Clone Name | bart29g08 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_450186.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2532 Score = 121 bits (61), Expect = 2e-24 Identities = 85/93 (91%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggatcatcaccagcgacccctacgtcacgctctccgtcgc 482 |||| ||||||||| ||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 201 ccgcggccaccaccgccggaagatcatcaccagcgacccctacgtcacgctctccgtcgc 260 Query: 483 cggcgccgtcgtcgcgcgcaccgccgtcatccc 515 ||||||||| || ||||||||| ||||||||| Sbjct: 261 cggcgccgtggtggcgcgcacccgcgtcatccc 293 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Plus Query: 247 aagccggtgctcctgcacggggacctcgacctctgggtcctcgaggcgcggctgctgccc 306 ||||| ||||| || ||||||||||||||||| ||||| |||||||||| ||||| || Sbjct: 49 aagcccgtgctgctccacggggacctcgacctgtgggtggtcgaggcgcgcctgctccca 108 Query: 307 aacatggacatgttctccgagcacatccgccgctgcttcgcctcctgc 354 |||||||||||||||||||||||| | || || ||||||||| ||||| Sbjct: 109 aacatggacatgttctccgagcacgtacggcggtgcttcgccgcctgc 156
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 121 bits (61), Expect = 2e-24 Identities = 85/93 (91%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggatcatcaccagcgacccctacgtcacgctctccgtcgc 482 |||| ||||||||| ||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 21090886 ccgcggccaccaccgccggaagatcatcaccagcgacccctacgtcacgctctccgtcgc 21090945 Query: 483 cggcgccgtcgtcgcgcgcaccgccgtcatccc 515 ||||||||| || ||||||||| ||||||||| Sbjct: 21090946 cggcgccgtggtggcgcgcacccgcgtcatccc 21090978 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Plus Query: 247 aagccggtgctcctgcacggggacctcgacctctgggtcctcgaggcgcggctgctgccc 306 ||||| ||||| || ||||||||||||||||| ||||| |||||||||| ||||| || Sbjct: 21090734 aagcccgtgctgctccacggggacctcgacctgtgggtggtcgaggcgcgcctgctccca 21090793 Query: 307 aacatggacatgttctccgagcacatccgccgctgcttcgcctcctgc 354 |||||||||||||||||||||||| | || || ||||||||| ||||| Sbjct: 21090794 aacatggacatgttctccgagcacgtacggcggtgcttcgccgcctgc 21090841 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 20684479 ccggcaccggcaccggcaccga 20684458 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 417 cggcagccgccgccaccacc 436 |||||||||||||||||||| Sbjct: 20293104 cggcagccgccgccaccacc 20293123 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 cgtcgccggcgccgtcgtcg 496 |||||||||||||||||||| Sbjct: 14424895 cgtcgccggcgccgtcgtcg 14424914 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 10180451 gccgccgccaccaccaccgc 10180470
>dbj|AK109315.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-G03, full insert sequence Length = 1300 Score = 121 bits (61), Expect = 2e-24 Identities = 85/93 (91%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggatcatcaccagcgacccctacgtcacgctctccgtcgc 482 |||| ||||||||| ||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 506 ccgcggccaccaccgccggaagatcatcaccagcgacccctacgtcacgctctccgtcgc 565 Query: 483 cggcgccgtcgtcgcgcgcaccgccgtcatccc 515 ||||||||| || ||||||||| ||||||||| Sbjct: 566 cggcgccgtggtggcgcgcacccgcgtcatccc 598 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Plus Query: 247 aagccggtgctcctgcacggggacctcgacctctgggtcctcgaggcgcggctgctgccc 306 ||||| ||||| || ||||||||||||||||| ||||| |||||||||| ||||| || Sbjct: 354 aagcccgtgctgctccacggggacctcgacctgtgggtggtcgaggcgcgcctgctccca 413 Query: 307 aacatggacatgttctccgagcacatccgccgctgcttcgcctcctgc 354 |||||||||||||||||||||||| | || || ||||||||| ||||| Sbjct: 414 aacatggacatgttctccgagcacgtacggcggtgcttcgccgcctgc 461
>dbj|AK100579.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023105L14, full insert sequence Length = 3079 Score = 121 bits (61), Expect = 2e-24 Identities = 85/93 (91%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggatcatcaccagcgacccctacgtcacgctctccgtcgc 482 |||| ||||||||| ||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 427 ccgcggccaccaccgccggaagatcatcaccagcgacccctacgtcacgctctccgtcgc 486 Query: 483 cggcgccgtcgtcgcgcgcaccgccgtcatccc 515 ||||||||| || ||||||||| ||||||||| Sbjct: 487 cggcgccgtggtggcgcgcacccgcgtcatccc 519 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Plus Query: 247 aagccggtgctcctgcacggggacctcgacctctgggtcctcgaggcgcggctgctgccc 306 ||||| ||||| || ||||||||||||||||| ||||| |||||||||| ||||| || Sbjct: 275 aagcccgtgctgctccacggggacctcgacctgtgggtggtcgaggcgcgcctgctccca 334 Query: 307 aacatggacatgttctccgagcacatccgccgctgcttcgcctcctgc 354 |||||||||||||||||||||||| | || || ||||||||| ||||| Sbjct: 335 aacatggacatgttctccgagcacgtacggcggtgcttcgccgcctgc 382
>dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone: P0478E02 Length = 140715 Score = 121 bits (61), Expect = 2e-24 Identities = 85/93 (91%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggatcatcaccagcgacccctacgtcacgctctccgtcgc 482 |||| ||||||||| ||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 112186 ccgcggccaccaccgccggaagatcatcaccagcgacccctacgtcacgctctccgtcgc 112245 Query: 483 cggcgccgtcgtcgcgcgcaccgccgtcatccc 515 ||||||||| || ||||||||| ||||||||| Sbjct: 112246 cggcgccgtggtggcgcgcacccgcgtcatccc 112278 Score = 103 bits (52), Expect = 6e-19 Identities = 94/108 (87%) Strand = Plus / Plus Query: 247 aagccggtgctcctgcacggggacctcgacctctgggtcctcgaggcgcggctgctgccc 306 ||||| ||||| || ||||||||||||||||| ||||| |||||||||| ||||| || Sbjct: 112034 aagcccgtgctgctccacggggacctcgacctgtgggtggtcgaggcgcgcctgctccca 112093 Query: 307 aacatggacatgttctccgagcacatccgccgctgcttcgcctcctgc 354 |||||||||||||||||||||||| | || || ||||||||| ||||| Sbjct: 112094 aacatggacatgttctccgagcacgtacggcggtgcttcgccgcctgc 112141
>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence, complete sequence Length = 130272 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgccgtcgtcgcgc 499 ||||||||||||||||||||||||| | ||| | ||||||||||| |||||||| Sbjct: 51569 gatcatcaccagcgacccctacgtctccgtctgcctcgccggcgccaccgtcgcgc 51514 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 253 gtgctcctgcacggggacctcgac 276 |||||||||||||| ||||||||| Sbjct: 51745 gtgctcctgcacggcgacctcgac 51722
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgccgtcgtcgcgc 499 ||||||||||||||||||||||||| | ||| | ||||||||||| |||||||| Sbjct: 35050668 gatcatcaccagcgacccctacgtctccgtctgcctcgccggcgccaccgtcgcgc 35050613 Score = 48.1 bits (24), Expect = 0.030 Identities = 24/24 (100%) Strand = Plus / Plus Query: 134 ctcccggcaccggcaccggcaccg 157 |||||||||||||||||||||||| Sbjct: 14037041 ctcccggcaccggcaccggcaccg 14037064 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 472 ctctccgtcgccggcgccgtcgtcgcgcgc 501 ||||||||||||| ||||||| |||||||| Sbjct: 29832494 ctctccgtcgccgtcgccgtcatcgcgcgc 29832523 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 253 gtgctcctgcacggggacctcgac 276 |||||||||||||| ||||||||| Sbjct: 35050844 gtgctcctgcacggcgacctcgac 35050821 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 33017300 ccggcaccggcaccggcacc 33017319 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 16529683 gccgccgccaccaccaccgc 16529664 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 7557396 gccgccgccaccaccaccgc 7557377 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 3520323 cggcaccggcaccggcaccg 3520342 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 2060967 gccgccgccaccaccaccgc 2060948 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 accagcgacccctacgtcac 470 |||||||||||||||||||| Sbjct: 1010914 accagcgacccctacgtcac 1010895 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 429 ccaccaccaccgcaggatcatcaccagc 456 ||||||||||||||| ||||||| |||| Sbjct: 732338 ccaccaccaccgcagcatcatcatcagc 732311
