 gaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgt 469
           ||||| ||||| ||||| ||||| ||| ||||||||||||||||||||||||||||| | 
Sbjct: 409 gaaatatgggatacggctggccaagagcggtaccacagcctggcgcccatgtactacaga 468

                                                   
Query: 470 ggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509
           ||||||   |||||||| ||||| || |||||||| ||||
Sbjct: 469 ggcgcccaggccgccatagtcgtgtacgacatcacgaacg 508



to top

>emb|CR724508.1|CNS0GLZ6 Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 95/112 (84%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||||||||||||||||||| | |||||||| ||||| || 
Sbjct: 441 acggtgaagtttgagatctgggacacggccggccaggagcgctaccacagtctggctcct 500

                                                               
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacg 509
           ||||| ||||| |||||    ||||||||||| ||||| |||||||| ||||
Sbjct: 501 atgtattaccgaggcgcgcaggccgccatcgtggtctacgacatcacaaacg 552



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           ||||||||| |||||||||||||||||||||| || |||  ||| ||||||||
Sbjct: 336 aagtccagcttggtgctccgcttcgtcaagggtcaattccacgaattccagga 388



to top

>emb|CR860097.1| Pongo pygmaeus mRNA; cDNA DKFZp468C168 (from clone DKFZp468C168)
          Length = 1650

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 393 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 452

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 453 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 500



to top

>emb|CR626803.1| full-length cDNA clone CS0DI004YB12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1558

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471



to top

>emb|CR625641.1| full-length cDNA clone CS0DI053YE06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1577

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 366 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 425

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 426 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 473



to top

>emb|CR625174.1| full-length cDNA clone CS0DI013YF02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1531

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 347 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 406

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 407 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 454



to top

>emb|CR624854.1| full-length cDNA clone CS0DH002YK07 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1610

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 387 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 446

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 447 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 494



to top

>emb|CR623581.1| full-length cDNA clone CS0DI044YG15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1576

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471



to top

>emb|CR622103.1| full-length cDNA clone CS0DI086YP22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1568

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 350 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 409

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 410 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 457



to top

>emb|CR621567.1| full-length cDNA clone CS0DC023YN19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1565

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 364 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 423

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 424 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 471



to top

>emb|CR620573.1| full-length cDNA clone CS0DE008YO18 of Placenta of Homo sapiens
           (human)
          Length = 1661

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 417 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 476

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 477 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 524



to top

>emb|CR620653.1| full-length cDNA clone CS0DF002YO05 of Fetal brain of Homo sapiens
           (human)
          Length = 1721

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 504 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 563

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 564 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 611



to top

>emb|CR617879.1| full-length cDNA clone CS0DD007YI09 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1336

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 120 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 179

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 180 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 227



to top

>emb|CR617757.1| full-length cDNA clone CS0DI010YH11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1598

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489



to top

>emb|CR615479.1| full-length cDNA clone CS0DA009YL15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1607

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489



to top

>emb|CR613867.1| full-length cDNA clone CS0DC028YA10 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1584

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489



to top

>emb|CR612483.1| full-length cDNA clone CS0DH005YE20 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1414

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 217 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 276

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 277 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 324



to top

>emb|CR612169.1| full-length cDNA clone CS0DI006YD09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1500

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 296 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 355

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 356 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 403



to top

>emb|CR611639.1| full-length cDNA clone CS0DE004YH07 of Placenta of Homo sapiens
           (human)
          Length = 1602

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 374 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 433

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 434 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 481



to top

>emb|CR607787.1| full-length cDNA clone CS0DI010YF11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1595

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489



to top

>emb|CR607771.1| full-length cDNA clone CS0DI077YG09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1620

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 404 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 463

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 464 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 511



to top

>emb|CR608029.1| full-length cDNA clone CS0DC015YE20 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1593

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 374 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 433

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 434 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 481



to top

>emb|CR603551.1| full-length cDNA clone CS0DM007YF04 of Fetal liver of Homo sapiens
           (human)
          Length = 1599

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 387 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 446

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 447 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 494



to top

>emb|CR601486.1| full-length cDNA clone CS0DA006YF19 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1570

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 366 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 425

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 426 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 473



to top

>emb|CR600565.1| full-length cDNA clone CS0DI075YN07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1599

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487



to top

>emb|CR600279.1| full-length cDNA clone CS0DB005YK02 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1591

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 376 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 435

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 483



to top

>emb|CR599091.1| full-length cDNA clone CS0DI081YC13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1593

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487



to top

>emb|CR595237.1| full-length cDNA clone CL0BA011ZH04 of Placenta of Homo sapiens
           (human)
          Length = 1632

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 382 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 441

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 442 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 489



to top

>emb|CR591906.1| full-length cDNA clone CS0DI042YG22 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1589

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 380 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 439

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 440 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 487



to top

>emb|CR591636.1| full-length cDNA clone CS0DI022YM14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1590

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 376 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 435

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 483



to top

>gb|AF498938.1| Homo sapiens small GTP binding protein RAB5C (RAB5C) mRNA, complete
           cds
          Length = 651

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315



to top

>emb|CR541901.1| Homo sapiens full open reading frame cDNA clone RZPDo834B1233D for
           gene RAB5C, RAB5C, member RAS oncogene family; complete
           cds, incl. stopcodon
          Length = 651

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315



to top

>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence
          Length = 174902

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 496 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 437

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 436 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 389



to top

>gb|AF141304.1|AF141304 Homo sapiens small GTPase (RAB5C) mRNA, complete cds
          Length = 729

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 277 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 336

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 337 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 384



to top

>gb|AY888260.1| Synthetic construct Homo sapiens clone FLH009616.01X RAB5C member
           RAS oncogene family (RAB5C) mRNA, complete cds
          Length = 651

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315



to top

>dbj|AK025474.1| Homo sapiens cDNA: FLJ21821 fis, clone HEP01311, highly similar to
            HSU18420 Human ras-related small GTP binding protein Rab5
            (rab5) mRNA
          Length = 2378

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                        
Query: 401  gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
            |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 1112 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 1171

                                                            
Query: 461  tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
            ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 1172 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 1219



to top

>gb|AY893587.1| Synthetic construct Homo sapiens clone FLH130878.01X RAB5C member
           RAS oncogene family (RAB5C) mRNA, complete cds
          Length = 651

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 208 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 267

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 268 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 315



to top

>gb|AC003104.1|AC003104 Homo sapiens chromosome 17, clone HCIT48C15, complete sequence
          Length = 100635

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                        
Query: 401  gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
            |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 9561 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 9620

                                                            
Query: 461  tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
            ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 9621 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 9668



to top

>gb|U18420.1|HSU18420 Human ras-related small GTP binding protein Rab5 (rab5) mRNA,
           complete cds
          Length = 1590

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 343 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 402

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 403 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 450



to top

>gb|U11293.1|HSU11293 Human Rab5c-like protein mRNA, complete cds
          Length = 1529

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 283 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 342

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||||||||||||||||
Sbjct: 343 tactatcggggggcccaggctgccatcgtggtctatgacatcaccaac 390



to top

>gb|DQ215564.1| Taeniopygia guttata clone 0061P0006C04 RAB5C member RAS oncogene
           family-like mRNA, complete sequence
          Length = 1393

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||||||||| || |||||| | |||||||||||||| |||
Sbjct: 349 acggtgaagtttgagatctgggacacggcggggcaggagcgataccacagcctggccccc 408

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||||||||| || ||    || |||||||| ||||| ||||||||||||
Sbjct: 409 atgtactaccggggggctcaggcagccatcgtggtctacgacatcaccaac 459



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||||||||| || ||||| |||||||| ||||||  ||||| ||||||
Sbjct: 244 aagtccagcctggtcctgcgctttgtcaaggggcagttccacgagtaccagga 296



to top

>emb|AJ437656.1|SCH437656 Simmondsia chinensis mRNA for Rab-related small GTP-binding protein
           (rab gene)
          Length = 837

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| ||||| ||||| ||||| || || ||||||||||| |   |||| |||
Sbjct: 202 acggtgaagtttgaaatatgggatacggctggtcaagagaggtaccatattttggctccc 261

                                                                       
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517
           ||||||||| | |||||||| || |||||  | |||||||||||||||| |||||  || 
Sbjct: 262 atgtactacagaggcgccgcagctgccattattgtctatgacatcaccagcgcggattca 321

                                              
Query: 518 tttacacgtgcaaagaaatgggttcaagaacttca 552
           ||| ||| ||| ||||||||||| || ||||||||
Sbjct: 322 tttgcacttgctaagaaatgggtacaggaacttca 356



to top

>emb|BX052472.1|CNS09CNG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 560 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 619

                
Query: 464 taccg 468
           |||||
Sbjct: 620 taccg 624



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 458 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 502



to top

>emb|BX032716.1|CNS08XEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 326 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 385

                
Query: 464 taccg 468
           |||||
Sbjct: 386 taccg 390



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 224 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 268



to top

>emb|BX028733.1|CNS08UC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556

                
Query: 464 taccg 468
           |||||
Sbjct: 557 taccg 561



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439



to top

>emb|BX020822.1|CNS08O8A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 516

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 196 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 255

                
Query: 464 taccg 468
           |||||
Sbjct: 256 taccg 260



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 302 ctggtgctccgcttcgtcaagggccagttc 331
           |||||| | |||||||||||||||||||||
Sbjct: 94  ctggtgttacgcttcgtcaagggccagttc 123



to top

>ref|XM_555603.1| Anopheles gambiae str. PEST ENSANGP00000027173
           (ENSANGG00000007604), partial mRNA
          Length = 513

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 316 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 375

                
Query: 464 taccg 468
           |||||
Sbjct: 376 taccg 380



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 214 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 258



to top

>ref|XM_317586.2| Anopheles gambiae str. PEST ENSANGP00000023894
           (ENSANGG00000007604), partial mRNA
          Length = 513

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 316 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 375

                
Query: 464 taccg 468
           |||||
Sbjct: 376 taccg 380



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 214 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 258



to top

>ref|XM_317587.2| Anopheles gambiae str. PEST ENSANGP00000023388
           (ENSANGG00000007604), partial mRNA
          Length = 890

