ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart29h11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA 460 e-126
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 460 e-126
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 460 e-126
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 297 2e-77
5dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 297 2e-77
6gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 278 2e-71
7dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 278 2e-71
8gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 278 2e-71
9dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 270 4e-69
10gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 270 4e-69
11emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 270 4e-69
12emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 270 4e-69
13gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 194 2e-46
14emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 174 2e-40
15gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 84 5e-13
16ref|NM_111960.2| Arabidopsis thaliana structural constituent of ... 82 2e-12
17gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal prote... 82 2e-12
18gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosoma... 82 2e-12
19gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosoma... 82 2e-12
20gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete s... 82 2e-12
21gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal prote... 82 2e-12
22dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic r... 76 1e-10
23dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic r... 76 1e-10
24emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
25gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal prot... 74 5e-10
26ref|NM_111754.2| Arabidopsis thaliana structural constituent of ... 68 3e-08
27gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosoma... 68 3e-08
28gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosoma... 68 3e-08
29emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
30gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete se... 60 7e-06
31dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acid... 60 7e-06
32emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 56 1e-04
33ref|NM_129559.2| Arabidopsis thaliana structural constituent of ... 52 0.002
34gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence 52 0.002
35emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
36gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds 52 0.002
37gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S a... 52 0.002
38gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 50 0.007
39gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 ... 50 0.007
40emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ri... 50 0.007
41gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11... 50 0.007
42gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, co... 50 0.007
43dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I a... 50 0.007
44ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.028
45emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-... 48 0.028
46emb|BX019003.1|CNS08MTR Single read from an extremity of a full-... 48 0.028
47emb|BX018793.1|CNS08MNX Single read from an extremity of a full-... 48 0.028
48emb|BX013777.1|CNS08ISL Single read from an extremity of a full-... 48 0.028
49emb|BX006032.1|CNS08CTG Single read from an extremity of a full-... 48 0.028
50emb|BX005998.1|CNS08CSI Single read from an extremity of a full-... 48 0.028
51ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.028
52ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosom... 46 0.11
53emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 46 0.11
54emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-... 46 0.11
55emb|BX072146.1|CNS09RTY Single read from an extremity of a full-... 46 0.11
56emb|BX072055.1|CNS09RRF Single read from an extremity of a full-... 46 0.11
57emb|BX072031.1|CNS09RQR Single read from an extremity of a full-... 46 0.11
58emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 46 0.11
59emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 46 0.11
60emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 46 0.11
61emb|BX071518.1|CNS09RCI Single read from an extremity of a full-... 46 0.11
62emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 46 0.11
63emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 46 0.11
64emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 46 0.11
65emb|BX071386.1|CNS09R8U Single read from an extremity of a full-... 46 0.11
66emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-... 46 0.11
67emb|BX071251.1|CNS09R53 Single read from an extremity of a full-... 46 0.11
68emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 46 0.11
69emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 46 0.11
70emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 46 0.11
71emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 46 0.11
72emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-... 46 0.11
73emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 46 0.11
74emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 46 0.11
75emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.11
76emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 46 0.11
77emb|BX070541.1|CNS09QLD Single read from an extremity of a full-... 46 0.11
78emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 46 0.11
79emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 46 0.11
80emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-... 46 0.11
81emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 46 0.11
82emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 46 0.11
83emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 46 0.11
84emb|BX061042.1|CNS09J9I Single read from an extremity of a full-... 46 0.11
85emb|BX069588.1|CNS09PUW Single read from an extremity of a full-... 46 0.11
86emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 46 0.11
87emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 46 0.11
88emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-... 46 0.11
89emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 46 0.11
90emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-... 46 0.11
91emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 46 0.11
92emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 46 0.11
93emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 46 0.11
94emb|BX068760.1|CNS09P7W Single read from an extremity of a full-... 46 0.11
95emb|BX068607.1|CNS09P3N Single read from an extremity of a full-... 46 0.11
96emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 46 0.11
97emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-... 46 0.11
98emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 46 0.11
99emb|BX067891.1|CNS09OJR Single read from an extremity of a full-... 46 0.11
100emb|BX067841.1|CNS09OID Single read from an extremity of a full-... 46 0.11
101emb|BX067819.1|CNS09OHR Single read from an extremity of a full-... 46 0.11
102emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 46 0.11
103emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 46 0.11
104emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 46 0.11
105emb|BX067564.1|CNS09OAO Single read from an extremity of a full-... 46 0.11
106emb|BX067487.1|CNS09O8J Single read from an extremity of a full-... 46 0.11
107emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 46 0.11
108emb|BX066992.1|CNS09NUS Single read from an extremity of a full-... 46 0.11
109emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 46 0.11
110emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 46 0.11
111emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 46 0.11
112emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-... 46 0.11
113emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-... 46 0.11
114emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 46 0.11
115emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 46 0.11
116emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 46 0.11
117emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-... 46 0.11
118emb|BX066329.1|CNS09NCD Single read from an extremity of a full-... 46 0.11
119emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-... 46 0.11
120emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 46 0.11
121emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 46 0.11
122emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 46 0.11
123emb|BX065359.1|CNS09MLF Single read from an extremity of a full-... 46 0.11
124emb|BX065269.1|CNS09MIX Single read from an extremity of a full-... 46 0.11
125emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 46 0.11
126emb|BX065042.1|CNS09MCM Single read from an extremity of a full-... 46 0.11
127emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 46 0.11
128emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 46 0.11
129emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 46 0.11
130emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 46 0.11
131emb|BX064796.1|CNS09M5S Single read from an extremity of a full-... 46 0.11
132emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 46 0.11
133emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 46 0.11
134emb|BX064530.1|CNS09LYE Single read from an extremity of a full-... 46 0.11
135emb|BX064423.1|CNS09LVF Single read from an extremity of a full-... 46 0.11
136emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 46 0.11
137emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 46 0.11
138emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 46 0.11
139emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 46 0.11
140emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 46 0.11
141emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 46 0.11
142emb|BX063577.1|CNS09L7X Single read from an extremity of a full-... 46 0.11
143emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 46 0.11
144emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 46 0.11
145emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-... 46 0.11
146emb|BX063420.1|CNS09L3K Single read from an extremity of a full-... 46 0.11
147emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 46 0.11
148emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 46 0.11
149emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 46 0.11
150emb|BX062546.1|CNS09KFA Single read from an extremity of a full-... 46 0.11
151emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 46 0.11
152emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 46 0.11
153emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 46 0.11
154emb|BX062183.1|CNS09K57 Single read from an extremity of a full-... 46 0.11
155emb|BX062169.1|CNS09K4T Single read from an extremity of a full-... 46 0.11
156emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 46 0.11
157emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 46 0.11
158emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 46 0.11
159emb|BX061164.1|CNS09JCW Single read from an extremity of a full-... 46 0.11
160emb|BX061163.1|CNS09JCV Single read from an extremity of a full-... 46 0.11
161emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 46 0.11
162emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 46 0.11
163emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 46 0.11
164emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 46 0.11
165emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 46 0.11
166emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 46 0.11
167emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 46 0.11
168emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 46 0.11
169emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-... 46 0.11
170emb|BX059866.1|CNS09ICU Single read from an extremity of a full-... 46 0.11
171emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 46 0.11
172emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 46 0.11
173emb|BX059642.1|CNS09I6M Single read from an extremity of a full-... 46 0.11
174emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 46 0.11
175emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 46 0.11
176emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 46 0.11
177emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 46 0.11
178emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 46 0.11
179emb|BX059184.1|CNS09HTW Single read from an extremity of a full-... 46 0.11
180emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 46 0.11
181emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-... 46 0.11
182emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 46 0.11
183emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 46 0.11
184emb|BX058740.1|CNS09HHK Single read from an extremity of a full-... 46 0.11
185emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 46 0.11
186emb|BX058315.1|CNS09H5R Single read from an extremity of a full-... 46 0.11
187emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 46 0.11
188emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 46 0.11
189emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 46 0.11
190emb|BX057796.1|CNS09GRC Single read from an extremity of a full-... 46 0.11
191emb|BX057631.1|CNS09GMR Single read from an extremity of a full-... 46 0.11
192emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-... 46 0.11
193emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-... 46 0.11
194emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 46 0.11
195emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-... 46 0.11
196emb|BX057133.1|CNS09G8X Single read from an extremity of a full-... 46 0.11
197emb|BX057094.1|CNS09G7U Single read from an extremity of a full-... 46 0.11
198emb|BX057074.1|CNS09G7A Single read from an extremity of a full-... 46 0.11
199emb|BX056996.1|CNS09G54 Single read from an extremity of a full-... 46 0.11
200emb|BX056958.1|CNS09G42 Single read from an extremity of a full-... 46 0.11
201emb|BX056914.1|CNS09G2U Single read from an extremity of a full-... 46 0.11
202emb|BX056483.1|CNS09FQV Single read from an extremity of a full-... 46 0.11
203emb|BX055960.1|CNS09FCC Single read from an extremity of a full-... 46 0.11
204emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 46 0.11
205emb|BX056320.1|CNS09FMC Single read from an extremity of a full-... 46 0.11
206emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 46 0.11
207emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 46 0.11
208emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 46 0.11
209emb|BX055999.1|CNS09FDF Single read from an extremity of a full-... 46 0.11
210emb|BX055725.1|CNS09F5T Single read from an extremity of a full-... 46 0.11
211emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 46 0.11
212emb|BX055621.1|CNS09F2X Single read from an extremity of a full-... 46 0.11
213emb|BX055603.1|CNS09F2F Single read from an extremity of a full-... 46 0.11
214emb|BX055567.1|CNS09F1F Single read from an extremity of a full-... 46 0.11
215emb|BX053214.1|CNS09D82 Single read from an extremity of a full-... 46 0.11
216emb|BX053185.1|CNS09D79 Single read from an extremity of a full-... 46 0.11
217emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 46 0.11
218emb|BX052948.1|CNS09D0O Single read from an extremity of a full-... 46 0.11
219emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 46 0.11
220emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 46 0.11
221emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-... 46 0.11
222emb|BX054345.1|CNS09E3H Single read from an extremity of a full-... 46 0.11
223emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 46 0.11
224emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 46 0.11
225emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 46 0.11
226emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-... 46 0.11
227emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 46 0.11
228emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 46 0.11
229emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-... 46 0.11
230emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 46 0.11
231emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 46 0.11
232emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 46 0.11
233emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 46 0.11
234emb|BX052836.1|CNS09CXK Single read from an extremity of a full-... 46 0.11
235emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 46 0.11
236emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 46 0.11
237emb|BX052724.1|CNS09CUG Single read from an extremity of a full-... 46 0.11
238emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 46 0.11
239emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 46 0.11
240emb|BX052235.1|CNS09CGV Single read from an extremity of a full-... 46 0.11
241emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 46 0.11
242emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 46 0.11
243emb|BX052006.1|CNS09CAI Single read from an extremity of a full-... 46 0.11
244emb|BX051964.1|CNS09C9C Single read from an extremity of a full-... 46 0.11
245emb|BX051899.1|CNS09C7J Single read from an extremity of a full-... 46 0.11
246emb|BX051866.1|CNS09C6M Single read from an extremity of a full-... 46 0.11
247emb|BX051626.1|CNS09BZY Single read from an extremity of a full-... 46 0.11
248emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-... 46 0.11
249emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 46 0.11
250emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 46 0.11
251emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 46 0.11
252emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 46 0.11
253emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-... 46 0.11
254emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 46 0.11
255emb|BX050244.1|CNS09AXK Single read from an extremity of a full-... 46 0.11
256emb|BX050212.1|CNS09AWO Single read from an extremity of a full-... 46 0.11
257emb|BX050202.1|CNS09AWE Single read from an extremity of a full-... 46 0.11
258emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-... 46 0.11
259emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 46 0.11
260emb|BX050797.1|CNS09BCX Single read from an extremity of a full-... 46 0.11
261emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 46 0.11
262emb|BX050723.1|CNS09BAV Single read from an extremity of a full-... 46 0.11
263emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 46 0.11
264emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 46 0.11
265emb|BX050552.1|CNS09B64 Single read from an extremity of a full-... 46 0.11
266emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 46 0.11
267emb|BX050514.1|CNS09B52 Single read from an extremity of a full-... 46 0.11
268emb|BX050479.1|CNS09B43 Single read from an extremity of a full-... 46 0.11
269emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 46 0.11
270emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 46 0.11
271emb|BX050290.1|CNS09AYU Single read from an extremity of a full-... 46 0.11
272emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 46 0.11
273emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 46 0.11
274emb|BX049674.1|CNS09AHQ Single read from an extremity of a full-... 46 0.11
275emb|BX030999.1|CNS08W2Z Single read from an extremity of a full-... 46 0.11
276emb|BX030941.1|CNS08W1D Single read from an extremity of a full-... 46 0.11
277emb|BX030929.1|CNS08W11 Single read from an extremity of a full-... 46 0.11
278emb|BX030903.1|CNS08W0B Single read from an extremity of a full-... 46 0.11
279emb|BX049615.1|CNS09AG3 Single read from an extremity of a full-... 46 0.11
280emb|BX049546.1|CNS09AE6 Single read from an extremity of a full-... 46 0.11
281emb|BX049524.1|CNS09ADK Single read from an extremity of a full-... 46 0.11
282emb|BX049466.1|CNS09ABY Single read from an extremity of a full-... 46 0.11
283emb|BX049240.1|CNS09A5O Single read from an extremity of a full-... 46 0.11
284emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 46 0.11
285emb|BX048525.1|CNS099LT Single read from an extremity of a full-... 46 0.11
286emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 46 0.11
287emb|BX048234.1|CNS099DQ Single read from an extremity of a full-... 46 0.11
288emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 46 0.11
289emb|BX047999.1|CNS09977 Single read from an extremity of a full-... 46 0.11
290emb|BX047946.1|CNS0995Q Single read from an extremity of a full-... 46 0.11
291emb|BX047843.1|CNS0992V Single read from an extremity of a full-... 46 0.11
292emb|BX047734.1|CNS098ZU Single read from an extremity of a full-... 46 0.11
293emb|BX047732.1|CNS098ZS Single read from an extremity of a full-... 46 0.11
294emb|BX047714.1|CNS098ZA Single read from an extremity of a full-... 46 0.11
295emb|BX047691.1|CNS098YN Single read from an extremity of a full-... 46 0.11
296emb|BX047277.1|CNS098N5 Single read from an extremity of a full-... 46 0.11
297emb|BX047157.1|CNS098JT Single read from an extremity of a full-... 46 0.11
298emb|BX047017.1|CNS098FX Single read from an extremity of a full-... 46 0.11
299emb|BX046849.1|CNS098B9 Single read from an extremity of a full-... 46 0.11
300emb|BX046679.1|CNS0986J Single read from an extremity of a full-... 46 0.11
301emb|BX046353.1|CNS097XH Single read from an extremity of a full-... 46 0.11
302emb|BX046290.1|CNS097VQ Single read from an extremity of a full-... 46 0.11
303emb|BX046163.1|CNS097S7 Single read from an extremity of a full-... 46 0.11
304emb|BX046117.1|CNS097QX Single read from an extremity of a full-... 46 0.11
305emb|BX046099.1|CNS097QF Single read from an extremity of a full-... 46 0.11
306emb|BX046025.1|CNS097OD Single read from an extremity of a full-... 46 0.11
307emb|BX045705.1|CNS097FH Single read from an extremity of a full-... 46 0.11
308emb|BX045497.1|CNS0979P Single read from an extremity of a full-... 46 0.11
309emb|BX045440.1|CNS09784 Single read from an extremity of a full-... 46 0.11
310emb|BX045432.1|CNS0977W Single read from an extremity of a full-... 46 0.11
311emb|BX045074.1|CNS096XY Single read from an extremity of a full-... 46 0.11
312emb|BX045040.1|CNS096X0 Single read from an extremity of a full-... 46 0.11
313emb|BX045257.1|CNS09731 Single read from an extremity of a full-... 46 0.11
314emb|BX044857.1|CNS096RX Single read from an extremity of a full-... 46 0.11
315emb|BX044741.1|CNS096OP Single read from an extremity of a full-... 46 0.11
316emb|BX044735.1|CNS096OJ Single read from an extremity of a full-... 46 0.11
317emb|BX043090.1|CNS095EU Single read from an extremity of a full-... 46 0.11
318emb|BX043059.1|CNS095DZ Single read from an extremity of a full-... 46 0.11
319emb|BX042955.1|CNS095B3 Single read from an extremity of a full-... 46 0.11
320emb|BX044619.1|CNS096LB Single read from an extremity of a full-... 46 0.11
321emb|BX044429.1|CNS096G1 Single read from an extremity of a full-... 46 0.11
322emb|BX044185.1|CNS09699 Single read from an extremity of a full-... 46 0.11
323emb|BX044159.1|CNS0968J Single read from an extremity of a full-... 46 0.11
324emb|BX044153.1|CNS0968D Single read from an extremity of a full-... 46 0.11
325emb|BX044099.1|CNS0966V Single read from an extremity of a full-... 46 0.11
326emb|BX044052.1|CNS0965K Single read from an extremity of a full-... 46 0.11
327emb|BX044026.1|CNS0964U Single read from an extremity of a full-... 46 0.11
328emb|BX043798.1|CNS095YI Single read from an extremity of a full-... 46 0.11
329emb|BX043757.1|CNS095XD Single read from an extremity of a full-... 46 0.11
330emb|BX043472.1|CNS095PG Single read from an extremity of a full-... 46 0.11
331emb|BX043702.1|CNS095VU Single read from an extremity of a full-... 46 0.11
332emb|BX043623.1|CNS095TN Single read from an extremity of a full-... 46 0.11
333emb|BX043251.1|CNS095JB Single read from an extremity of a full-... 46 0.11
334emb|BX043128.1|CNS095FW Single read from an extremity of a full-... 46 0.11
335emb|BX043127.1|CNS095FV Single read from an extremity of a full-... 46 0.11
336emb|BX043118.1|CNS095FM Single read from an extremity of a full-... 46 0.11
337emb|BX042609.1|CNS0951H Single read from an extremity of a full-... 46 0.11
338emb|BX042524.1|CNS094Z4 Single read from an extremity of a full-... 46 0.11
339emb|BX042434.1|CNS094WM Single read from an extremity of a full-... 46 0.11
340emb|BX042404.1|CNS094VS Single read from an extremity of a full-... 46 0.11
341emb|BX042353.1|CNS094UD Single read from an extremity of a full-... 46 0.11
342emb|BX041748.1|CNS094DK Single read from an extremity of a full-... 46 0.11
343emb|BX041651.1|CNS094AV Single read from an extremity of a full-... 46 0.11
344emb|BX041602.1|CNS0949I Single read from an extremity of a full-... 46 0.11
345emb|BX041467.1|CNS0945R Single read from an extremity of a full-... 46 0.11
346emb|BX041389.1|CNS0943L Single read from an extremity of a full-... 46 0.11
347emb|BX041365.1|CNS0942X Single read from an extremity of a full-... 46 0.11
348emb|BX041135.1|CNS093WJ Single read from an extremity of a full-... 46 0.11
349emb|BX041109.1|CNS093VT Single read from an extremity of a full-... 46 0.11
350emb|BX041108.1|CNS093VS Single read from an extremity of a full-... 46 0.11
351emb|BX040887.1|CNS093PN Single read from an extremity of a full-... 46 0.11
352emb|BX040837.1|CNS093O9 Single read from an extremity of a full-... 46 0.11
353emb|BX040799.1|CNS093N7 Single read from an extremity of a full-... 46 0.11
354emb|BX040616.1|CNS093I4 Single read from an extremity of a full-... 46 0.11
355emb|BX040351.1|CNS093AR Single read from an extremity of a full-... 46 0.11
356emb|BX040297.1|CNS09399 Single read from an extremity of a full-... 46 0.11
357emb|BX040236.1|CNS0937K Single read from an extremity of a full-... 46 0.11
358emb|BX040137.1|CNS0934T Single read from an extremity of a full-... 46 0.11
359emb|BX040069.1|CNS0932X Single read from an extremity of a full-... 46 0.11
360emb|BX039907.1|CNS092YF Single read from an extremity of a full-... 46 0.11
361emb|BX039734.1|CNS092TM Single read from an extremity of a full-... 46 0.11
362emb|BX039373.1|CNS092JL Single read from an extremity of a full-... 46 0.11
363emb|BX039309.1|CNS092HT Single read from an extremity of a full-... 46 0.11
364emb|BX039262.1|CNS092GI Single read from an extremity of a full-... 46 0.11
365emb|BX037386.1|CNS0910E Single read from an extremity of a full-... 46 0.11
366emb|BX037345.1|CNS090Z9 Single read from an extremity of a full-... 46 0.11
367emb|BX037247.1|CNS090WJ Single read from an extremity of a full-... 46 0.11
368emb|BX037215.1|CNS090VN Single read from an extremity of a full-... 46 0.11
369emb|BX036759.1|CNS090IZ Single read from an extremity of a full-... 46 0.11
370emb|BX036700.1|CNS090HC Single read from an extremity of a full-... 46 0.11
371emb|BX036670.1|CNS090GI Single read from an extremity of a full-... 46 0.11
372emb|BX037189.1|CNS090UX Single read from an extremity of a full-... 46 0.11
373emb|BX037187.1|CNS090UV Single read from an extremity of a full-... 46 0.11
374emb|BX037165.1|CNS090U9 Single read from an extremity of a full-... 46 0.11
375emb|BX037106.1|CNS090SM Single read from an extremity of a full-... 46 0.11
376emb|BX037012.1|CNS090Q0 Single read from an extremity of a full-... 46 0.11
377emb|BX036831.1|CNS090KZ Single read from an extremity of a full-... 46 0.11
378emb|BX036518.1|CNS090CA Single read from an extremity of a full-... 46 0.11
379emb|BX036428.1|CNS0909S Single read from an extremity of a full-... 46 0.11
380emb|BX036405.1|CNS09095 Single read from an extremity of a full-... 46 0.11
381emb|BX036358.1|CNS0907U Single read from an extremity of a full-... 46 0.11
382emb|BX036158.1|CNS0902A Single read from an extremity of a full-... 46 0.11