>gb|AF271358.1| Oryza sativa (indica cultivar-group) phospholipase D (RPLD5) gene, complete cds Length = 6300 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgccgtcgtcgcgc 499 ||||||||||||||||||||||||| | ||| | ||||||||||| |||||||| Sbjct: 1601 gatcatcaccagcgacccctacgtctccgtctgcctcgccggcgccaccgtcgcgc 1656 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 253 gtgctcctgcacggggacctcgacctctgg 282 |||||||||||||| ||||||||| ||||| Sbjct: 1431 gtgctcctgcacggcgacctcgacatctgg 1460
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgccgtcgtcgcgc 499 ||||||||||||||||||||||||| | ||| | ||||||||||| |||||||| Sbjct: 35140740 gatcatcaccagcgacccctacgtctccgtctgcctcgccggcgccaccgtcgcgc 35140685 Score = 48.1 bits (24), Expect = 0.030 Identities = 24/24 (100%) Strand = Plus / Plus Query: 134 ctcccggcaccggcaccggcaccg 157 |||||||||||||||||||||||| Sbjct: 14032016 ctcccggcaccggcaccggcaccg 14032039 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 472 ctctccgtcgccggcgccgtcgtcgcgcgc 501 ||||||||||||| ||||||| |||||||| Sbjct: 29923916 ctctccgtcgccgtcgccgtcatcgcgcgc 29923945 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 253 gtgctcctgcacggggacctcgac 276 |||||||||||||| ||||||||| Sbjct: 35140916 gtgctcctgcacggcgacctcgac 35140893 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 33107810 ccggcaccggcaccggcacc 33107829 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 16523317 gccgccgccaccaccaccgc 16523298 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 7555231 gccgccgccaccaccaccgc 7555212 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 3520434 cggcaccggcaccggcaccg 3520453 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 2060979 gccgccgccaccaccaccgc 2060960 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 accagcgacccctacgtcac 470 |||||||||||||||||||| Sbjct: 1010912 accagcgacccctacgtcac 1010893 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 429 ccaccaccaccgcaggatcatcaccagc 456 ||||||||||||||| ||||||| |||| Sbjct: 732336 ccaccaccaccgcagcatcatcatcagc 732309
>dbj|AK069703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027C22, full insert sequence Length = 2733 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgccgtcgtcgcgc 499 ||||||||||||||||||||||||| | ||| | ||||||||||| |||||||| Sbjct: 345 gatcatcaccagcgacccctacgtctccgtctgcctcgccggcgccaccgtcgcgc 400 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 253 gtgctcctgcacggggacctcgac 276 |||||||||||||| ||||||||| Sbjct: 169 gtgctcctgcacggcgacctcgac 192
>dbj|AP004948.1| Lotus japonicus genomic DNA, chromosome , clone:LjT35I07, TM0121b, complete sequence Length = 56086 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 444 gatcatcaccagcgacccctacgtcacgctctccgtcgccggcgcc 489 |||||||||||||||||| |||||||| ||| | ||||||||||| Sbjct: 53927 gatcatcaccagcgacccttacgtcaccgtctgcctcgccggcgcc 53882
>gb|AC137597.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0022F22, from chromosome 3, complete sequence Length = 144268 Score = 48.1 bits (24), Expect = 0.030 Identities = 24/24 (100%) Strand = Plus / Plus Query: 134 ctcccggcaccggcaccggcaccg 157 |||||||||||||||||||||||| Sbjct: 46720 ctcccggcaccggcaccggcaccg 46743
>gb|AF544228.1| Gossypium hirsutum phospholipase D delta isoform (pldd) mRNA, complete cds Length = 3048 Score = 48.1 bits (24), Expect = 0.030 Identities = 33/36 (91%) Strand = Plus / Plus Query: 435 ccaccgcaggatcatcaccagcgacccctacgtcac 470 |||||| | ||||||||||||||| ||||||||||| Sbjct: 428 ccaccgtaagatcatcaccagcgatccctacgtcac 463
>gb|AY138251.1| Gossypium hirsutum phospholipase D delta isoform 1b mRNA, complete cds Length = 3028 Score = 48.1 bits (24), Expect = 0.030 Identities = 33/36 (91%) Strand = Plus / Plus Query: 435 ccaccgcaggatcatcaccagcgacccctacgtcac 470 |||||| | ||||||||||||||| ||||||||||| Sbjct: 428 ccaccgtaagatcatcaccagcgatccctacgtcac 463
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 480 cgccggcgccgtcgtcgcgcgca 502 ||||||||||||||||||||||| Sbjct: 531204 cgccggcgccgtcgtcgcgcgca 531226
>ref|XM_533845.2| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1 (SWI/SNF complex 155 kDa subunit) (BRG1-associated factor 155) (LOC476640), mRNA Length = 3402 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccaccgc 441 ||||||||||||||||||||||| Sbjct: 3321 gcagccgccgccaccaccaccgc 3343
>gb|DQ215528.1| Taeniopygia guttata clone 0058P0032A06 RIKEN cDNA 2210402C18 variant 1-like mRNA, complete sequence Length = 1505 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 136 cccggcaccggcaccggcaccg 157 |||||||||||||||||||||| Sbjct: 117 cccggcaccggcaccggcaccg 96 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 110 ccggcaccggcaccggcacc 91
>gb|AC096689.5| Oryza sativa chromosome 3 BAC OSJNBa0027J18 genomic sequence, complete sequence Length = 112892 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Minus Query: 472 ctctccgtcgccggcgccgtcgtcgcgcgc 501 ||||||||||||| ||||||| |||||||| Sbjct: 16967 ctctccgtcgccgtcgccgtcatcgcgcgc 16938
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 2260488 ccggcaccggcaccggcaccga 2260509 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2260482 ccggcaccggcaccggcaccg 2260502 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1050751 ccggcaccggcaccggcaccg 1050771
>ref|XM_753355.1| Ustilago maydis 521 hypothetical protein (UM02301.1) partial mRNA Length = 1944 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 168 ggccgccgcggcagcagctgccgcgt 193 |||||| ||||||||||||||||||| Sbjct: 1746 ggccgcagcggcagcagctgccgcgt 1721
>ref|XM_540806.1| PREDICTED: Canis familiaris similar to MAS-related G-protein coupled receptor, member D (LOC483685), mRNA Length = 1050 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 1016 ccggcaccggcaccggcaccga 1037
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 481 gccggcgccgtcgtcgcgcgcaccgc 506 |||||||||||||||| ||||||||| Sbjct: 760767 gccggcgccgtcgtcgagcgcaccgc 760742
>gb|AC091542.3| Felis catus clone RP86-141L11, complete sequence Length = 142451 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 136 cccggcaccggcaccggcaccg 157 |||||||||||||||||||||| Sbjct: 35057 cccggcaccggcaccggcaccg 35036
>emb|BX072361.1|CNS09RZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 683 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 210 ggcagccgccgccaccaccacc 189
>emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 318 ggcagccgccgccaccaccacc 339
>emb|BX068379.1|CNS09OXB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 383 ggcagccgccgccaccaccacc 362
>emb|BX068378.1|CNS09OXA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 852 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 428 ggcagccgccgccaccaccacc 449