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 471 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 530

                
Query: 464 taccg 468
           |||||
Sbjct: 531 taccg 535



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 369 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 413



to top

>ref|XM_317584.2| Anopheles gambiae str. PEST ENSANGP00000022645
           (ENSANGG00000007604), partial mRNA
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556

                
Query: 464 taccg 468
           |||||
Sbjct: 557 taccg 561



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439



to top

>ref|XM_317588.2| Anopheles gambiae str. PEST ENSANGP00000010093
           (ENSANGG00000007604), partial mRNA
          Length = 966

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 547 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 606

                
Query: 464 taccg 468
           |||||
Sbjct: 607 taccg 611



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 445 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 489



to top

>ref|XM_317585.2| Anopheles gambiae str. PEST ENSANGP00000022624
           (ENSANGG00000007604), partial mRNA
          Length = 916

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| |||||||||||  ||||||||||||||
Sbjct: 497 aagttcgaaatctgggacactgctggacaggaaaggtaccacagtttggcgcccatgtac 556

                
Query: 464 taccg 468
           |||||
Sbjct: 557 taccg 561



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 395 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 439



to top

>ref|NM_001034743.1| Bos taurus RAB5C, member RAS oncogene family isoform b (RAB5C),
           mRNA
          Length = 1045

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 391 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 450

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||| ||||||||||||
Sbjct: 451 tactatcggggggcccaggctgccatcgtggtctacgacatcaccaac 498



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           ||||| |||||||| || ||||||||||||||||| ||||||  ||||| ||||||
Sbjct: 280 ggcaaatccagcctcgtcctccgcttcgtcaagggtcagttccacgagtaccagga 335



to top

>emb|Z27110.1|CFRAB5C C.familiaris mRNA for  Rab5c protein
          Length = 763

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || || |||||| |||| ||||||||||| ||||||||||| || || 
Sbjct: 322 atctgggacacagctggacaggagcggtatcacagcctggcccccatgtactatcggggg 381

                                               
Query: 473 gccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||   || |||||||| ||||||||||||||||||
Sbjct: 382 gcccaggctgccatcgtggtctatgacatcaccaac 417



to top

>ref|NM_001003261.1| Canis familiaris RAB5C, member RAS oncogene family (RAB5C), mRNA
          Length = 763

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || || |||||| |||| ||||||||||| ||||||||||| || || 
Sbjct: 322 atctgggacacagctggacaggagcggtatcacagcctggcccccatgtactatcggggg 381

                                               
Query: 473 gccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||   || |||||||| ||||||||||||||||||
Sbjct: 382 gcccaggctgccatcgtggtctatgacatcaccaac 417



to top

>gb|BT021518.1| Bos taurus RAB5C, member RAS oncogene family (RAB5C), mRNA,
           complete cds
          Length = 1045

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| |||| ||||||||||| ||||||
Sbjct: 391 gtcaagtttgagatctgggacacagctggacaggagcggtatcacagcctggcccccatg 450

                                                           
Query: 461 tactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           ||||| || || |||   || |||||||| ||||| ||||||||||||
Sbjct: 451 tactatcggggggcccaggctgccatcgtggtctacgacatcaccaac 498



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           ||||| |||||||| || ||||||||||||||||| ||||||  ||||| ||||||
Sbjct: 280 ggcaaatccagcctcgtcctccgcttcgtcaagggtcagttccacgagtaccagga 335



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 511      ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
                ||||||||| || |||||||||||||||||||||||||||||||| |||||
Sbjct: 25949684 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 25949734



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                            
Query: 404      aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
                ||||| ||||||||||| || || || |||||||| || |||||| |||| |||||||||
Sbjct: 25948887 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 25948946

                                                         
Query: 464      taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
                ||  | || || || || ||||| || ||||||||||||||
Sbjct: 25948947 tataggggtgcggctgctgccatagttgtctatgacatcac 25948987



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 222      ccggcgccggcgccggcggcagca 245
                ||||||||||||||||||||||||
Sbjct: 35006709 ccggcgccggcgccggcggcagca 35006686



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 219      acgccggcgccggcgccggcggc 241
                |||||||||||||||||||||||
Sbjct: 33690497 acgccggcgccggcgccggcggc 33690475



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 87       atccatccgtccgtccgtccgtc 109
                |||||||||||||||||||||||
Sbjct: 29709006 atccatccgtccgtccgtccgtc 29708984



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 222      ccggcgccggcgccggcggcagc 244
                |||||||||||||||||||||||
Sbjct: 12457412 ccggcgccggcgccggcggcagc 12457434



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 217     caacgccggcgccggcgccggcg 239
               |||||||||||||||||||||||
Sbjct: 5609838 caacgccggcgccggcgccggcg 5609816



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 472      cgccgccgccgccatcgtcgtc 493
                ||||||||||||||||||||||
Sbjct: 27434878 cgccgccgccgccatcgtcgtc 27434857



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 238      cggcagcaagatccgcaacgccaagctggt 267
                ||||| |||||||||||||||||| |||||
Sbjct: 25948031 cggcaacaagatccgcaacgccaaactggt 25948060



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 222      ccggcgccggcgccggcggcagcaag 247
                |||||||||||||||||||| |||||
Sbjct: 12643700 ccggcgccggcgccggcggcggcaag 12643725



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 220     cgccggcgccggcgccggcggc 241
               ||||||||||||||||||||||
Sbjct: 3105099 cgccggcgccggcgccggcggc 3105078



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 283      cggcaccggcaagtccagcct 303
                |||||||||||||||||||||
Sbjct: 21353801 cggcaccggcaagtccagcct 21353781



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 473     gccgccgccgccatcgtcgtc 493
               |||||||||||||||||||||
Sbjct: 5412078 gccgccgccgccatcgtcgtc 5412098



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 219     acgccggcgccggcgccggcg 239
               |||||||||||||||||||||
Sbjct: 5104482 acgccggcgccggcgccggcg 5104502



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 221     gccggcgccggcgccggcggc 241
               |||||||||||||||||||||
Sbjct: 2862003 gccggcgccggcgccggcggc 2862023



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 470    ggcgccgccgccgccatcgtcgtct 494
              ||||||||| |||||||||||||||
Sbjct: 965675 ggcgccgccaccgccatcgtcgtct 965651



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      acgccggcgccggcgccggc 238
                ||||||||||||||||||||
Sbjct: 34058122 acgccggcgccggcgccggc 34058103



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33690477 cgccggcgccggcgccggcg 33690496



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ggcaccggcaagtccagcct 303
                ||||||||||||||||||||
Sbjct: 33634017 ggcaccggcaagtccagcct 33633998



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ggcaccggcaagtccagcct 303
                ||||||||||||||||||||
Sbjct: 33629763 ggcaccggcaagtccagcct 33629744



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33527522 cgccggcgccggcgccggcg 33527541



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33527541 cgccggcgccggcgccggcg 33527522



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 212      gcggccaacgccggcgccggcgccggcg 239
                ||||||| || |||||||||||||||||
Sbjct: 30349191 gcggccaccggcggcgccggcgccggcg 30349218



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 222      ccggcgccggcgccggcggc 241
                ||||||||||||||||||||
Sbjct: 30242716 ccggcgccggcgccggcggc 30242735



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 470      ggcgccgccgccgccatcgtcgtc 493
                ||||||||||||||| ||||||||
Sbjct: 27111938 ggcgccgccgccgccgtcgtcgtc 27111961



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 221      gccggcgccggcgccggcgg 240
                ||||||||||||||||||||
Sbjct: 13577548 gccggcgccggcgccggcgg 13577567



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5609816 cgccggcgccggcgccggcg 5609835



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5104502 cgccggcgccggcgccggcg 5104483



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 222     ccggcgccggcgccggcggc 241
               ||||||||||||||||||||
Sbjct: 4881950 ccggcgccggcgccggcggc 4881969



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 222     ccggcgccggcgccggcggc 241
               ||||||||||||||||||||
Sbjct: 4731341 ccggcgccggcgccggcggc 4731360



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3637992 cgccggcgccggcgccggcg 3637973



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3637973 cgccggcgccggcgccggcg 3637992



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3105080 cgccggcgccggcgccggcg 3105099



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 225     gcgccggcgccggcggcagc 244
               ||||||||||||||||||||
Sbjct: 1652613 gcgccggcgccggcggcagc 1652594



to top

>gb|AC135792.3| Oryza sativa chromosome 3 BAC OSJNBa0056E06 genomic sequence, complete
             sequence
          Length = 140720

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                                
Query: 511   ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
             ||||||||| || |||||||||||||||||||||||||||||||| |||||
Sbjct: 58236 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 58186



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                         
Query: 404   aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
             ||||| ||||||||||| || || || |||||||| || |||||| |||| |||||||||
Sbjct: 59033 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 58974

                                                      
Query: 464   taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
             ||  | || || || || ||||| || ||||||||||||||
Sbjct: 58973 tataggggtgcggctgctgccatagttgtctatgacatcac 58933



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 238   cggcagcaagatccgcaacgccaagctggt 267
             ||||| |||||||||||||||||| |||||
Sbjct: 59889 cggcaacaagatccgcaacgccaaactggt 59860



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                                   
Query: 511      ggcctcttttacacgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
                ||||||||| || |||||||||||||||||||||||||||||||| |||||
Sbjct: 26040993 ggcctctttcacccgtgcaaagaaatgggttcaagaacttcaagctcaagg 26041043



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                            
Query: 404      aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
                ||||| ||||||||||| || || || |||||||| || |||||| |||| |||||||||
Sbjct: 26040196 aagtttgaaatctgggatacagctgggcaggagagatatcacagcttggctcccatgtac 26040255

                                                         
Query: 464      taccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
                ||  | || || || || ||||| || ||||||||||||||
Sbjct: 26040256 tataggggtgcggctgctgccatagttgtctatgacatcac 26040296