383emb|BX036109.1|CNS0900X Single read from an extremity of a full-... 46 0.11
384emb|BX035782.1|CNS08ZRU Single read from an extremity of a full-... 46 0.11
385emb|BX035671.1|CNS08ZOR Single read from an extremity of a full-... 46 0.11
386emb|BX035626.1|CNS08ZNI Single read from an extremity of a full-... 46 0.11
387emb|BX035617.1|CNS08ZN9 Single read from an extremity of a full-... 46 0.11
388emb|BX035548.1|CNS08ZLC Single read from an extremity of a full-... 46 0.11
389emb|BX035515.1|CNS08ZKF Single read from an extremity of a full-... 46 0.11
390emb|BX035485.1|CNS08ZJL Single read from an extremity of a full-... 46 0.11
391emb|BX035372.1|CNS08ZGG Single read from an extremity of a full-... 46 0.11
392emb|BX035343.1|CNS08ZFN Single read from an extremity of a full-... 46 0.11
393emb|BX035328.1|CNS08ZF8 Single read from an extremity of a full-... 46 0.11
394emb|BX035267.1|CNS08ZDJ Single read from an extremity of a full-... 46 0.11
395emb|BX035228.1|CNS08ZCG Single read from an extremity of a full-... 46 0.11
396emb|BX035165.1|CNS08ZAP Single read from an extremity of a full-... 46 0.11
397emb|BX034803.1|CNS08Z0N Single read from an extremity of a full-... 46 0.11
398emb|BX034670.1|CNS08YWY Single read from an extremity of a full-... 46 0.11
399emb|BX035008.1|CNS08Z6C Single read from an extremity of a full-... 46 0.11
400emb|BX034906.1|CNS08Z3I Single read from an extremity of a full-... 46 0.11
401emb|BX034904.1|CNS08Z3G Single read from an extremity of a full-... 46 0.11
402emb|BX034886.1|CNS08Z2Y Single read from an extremity of a full-... 46 0.11
403emb|BX034882.1|CNS08Z2U Single read from an extremity of a full-... 46 0.11
404emb|BX034881.1|CNS08Z2T Single read from an extremity of a full-... 46 0.11
405emb|BX034538.1|CNS08YTA Single read from an extremity of a full-... 46 0.11
406emb|BX034506.1|CNS08YSE Single read from an extremity of a full-... 46 0.11
407emb|BX034480.1|CNS08YRO Single read from an extremity of a full-... 46 0.11
408emb|BX034370.1|CNS08YOM Single read from an extremity of a full-... 46 0.11
409emb|BX034264.1|CNS08YLO Single read from an extremity of a full-... 46 0.11
410emb|BX034229.1|CNS08YKP Single read from an extremity of a full-... 46 0.11
411emb|BX034221.1|CNS08YKH Single read from an extremity of a full-... 46 0.11
412emb|BX034196.1|CNS08YJS Single read from an extremity of a full-... 46 0.11
413emb|BX034144.1|CNS08YIC Single read from an extremity of a full-... 46 0.11
414emb|BX034142.1|CNS08YIA Single read from an extremity of a full-... 46 0.11
415emb|BX034126.1|CNS08YHU Single read from an extremity of a full-... 46 0.11
416emb|BX034110.1|CNS08YHE Single read from an extremity of a full-... 46 0.11
417emb|BX034108.1|CNS08YHC Single read from an extremity of a full-... 46 0.11
418emb|BX034106.1|CNS08YHA Single read from an extremity of a full-... 46 0.11
419emb|BX034010.1|CNS08YEM Single read from an extremity of a full-... 46 0.11
420emb|BX034008.1|CNS08YEK Single read from an extremity of a full-... 46 0.11
421emb|BX033976.1|CNS08YDO Single read from an extremity of a full-... 46 0.11
422emb|BX033938.1|CNS08YCM Single read from an extremity of a full-... 46 0.11
423emb|BX033860.1|CNS08YAG Single read from an extremity of a full-... 46 0.11
424emb|BX033846.1|CNS08YA2 Single read from an extremity of a full-... 46 0.11
425emb|BX033821.1|CNS08Y9D Single read from an extremity of a full-... 46 0.11
426emb|BX033820.1|CNS08Y9C Single read from an extremity of a full-... 46 0.11
427emb|BX033818.1|CNS08Y9A Single read from an extremity of a full-... 46 0.11
428emb|BX033673.1|CNS08Y59 Single read from an extremity of a full-... 46 0.11
429emb|BX033647.1|CNS08Y4J Single read from an extremity of a full-... 46 0.11
430emb|BX033618.1|CNS08Y3Q Single read from an extremity of a full-... 46 0.11
431emb|BX033569.1|CNS08Y2D Single read from an extremity of a full-... 46 0.11
432emb|BX033479.1|CNS08XZV Single read from an extremity of a full-... 46 0.11
433emb|BX033311.1|CNS08XV7 Single read from an extremity of a full-... 46 0.11
434emb|BX033238.1|CNS08XT6 Single read from an extremity of a full-... 46 0.11
435emb|BX033237.1|CNS08XT5 Single read from an extremity of a full-... 46 0.11
436emb|BX033218.1|CNS08XSM Single read from an extremity of a full-... 46 0.11
437emb|BX033076.1|CNS08XOO Single read from an extremity of a full-... 46 0.11
438emb|BX033023.1|CNS08XN7 Single read from an extremity of a full-... 46 0.11
439emb|BX032861.1|CNS08XIP Single read from an extremity of a full-... 46 0.11
440emb|BX032848.1|CNS08XIC Single read from an extremity of a full-... 46 0.11
441emb|BX032759.1|CNS08XFV Single read from an extremity of a full-... 46 0.11
442emb|BX032572.1|CNS08XAO Single read from an extremity of a full-... 46 0.11
443emb|BX032456.1|CNS08X7G Single read from an extremity of a full-... 46 0.11
444emb|BX032454.1|CNS08X7E Single read from an extremity of a full-... 46 0.11
445emb|BX032379.1|CNS08X5B Single read from an extremity of a full-... 46 0.11
446emb|BX032309.1|CNS08X3D Single read from an extremity of a full-... 46 0.11
447emb|BX032149.1|CNS08WYX Single read from an extremity of a full-... 46 0.11
448emb|BX032101.1|CNS08WXL Single read from an extremity of a full-... 46 0.11
449emb|BX032100.1|CNS08WXK Single read from an extremity of a full-... 46 0.11
450emb|BX031868.1|CNS08WR4 Single read from an extremity of a full-... 46 0.11
451emb|BX031826.1|CNS08WPY Single read from an extremity of a full-... 46 0.11
452emb|BX031749.1|CNS08WNT Single read from an extremity of a full-... 46 0.11
453emb|BX031528.1|CNS08WHO Single read from an extremity of a full-... 46 0.11
454emb|BX031481.1|CNS08WGD Single read from an extremity of a full-... 46 0.11
455emb|BX031424.1|CNS08WES Single read from an extremity of a full-... 46 0.11
456emb|BX031365.1|CNS08WD5 Single read from an extremity of a full-... 46 0.11
457emb|BX031330.1|CNS08WC6 Single read from an extremity of a full-... 46 0.11
458emb|BX030842.1|CNS08VYM Single read from an extremity of a full-... 46 0.11
459emb|BX030693.1|CNS08VUH Single read from an extremity of a full-... 46 0.11
460emb|BX031290.1|CNS08WB2 Single read from an extremity of a full-... 46 0.11
461emb|BX031264.1|CNS08WAC Single read from an extremity of a full-... 46 0.11
462emb|BX031187.1|CNS08W87 Single read from an extremity of a full-... 46 0.11
463emb|BX031162.1|CNS08W7I Single read from an extremity of a full-... 46 0.11
464emb|BX031150.1|CNS08W76 Single read from an extremity of a full-... 46 0.11
465emb|BX030510.1|CNS08VPE Single read from an extremity of a full-... 46 0.11
466emb|BX030498.1|CNS08VP2 Single read from an extremity of a full-... 46 0.11
467emb|BX030436.1|CNS08VNC Single read from an extremity of a full-... 46 0.11
468emb|BX030414.1|CNS08VMQ Single read from an extremity of a full-... 46 0.11
469emb|BX030353.1|CNS08VL1 Single read from an extremity of a full-... 46 0.11
470emb|BX030216.1|CNS08VH8 Single read from an extremity of a full-... 46 0.11
471emb|BX030189.1|CNS08VGH Single read from an extremity of a full-... 46 0.11
472emb|BX030043.1|CNS08VCF Single read from an extremity of a full-... 46 0.11
473emb|BX030039.1|CNS08VCB Single read from an extremity of a full-... 46 0.11
474emb|BX029932.1|CNS08V9C Single read from an extremity of a full-... 46 0.11
475emb|BX029856.1|CNS08V78 Single read from an extremity of a full-... 46 0.11
476emb|BX029781.1|CNS08V55 Single read from an extremity of a full-... 46 0.11
477emb|BX029776.1|CNS08V50 Single read from an extremity of a full-... 46 0.11
478emb|BX029391.1|CNS08UUB Single read from an extremity of a full-... 46 0.11
479emb|BX029322.1|CNS08USE Single read from an extremity of a full-... 46 0.11
480emb|BX029190.1|CNS08UOQ Single read from an extremity of a full-... 46 0.11
481emb|BX029189.1|CNS08UOP Single read from an extremity of a full-... 46 0.11
482emb|BX029177.1|CNS08UOD Single read from an extremity of a full-... 46 0.11
483emb|BX029754.1|CNS08V4E Single read from an extremity of a full-... 46 0.11
484emb|BX029752.1|CNS08V4C Single read from an extremity of a full-... 46 0.11
485emb|BX029599.1|CNS08V03 Single read from an extremity of a full-... 46 0.11
486emb|BX029095.1|CNS08UM3 Single read from an extremity of a full-... 46 0.11
487emb|BX028997.1|CNS08UJD Single read from an extremity of a full-... 46 0.11
488emb|BX028987.1|CNS08UJ3 Single read from an extremity of a full-... 46 0.11
489emb|BX028918.1|CNS08UH6 Single read from an extremity of a full-... 46 0.11
490emb|BX028886.1|CNS08UGA Single read from an extremity of a full-... 46 0.11
491emb|BX028727.1|CNS08UBV Single read from an extremity of a full-... 46 0.11
492emb|BX028691.1|CNS08UAV Single read from an extremity of a full-... 46 0.11
493emb|BX028689.1|CNS08UAT Single read from an extremity of a full-... 46 0.11
494emb|BX028609.1|CNS08U8L Single read from an extremity of a full-... 46 0.11
495emb|BX028582.1|CNS08U7U Single read from an extremity of a full-... 46 0.11
496emb|BX022309.1|CNS08PDL Single read from an extremity of a full-... 46 0.11
497emb|BX022280.1|CNS08PCS Single read from an extremity of a full-... 46 0.11
498emb|BX022279.1|CNS08PCR Single read from an extremity of a full-... 46 0.11
499emb|BX028394.1|CNS08U2M Single read from an extremity of a full-... 46 0.11
500emb|BX028306.1|CNS08U06 Single read from an extremity of a full-... 46 0.11