>emb|BX067609.1|CNS09OBX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 429 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 361 ggcagccgccgccaccaccacc 340
>emb|BX067608.1|CNS09OBW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 420 ggcagccgccgccaccaccacc 441
>emb|BX061944.1|CNS09JYK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 348 ggcagccgccgccaccaccacc 327
>emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 730 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 368 ggcagccgccgccaccaccacc 347
>emb|BX056299.1|CNS09FLR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 371 ggcagccgccgccaccaccacc 350
>emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 322 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 308 ggcagccgccgccaccaccacc 287
>emb|BX055253.1|CNS09ESP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 837 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 415 ggcagccgccgccaccaccacc 436
>emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 404 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 272 ggcagccgccgccaccaccacc 251
>emb|BX049557.1|CNS09AEH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 459 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 320 ggcagccgccgccaccaccacc 299
>emb|BX049556.1|CNS09AEG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 399 ggcagccgccgccaccaccacc 420
>emb|BX049060.1|CNS09A0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 855 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 439 ggcagccgccgccaccaccacc 460
>emb|BX046605.1|CNS0984H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 348 ggcagccgccgccaccaccacc 327
>emb|BX041706.1|CNS094CE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 322 ggcagccgccgccaccaccacc 301
>emb|BX041705.1|CNS094CD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 857 ggcagccgccgccaccaccacc 878
>emb|BX041977.1|CNS094JX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 657 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 395 ggcagccgccgccaccaccacc 416
>emb|BX041260.1|CNS09400 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 441 ggcagccgccgccaccaccacc 462
>emb|BX039117.1|CNS092CH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 608 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 414 ggcagccgccgccaccaccacc 393
>emb|BX039116.1|CNS092CG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 444 ggcagccgccgccaccaccacc 465
>emb|BX038773.1|CNS0922X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 688 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 398 ggcagccgccgccaccaccacc 377
>emb|BX038772.1|CNS0922W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 443 ggcagccgccgccaccaccacc 464
>emb|BX038693.1|CNS0920P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 704 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 383 ggcagccgccgccaccaccacc 362
>emb|BX038692.1|CNS0920O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 452 ggcagccgccgccaccaccacc 473
>emb|BX038208.1|CNS091N8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 669 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 410 ggcagccgccgccaccaccacc 389
>emb|BX038207.1|CNS091N7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 654 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 398 ggcagccgccgccaccaccacc 419
>emb|BX038039.1|CNS091IJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 723 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 392 ggcagccgccgccaccaccacc 371
>emb|BX038038.1|CNS091II Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 439 ggcagccgccgccaccaccacc 460
>emb|BX037613.1|CNS0916P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 667 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 409 ggcagccgccgccaccaccacc 388
>emb|BX037612.1|CNS0916O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 445 ggcagccgccgccaccaccacc 466
>emb|BX037577.1|CNS0915P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 653 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 387 ggcagccgccgccaccaccacc 366
>emb|BX037488.1|CNS09138 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 819 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 339 ggcagccgccgccaccaccacc 318
>emb|BX037487.1|CNS09137 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 408 ggcagccgccgccaccaccacc 429
>emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 601 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 417 ggcagccgccgccaccaccacc 438
>emb|BX028080.1|CNS08TTW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 319 ggcagccgccgccaccaccacc 340
>emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 393 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 363 ggcagccgccgccaccaccacc 342
>emb|BX019545.1|CNS08N8T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 377 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 317 ggcagccgccgccaccaccacc 296
>emb|BX019544.1|CNS08N8S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 588 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 437 ggcagccgccgccaccaccacc 458
>emb|BX021590.1|CNS08OTM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 607 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 349 ggcagccgccgccaccaccacc 328
>emb|BX021589.1|CNS08OTL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 691 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 281 ggcagccgccgccaccaccacc 302
>emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA31DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 373 ggcagccgccgccaccaccacc 352
>emb|BX008016.1|CNS08ECK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 356 ggcagccgccgccaccaccacc 335
>emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 417 ggcagccgccgccaccaccacc 438
>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29 Length = 303550 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 156453 ccggcaccggcaccggcaccga 156432 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 156477 ccggcaccggcaccggcaccg 156457 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 156471 ccggcaccggcaccggcaccg 156451 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 156465 ccggcaccggcaccggcaccg 156445 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 156459 ccggcaccggcaccggcaccg 156439 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 156482 cggcaccggcaccggcaccg 156463
>emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete genome; segment 16/29 Length = 299050 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 79867 ccggcaccggcaccggcaccga 79846 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 296848 ccggcaccggcaccggcaccg 296828 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 296842 ccggcaccggcaccggcaccg 296822 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 296836 ccggcaccggcaccggcaccg 296816 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 296830 ccggcaccggcaccggcaccg 296810 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 79873 ccggcaccggcaccggcaccg 79853
>emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete genome; segment 12/29 Length = 276800 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 136 cccggcaccggcaccggcaccg 157 |||||||||||||||||||||| Sbjct: 214608 cccggcaccggcaccggcaccg 214629 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 214615 ccggcaccggcaccggcaccg 214635 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 142009 ccggcaccggcaccggcaccg 141989 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 142003 ccggcaccggcaccggcaccg 141983
>emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete genome; segment 8/29 Length = 321250 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 103335 ccggcaccggcaccggcaccga 103356
>emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0014D23, complete sequence Length = 133759 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 133 cctcccggcaccggcaccggca 154 |||||||||||||||||||||| Sbjct: 107982 cctcccggcaccggcaccggca 107961
>gb|DQ023263.1| Macaca mulatta 17beta-hydroxysteroid dehydrogenase type 1 (HSD17B1) gene, complete cds Length = 40709 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 420 cagccgccgccaccaccaccgc 441 |||||||||||||||||||||| Sbjct: 35138 cagccgccgccaccaccaccgc 35117
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 476 ccgtcgccggcgccgtcgtcgc 497 |||||||||||||||||||||| Sbjct: 3366712 ccgtcgccggcgccgtcgtcgc 3366691 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4536571 ccggcaccggcaccggcaccg 4536551 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4536565 ccggcaccggcaccggcaccg 4536545 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4536559 ccggcaccggcaccggcaccg 4536539 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 568099 ccggcaccggcaccggcaccg 568079
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 136 cccggcaccggcaccggcaccg 157 |||||||||||||||||||||| Sbjct: 631990 cccggcaccggcaccggcaccg 631969 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631983 ccggcaccggcaccggcaccg 631963 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631977 ccggcaccggcaccggcaccg 631957 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631971 ccggcaccggcaccggcaccg 631951 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631965 ccggcaccggcaccggcaccg 631945 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631959 ccggcaccggcaccggcaccg 631939 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631953 ccggcaccggcaccggcaccg 631933 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 631947 ccggcaccggcaccggcaccg 631927 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 631941 ccggcaccggcaccggcacc 631922
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 133 cctcccggcaccggcaccggca 154 |||||||||||||||||||||| Sbjct: 19819520 cctcccggcaccggcaccggca 19819499 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 30406084 ccggcaccggcaccggcaccg 30406064 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 29785578 ccggcaccggcaccggcaccg 29785598 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 357 caccgcctcctcctgcgcgcccagg 381 |||||||||||||| |||||||||| Sbjct: 29432100 caccgcctcctcctccgcgcccagg 29432124 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 27952451 cggcaccggcaccggcaccg 27952432 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 480 cgccggcgccgtcgtcgcgc 499 |||||||||||||||||||| Sbjct: 16698764 cgccggcgccgtcgtcgcgc 16698745 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 13824782 cggcaccggcaccggcaccg 13824801
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 414 ggccggcagccgccgccaccaccacc 439 ||||||| |||||||||||||||||| Sbjct: 34715562 ggccggccgccgccgccaccaccacc 34715587 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 9732976 ccggcaccggcaccggcaccg 9732956 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 33175923 gccgccgccaccaccaccgc 33175942 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 474 ctccgtcgccggcgccgtcgtcgc 497 ||||||| |||||||||||||||| Sbjct: 24077866 ctccgtccccggcgccgtcgtcgc 24077889 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gtcgccgtcgccgcccaagc 250 |||||||||||||||||||| Sbjct: 8535848 gtcgccgtcgccgcccaagc 8535867
>dbj|AP003411.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1148D12 Length = 132060 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 414 ggccggcagccgccgccaccaccacc 439 ||||||| |||||||||||||||||| Sbjct: 30802 ggccggccgccgccgccaccaccacc 30827
>dbj|AP004331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0085D07 Length = 172483 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 414 ggccggcagccgccgccaccaccacc 439 ||||||| |||||||||||||||||| Sbjct: 167579 ggccggccgccgccgccaccaccacc 167604
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 344 tcgcctcctgcggcaccgcctc 365 |||||||||||||||||||||| Sbjct: 4264524 tcgcctcctgcggcaccgcctc 4264545 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 1186217 ccggcaccggcaccggcaccga 1186238 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 1140691 ccggcaccggcaccggcaccga 1140670 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 6915136 ccggcaccggcaccggcaccg 6915116 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccga 158 ||||||||||||||||||||| Sbjct: 4209605 cggcaccggcaccggcaccga 4209625 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3635803 ccggcaccggcaccggcaccg 3635823 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2213565 ccggcaccggcaccggcaccg 2213545 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1432432 ccggcaccggcaccggcaccg 1432452 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1186211 ccggcaccggcaccggcaccg 1186231 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1175375 ccggcaccggcaccggcaccg 1175395 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1140697 ccggcaccggcaccggcaccg 1140677 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 419058 ccggcaccggcaccggcaccg 419078 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 419052 ccggcaccggcaccggcaccg 419072 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 216478 ccggcaccggcaccggcaccg 216498 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 6915141 cggcaccggcaccggcaccg 6915122 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 6915130 ccggcaccggcaccggcacc 6915111 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 3635809 ccggcaccggcaccggcacc 3635828 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 2759401 cggcaccggcaccggcaccg 2759382
>ref|XM_239258.3| PREDICTED: Rattus norvegicus suppressor of Ty 6 homolog (S. cerevisiae) (predicted) (Supt6h_predicted), mRNA Length = 5940 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccg 440 |||||||||||||||||||||| Sbjct: 40 gcagccgccgccaccaccaccg 19
>gb|AF275943.1|AF275943 Streptomyces avermitilis avermectin polyketide synthase gene, partial cds Length = 11096 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 2983 ccggcaccggcaccggcaccga 2962 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2989 ccggcaccggcaccggcaccg 2969
>dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1112_E07 Length = 132055 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 78090 ccggcaccggcaccggcaccga 78069
>dbj|AK121331.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023118I11, full insert sequence Length = 6581 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 414 ggccggcagccgccgccaccaccacc 439 ||||||| |||||||||||||||||| Sbjct: 212 ggccggccgccgccgccaccaccacc 187
>ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913 (ENSANGG00000014424), mRNA Length = 817 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 418 ggcagccgccgccaccaccacc 439 |||||||||||||||||||||| Sbjct: 435 ggcagccgccgccaccaccacc 456
>dbj|AK107599.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-131-B03, full insert sequence Length = 1376 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 414 ggccggcagccgccgccaccaccacc 439 ||||||| |||||||||||||||||| Sbjct: 259 ggccggccgccgccgccaccaccacc 234
>dbj|AK100026.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146I06, full insert sequence Length = 1567 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 509 ccggcaccggcaccggcaccga 530
>dbj|AK068575.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156N24, full insert sequence Length = 2050 Score = 44.1 bits (22), Expect = 0.46 Identities = 28/30 (93%) Strand = Plus / Plus Query: 472 ctctccgtcgccggcgccgtcgtcgcgcgc 501 ||||||||||||| ||||||| |||||||| Sbjct: 94 ctctccgtcgccgtcgccgtcatcgcgcgc 123
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 476 ccgtcgccggcgccgtcgtcgc 497 |||||||||||||||||||||| Sbjct: 3359302 ccgtcgccggcgccgtcgtcgc 3359281 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4541697 ccggcaccggcaccggcaccg 4541677 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 580222 ccggcaccggcaccggcaccg 580202
>dbj|AB032367.1| Streptomyces avermitilis polyketide synthase gene cluster (aveA1, aveA2, aveA3, aveA4) and aveC, aveE genes, complete cds Length = 64957 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 48501 ccggcaccggcaccggcaccga 48522 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccga 158 |||||||||||||||||||||| Sbjct: 2975 ccggcaccggcaccggcaccga 2954 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 48495 ccggcaccggcaccggcaccg 48515 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 37659 ccggcaccggcaccggcaccg 37679 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2981 ccggcaccggcaccggcaccg 2961
>ref|NM_179708.1| Arabidopsis thaliana ATRER1C AT2G23310 (ATRER1C) transcript variant AT2G23310.2 mRNA, complete cds Length = 1064 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 154 ccggcagccgccgccaccacc 174
>ref|NM_127895.2| Arabidopsis thaliana ATRER1C AT2G23310 (ATRER1C) transcript variant AT2G23310.1 mRNA, complete cds Length = 1067 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 154 ccggcagccgccgccaccacc 174
>ref|NM_124304.2| Arabidopsis thaliana unknown protein AT5G49270 mRNA, complete cds Length = 2147 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccgattt 161 ||||||||||||||||| ||||||| Sbjct: 140 ccggcaccggcaccggccccgattt 164
>ref|NM_102663.1| Arabidopsis thaliana CIPK18 (CBL-interacting protein kinase 18); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyro> AT1G29230 (CIPK18) mRNA, complete cds Length = 1563 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 60 gccgccgccaccaccaccgca 80
>gb|AY061964.1| Zea mays fertilization-independent endosperm protein (FIE1) mRNA, complete cds Length = 1787 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccga 158 ||||||||||||||||||||| Sbjct: 1534 cggcaccggcaccggcaccga 1514
>gb|AC118284.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1087_C03, complete sequence Length = 101218 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 13542 ccggcaccggcaccggcaccg 13562
>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence Length = 1395069 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 610149 ccggcaccggcaccggcaccg 610169 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 610143 ccggcaccggcaccggcaccg 610163 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 610137 ccggcaccggcaccggcaccg 610157 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 485 gcgccgtcgtcgcgcgcaccgccg 508 |||||||||||||||||| ||||| Sbjct: 1292401 gcgccgtcgtcgcgcgcatcgccg 1292424 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 gtcgccggcgccgtcgtcgc 497 |||||||||||||||||||| Sbjct: 588955 gtcgccggcgccgtcgtcgc 588974
>gb|AC168047.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940115D9, complete sequence Length = 108001 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 26549 ccggcaccggcaccggcaccg 26529
>ref|XM_467219.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1509 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ccgtcgccggcgccgtcgtcg 496 ||||||||||||||||||||| Sbjct: 463 ccgtcgccggcgccgtcgtcg 483
>gb|DQ213306.1| Taeniopygia guttata clone 0061P0024G12 mitochondrial ribosomal protein S16-like mRNA, complete sequence Length = 1306 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 418 ccggcaccggcaccggcaccg 438
>ref|XM_465546.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1041 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 169 gccgccgcggcagcagctgccgcgtccgcgtcg 201 ||||||||||||||||| | |||||| |||||| Sbjct: 310 gccgccgcggcagcagcaggcgcgtcggcgtcg 342
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3419918 ccggcaccggcaccggcaccg 3419898 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3419912 ccggcaccggcaccggcaccg 3419892 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3419906 ccggcaccggcaccggcaccg 3419886 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3419900 ccggcaccggcaccggcaccg 3419880 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3419894 ccggcaccggcaccggcaccg 3419874 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2440511 ccggcaccggcaccggcaccg 2440491
>ref|XM_473768.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2376 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 148 ccggcaccggcaccggcaccg 128
>ref|XM_473712.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 369 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 314 ccggcaccggcaccggcaccg 334
>ref|XM_473654.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 975 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 357 caccgcctcctcctgcgcgcccagg 381 |||||||||||||| |||||||||| Sbjct: 687 caccgcctcctcctccgcgcccagg 663
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccaccgcag 443 ||||||||| ||||||||||||||| Sbjct: 675474 gcagccgccaccaccaccaccgcag 675498
>gb|AY022893.1| Oryza sativa microsatellite MRG5218 containing (CGG)X9, closest to marker R1479, genomic sequence Length = 227 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 465 cgtcacgctctccgtcgccggcgcc 489 ||||||||||| ||||||||||||| Sbjct: 20 cgtcacgctctgcgtcgccggcgcc 44