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 222      ccggcgccggcgccggcggcagca 245
                ||||||||||||||||||||||||
Sbjct: 35096781 ccggcgccggcgccggcggcagca 35096758



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 219      acgccggcgccggcgccggcggc 241
                |||||||||||||||||||||||
Sbjct: 33780969 acgccggcgccggcgccggcggc 33780947



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 87       atccatccgtccgtccgtccgtc 109
                |||||||||||||||||||||||
Sbjct: 29800428 atccatccgtccgtccgtccgtc 29800406



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 222      ccggcgccggcgccggcggcagc 244
                |||||||||||||||||||||||
Sbjct: 12454175 ccggcgccggcgccggcggcagc 12454197



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 217     caacgccggcgccggcgccggcg 239
               |||||||||||||||||||||||
Sbjct: 5609051 caacgccggcgccggcgccggcg 5609029



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 472      cgccgccgccgccatcgtcgtc 493
                ||||||||||||||||||||||
Sbjct: 27526201 cgccgccgccgccatcgtcgtc 27526180



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 238      cggcagcaagatccgcaacgccaagctggt 267
                ||||| |||||||||||||||||| |||||
Sbjct: 26039340 cggcaacaagatccgcaacgccaaactggt 26039369



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 222      ccggcgccggcgccggcggcagcaag 247
                |||||||||||||||||||| |||||
Sbjct: 12640463 ccggcgccggcgccggcggcggcaag 12640488



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 220     cgccggcgccggcgccggcggc 241
               ||||||||||||||||||||||
Sbjct: 3105210 cgccggcgccggcgccggcggc 3105189



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 283      cggcaccggcaagtccagcct 303
                |||||||||||||||||||||
Sbjct: 21346830 cggcaccggcaagtccagcct 21346810



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 473     gccgccgccgccatcgtcgtc 493
               |||||||||||||||||||||
Sbjct: 5411293 gccgccgccgccatcgtcgtc 5411313



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 219     acgccggcgccggcgccggcg 239
               |||||||||||||||||||||
Sbjct: 5103699 acgccggcgccggcgccggcg 5103719



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 221     gccggcgccggcgccggcggc 241
               |||||||||||||||||||||
Sbjct: 2862114 gccggcgccggcgccggcggc 2862134



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 470    ggcgccgccgccgccatcgtcgtct 494
              ||||||||| |||||||||||||||
Sbjct: 965673 ggcgccgccaccgccatcgtcgtct 965649



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 219      acgccggcgccggcgccggc 238
                ||||||||||||||||||||
Sbjct: 34148594 acgccggcgccggcgccggc 34148575



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33780949 cgccggcgccggcgccggcg 33780968



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ggcaccggcaagtccagcct 303
                ||||||||||||||||||||
Sbjct: 33724489 ggcaccggcaagtccagcct 33724470



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      ggcaccggcaagtccagcct 303
                ||||||||||||||||||||
Sbjct: 33720235 ggcaccggcaagtccagcct 33720216



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33618013 cgccggcgccggcgccggcg 33617994



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 220      cgccggcgccggcgccggcg 239
                ||||||||||||||||||||
Sbjct: 33617994 cgccggcgccggcgccggcg 33618013



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 212      gcggccaacgccggcgccggcgccggcg 239
                ||||||| || |||||||||||||||||
Sbjct: 30440613 gcggccaccggcggcgccggcgccggcg 30440640



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 222      ccggcgccggcgccggcggc 241
                ||||||||||||||||||||
Sbjct: 30334138 ccggcgccggcgccggcggc 30334157



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 470      ggcgccgccgccgccatcgtcgtc 493
                ||||||||||||||| ||||||||
Sbjct: 27203261 ggcgccgccgccgccgtcgtcgtc 27203284



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 221      gccggcgccggcgccggcgg 240
                ||||||||||||||||||||
Sbjct: 13573423 gccggcgccggcgccggcgg 13573442



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5609029 cgccggcgccggcgccggcg 5609048



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 5103719 cgccggcgccggcgccggcg 5103700



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 222     ccggcgccggcgccggcggc 241
               ||||||||||||||||||||
Sbjct: 4881165 ccggcgccggcgccggcggc 4881184



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 222     ccggcgccggcgccggcggc 241
               ||||||||||||||||||||
Sbjct: 4731456 ccggcgccggcgccggcggc 4731475



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3638084 cgccggcgccggcgccggcg 3638103



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3638103 cgccggcgccggcgccggcg 3638084



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 220     cgccggcgccggcgccggcg 239
               ||||||||||||||||||||
Sbjct: 3105191 cgccggcgccggcgccggcg 3105210



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 225     gcgccggcgccggcggcagc 244
               ||||||||||||||||||||
Sbjct: 1652611 gcgccggcgccggcggcagc 1652592



to top

>ref|NM_001030328.2| Xenopus tropicalis RAB5A protein (RAB5A), mRNA
          Length = 1003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||||||||| || ||||||||||| |||||  |||| |||
Sbjct: 414 acggtgaagtttgagatctgggacacggcagggcaggagaggtatcacagtttggccccc 473

                                                             
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507
           ||||||||||| || |||   || ||||| || || ||||||||||||||
Sbjct: 474 atgtactaccgaggagcccaggcagccattgtagtttatgacatcaccaa 523



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||| |||| || |||||||| |||||||||||
Sbjct: 309 aagtccagcttggtcctgcgcttcgttaagggccagtt 346



to top

>emb|CR761238.2| Xenopus tropicalis finished cDNA, clone TEgg117g03
          Length = 1003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||||||||| || ||||||||||| |||||  |||| |||
Sbjct: 414 acggtgaagtttgagatctgggacacggcagggcaggagaggtatcacagtttggccccc 473

                                                             
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507
           ||||||||||| || |||   || ||||| || || ||||||||||||||
Sbjct: 474 atgtactaccgaggagcccaggcagccattgtagtttatgacatcaccaa 523



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 293 aagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||| |||| || |||||||| |||||||||||
Sbjct: 309 aagtccagcttggtcctgcgcttcgttaagggccagtt 346



to top

>emb|BX052473.1|CNS09CNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||||||||||||||| || || || ||||| |||||||||||  ||||||||||||||
Sbjct: 720 aagttcgaaatctgggaaactgctggacaggaaaggtaccacagtttggcgcccatgtac 661

                
Query: 464 taccg 468
           |||||
Sbjct: 660 taccg 656



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 822 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 778



to top

>emb|BX028734.1|CNS08UC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||||||||||||||| || || || ||||| |||||||||||  ||||||||||||||
Sbjct: 715 aagttcgaaatctgggaaactgctggacaggaaaggtaccacagtttggcgcccatgtac 656

                
Query: 464 taccg 468
           |||||
Sbjct: 655 taccg 651



to top

>gb|BC047803.1| Danio rerio RAB5A, member RAS oncogene family, mRNA (cDNA clone
           MGC:56009 IMAGE:3819814), complete cds
          Length = 2408

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 126/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456
           |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| ||
Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457

                                                                       
Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516
           |||||||||| | || |||   |||||||| || || |||||||||||||| | ||  ||
Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517

                                               
Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552
            ||| || | |||||||| |||||| |||| |||||
Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553



to top

>gb|BC063966.1| Danio rerio RAB5A, member RAS oncogene family, mRNA (cDNA clone
           MGC:77676 IMAGE:6997315), complete cds
          Length = 1858

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 126/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456
           |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| ||
Sbjct: 393 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 452

                                                                       
Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516
           |||||||||| | || |||   |||||||| || || |||||||||||||| | ||  ||
Sbjct: 453 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 512

                                               
Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552
            ||| || | |||||||| |||||| |||| |||||
Sbjct: 513 atttgcaagagcaaagaactgggttaaagagcttca 548



to top

>ref|XM_697418.1| PREDICTED: Danio rerio hypothetical protein LOC554855 (LOC554855),
           mRNA
          Length = 2378

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 126/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456
           |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| ||
Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457

                                                                       
Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516
           |||||||||| | || |||   |||||||| || || |||||||||||||| | ||  ||
Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517

                                               
Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552
            ||| || | |||||||| |||||| |||| |||||
Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553



to top

>ref|NM_201485.1| Danio rerio RAB5A, member RAS oncogene family (rab5a), mRNA
          Length = 2408

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 126/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 397 gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456
           |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| ||
Sbjct: 398 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 457

                                                                       
Query: 457 catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctc 516
           |||||||||| | || |||   |||||||| || || |||||||||||||| | ||  ||
Sbjct: 458 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaatgaggagtc 517

                                               
Query: 517 ttttacacgtgcaaagaaatgggttcaagaacttca 552
            ||| || | |||||||| |||||| |||| |||||
Sbjct: 518 atttgcaagagcaaagaactgggttaaagagcttca 553



to top

>gb|BC029678.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone
           MGC:36507 IMAGE:5368061), complete cds
          Length = 1587

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 346 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 405

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 406 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 456



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 238 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 279



to top

>gb|BC023027.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone
           MGC:36517 IMAGE:5369566), complete cds
          Length = 1620

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 362 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 421

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 422 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 472



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 254 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 295



to top

>gb|AY081181.1| Drosophila melanogaster clone LD03788 Rab5 mRNA, complete cds
          Length = 1736

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 461 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 519



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 359 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 402



to top

>gb|AY081180.1| Drosophila melanogaster clone GM02432 Rab5 mRNA, complete cds
          Length = 886

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 377 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 435



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 275 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 318



to top

>emb|AJ721020.1| Gallus gallus mRNA for hypothetical protein, clone 32j11
          Length = 1090

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || ||||||||||| || ||||||||| | |||||||| ||||| |||
Sbjct: 347 acggtgaagtttgagatctgggacacagcaggccaggagcgataccacagtctggccccc 406

                      
Query: 458 atgtactaccg 468
           |||||||||||
Sbjct: 407 atgtactaccg 417



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 245 tccagcctggtgctgcgcttcgtcaaggggcagttccacgagtaccagga 294



to top

>ref|NM_024456.1| Mus musculus RAB5C, member RAS oncogene family (Rab5c), mRNA
          Length = 1943

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 407 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 466

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 467 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 517