>ref|XM_479931.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1236

 Score =  460 bits (232), Expect = e-126
 Identities = 340/376 (90%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187

                                                                       
Query: 196 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247

                                                                       
Query: 256 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307

                                                                       
Query: 316 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 375
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367

                                                                       
Query: 376 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 435
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 427

                                                                       
Query: 436 aggttcgcgaggaggtcgccaagcacaaggttggcgctcctgctcgtgttgggctagttg 495
           |||| ||||||||||| |||||| |||||||||| ||||||||||||||||| || ||||
Sbjct: 428 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 487

                           
Query: 496 cacctgttgatgtggt 511
           | ||||||||||||||
Sbjct: 488 ctcctgttgatgtggt 503



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                     
Query: 2  taggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 44
          |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1  taggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score =  460 bits (232), Expect = e-126
 Identities = 340/376 (90%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 110 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 169

                                                                       
Query: 196 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 170 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 229

                                                                       
Query: 256 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 230 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 289

                                                                       
Query: 316 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 375
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 290 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 349

                                                                       
Query: 376 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 435
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 350 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 409

                                                                       
Query: 436 aggttcgcgaggaggtcgccaagcacaaggttggcgctcctgctcgtgttgggctagttg 495
           |||| ||||||||||| |||||| |||||||||| ||||||||||||||||| || ||||
Sbjct: 410 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 469

                           
Query: 496 cacctgttgatgtggt 511
           | ||||||||||||||
Sbjct: 470 ctcctgttgatgtggt 485



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score =  460 bits (232), Expect = e-126
 Identities = 340/376 (90%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187

                                                                       
Query: 196 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247

                                                                       
Query: 256 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307

                                                                       
Query: 316 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 375
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367

                                                                       
Query: 376 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 435
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 427

                                                                       
Query: 436 aggttcgcgaggaggtcgccaagcacaaggttggcgctcctgctcgtgttgggctagttg 495
           |||| ||||||||||| |||||| |||||||||| ||||||||||||||||| || ||||
Sbjct: 428 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 487

                           
Query: 496 cacctgttgatgtggt 511
           | ||||||||||||||
Sbjct: 488 ctcctgttgatgtggt 503



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                    
Query: 3  aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 44
          ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  297 bits (150), Expect = 2e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                           
Query: 136     cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
               ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 1716667 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 1716608

                                                                           
Query: 196     agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
               || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 1716607 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 1716548

                                                                           
Query: 256     agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
               |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 1716547 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 1716488

                                                                           
Query: 316     ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 375
               |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 1716487 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 1716428

                     
Query: 376     agctca 381
               ||||||
Sbjct: 1716427 agctca 1716422



 Score =  111 bits (56), Expect = 2e-21
 Identities = 65/68 (95%)
 Strand = Plus / Minus

                                                                           
Query: 399     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 458
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1716313 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 1716254

                       
Query: 459     cacaaggt 466
                |||||||
Sbjct: 1716253 tacaaggt 1716246



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                           
Query: 1       ctaggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 44
               ||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1716795 ctaggttaaagcgacgccgccgccgcaagccgtccgccttgctc 1716752



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 463     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
               ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 1715379 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggt 1715331



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  297 bits (150), Expect = 2e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                          
Query: 136    cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
              ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 116167 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 116108

                                                                          
Query: 196    agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
              || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 116107 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 116048

                                                                          
Query: 256    agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
              |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 116047 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 115988

                                                                          
Query: 316    ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 375
              |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 115987 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 115928

                    
Query: 376    agctca 381
              ||||||
Sbjct: 115927 agctca 115922



 Score =  111 bits (56), Expect = 2e-21
 Identities = 65/68 (95%)
 Strand = Plus / Minus

                                                                          
Query: 399    aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 458
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 115813 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 115754