>gb|AC138341.9| Mus musculus chromosome 5, clone RP23-37N15, complete sequence Length = 176410 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 79792 ccggcaccggcaccggcaccg 79812 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 79786 ccggcaccggcaccggcaccg 79806 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 79780 ccggcaccggcaccggcaccg 79800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 79774 ccggcaccggcaccggcaccg 79794
>gb|AC123253.4| Rattus norvegicus 12 BAC CH230-230N7 (Children's Hospital Oakland Research Institute) complete sequence Length = 231202 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 190373 gcagccgccgccaccaccacc 190393
>ref|XM_365410.1| Magnaporthe grisea 70-15 hypothetical protein (MG02112.4) partial mRNA Length = 864 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 806 ccggcaccggcaccggcaccg 786 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 800 ccggcaccggcaccggcacc 781
>ref|XM_366062.1| Magnaporthe grisea 70-15 predicted protein (MG10282.4) partial mRNA Length = 378 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 82 ccggcaccggcaccggcaccg 102
>ref|XM_417814.1| PREDICTED: Gallus gallus similar to peroxisomal protein (PeP) (LOC419667), mRNA Length = 3173 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 252 ccggcaccggcaccggcaccg 232
>gb|AY380839.1| Leifsonia xyli subsp. cynodontis plasmid pCXC100 RepA, putative plasmid partition protein ParA, and putative plasmid related protein genes, complete cds; and unknown genes Length = 4992 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 133 cctcccggcaccggcaccggcaccg 157 |||||||||||||||||||| |||| Sbjct: 4470 cctcccggcaccggcaccgggaccg 4446
>ref|XM_324081.1| Neurospora crassa OR74A hypothetical protein (NCU04725.1) partial mRNA Length = 1623 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 35 ccggcaccggcaccggcaccg 55
>gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence Length = 279448 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 104993 ccggcaccggcaccggcaccg 104973 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 104987 ccggcaccggcaccggcacc 104968 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 104615 ccggcaccggcaccggcacc 104596
>ref|NM_172803.2| Mus musculus dedicator of cytokinesis 4 (Dock4), mRNA Length = 8072 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 5982 ccggcaccggcaccggcaccg 5962
>ref|XM_322357.1| Neurospora crassa OR74A hypothetical protein (NCU00272.1) partial mRNA Length = 3120 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 734 ccggcaccggcaccggcaccg 714 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 728 ccggcaccggcaccggcaccg 708 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 739 cggcaccggcaccggcaccg 720
>ref|XM_952650.1| Neurospora crassa OR74A hypothetical protein (NCU00272.1) partial mRNA Length = 3120 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 734 ccggcaccggcaccggcaccg 714 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 728 ccggcaccggcaccggcaccg 708 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 739 cggcaccggcaccggcaccg 720
>ref|XM_955267.1| Neurospora crassa OR74A hypothetical protein (NCU04725.1) partial mRNA Length = 1623 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 35 ccggcaccggcaccggcaccg 55
>ref|XM_956344.1| Neurospora crassa OR74A hypothetical protein (NCU01351.1) partial mRNA Length = 1110 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 862 ccggcaccggcaccggcaccg 842
>ref|XM_959870.1| Neurospora crassa OR74A hypothetical protein (NCU03104.1) partial mRNA Length = 3834 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3517 ccggcaccggcaccggcaccg 3537 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 3512 cggcaccggcaccggcaccg 3531
>ref|XM_326843.1| Neurospora crassa OR74A hypothetical protein (NCU01351.1) partial mRNA Length = 1110 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 862 ccggcaccggcaccggcaccg 842
>ref|XM_330539.1| Neurospora crassa OR74A hypothetical protein (NCU03104.1) partial mRNA Length = 3834 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3517 ccggcaccggcaccggcaccg 3537 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 3512 cggcaccggcaccggcaccg 3531
>gb|DQ493951.1| Magnaporthe grisea 70-15 clone 41H14 telomere region, partial sequence Length = 39091 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 414 ccggcaccggcaccggcaccg 394 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 408 ccggcaccggcaccggcacc 389
>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence Length = 214580 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 126706 ccggcaccggcaccggcaccg 126726 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 126700 ccggcaccggcaccggcaccg 126720 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 126694 ccggcaccggcaccggcaccg 126714 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 126688 ccggcaccggcaccggcaccg 126708
>ref|NM_009297.1| Mus musculus suppressor of Ty 6 homolog (S. cerevisiae) (Supt6h), mRNA Length = 5923 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 46 gcagccgccgccaccaccacc 26
>ref|NM_024287.2| Mus musculus RAB6, member RAS oncogene family (Rab6), mRNA Length = 3404 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 53 gcagccgccgccgccaccaccgcag 29
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 491 tcgtcgcgcgcaccgccgtcatccc 515 ||||||||| ||||||||||||||| Sbjct: 1299816 tcgtcgcgcccaccgccgtcatccc 1299792
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 145573 ccggcaccggcaccggcaccg 145593
>gb|AF484556.1| Streptomyces atroolivaceus leinamycin biosynthetic gene cluster, complete sequence Length = 135638 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 88217 ccggcaccggcaccggcaccg 88237
>ref|XM_990324.1| PREDICTED: Mus musculus suppressor of Ty 6 homolog (S. cerevisiae) (Supt6h), mRNA Length = 3370 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 876 gcagccgccgccaccaccacc 856
>gb|AY233338.1| Leifsonia xyli subsp. cynodontis plasmid pcxc100 par locus, partial sequence Length = 773 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 133 cctcccggcaccggcaccggcaccg 157 |||||||||||||||||||| |||| Sbjct: 521 cctcccggcaccggcaccgggaccg 545
>gb|AY195850.1| Zea mays fertilization-independent type 2 mRNA, complete cds Length = 1780 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1513 ccggcaccggcaccggcaccg 1493 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1507 ccggcaccggcaccggcaccg 1487 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 1518 cggcaccggcaccggcaccg 1499
>ref|XM_843028.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0424) partial mRNA Length = 2745 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccaccgcag 443 ||||||||| ||||||||||||||| Sbjct: 2631 gcagccgccaccaccaccaccgcag 2655
>ref|XM_533915.2| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 1 (LOC476710), mRNA Length = 5593 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862766.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 23 (LOC476710), mRNA Length = 5654 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 115 agccgccgccaccaccaccgc 95