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 299 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 340



to top

>ref|NM_164479.1| Drosophila melanogaster Rab-protein 5 CG3664-RF, transcript variant
           F (Rab5), mRNA
          Length = 1741

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 455 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 513



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 353 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 396



to top

>ref|NM_164478.1| Drosophila melanogaster Rab-protein 5 CG3664-RD, transcript variant
           D (Rab5), mRNA
          Length = 1759

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 473 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 531



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 371 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 414



to top

>ref|NM_164477.1| Drosophila melanogaster Rab-protein 5 CG3664-RC, transcript variant
           C (Rab5), mRNA
          Length = 2063

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 777 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 835



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 675 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 718



to top

>ref|NM_164476.1| Drosophila melanogaster Rab-protein 5 CG3664-RB, transcript variant
           B (Rab5), mRNA
          Length = 1980

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 694 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 752



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 592 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 635



to top

>ref|NM_164475.1| Drosophila melanogaster Rab-protein 5 CG3664-RA, transcript variant
           A (Rab5), mRNA
          Length = 1765

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 479 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 537



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 377 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 420



to top

>ref|NM_078733.2| Drosophila melanogaster Rab-protein 5 CG3664-RE, transcript variant
           E (Rab5), mRNA
          Length = 1775

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 489 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 547



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 387 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 430



to top

>dbj|AK167599.1| Mus musculus 13 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530024J05
           product:RAB5C, member RAS oncogene family, full insert
           sequence
          Length = 1877

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 396 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 455

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 456 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 506



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 288 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 329



to top

>dbj|AK172328.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830201H23 product:RAB5C, member RAS
           oncogene family, full insert sequence
          Length = 1580

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 353 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 412

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 413 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 463



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 245 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 286



to top

>gb|AY060343.1| Drosophila melanogaster GH24702 full length cDNA
          Length = 2061

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 777 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 835



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 675 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 718



to top

>dbj|AK159832.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420032F05 product:RAB5C, member RAS
           oncogene family, full insert sequence
          Length = 1622

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 396 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 455

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 456 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 506



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 288 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 329



to top

>dbj|AK170540.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630107G03
           product:RAB5C, member RAS oncogene family, full insert
           sequence
          Length = 1642

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 416 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 475

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 476 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 526



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 308 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 349



to top

>emb|CR388793.1| Gallus gallus finished cDNA, clone ChEST518p6
          Length = 669

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || ||||||||||| || ||||||||| | |||||||| ||||| |||
Sbjct: 312 acggtgaagtttgagatctgggacacagcaggccaggagcgataccacagtctggccccc 371

                      
Query: 458 atgtactaccg 468
           |||||||||||
Sbjct: 372 atgtactaccg 382



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 296 tccagcctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 210 tccagcctggtgctgcgcttcgtcaaggggcagttccacgagtaccagga 259



to top

>gb|BC027378.1| Mus musculus RAB5C, member RAS oncogene family, mRNA (cDNA clone
           IMAGE:4951081), partial cds
          Length = 1528

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 168 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 227

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 228 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 278



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 60  ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 101



to top

>dbj|AK089199.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630036C17
           product:RAB5C, member RAS oncogene family, full insert
           sequence
          Length = 1943

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 407 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 466

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 467 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 517



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 299 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 340



to top

>emb|BX950869.14| Zebrafish DNA sequence from clone CH211-1J13 in linkage group 19,
             complete sequence
          Length = 91362

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                         
Query: 397   gacggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcc 456
             |||||| ||||| || ||||||||||| || || |||||| | |||||||| ||||| ||
Sbjct: 52059 gacggtaaagtttgagatctgggacacagctggacaggagcgctaccacagtctggcccc 52118

                                                                
Query: 457   catgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507
             |||||||||| | || |||   |||||||| || || ||||||||||||||
Sbjct: 52119 catgtactacagaggtgcccaggccgccattgtagtttatgacatcaccaa 52169



to top

>emb|AL591469.9| Mouse DNA sequence from clone RP23-390D17 on chromosome 11, complete
              sequence
          Length = 168981

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 92/111 (82%)
 Strand = Plus / Minus

                                                                          
Query: 398    acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
              ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 129459 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 129400

                                                                 
Query: 458    atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
              |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 129399 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 129349



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 290    ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
              ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 130899 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 130858



to top

>dbj|AB035671.1| Drosophila melanogaster mRNA for Rab5 protein, complete cds
          Length = 1377

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 478 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 536



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 376 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 419



to top

>dbj|AB035353.1| Drosophila melanogaster mRNA for Drab5, complete cds
          Length = 1054

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgta 462
           |||||||| |||||||||||||| ||||||||| ||||||||||| | || ||||||||
Sbjct: 507 aagttcgagatctgggacacggctggccaggagcggtaccacagcttagctcccatgta 565



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
           |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 405 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 448



to top

>gb|BC056058.1| Xenopus laevis Rab-protein 5, mRNA (cDNA clone MGC:69022
           IMAGE:4964226), complete cds
          Length = 2426

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || ||||||||||| || || |||||||||||||||||  |||| |||
Sbjct: 356 acggtgaagtttgagatctgggacaccgcagggcaggagaggtaccacagtttggccccc 415

                                                             
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaa 507
           |||||||| || || |||   || ||||| || || ||||||||||||||
Sbjct: 416 atgtactatcgaggagcccaggcggccattgtagtttatgacatcaccaa 465



to top

>gb|BC045466.1| Danio rerio RAB5C, member RAS oncogene family, mRNA (cDNA clone
           MGC:55826 IMAGE:3817929), complete cds
          Length = 2268

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 430 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 470



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475
           |||||||||||||| |||||| |||| |||||  |||| || ||||| ||| | || |||
Sbjct: 556 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 615

                                     
Query: 476 gccgccgccatcgtcgtctatgacat 501
              || |||||||||||||| |||||
Sbjct: 616 caggcagccatcgtcgtctacgacat 641



to top

>ref|XM_843712.1| PREDICTED: Canis familiaris similar to RAB17, member RAS oncogene
           family (LOC607120), mRNA
          Length = 939

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagc 448
           ||||| || ||||||||||||||||||||||||| ||||||||||
Sbjct: 499 aagtttgagatctgggacacggccggccaggagaagtaccacagc 543



to top

>emb|X63875.1|NTRAB5 N.tabacum SR1 mRNA Nt-rab5
          Length = 712

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||| || || || |||||||||||||||||| | ||||| 
Sbjct: 270 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccacagcttagcgcct 329

                                                                       
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517
           ||||||||| | || || || || || ||| |||| ||||||||||| | | | |  || 
Sbjct: 330 atgtactacagaggtgctgcagctgctatcatcgtgtatgacatcacaagcactgaatca 389

                                        
Query: 518 tttacacgtgcaaagaaatgggttcaaga 546
            || |||| ||||||||||||||||||||
Sbjct: 390 cttgcacgagcaaagaaatgggttcaaga 418



to top

>emb|BX039831.1|CNS092WB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           |||||||||||||||||||| || || ||||| || ||| ||||  ||||||||||||||
Sbjct: 494 aagttcgaaatctgggacactgctggacaggaaagatacgacagtttggcgcccatgtac 553

                
Query: 464 taccg 468
           |||||
Sbjct: 554 taccg 558



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 302 ctggtgctccgcttcgtcaagggccagttcgtcgagttccaggaa 346
           |||||| | |||||||||||||||||||||  ||||| |||||||
Sbjct: 392 ctggtgttacgcttcgtcaagggccagttccacgagtaccaggaa 436



to top

>gb|BC065634.1| Danio rerio RAB5C, member RAS oncogene family, mRNA (cDNA clone
           MGC:77261 IMAGE:6964045), complete cds
          Length = 2278

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 385 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 425



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475
           |||||||||||||| |||||| |||| |||||  |||| || ||||| ||| | || |||
Sbjct: 511 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 570

                                     
Query: 476 gccgccgccatcgtcgtctatgacat 501
              || |||||||||||||| |||||
Sbjct: 571 caggcagccatcgtcgtctacgacat 596



to top

>emb|BX005093.22| Zebrafish DNA sequence from clone CH211-210G13 in linkage group 3,
             complete sequence
          Length = 155392

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                      
Query: 290   ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
             |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 38155 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 38115



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 404   aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
             ||||| || ||||||||||||||||| |||||| |||| |||||  |||| || ||||| 
Sbjct: 32674 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 32615

                                                   
Query: 464   taccgtggcgccgccgccgccatcgtcgtctatgacat 501
             ||| | || |||   || |||||||||||||| |||||
Sbjct: 32614 tacagaggagcccaggcagccatcgtcgtctacgacat 32577



to top

>ref|XM_697428.1| PREDICTED: Danio rerio hypothetical protein LOC554438 (LOC554438),
           mRNA
          Length = 2246

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 432 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 472



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||| || ||||||||||||||||| |||||| |||| |||||  |||| || ||||| 
Sbjct: 546 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 605

                                                 
Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacat 501
           ||| | || |||   || |||||||||||||| |||||
Sbjct: 606 tacagaggagcccaggcagccatcgtcgtctacgacat 643



to top

>ref|NM_201501.1| Danio rerio RAB5C, member RAS oncogene family (rab5c), mRNA
          Length = 2268

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           |||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 430 ggcaagtccagcctggtgctgcgcttcgtcaaaggccagtt 470



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 70/86 (81%)
 Strand = Plus / Plus

                                                                       
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggcgcc 475
           |||||||||||||| |||||| |||| |||||  |||| || ||||| ||| | || |||
Sbjct: 556 tgggacacggccggacaggagcggtatcacagtttggcccctatgtattacagaggagcc 615

                                     
Query: 476 gccgccgccatcgtcgtctatgacat 501
              || |||||||||||||| |||||
Sbjct: 616 caggcagccatcgtcgtctacgacat 641



to top

>emb|Y07811.1|GGRAB5CLP G.gallus mRNA for rab5C-like protein
          Length = 1278