                      
Query: 459    cacaaggt 466
               |||||||
Sbjct: 115753 tacaaggt 115746



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 1      ctaggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 44
              ||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 116295 ctaggttaaagcgacgccgccgccgcaagccgtccgccttgctc 116252



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                               
Query: 463    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
              ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 114879 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggt 114831



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  278 bits (140), Expect = 2e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                        
Query: 138  atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
            |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 5848 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 5789

                                                                        
Query: 198  ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
             | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 5788 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 5729

                                                                        
Query: 258  ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
            || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 5728 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 5669

                                                                        
Query: 318  ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
            || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 5668 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 5609

                
Query: 378  ctca 381
            ||||
Sbjct: 5608 ctca 5605



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                        
Query: 399  aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 458
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 5485 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 5426

                        
Query: 459  cacaaggttggc 470
             |||||||||||
Sbjct: 5425 tacaaggttggc 5414



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 463  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
            ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 4744 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 4696



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  278 bits (140), Expect = 2e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                           
Query: 138     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1650134 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1650075

                                                                           
Query: 198     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1650074 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1650015

                                                                           
Query: 258     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
               || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 1650014 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1649955

                                                                           
Query: 318     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1649954 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1649895

                   
Query: 378     ctca 381
               ||||
Sbjct: 1649894 ctca 1649891



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                           
Query: 399     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 458
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1649771 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1649712

                           
Query: 459     cacaaggttggc 470
                |||||||||||
Sbjct: 1649711 tacaaggttggc 1649700



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 463     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
               ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 1649030 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 1648982



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  278 bits (140), Expect = 2e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                           
Query: 138     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1647855 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1647796

                                                                           
Query: 198     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1647795 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1647736

                                                                           
Query: 258     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
               || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 1647735 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1647676

                                                                           
Query: 318     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1647675 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1647616

                   
Query: 378     ctca 381
               ||||
Sbjct: 1647615 ctca 1647612



 Score =  111 bits (56), Expect = 2e-21
 Identities = 68/72 (94%)
 Strand = Plus / Minus

                                                                           
Query: 399     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 458
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1647492 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1647433

                           
Query: 459     cacaaggttggc 470
                |||||||||||
Sbjct: 1647432 tacaaggttggc 1647421



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 463     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
               ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 1646751 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 1646703



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  270 bits (136), Expect = 4e-69
 Identities = 217/244 (88%)
 Strand = Plus / Minus

                                                                           
Query: 138     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269

                                                                           
Query: 198     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209

                                                                           
Query: 258     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
               || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149

                                                                           
Query: 318     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089

                   
Query: 378     ctca 381
               ||||
Sbjct: 1603088 ctca 1603085



 Score =  117 bits (59), Expect = 4e-23
 Identities = 68/71 (95%)
 Strand = Plus / Minus

                                                                           
Query: 396     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 455
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 456     aagcacaaggt 466
               ||| |||||||
Sbjct: 1602928 aagtacaaggt 1602918



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 463     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
               ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 1602194



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  270 bits (136), Expect = 4e-69
 Identities = 217/244 (88%)
 Strand = Plus / Minus

                                                                           
Query: 138     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269

                                                                           
Query: 198     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209

                                                                           
Query: 258     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
               || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149

                                                                           
Query: 318     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089

                   
Query: 378     ctca 381
               ||||
Sbjct: 1603088 ctca 1603085



 Score =  117 bits (59), Expect = 4e-23
 Identities = 68/71 (95%)
 Strand = Plus / Minus

                                                                           
Query: 396     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 455
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 456     aagcacaaggt 466
               ||| |||||||
Sbjct: 1602928 aagtacaaggt 1602918



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 463     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
               ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 1602194



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  270 bits (136), Expect = 4e-69
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 138   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 89594 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 89653

                                                                         
Query: 198   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 89654 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 89713

                                                                         
Query: 258   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 89714 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 89773

                                                                         
Query: 318   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 89774 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 89833

                 
Query: 378   ctca 381
             ||||
Sbjct: 89834 ctca 89837



 Score =  117 bits (59), Expect = 4e-23
 Identities = 68/71 (95%)
 Strand = Plus / Plus

                                                                         
Query: 396   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 455
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 89993

                        
Query: 456   aagcacaaggt 466
             ||| |||||||
Sbjct: 89994 aagtacaaggt 90004



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                              
Query: 463   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
             ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 90680 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 90728



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  270 bits (136), Expect = 4e-69
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 138   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 22404 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 22463

                                                                         
Query: 198   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 22464 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 22523

                                                                         
Query: 258   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 22524 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 22583

                                                                         
Query: 318   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 377
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 22584 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 22643

                 
Query: 378   ctca 381
             ||||
Sbjct: 22644 ctca 22647



 Score =  117 bits (59), Expect = 4e-23
 Identities = 68/71 (95%)
 Strand = Plus / Plus

                                                                         
Query: 396   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 455
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 22803

                        
Query: 456   aagcacaaggt 466
             ||| |||||||
Sbjct: 22804 aagtacaaggt 22814



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                              
Query: 463   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
             ||||||| ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 23490 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggt 23538



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 138 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
           |||||||||||| |||||||||| ||||||||||||||||||||| ||||||| |||   
Sbjct: 114 atggcgatcaagcggaccaaggcggagaagaagatcgcgtacgacaagaagctgtgcagc 173

                                                                       
Query: 198 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 257
            ||||||| |||||||||||||||||||||||| |||||||||| ||||| |||||||||
Sbjct: 174 ctgctcgatgagtacaccaaggtgctcatcgccctcgccgacaacgtcggttccaagcag 233

                                                                       
Query: 258 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 317
           |||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||| 
Sbjct: 234 ctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacg 293

                                                 
Query: 318 ctgatccgccgctgcatcaaggtgcactcggagaagac 355
           || ||| | ||||||||||||||| || | ||||||||
Sbjct: 294 ctcatcaggcgctgcatcaaggtgtacgccgagaagac 331



 Score =  151 bits (76), Expect = 3e-33
 Identities = 112/124 (90%)
 Strand = Plus / Plus

                                                                       
Query: 385 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 444
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 420

                                                                       
Query: 445 aggaggtcgccaagcacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 504
           |||||||||||||| ||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 421 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 480

               
Query: 505 atgt 508
           ||||
Sbjct: 481 atgt 484



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  174 bits (88), Expect = 2e-40
 Identities = 187/220 (85%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 195
           |||||||||||||| |||| ||||| ||||||||||||||||||||| ||||||| ||| 
Sbjct: 131 cgatggcgatcaagcggactaaggcggagaagaagatcgcgtacgacaagaagctgtgca 190

                                                                       
Query: 196 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 255
              ||||||| |||||||||||||||||||||||| | |||||||| ||||| |||||||
Sbjct: 191 gcctgctcgatgagtacaccaaggtgctcatcgccctggccgacaacgtcggttccaagc 250

                                                                       
Query: 256 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 315
           |||||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||
Sbjct: 251 agctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaaca 310

                                                   
Query: 316 ccctgatccgccgctgcatcaaggtgcactcggagaagac 355
           | || ||| | || |||||||||||| || | ||||||||
Sbjct: 311 cgctcatcaggcgttgcatcaaggtgtacgccgagaagac 350



 Score =  151 bits (76), Expect = 3e-33
 Identities = 112/124 (90%)
 Strand = Plus / Plus

                                                                       
Query: 385 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 444
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 439

                                                                       
Query: 445 aggaggtcgccaagcacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 504
           |||||||||||||| ||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 440 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 499