>ref|XM_862758.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 22 (LOC476710), mRNA Length = 5581 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_848646.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 2 (LOC476710), mRNA Length = 5671 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862745.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 21 (LOC476710), mRNA Length = 5467 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862739.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 20 (LOC476710), mRNA Length = 5419 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862731.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 19 (LOC476710), mRNA Length = 5440 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862722.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 18 (LOC476710), mRNA Length = 5431 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862714.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 17 (LOC476710), mRNA Length = 5389 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862707.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 16 (LOC476710), mRNA Length = 5434 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862700.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 15 (LOC476710), mRNA Length = 5506 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862693.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 14 (LOC476710), mRNA Length = 5467 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862685.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 13 (LOC476710), mRNA Length = 5476 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862676.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 12 (LOC476710), mRNA Length = 5452 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862668.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 11 (LOC476710), mRNA Length = 5458 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862660.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 10 (LOC476710), mRNA Length = 5479 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862650.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 9 (LOC476710), mRNA Length = 5455 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862640.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 8 (LOC476710), mRNA Length = 5431 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862629.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 7 (LOC476710), mRNA Length = 5446 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862620.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 6 (LOC476710), mRNA Length = 5482 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862610.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 5 (LOC476710), mRNA Length = 5437 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862599.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 4 (LOC476710), mRNA Length = 5461 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_862590.1| PREDICTED: Canis familiaris similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin a4, transcript variant 3 (LOC476710), mRNA Length = 5494 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 57 agccgccgccaccaccaccgc 37
>ref|XM_755123.1| Ustilago maydis 521 hypothetical protein (UM04069.1) partial mRNA Length = 2823 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2591 ccggcaccggcaccggcaccg 2611
>ref|XM_755702.1| Ustilago maydis 521 hypothetical protein (UM04648.1) partial mRNA Length = 1566 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 947 ccggcaccggcaccggcaccg 927
>ref|XM_757305.1| Ustilago maydis 521 hypothetical protein (UM06251.1) partial mRNA Length = 5031 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4624 ccggcaccggcaccggcaccg 4644
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4230300 ccggcaccggcaccggcaccg 4230280
>gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complete sequence Length = 187196 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 170895 gcagccgccgccgccaccaccgcag 170919
>gb|AC124531.5| Mus musculus BAC clone RP23-299D2 from 7, complete sequence Length = 191228 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 151690 gcagccgccgccgccaccaccgcag 151714
>gb|AC137820.11| Medicago truncatula clone mth2-15f9, complete sequence Length = 134674 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 139 ggcaccggcaccggcaccgat 159 ||||||||||||||||||||| Sbjct: 116938 ggcaccggcaccggcaccgat 116918
>emb|AJ833017.1| Streptomyces clavuligerus partial ORF1 and brp gene Length = 1696 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 337 ccggcaccggcaccggcaccg 317
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1993126 ccggcaccggcaccggcaccg 1993106 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 1993120 ccggcaccggcaccggcacc 1993101
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2826497 ccggcaccggcaccggcaccg 2826517
>emb|BX044135.1|CNS0967V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC17CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 408 gcagccgccgccaccaccacc 388
>emb|BX024766.1|CNS08R9U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 460 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 301 gcagccgccgccaccaccacc 281
>emb|BX024765.1|CNS08R9T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 831 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 423 gcagccgccgccaccaccacc 443
>ref|XM_781163.1| PREDICTED: Strongylocentrotus purpuratus similar to YLP motif containing protein 1 (Nuclear protein ZAP3) (LOC581149), mRNA Length = 5799 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 5037 gcagccgccgccaccaccacc 5057
>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14 Length = 348257 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccga 158 ||||||||||||||||||||| Sbjct: 342351 cggcaccggcaccggcaccga 342371
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 cccggcaccggcaccggcacc 156 ||||||||||||||||||||| Sbjct: 1038196 cccggcaccggcaccggcacc 1038176
>emb|BX295540.1|NC49D12 Neurospora crassa DNA linkage group VI Cosmid contig 49D12 Length = 95032 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 64707 ccggcaccggcaccggcaccg 64727 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 64701 ccggcaccggcaccggcaccg 64721 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 64713 ccggcaccggcaccggcacc 64732
>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29 Length = 292100 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 174014 ccggcaccggcaccggcaccg 173994 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 174008 ccggcaccggcaccggcacc 173989 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 173744 ccggcaccggcaccggcacc 173725
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 44732 ccggcaccggcaccggcaccg 44752 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 44727 cggcaccggcaccggcaccg 44746
>emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete genome; segment 9/29 Length = 300800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 198579 ccggcaccggcaccggcaccg 198599 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 198573 ccggcaccggcaccggcaccg 198593