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| ||||| ||||| ||||| || |||||| |||| ||||||||||| |||
Sbjct: 212 acggtgaagtttgaaatatgggatacggcaggacaggagcggtatcacagcctggcaccc 271

                      
Query: 458 atgtactaccg 468
           ||||| |||||
Sbjct: 272 atgtattaccg 282



to top

>ref|NM_204525.1| Gallus gallus RAB5C, member RAS oncogene family (RAB5C), mRNA
          Length = 1278

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| ||||| ||||| ||||| || |||||| |||| ||||||||||| |||
Sbjct: 212 acggtgaagtttgaaatatgggatacggcaggacaggagcggtatcacagcctggcaccc 271

                      
Query: 458 atgtactaccg 468
           ||||| |||||
Sbjct: 272 atgtattaccg 282



to top

>dbj|AK134691.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330525E15 product:RAB5C, member
           RAS oncogene family, full insert sequence
          Length = 1829

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || ||||| ||| | || ||||||||||| || 
Sbjct: 346 acggtcaagtttgagatctgggacacagctggccaagagcgctatcacagcctggccccg 405

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   ||  |||| || ||||||||||||||||||
Sbjct: 406 atgtactatcggggggcccaagcatccattgtggtctatgacatcaccaac 456



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||||||||||||||| |||||||| |||||||| ||||||
Sbjct: 238 ggcaagtccagcctggtcctccgctttgtcaaggggcagttc 279



to top

>ref|XM_213463.3| PREDICTED: Rattus norvegicus RAB5C, member RAS oncogene family
           (predicted) (Rab5c_predicted), mRNA
          Length = 1878

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||||||||| || ||||||||||| || || || ||| | || ||||||||||| || 
Sbjct: 404 acggtcaagtttgagatctgggacacagctgggcaagagcgatatcacagcctggccccg 463

                                                              
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaac 508
           |||||||| || || |||   || ||||| || ||||||||||||||||||
Sbjct: 464 atgtactatcggggggcccaagcagccattgtggtctatgacatcaccaac 514



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 290 ggcaagtccagcctggtgctccgcttcgtcaagggccagttc 331
           ||||| ||||||||||| |||||||| |||||||| ||||||
Sbjct: 296 ggcaaatccagcctggtcctccgctttgtcaaggggcagttc 337



to top

>gb|BT013315.1| Lycopersicon esculentum clone 135000F, mRNA sequence
          Length = 1546

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 120/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||| || || || |||||||||||||| ||| | ||||| 
Sbjct: 214 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccatagcttagcgcct 273

                                                                       
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517
           ||||| ||| | || || || || || ||  |||||||||||||||||| | | |  || 
Sbjct: 274 atgtattacaggggtgctgcagcagctattatcgtctatgacatcaccagcactgattca 333

                                         
Query: 518 tttacacgtgcaaagaaatgggttcaagaa 547
           ||| |||| |||||||||||||| ||||||
Sbjct: 334 tttgcacgggcaaagaaatgggtgcaagaa 363



to top

>gb|BT012776.1| Lycopersicon esculentum clone 113755R, mRNA sequence
          Length = 1003

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 120/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || |||||||| || || || |||||||||||||| ||| | ||||| 
Sbjct: 212 acggtgaagtttgagatctgggatactgctggtcaggagaggtaccatagcttagcgcct 271

                                                                       
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517
           ||||| ||| | || || || || || ||  |||||||||||||||||| | | |  || 
Sbjct: 272 atgtattacaggggtgctgcagcagctattatcgtctatgacatcaccagcactgattca 331

                                         
Query: 518 tttacacgtgcaaagaaatgggttcaagaa 547
           ||| |||| |||||||||||||| ||||||
Sbjct: 332 tttgcacgggcaaagaaatgggtgcaagaa 361



to top

>ref|XM_749452.1| Aspergillus fumigatus Af293 RAB GTPase Ypt51 (Afu3g10740) partial
           mRNA
          Length = 789

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 402 tcaagttcgaaatctgggacacggccggccagga 435
           |||||||||||||||||||||| |||||||||||
Sbjct: 191 tcaagttcgaaatctgggacacagccggccagga 224



to top

>emb|CR665120.2|CNS0FC6E Tetraodon nigroviridis full-length cDNA
          Length = 877

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactac 466
           ||||||||||||||||| || ||| | |||||||| ||||| ||||||||||||
Sbjct: 396 atctgggacacggccgggcaagagcgctaccacagtctggcacccatgtactac 449



to top

>emb|AL590448.1|CNS07EGF chromosome VIII of strain GB-M1 of Encephalitozoon cuniculi
             (Microspora)
          Length = 238147

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 402   tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctg 451
             |||||||||| || |||||||| || ||||||||||||||| ||||||||
Sbjct: 86931 tcaagttcgagatatgggacactgcaggccaggagaggtacaacagcctg 86980



to top

>gb|AY112178.1| Zea mays CL13607_1 mRNA sequence
          Length = 614

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 524 cgtgcaaagaaatgggttcaagaacttcaagcacaagg 561
           ||||| |||||||||||||||||||||||||| |||||
Sbjct: 612 cgtgcgaagaaatgggttcaagaacttcaagcccaagg 575



to top

>ref|XM_778785.1| PREDICTED: Strongylocentrotus purpuratus similar to Ras-related
           protein Rab-5C (RAB5L) (L1880) (LOC578627), mRNA
          Length = 1106

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||| |||||||||||||| ||||| || ||| | ||||||||| |||| || ||||||
Sbjct: 465 aagtttgaaatctgggacacagccggacaagagcgttaccacagcttggcacctatgtac 524

                
Query: 464 taccg 468
           |||||
Sbjct: 525 taccg 529



to top

>ref|XM_777279.1| PREDICTED: Strongylocentrotus purpuratus similar to RAB5B, member
           RAS oncogene family (LOC577021), mRNA
          Length = 1933

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||| |||||||||||||| ||||| || ||| | ||||||||| |||| || ||||||
Sbjct: 58  aagtttgaaatctgggacacagccggacaagagcgttaccacagcttggcacctatgtac 117

                
Query: 464 taccg 468
           |||||
Sbjct: 118 taccg 122



to top

>emb|AJ296341.1|CIN296341 Cichorium intybus X cichorium endivia partial ggtp1 gene for GTP
           binding protein, exons 1-3
          Length = 467

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                       
Query: 342 aggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacgg 401
           ||||||| || | ||||||||||||||| ||||||||| | ||||| ||||| |  ||||
Sbjct: 159 aggaatcgacaatcggcgccgccttcttttcgcaaaccttagcggtaaacgatgcaacgg 218

                                                                       
Query: 402 tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgt 461
           | || || || || ||||| ||||| || || || ||||| || ||| |||| |||||||
Sbjct: 219 tgaaatttgagatatgggatacggcgggtcaagaaaggtatcatagcttggctcccatgt 278

                
Query: 462 actac 466
           |||||
Sbjct: 279 actac 283



to top

>emb|AJ296338.1|CIN296338 Cichorium intybus X cichorium endivia partial ggtp0 gene for GTP
           bindinf protein, exons 1-3
          Length = 466

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                       
Query: 342 aggaatccaccaccggcgccgccttcttctcgcaaaccctggcggtcaacgacgagacgg 401
           ||||||| || | ||||||||||||||| ||||||||| | ||||| ||||| |  ||||
Sbjct: 158 aggaatcgacaatcggcgccgccttcttttcgcaaaccttagcggtaaacgatgcaacgg 217

                                                                       
Query: 402 tcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgt 461
           | || || || || ||||| ||||| || || || ||||| || ||| |||| |||||||
Sbjct: 218 tgaaatttgagatatgggatacggcgggtcaagaaaggtatcatagcttggctcccatgt 277

                
Query: 462 actac 466
           |||||
Sbjct: 278 actac 282



to top

>ref|NM_133685.1| Mus musculus RAB31, member RAS oncogene family (Rab31), mRNA
          Length = 3416

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || ||||||||| ||| ||||  |||||| || ||||||||||| || 
Sbjct: 312 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 371

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | || || ||| || ||||||||||||||||
Sbjct: 372 tctgctgcagccgtcatcgtctatgacatcac 403



to top

>gb|BC072360.1| Xenopus laevis hypothetical protein MGC83515, mRNA (cDNA clone
           MGC:83515 IMAGE:4755502), complete cds
          Length = 1293

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           ||||||||||||||||||||||||||||
Sbjct: 310 atctgggacacggccggccaggagaggt 337



to top

>emb|CT025302.2| Xenopus tropicalis finished cDNA, clone TNeu107b15
          Length = 1312

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           ||||||||||||||||||||||||||||
Sbjct: 296 atctgggacacggccggccaggagaggt 323



to top

>emb|BX511265.13| Zebrafish DNA sequence from clone RP71-45G20 in linkage group 9, complete
              sequence
          Length = 183988

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 416    tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
              |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 156346 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 156291



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 289    cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
              ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 158739 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 158698



to top

>gb|BC013063.1| Mus musculus RAB31, member RAS oncogene family, mRNA (cDNA clone
           MGC:7715 IMAGE:3497938), complete cds
          Length = 3416

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || ||||||||| ||| ||||  |||||| || ||||||||||| || 
Sbjct: 312 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 371

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | || || ||| || ||||||||||||||||
Sbjct: 372 tctgctgcagccgtcatcgtctatgacatcac 403



to top

>gb|BC066634.1| Danio rerio RAB5B, member RAS oncogene family, mRNA (cDNA clone
           MGC:76978 IMAGE:6525746), complete cds
          Length = 2364

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
           |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 372 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 427



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 245 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 286



to top

>dbj|AK159095.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420001G12 product:Similar to RAB31,
           member RAS oncogene family, full insert sequence
          Length = 3364

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || ||||||||| ||| ||||  |||||| || ||||||||||| || 
Sbjct: 272 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 331

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | || || ||| || ||||||||||||||||
Sbjct: 332 tctgctgcagccgtcatcgtctatgacatcac 363



to top

>dbj|AK156677.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830037B14 product:Similar to RAB31,
           member RAS oncogene family, full insert sequence
          Length = 3474