               
Query: 505 atgt 508
           ||||
Sbjct: 500 atgt 503



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                               
Query: 3  aggttaaagcgacgccgccgccgcaagccgtccgcct 39
          |||||||||||||||||||||||||||||||||||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgcct 38



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 414 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggcgct 473
           ||||||||||||||||| ||||||||  | |||||||| || ||| |||||||||| |||
Sbjct: 404 ttcaccaagggtgacctgaaggaggtcagtgaggaggttgctaagtacaaggttggagct 463

                         
Query: 474 cctgctcgtgttgg 487
           ||||||||||||||
Sbjct: 464 cctgctcgtgttgg 477



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 cagctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaac 314
           ||||||||| | || ||||||||||| ||||| |||||  | || |||||||| ||||||
Sbjct: 245 cagctccagaacattcgcaagggtcttcgcggcgactctgttgtcctcatggggaagaac 304

                   
Query: 315 accctgat 322
           ||| ||||
Sbjct: 305 accatgat 312



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 152 gaccaaggccgagaagaagatcgcgtacga 181
           ||||||||| |||||||||||||| |||||
Sbjct: 142 gaccaaggctgagaagaagatcgcttacga 171



to top

>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome AT3G11250
           mRNA, complete cds
          Length = 1239

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| || ||||| |||||||| ||  |||||||||| |||||  |||||||||| 
Sbjct: 364 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 423

                                                    
Query: 471 gctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
           |||||||||||||| ||  ||||||| ||| ||||||||||
Sbjct: 424 gctcctgctcgtgtgggtttagttgctcctattgatgtggt 464



to top

>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1254

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||||||||||||||||||||| ||  | ||||| ||||| ||| |||||||||| 
Sbjct: 437 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 496

                            
Query: 471 gctcctgctcgtgttgg 487
           || ||||||||||||||
Sbjct: 497 gcacctgctcgtgttgg 513



to top

>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1003

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| || ||||| |||||||| ||  |||||||||| |||||  |||||||||| 
Sbjct: 271 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 330

                                                    
Query: 471 gctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
           |||||||||||||| ||  ||||||| ||| ||||||||||
Sbjct: 331 gctcctgctcgtgtgggtttagttgctcctattgatgtggt 371



to top

>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1174

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| || ||||| |||||||| ||  |||||||||| |||||  |||||||||| 
Sbjct: 334 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 393

                                                    
Query: 471 gctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
           |||||||||||||| ||  ||||||| ||| ||||||||||
Sbjct: 394 gctcctgctcgtgtgggtttagttgctcctattgatgtggt 434



to top

>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence
          Length = 1185

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| || ||||| |||||||| ||  |||||||||| |||||  |||||||||| 
Sbjct: 311 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 370

                                                    
Query: 471 gctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
           |||||||||||||| ||  ||||||| ||| ||||||||||
Sbjct: 371 gctcctgctcgtgtgggtttagttgctcctattgatgtggt 411



to top

>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1253

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||||||||||||||||||||| ||  | ||||| ||||| ||| |||||||||| 
Sbjct: 415 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 474

                            
Query: 471 gctcctgctcgtgttgg 487
           || ||||||||||||||
Sbjct: 475 gcacctgctcgtgttgg 491



to top

>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C2319
          Length = 1345

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 414 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggcgct 473
           ||||||||||||||| | ||||| ||| | |||||||| || ||| |||||||||| |||
Sbjct: 433 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 492

                         
Query: 474 cctgctcgtgttgg 487
           ||||||||||||||
Sbjct: 493 cctgctcgtgttgg 506



to top

>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C212
          Length = 1326

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 414 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggcgct 473
           ||||||||||||||| | ||||| ||| | |||||||| || ||| |||||||||| |||
Sbjct: 440 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 499

                         
Query: 474 cctgctcgtgttgg 487
           ||||||||||||||
Sbjct: 500 cctgctcgtgttgg 513



to top

>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1185

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||| |||||||||| || ||| |||||||||| 
Sbjct: 325 atctttaccaaaggtgacctcaaggaagttagcgaggaggttgctaagtacaaggttggt 384

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 385 gcccctgctcgtgt 398



to top

>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds
          Length = 1127

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||||||||||||||| |||||||| ||  | || ||||| |||||| |||||||||| 
Sbjct: 265 atcttcaccaagggtgatctcaaggaagtcagtgaagaggttgccaagtacaaggttgga 324

                            
Query: 471 gctcctgctcgtgttgg 487
           || ||||||||||||||
Sbjct: 325 gcccctgctcgtgttgg 341



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 154 ccaaggccgagaagaagatcgcgtacgaccagaagctctgccagttgct 202
           ||||||| |||||||||||||| || ||    |||||||||||||||||
Sbjct: 8   ccaaggctgagaagaagatcgcttatgatgctaagctctgccagttgct 56



to top

>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome AT3G09200
           mRNA, complete cds
          Length = 1307

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||| |||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 401 gcccctgctcgtgt 414



to top

>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 994

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||| |||||||||| 
Sbjct: 271 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 330

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 331 gcccctgctcgtgt 344



to top

>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 1160

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||| |||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 401 gcccctgctcgtgt 414



to top

>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||| |||||||||| 
Sbjct: 308 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 367

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 368 gcccctgctcgtgt 381



to top

>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence
          Length = 1199

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||| ||||||| || 
Sbjct: 339 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtcggt 398

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 399 gcccctgctcgtgt 412



to top

>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal
           protein P0, partial cds
          Length = 820

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| ||||||||| | ||||||||||| || ||||| || ||| ||||||| || 
Sbjct: 481 atcttcacaaagggtgacttgaaggaggttcgtgaagaggttgctaagtacaaggtcgga 540

                         
Query: 471 gctcctgctcgtgt 484
           || |||||||||||
Sbjct: 541 gcacctgctcgtgt 554



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 156 aaggccgagaagaagatcgcgtacgaccagaagctctgccag 197
           ||||| || ||||||||||| ||||| |||||||||||||||
Sbjct: 226 aaggctgataagaagatcgcttacgatcagaagctctgccag 267



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 153 accaaggccgagaagaagatcgcgtacgaccagaagctctgcca 196
           |||||||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 255 accaaggctgagaagaagatcgcatacgatcagaagctatgcca 298



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 454 ccaagcacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgatgt 508
           ||||| |||||||||| |||||||||||| ||||  | ||||||||  |||||||
Sbjct: 556 ccaagtacaaggttggagctcctgctcgttttggtttggttgcaccaattgatgt 610



to top

>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome AT2G40010
           mRNA, complete cds
          Length = 1153

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| ||||||||| | ||||| ||  | || ||||| || ||| |||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                         
Query: 471 gctcctgctcgtgt 484
           ||||||||||||||
Sbjct: 334 gctcctgctcgtgt 347



to top

>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence
          Length = 1373

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| ||||||||| | ||||| ||  | || ||||| || ||| |||||||||| 
Sbjct: 478 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 537

                         
Query: 471 gctcctgctcgtgt 484
           ||||||||||||||
Sbjct: 538 gctcctgctcgtgt 551



to top

>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| ||||||||| | ||||| ||  | || ||||| || ||| |||||||||| 
Sbjct: 130 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 189

                         
Query: 471 gctcctgctcgtgt 484
           ||||||||||||||
Sbjct: 190 gctcctgctcgtgt 203



to top

>gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds
          Length = 1118

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 237 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 296
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 147 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 206

                                     
Query: 297 gtgctcatgggcaagaacaccctgat 322
           ||||| ||||||||||||||| ||||
Sbjct: 207 gtgctgatgggcaagaacaccatgat 232



to top

>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal
           protein P0 (At2g40010) mRNA, complete cds
          Length = 985