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || ||||||||| ||| ||||  |||||| || ||||||||||| || 
Sbjct: 384 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 443

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | || || ||| || ||||||||||||||||
Sbjct: 444 tctgctgcagccgtcatcgtctatgacatcac 475



to top

>ref|XM_703529.1| PREDICTED: Danio rerio similar to RAB5A member RAS oncogene family,
           transcript variant 2 (LOC573322), mRNA
          Length = 729

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
           |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 406 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 461



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 279 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 320



to top

>ref|XM_681894.1| PREDICTED: Danio rerio similar to RAB5A member RAS oncogene family,
           transcript variant 1 (LOC573322), mRNA
          Length = 684

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
           |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 361 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 416



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 234 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 275



to top

>dbj|AK051270.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130027D07 product:GTP-BINDING
           PROTEIN RAB0 homolog [Rattus norvegicus], full insert
           sequence
          Length = 3392

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || ||||||||| ||| ||||  |||||| || ||||||||||| || 
Sbjct: 303 atctgggacaccgctggccaggagcggttccactccctggctcctatgtactaccgagga 362

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | || || ||| || ||||||||||||||||
Sbjct: 363 tctgctgcagccgtcatcgtctatgacatcac 394



to top

>ref|NM_212885.1| Danio rerio RAB5B, member RAS oncogene family (rab5b), mRNA
          Length = 2364

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 416 tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
           |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 372 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 427



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 289 cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
           ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 245 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 286



to top

>ref|XM_578804.1| PREDICTED: Rattus norvegicus similar to RAB17, member RAS oncogene
           family (LOC503269), mRNA
          Length = 1143

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| ||||||||||||| ||||||||||
Sbjct: 712 atctgggacacagccggccaggagaagtaccacagc 747



to top

>emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 in linkage group 9,
              complete sequence
          Length = 211682

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 416    tgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtgg 471
              |||||||| ||||| || ||| | ||||||||| |||| |||||||||||||||||
Sbjct: 207698 tgggacacagccggacaagagcgctaccacagcttggctcccatgtactaccgtgg 207753



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 289    cggcaagtccagcctggtgctccgcttcgtcaagggccagtt 330
              ||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 205304 cggcaagtccagcctggtgctgcgctttgtgaagggacagtt 205345



to top

>ref|XM_598573.2| PREDICTED: Bos taurus similar to RAS and EF hand domain containing
            (LOC520334), mRNA
          Length = 2367

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 414  tctgggacacggccggccaggagaggtaccacagc 448
            |||||||||| || |||||||||||||||||||||
Sbjct: 1958 tctgggacacagctggccaggagaggtaccacagc 1992



to top

>ref|XM_363259.1| Magnaporthe grisea 70-15 hypothetical protein (MG01185.4) partial
           mRNA
          Length = 774

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           |||||||||||||| ||||||||||| || |||||||| || ||| |    ||||| |||
Sbjct: 310 acggtcaagttcgagatctgggacacagctggccaggaaagatacaagtctctggctccc 369

                      
Query: 458 atgtactaccg 468
           |||||||||||
Sbjct: 370 atgtactaccg 380



to top

>ref|XM_959718.1| Neurospora crassa OR74A hypothetical protein (NCU00895.1) partial
           mRNA
          Length = 663

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggag 436
           |||||||||||||| |||||||| || ||||||||||||
Sbjct: 202 acggtcaagttcgagatctgggataccgccggccaggag 240



to top

>ref|XM_325074.1| Neurospora crassa OR74A hypothetical protein (NCU00895.1) partial
           mRNA
          Length = 663

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggag 436
           |||||||||||||| |||||||| || ||||||||||||
Sbjct: 202 acggtcaagttcgagatctgggataccgccggccaggag 240



to top

>gb|BT012805.1| Lycopersicon esculentum clone 113821R, mRNA sequence
          Length = 978

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 527 gcaaagaaatgggttcaagaacttcaagcacaagg 561
           ||||| ||||||||||| |||||||||||||||||
Sbjct: 472 gcaaaaaaatgggttcaggaacttcaagcacaagg 506



to top

>emb|BX842682.1| Neurospora crassa DNA linkage group I BAC contig B13C5
          Length = 116467

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 398    acggtcaagttcgaaatctgggacacggccggccaggag 436
              |||||||||||||| |||||||| || ||||||||||||
Sbjct: 108053 acggtcaagttcgagatctgggataccgccggccaggag 108091



to top

>ref|XM_228043.3| PREDICTED: Rattus norvegicus similar to RIKEN cDNA 9830134C10 gene
            (LOC309649), mRNA
          Length = 2094

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 416  tgggacacggccggccaggagaggtaccacagcct 450
            |||||||||||||| || |||||||||||||||||
Sbjct: 1762 tgggacacggccggacaagagaggtaccacagcct 1796



to top

>ref|XM_527372.1| PREDICTED: Pan troglodytes similar to RIKEN cDNA 9830134C10 gene
            (LOC471993), mRNA
          Length = 3732

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                              
Query: 414  tctgggacacggccggccaggagaggtaccacag 447
            ||||||||||||| ||||| ||||||||||||||
Sbjct: 2402 tctgggacacggctggccaagagaggtaccacag 2435



to top

>ref|XM_878893.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family,
           transcript variant 6 (LOC539150), mRNA
          Length = 1103

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429

                 
Query: 461 tactac 466
           ||||||
Sbjct: 430 tactac 435



to top

>ref|XM_585238.2| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family,
           transcript variant 1 (LOC539150), mRNA
          Length = 3351

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429

                 
Query: 461 tactac 466
           ||||||
Sbjct: 430 tactac 435



to top

>ref|XM_878835.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family,
           transcript variant 5 (LOC539150), mRNA
          Length = 3324

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429

                 
Query: 461 tactac 466
           ||||||
Sbjct: 430 tactac 435



to top

>ref|XM_878801.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family,
           transcript variant 4 (LOC539150), mRNA
          Length = 1064

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429

                 
Query: 461 tactac 466
           ||||||
Sbjct: 430 tactac 435



to top

>ref|XM_866612.1| PREDICTED: Bos taurus similar to RAB5B, member RAS oncogene family,
           transcript variant 3 (LOC539150), mRNA
          Length = 3300

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 370 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 429

                 
Query: 461 tactac 466
           ||||||
Sbjct: 430 tactac 435



to top

>ref|XM_604898.2| PREDICTED: Bos taurus similar to RAB6B, member RAS oncogene family
           (LOC526526), partial mRNA
          Length = 956

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 414 tctgggacacggccggccaggagaggtaccacagcctg 451
           |||||||||| |||||||||||||||| || |||||||
Sbjct: 68  tctgggacacagccggccaggagaggttccgcagcctg 105



to top

>ref|XM_848388.1| PREDICTED: Canis familiaris similar to RAB6B, member RAS oncogene
           family (LOC610830), mRNA
          Length = 983

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 414 tctgggacacggccggccaggagaggtaccacagcctg 451
           |||||||||| |||||||||||||||| || |||||||
Sbjct: 185 tctgggacacagccggccaggagaggttccgcagcctg 222



to top

>ref|XM_851035.1| PREDICTED: Canis familiaris similar to RAB5B, member RAS oncogene
           family, transcript variant 3 (LOC474394), mRNA
          Length = 1296

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 371 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 430

                 
Query: 461 tactac 466
           ||||||
Sbjct: 431 tactac 436



to top

>ref|XM_531627.2| PREDICTED: Canis familiaris similar to RAB5B, member RAS oncogene
           family, transcript variant 1 (LOC474394), mRNA
          Length = 1406

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 401 gtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatg 460
           |||||||| || ||||||||||| || || |||||| | ||||| ||| |||| ||||||
Sbjct: 371 gtcaagtttgagatctgggacacagctgggcaggagcgataccatagcttggcccccatg 430

                 
Query: 461 tactac 466
           ||||||
Sbjct: 431 tactac 436



to top

>emb|CR938123.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 852

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 411 aaatctgggacacggccggccaggag 436
           ||||||||||||||||||||||||||
Sbjct: 383 aaatctgggacacggccggccaggag 408



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                         
Query: 397     gacggtcaagttcgaaatctgggacacggccggccaggagag 438
               |||||||||||||||||| ||||| || ||||| ||||||||
Sbjct: 2001899 gacggtcaagttcgaaatatgggataccgccggtcaggagag 2001940



to top

>ref|XM_688516.1| PREDICTED: Danio rerio similar to Aldehyde dehydrogenase 7 family,
           member A1 (LOC573432), mRNA
          Length = 960

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 404 aagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgcccatgtac 463
           ||||| || ||||||||||||||||| |||||| |||| |||||  |||| || ||||| 
Sbjct: 832 aagtttgagatctgggacacggccggacaggagcggtatcacagtttggcccctatgtat 891

                                                 
Query: 464 taccgtggcgccgccgccgccatcgtcgtctatgacat 501
           ||| | || |||   || |||||||||||||| |||||
Sbjct: 892 tacagaggagcccaggcagccatcgtcgtctacgacat 929



to top

>gb|AC092186.1|AC092186 Drosophila melanogaster, chromosome 2L, region 22D-22E, BAC clone
              BACR22P10, complete sequence
          Length = 184650

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 404    aagttcgaaatctgggacacggccggccaggagaggta 441
              |||||||| |||||||||||||| ||||||||| ||||
Sbjct: 119882 aagttcgagatctgggacacggctggccaggagcggta 119845



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 302    ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
              |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 119984 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 119941



to top

>tpg|BK000968.1| TPA: TPA_exp: Drosophila melanogaster CG4272 gene, partial sequence;
            and Rab5 (Rab5) gene, complete cds
          Length = 6778

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 404  aagttcgaaatctgggacacggccggccaggagaggta 441
            |||||||| |||||||||||||| ||||||||| ||||
Sbjct: 4359 aagttcgagatctgggacacggctggccaggagcggta 4396



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 302  ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
            |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 4257 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 4300



to top

>emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, complete sequence
          Length = 192029