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggttggc 470
           |||||||| ||||||||| | ||||| ||  | || ||||| || ||| |||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                         
Query: 471 gctcctgctcgtgt 484
           ||||||||||||||
Sbjct: 334 gctcctgctcgtgt 347



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 411   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggtt 467
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||| ||||||||
Sbjct: 21237 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 21181



to top

>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete
             sequence
          Length = 85561

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 411   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagcacaaggtt 467
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||| ||||||||
Sbjct: 85560 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 85504



to top

>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein
           (rpp0 gene)
          Length = 608

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 294 atcgtgctcatgggcaagaacaccctgat 322
           |||||||||||||||||||||||| ||||
Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182



to top

>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete
             sequence
          Length = 103517

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 463   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggt 511
             ||||||| |||||||||||||| ||  ||||||| ||| ||||||||||
Sbjct: 59147 aggttggtgctcctgctcgtgtgggtttagttgctcctattgatgtggt 59195



to top

>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds
          Length = 1081

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 294 atcgtgctcatgggcaagaacaccctgat 322
           |||||||||||||||||||||||| ||||
Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255



to top

>dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I antigen, partial cds
            and promoter region
          Length = 3861

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 237  gacaatgtcggctccaagcagctccaggagatccgca 273
            |||||||| |||||||||||| | |||||||||||||
Sbjct: 1649 gacaatgtgggctccaagcagatgcaggagatccgca 1685



to top

>ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC587264), mRNA
          Length = 533

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 295 tcgtgctcatgggcaagaacaccctgatccgc 326
           |||| |||||||||||||||||| ||||||||
Sbjct: 196 tcgtcctcatgggcaagaacaccatgatccgc 227



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 gacaatgtcggctccaagcag 257
           |||||||||||||||||||||
Sbjct: 138 gacaatgtcggctccaagcag 158



to top

>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 292 ccatcgtgctcatgggcaagaacaccctgatccgcc 327
           |||||||||| ||||||||||||||| |||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271



to top

>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 279 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257



to top

>ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC590099), mRNA
          Length = 198

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 295 tcgtgctcatgggcaagaacaccctgatccgc 326
           |||| |||||||||||||||||| ||||||||
Sbjct: 119 tcgtcctcatgggcaagaacaccatgatccgc 150



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 237 gacaatgtcggctccaagcag 257
           |||||||||||||||||||||
Sbjct: 61  gacaatgtcggctccaagcag 81



to top

>ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosomal protein P0
           (AN2734.2), mRNA
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 399 aacgttggcctcatcttcaccaagggtgacctcaaggag 437
           ||||||||  ||||||||||||| || ||||||||||||
Sbjct: 247 aacgttggtttcatcttcaccaacggcgacctcaaggag 285



to top

>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 91  ccatcgtgctgatgggcaagaacaccatgat 121



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 55  ccatcgtgctgatgggcaagaacaccatgat 85



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275



to top

>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 52  ccatcgtgctgatgggcaagaacaccatgat 82



to top

>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 335

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179



to top

>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270



to top

>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233



to top

>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820



to top

>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231



to top

>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134



to top

>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741



to top

>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341



to top

>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 304

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760



to top

>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 92  ccatcgtgctgatgggcaagaacaccatgat 122



to top

>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854



to top

>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 198

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229



to top

>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133



to top

>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206



to top

>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755



to top

>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202



to top

>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756



to top

>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356



to top

>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX060185.1|CNS09ILP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX059866.1|CNS09ICU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX059758.1|CNS09I9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX059741.1|CNS09I9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX059642.1|CNS09I6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX059587.1|CNS09I53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX059585.1|CNS09I51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 152 ccatcgtgctgatgggcaagaacaccatgat 182



to top

>emb|BX059469.1|CNS09I1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 108 ccatcgtgctgatgggcaagaacaccatgat 138



to top

>emb|BX059220.1|CNS09HUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX059184.1|CNS09HTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX059095.1|CNS09HRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX058839.1|CNS09HKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX058740.1|CNS09HHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX058315.1|CNS09H5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX058203.1|CNS09H2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056754.1|CNS09FYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX057924.1|CNS09GUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX057796.1|CNS09GRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX057631.1|CNS09GMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 88  ccatcgtgctgatgggcaagaacaccatgat 118



to top

>emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 159

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 87  ccatcgtgctgatgggcaagaacaccatgat 117



to top

>emb|BX057218.1|CNS09GBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX057133.1|CNS09G8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX057094.1|CNS09G7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX057074.1|CNS09G7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX056996.1|CNS09G54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056958.1|CNS09G42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX056914.1|CNS09G2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX056483.1|CNS09FQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 162 ccatcgtgctgatgggcaagaacaccatgat 192



to top

>emb|BX055960.1|CNS09FCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX055808.1|CNS09F84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX056320.1|CNS09FMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX056288.1|CNS09FLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 889 ccatcgtgctgatgggcaagaacaccatgat 859



to top

>emb|BX056287.1|CNS09FLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX056283.1|CNS09FLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 98  ccatcgtgctgatgggcaagaacaccatgat 128



to top

>emb|BX055999.1|CNS09FDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 190 ccatcgtgctgatgggcaagaacaccatgat 220



to top

>emb|BX055725.1|CNS09F5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055721.1|CNS09F5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX055621.1|CNS09F2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055603.1|CNS09F2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX055567.1|CNS09F1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX053214.1|CNS09D82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX053185.1|CNS09D79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 362

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX053146.1|CNS09D66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052948.1|CNS09D0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX052946.1|CNS09D0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX054345.1|CNS09E3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 188 ccatcgtgctgatgggcaagaacaccatgat 218



to top

>emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX053890.1|CNS09DQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 800 ccatcgtgctgatgggcaagaacaccatgat 770



to top

>emb|BX053889.1|CNS09DQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 282 ccatcgtgctgatgggcaagaacaccatgat 312



to top

>emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 248 ccatcgtgctgatgggcaagaacaccatgat 278



to top

>emb|BX053704.1|CNS09DLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX053693.1|CNS09DLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX053532.1|CNS09DGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX052874.1|CNS09CYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX052836.1|CNS09CXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 209



to top

>emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052777.1|CNS09CVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX052724.1|CNS09CUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX052368.1|CNS09CKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX052263.1|CNS09CHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX052235.1|CNS09CGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX052085.1|CNS09CCP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 113 ccatcgtgctgatgggcaagaacaccatgat 143



to top

>emb|BX052006.1|CNS09CAI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX051964.1|CNS09C9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 97  ccatcgtgctgatgggcaagaacaccatgat 127



to top

>emb|BX051899.1|CNS09C7J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX051866.1|CNS09C6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 213 ccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX051626.1|CNS09BZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 405

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 212 ccatcgtgctgatgggcaagaacaccatgat 242



to top

>emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 198 ccatcgtgctgatgggcaagaacaccatgat 228



to top

>emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 95  ccatcgtgctgatgggcaagaacaccatgat 125



to top

>emb|BX051577.1|CNS09BYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 292 ccatcgtgctcatgggcaagaacaccctgat 322
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,687,003
Number of Sequences: 3902068
Number of extensions: 3687003
Number of successful extensions: 82773
Number of sequences better than 10.0: 1057
Number of HSP's better than 10.0 without gapping: 1057
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79980
Number of HSP's gapped (non-prelim): 2784
length of query: 511
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 488
effective length of database: 17,143,297,704
effective search space: 8365929279552
effective search space used: 8365929279552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top