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 80     tcgatcgatccatccgtccgtccgtccgtc 109
              |||||| |||||||||||||||||||||||
Sbjct: 100238 tcgatccatccatccgtccgtccgtccgtc 100267



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 87     atccatccgtccgtccgtccgtc 109
              |||||||||||||||||||||||
Sbjct: 100637 atccatccgtccgtccgtccgtc 100659



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 83     atcgatccatccgtccgtccgtccgtc 109
              |||||||||||| ||||||||||||||
Sbjct: 100237 atcgatccatccatccgtccgtccgtc 100263



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 87     atccatccgtccgtccgtccgtc 109
              |||||||||||||||||||||||
Sbjct: 100025 atccatccgtccgtccgtccgtc 100047



to top

>gb|AY104562.1| Zea mays PCO063085 mRNA sequence
          Length = 1170

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 413 atctgggacacggccggccaggagaggtac 442
           ||||||||||| ||||||||||||||||||
Sbjct: 450 atctgggacaccgccggccaggagaggtac 479



to top

>gb|AE003583.3| Drosophila melanogaster chromosome 2L, section 8 of 83 of the complete
              sequence
          Length = 303641

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 404    aagttcgaaatctgggacacggccggccaggagaggta 441
              |||||||| |||||||||||||| ||||||||| ||||
Sbjct: 130091 aagttcgagatctgggacacggctggccaggagcggta 130054



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 302    ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
              |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 130193 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 130150



to top

>gb|AC004315.1|AC004315 Drosophila melanogaster (P1 DS03279 (D209)) DNA sequence, complete
             sequence
          Length = 35867

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 404   aagttcgaaatctgggacacggccggccaggagaggta 441
             |||||||| |||||||||||||| ||||||||| ||||
Sbjct: 23383 aagttcgagatctgggacacggctggccaggagcggta 23346



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 302   ctggtgctccgcttcgtcaagggccagttcgtcgagttccagga 345
             |||||||| |||||||||||||| ||||||  ||||| ||||||
Sbjct: 23485 ctggtgctgcgcttcgtcaagggacagttccacgagtaccagga 23442



to top

>ref|XM_450547.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1200

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 413 atctgggacacggccggccaggagaggta 441
           ||||||||||| |||||||||||||||||
Sbjct: 318 atctgggacaccgccggccaggagaggta 346



to top

>gb|AY135019.1| Zea mays PL transcription factor (pl) mRNA, pl-W22 allele, complete
           cds
          Length = 961

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 221 gccggcgccggcgccggcggcagca 245
           |||||||||||||||||||||||||
Sbjct: 396 gccggcgccggcgccggcggcagca 420



to top

>gb|AF320614.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1170 allele,
            complete cds
          Length = 6669

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 220  cgccggcgccggcgccggcggcagc 244
            |||||||||||||||||||||||||
Sbjct: 2922 cgccggcgccggcgccggcggcagc 2946



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 220  cgccggcgccggcgccggcg 239
            ||||||||||||||||||||
Sbjct: 2941 cgccggcgccggcgccggcg 2922



to top

>gb|AF320613.3| Zea mays anthocyanin regulatory C1 (c1) gene, C1-1162 allele,
            complete cds
          Length = 6666

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 220  cgccggcgccggcgccggcggcagc 244
            |||||||||||||||||||||||||
Sbjct: 2924 cgccggcgccggcgccggcggcagc 2948



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 220  cgccggcgccggcgccggcg 239
            ||||||||||||||||||||
Sbjct: 2943 cgccggcgccggcgccggcg 2924



to top

>gb|AC104702.2| Drosophila melanogaster 3L BAC RP98-11B4 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 153146

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 87     atccatccgtccgtccgtccgtcgc 111
              |||||||||||||||||||||||||
Sbjct: 110213 atccatccgtccgtccgtccgtcgc 110189



to top

>gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 169425

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 87    atccatccgtccgtccgtccgtcgc 111
             |||||||||||||||||||||||||
Sbjct: 31664 atccatccgtccgtccgtccgtcgc 31640



to top

>ref|NM_139854.1| Drosophila melanogaster CG8583-RA (CG8583), mRNA
          Length = 2942

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 87   atccatccgtccgtccgtccgtcgc 111
            |||||||||||||||||||||||||
Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630



to top

>gb|BC094134.1| Xenopus laevis cDNA clone MGC:115056 IMAGE:6957039, complete cds
          Length = 1610

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| ||||| || ||||||||||| || || || ||| | ||||||||||| ||||| 
Sbjct: 314 acggtgaagtttgagatctgggacacagcgggacaagagcgctaccacagccttgcgcct 373

                    
Query: 458 atgtactac 466
           |||||||||
Sbjct: 374 atgtactac 382



to top

>dbj|AK111872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040K07, full
           insert sequence
          Length = 1205

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 413 atctgggacacggccggccaggagaggta 441
           ||||||||||| |||||||||||||||||
Sbjct: 393 atctgggacaccgccggccaggagaggta 421



to top

>emb|X06333.1|ZMC1 Z.mays DNA for c1 locus
          Length = 4060

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 220  cgccggcgccggcgccggcggcagc 244
            |||||||||||||||||||||||||
Sbjct: 1663 cgccggcgccggcgccggcggcagc 1687



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 220  cgccggcgccggcgccggcg 239
            ||||||||||||||||||||
Sbjct: 1682 cgccggcgccggcgccggcg 1663



to top

>dbj|AK104132.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-D05, full
           insert sequence
          Length = 1098

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 413 atctgggacacggccggccaggagaggta 441
           ||||||||||| |||||||||||||||||
Sbjct: 325 atctgggacaccgccggccaggagaggta 353



to top

>dbj|AK071461.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023092H24, full
           insert sequence
          Length = 1200

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 413 atctgggacacggccggccaggagaggta 441
           ||||||||||| |||||||||||||||||
Sbjct: 318 atctgggacaccgccggccaggagaggta 346



to top

>gb|AY110109.1| Zea mays CL16448_2 mRNA sequence
          Length = 958

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 413 atctgggacacggccggccaggagaggta 441
           ||||||||||| |||||||||||||||||
Sbjct: 265 atctgggacaccgccggccaggagaggta 293



to top

>gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26 of 83 of the complete
              sequence
          Length = 269948

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 87     atccatccgtccgtccgtccgtcgc 111
              |||||||||||||||||||||||||
Sbjct: 154765 atccatccgtccgtccgtccgtcgc 154741



to top

>gb|BT001562.1| Drosophila melanogaster RE14391 full insert cDNA
          Length = 2957

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 87   atccatccgtccgtccgtccgtcgc 111
            |||||||||||||||||||||||||
Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630



to top

>gb|AF015269.1|AF015269 Zea mays retrotransposon Magellan, complete sequence, and PL
            transcription factor (Pl) gene, complete cds
          Length = 3218

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 221  gccggcgccggcgccggcggcagca 245
            |||||||||||||||||||||||||
Sbjct: 2584 gccggcgccggcgccggcggcagca 2608



to top

>gb|AF015268.1|AF015268 Zea mays PL transcription factor (Pl) gene, promoter and complete cds
          Length = 1900

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 221  gccggcgccggcgccggcggcagca 245
            |||||||||||||||||||||||||
Sbjct: 1266 gccggcgccggcgccggcggcagca 1290



to top

>gb|M37153.1|MZEMYBAA Z.mays c1 locus myb homologue cDNA, exons 1-3
          Length = 4059

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 220  cgccggcgccggcgccggcggcagc 244
            |||||||||||||||||||||||||
Sbjct: 1663 cgccggcgccggcgccggcggcagc 1687



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 220  cgccggcgccggcgccggcg 239
            ||||||||||||||||||||
Sbjct: 1682 cgccggcgccggcgccggcg 1663



to top

>gb|BC013170.1| Mus musculus RAB17, member RAS oncogene family, mRNA (cDNA clone
           MGC:6497 IMAGE:2648145), complete cds
          Length = 1653

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 454 atctgggacacagccggccaggagaagtacca 485



to top

>gb|BC072698.1| Rattus norvegicus RAB31, member RAS oncogene family, mRNA (cDNA
           clone MGC:91462 IMAGE:7105732), complete cds
          Length = 3335

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || || |||||| ||| |||   |||||| |||||||| ||||| |||
Sbjct: 265 atctgggacaccgctggtcaggagcggttccattccctggctcccatgtattaccgaggc 324

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | ||||| ||| || | ||||||||||||||
Sbjct: 325 tcggccgcagccgtcatagtctatgacatcac 356



to top

>ref|NM_192276.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1542

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 283 cggcaccggcaagtccagcctggt 306
           ||||||||||||||||||||||||
Sbjct: 741 cggcaccggcaagtccagcctggt 764



to top

>ref|XM_516181.1| PREDICTED: Pan troglodytes similar to RAB17, member RAS oncogene
            family (LOC460049), mRNA
          Length = 2145

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 413  atctgggacacggccggccaggagaggtaccacagc 448
            ||||||||||| || |||||||||| ||||||||||
Sbjct: 1072 atctgggacacagctggccaggagaagtaccacagc 1107



to top

>ref|XM_470371.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 627

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 222 ccggcgccggcgccggcggcagca 245
           ||||||||||||||||||||||||
Sbjct: 141 ccggcgccggcgccggcggcagca 164



to top

>gb|BC074609.1| Xenopus tropicalis RAB30, member RAS oncogene family, mRNA (cDNA
           clone MGC:69471 IMAGE:5336103), complete cds
          Length = 1414

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           |||||||||||||| |||||||||||||
Sbjct: 356 atctgggacacggctggccaggagaggt 383



to top

>gb|AC118682.8| Mus musculus chromosome 1, clone RP23-448B17, complete sequence
          Length = 195334

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 413   atctgggacacggccggccaggagaggtacca 444
             ||||||||||| ||||||||||||| ||||||
Sbjct: 60547 atctgggacacagccggccaggagaagtacca 60578



to top

>ref|NM_145094.2| Rattus norvegicus RAB31, member RAS oncogene family (Rab31), mRNA
          Length = 3335

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 413 atctgggacacggccggccaggagaggtaccacagcctggcgcccatgtactaccgtggc 472
           ||||||||||| || || |||||| ||| |||   |||||| |||||||| ||||| |||
Sbjct: 265 atctgggacaccgctggtcaggagcggttccattccctggctcccatgtattaccgaggc 324

                                           
Query: 473 gccgccgccgccatcgtcgtctatgacatcac 504
            | ||||| ||| || | ||||||||||||||
Sbjct: 325 tcggccgcagccgtcatagtctatgacatcac 356



to top

>gb|AY166852.2| Homo sapiens RAB41 mRNA, complete cds
          Length = 1538

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 504 atctgggacacggccggccaggag 527



to top

>ref|XM_881629.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-26,
           transcript variant 3 (LOC515675), mRNA
          Length = 2821

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           |||||||||||||| |||||||||||||
Sbjct: 151 atctgggacacggctggccaggagaggt 178



to top

>ref|XM_868411.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-26,
           transcript variant 2 (LOC515675), mRNA
          Length = 2915

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           |||||||||||||| |||||||||||||
Sbjct: 349 atctgggacacggctggccaggagaggt 376



to top

>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence,
            complete sequence
          Length = 130272

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 222  ccggcgccggcgccggcggcagca 245
            ||||||||||||||||||||||||
Sbjct: 7610 ccggcgccggcgccggcggcagca 7587



to top

>gb|BC051071.1| Mus musculus RAB17, member RAS oncogene family, mRNA (cDNA clone
           MGC:58945 IMAGE:6307319), complete cds
          Length = 1801

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 581 atctgggacacagccggccaggagaagtacca 612



to top

>ref|NM_008998.2| Mus musculus RAB17, member RAS oncogene family (Rab17), mRNA
          Length = 1788

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 606 atctgggacacagccggccaggagaagtacca 637



to top

>gb|BC114066.1| Bos taurus RAB26, member RAS oncogene family, mRNA (cDNA clone
           MGC:137742 IMAGE:8165990), complete cds
          Length = 1933

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           |||||||||||||| |||||||||||||
Sbjct: 509 atctgggacacggctggccaggagaggt 536



to top

>ref|NM_022449.1| Homo sapiens RAB17, member RAS oncogene family (RAB17), mRNA
          Length = 1982

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 857 atctgggacacagctggccaggagaagtaccacagc 892



to top

>gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10,
             complete sequence
          Length = 143073

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 416   tgggacacggccggccaggagaggtacc 443
             |||||||| |||||||||||||||||||
Sbjct: 66934 tgggacaccgccggccaggagaggtacc 66907



to top

>ref|XM_975892.1| PREDICTED: Mus musculus RAB17, member RAS oncogene family,
           transcript variant 2 (Rab17), mRNA
          Length = 1154

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 588 atctgggacacagccggccaggagaagtacca 619



to top

>ref|XM_741403.1| Aspergillus fumigatus Af293 ras-like GTP-binding protein
           (Afu4g03100) partial mRNA
          Length = 885

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 184 atctgggacacggccggccaggag 207



to top

>gb|BC082988.1| Homo sapiens RAB43, member RAS oncogene family, mRNA (cDNA clone
           IMAGE:5738096), **** WARNING: chimeric clone ****
          Length = 2983

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 288 atctgggacacggccggccaggag 311



to top

>gb|BC034011.1| Mus musculus cDNA clone IMAGE:4239538, **** WARNING: chimeric clone
           ****
          Length = 4908

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 570 atctgggacacagccggccaggagaagtacca 601



to top

>ref|XM_502830.1| Yarrowia lipolytica CLIB122, YALI0D14630g predicted mRNA
          Length = 651

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 193 atctgggacacggccggccaggag 216



to top

>emb|BX065790.1|CNS09MXE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 436 atctgggacacggccggccaggag 459



to top

>emb|BX040474.1|CNS093E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 774

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 419 atctgggacacggccggccaggag 442



to top

>emb|Z37503.1|VFRABGTPB V.faba mRNA for guanine nucleotide regulatory protein
          Length = 873

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 123/156 (78%)
 Strand = Plus / Plus

                                                                       
Query: 398 acggtcaagttcgaaatctgggacacggccggccaggagaggtaccacagcctggcgccc 457
           ||||| || ||||| || |||||||| || || || ||||| ||||| ||| |||| |||
Sbjct: 278 acggtgaaattcgagatttgggacacagcggggcaagagagataccatagcttggctccc 337

                                                                       
Query: 458 atgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcaccaacgcggcctct 517
           ||||| ||| | ||||| || || || ||| | |||||||||||||| | | | |  || 
Sbjct: 338 atgtattacagaggcgctgctgctgctatcattgtctatgacatcactagctcagattca 397

                                               
Query: 518 tttacacgtgcaaagaaatgggttcaagaacttcaa 553
           |||||||| || || || ||||||||||| ||||||
Sbjct: 398 tttacacgagctaaaaagtgggttcaagagcttcaa 433



to top

>emb|X70804.1|MMRAB17AA M.musculus rab17 mRNA
          Length = 645

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 413 atctgggacacggccggccaggagaggtacca 444
           ||||||||||| ||||||||||||| ||||||
Sbjct: 211 atctgggacacagccggccaggagaagtacca 242



to top

>emb|CR457282.1| Homo sapiens full open reading frame cDNA clone RZPDo834E039D for
           gene RAB17, RAB17, member RAS oncogene family; complete
           cds, incl. stopcodon
          Length = 639

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 211 atctgggacacagctggccaggagaagtaccacagc 246



to top

>ref|NM_001006108.1| Xenopus tropicalis RAB30, member RAS oncogene family (rsb30), mRNA
          Length = 1414

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 413 atctgggacacggccggccaggagaggt 440
           |||||||||||||| |||||||||||||
Sbjct: 356 atctgggacacggctggccaggagaggt 383



to top

>emb|AL136645.1|HSM801615 Homo sapiens mRNA; cDNA DKFZp564M1541 (from clone DKFZp564M1541)
          Length = 1608

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 481 atctgggacacagctggccaggagaagtaccacagc 516



to top

>emb|BX323459.20| Zebrafish DNA sequence from clone DKEYP-27C11 in linkage group 6,
              complete sequence
          Length = 168538

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                      
Query: 449    ctggcgcccatgtactaccgtggcgccgccgccgccatcgtcgtctatgacatcac 504
              ||||| |||||||||||| | ||| | || || |||||| ||||||||||||||||
Sbjct: 143227 ctggctcccatgtactacagaggctctgctgcggccatcatcgtctatgacatcac 143172



to top

>dbj|AK128345.1| Homo sapiens cDNA FLJ46487 fis, clone THYMU3026783
          Length = 4272

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 322 atctgggacacggccggccaggag 345



to top

>emb|CR626220.1| full-length cDNA clone CS0DI005YB17 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1511

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 419 atctgggacacagctggccaggagaagtaccacagc 454



to top

>emb|CR624533.1| full-length cDNA clone CS0DI005YC13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1528

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 437 atctgggacacagctggccaggagaagtaccacagc 472



to top

>emb|CR621894.1| full-length cDNA clone CS0DI034YJ09 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1519

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 429 atctgggacacagctggccaggagaagtaccacagc 464



to top

>emb|CR620019.1| full-length cDNA clone CS0DM014YA08 of Fetal liver of Homo sapiens
           (human)
          Length = 1500

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 512 atctgggacacggccggccaggag 535



to top

>emb|CR606784.1| full-length cDNA clone CS0DI012YO06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1471

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 409 atctgggacacagctggccaggagaagtaccacagc 444



to top

>emb|CR600396.1| full-length cDNA clone CS0DI077YE10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1508

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 413 atctgggacacagctggccaggagaagtaccacagc 448



to top

>emb|CR596493.1| full-length cDNA clone CS0DC005YF10 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1627

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 413 atctgggacacggccggccaggag 436
           ||||||||||||||||||||||||
Sbjct: 503 atctgggacacggccggccaggag 526



to top

>emb|CR591120.1| full-length cDNA clone CS0DI072YL12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1542

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 448 atctgggacacagctggccaggagaagtaccacagc 483



to top

>dbj|AK022600.1| Homo sapiens cDNA FLJ12538 fis, clone NT2RM4000356, moderately
           similar to RAS-RELATED PROTEIN RAB-17
          Length = 1982

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 413 atctgggacacggccggccaggagaggtaccacagc 448
           ||||||||||| || |||||||||| ||||||||||
Sbjct: 857 atctgggacacagctggccaggagaagtaccacagc 892



to top

>gb|DQ427413.1| Sorghum propinquum locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427412.1| Sorghum bicolor voucher PI585454 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427411.1| Sorghum bicolor voucher PI267539 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427410.1| Sorghum bicolor voucher PI267408 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427409.1| Sorghum bicolor voucher PI221607 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427408.1| Sorghum bicolor voucher PI152702 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427407.1| Sorghum bicolor voucher NSL92371 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427406.1| Sorghum bicolor voucher NSL87902 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427405.1| Sorghum bicolor voucher NSL87666 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427404.1| Sorghum bicolor voucher NSL77217 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427403.1| Sorghum bicolor voucher NSL77034 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427402.1| Sorghum bicolor voucher NSL56174 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427401.1| Sorghum bicolor voucher NSL56003 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427400.1| Sorghum bicolor voucher NSL55243 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59



to top

>gb|DQ427399.1| Sorghum bicolor voucher NSL51365 locus CSU108 genomic sequence
          Length = 695

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 244 caagatccgcaacgccaagctggt 267
           ||||||||||||||||||||||||
Sbjct: 36  caagatccgcaacgccaagctggt 59


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,964,263
Number of Sequences: 3902068
Number of extensions: 4964263
Number of successful extensions: 191796
Number of sequences better than 10.0: 1551
Number of HSP's better than 10.0 without gapping: 1621
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 150581
Number of HSP's gapped (non-prelim): 39809
length of query: 563
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 540
effective length of database: 17,143,297,704
effective search space: 9257380760160
effective search space used: 9257380760160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top