>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01, complete sequence Length = 186325 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 357 caccgcctcctcctgcgcgcccagg 381 |||||||||||||| |||||||||| Sbjct: 105116 caccgcctcctcctccgcgcccagg 105140
>emb|AL606638.2|OSJN00077 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0041A02, complete sequence Length = 166804 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 39462 ccggcaccggcaccggcaccg 39442
>emb|AL591070.19| Mouse DNA sequence from clone RP23-185A18 on chromosome 11 Contains the 3' end of a novel gene, Traf4 gene for Tnf receptor associated factor 4, the Nek8 gene for NIMA (never in mitosis gene a)-related expressed kinase 8, six novel genes, the Rpl23a gene for ribosomal protein L23a, the Rab34 gene for RAB34 member of RAS oncogene family, the Supt6h gene for suppressor of Ty 6 homolog (S. cerevisiae), the Sdf2 gene for stromal cell derived factor 2, the Spag5 gene for sperm associated antigen 5, the Aldo3 gene for aldolase 3 C isoform, the Pigs gene for phosphatidylinositol glycan class S and the Unc119 gene for unc-119 homolog (C. elegans), complete sequence Length = 233242 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 104333 gcagccgccgccaccaccacc 104313
>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5 Length = 72305 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 51355 ccggcaccggcaccggcaccg 51335
>gb|BT008328.1| Arabidopsis thaliana At5g49270 gene, complete cds Length = 1992 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccgattt 161 ||||||||||||||||| ||||||| Sbjct: 94 ccggcaccggcaccggccccgattt 118
>gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosome 12, complete sequence Length = 215502 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108926 ccggcaccggcaccggcaccg 108906 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108920 ccggcaccggcaccggcaccg 108900 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108914 ccggcaccggcaccggcaccg 108894 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108908 ccggcaccggcaccggcaccg 108888 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108902 ccggcaccggcaccggcaccg 108882 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108896 ccggcaccggcaccggcaccg 108876 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 108890 ccggcaccggcaccggcaccg 108870 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 108884 ccggcaccggcaccggcacc 108865
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 140 gcaccggcaccggcaccgatt 160 ||||||||||||||||||||| Sbjct: 3617375 gcaccggcaccggcaccgatt 3617395
>gb|AC132275.4| Mus musculus BAC clone RP24-341P14 from chromosome 3, complete sequence Length = 174425 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 62427 ccggcaccggcaccggcaccg 62407 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 62421 ccggcaccggcaccggcaccg 62401 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 62415 ccggcaccggcaccggcaccg 62395 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 62409 ccggcaccggcaccggcaccg 62389 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 62432 cggcaccggcaccggcaccg 62413
>gb|AF480446.1| Ustilago maydis kinesin (kin3) gene, complete cds Length = 9455 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 6415 ccggcaccggcaccggcaccg 6435
>gb|AE012045.1| Xanthomonas axonopodis pv. citri str. 306, section 423 of 469 of the complete genome Length = 11318 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1010 ccggcaccggcaccggcaccg 990 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1004 ccggcaccggcaccggcaccg 984
>gb|AE011897.1| Xanthomonas axonopodis pv. citri str. 306, section 275 of 469 of the complete genome Length = 12531 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 9118 ccggcaccggcaccggcaccg 9098
>gb|AY097390.1| Arabidopsis thaliana At2g23310/T20D16.6 mRNA, complete cds Length = 639 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 31 ccggcagccgccgccaccacc 51
>ref|NM_168748.1| Drosophila melanogaster CG32186-RA (CG32186), mRNA Length = 4788 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 4607 ccggcaccggcaccggcaccg 4627
>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 Length = 1913118 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 421 agccgccgccaccaccaccgc 441 ||||||||||||||||||||| Sbjct: 1657525 agccgccgccaccaccaccgc 1657545
>gb|AC002391.3| Arabidopsis thaliana chromosome 2 clone T20D16 map CIC06C07, complete sequence Length = 108881 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 33764 ccggcagccgccgccaccacc 33744
>gb|AC009375.8| Drosophila melanogaster 3L BAC RP98-44L18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 180787 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 140052 ccggcaccggcaccggcaccg 140032
>ref|NM_079093.2| Drosophila melanogaster Fibrillarin CG9888-RA (Fib), mRNA Length = 1331 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 417 cggcagccgccgccaccaccaccgc 441 |||| |||||||||||||||||||| Sbjct: 338 cggccgccgccgccaccaccaccgc 314
>dbj|AK136094.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length enriched library, clone:7420455J15 product:suppressor of Ty 6 homolog (S. cerevisiae), full insert sequence Length = 1523 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 687 gcagccgccgccaccaccacc 667
>dbj|AK140704.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930099F11 product:dedicator of cytokinesis 4, full insert sequence Length = 1911 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 1414 ccggcaccggcaccggcaccg 1394
>dbj|AK154012.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430022E15 product:RAB6, member RAS oncogene family, full insert sequence Length = 2017 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 126 gcagccgccgccgccaccaccgcag 102
>gb|AC106786.2| Homo sapiens chromosome 5 clone RP11-359P5, complete sequence Length = 107238 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 67785 gccgccgccaccaccaccgca 67765
>gb|AY069898.1| Arabidopsis thaliana At2g23310/T20D16.6 mRNA, complete cds Length = 1013 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 127 ccggcagccgccgccaccacc 147
>dbj|AK160134.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1500041A16 product:RAB6, member RAS oncogene family, full insert sequence Length = 1999 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 108 gcagccgccgccgccaccaccgcag 84
>gb|AY034099.1| Arabidopsis thaliana CBL-interacting protein kinase 18 (CIPK18) mRNA, complete cds Length = 1563 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 60 gccgccgccaccaccaccgca 80
>dbj|AK169842.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430037D24 product:RAB6, member RAS oncogene family, full insert sequence Length = 3215 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 230 gcagccgccgccgccaccaccgcag 206
>dbj|AK160866.1| Mus musculus adult male brain cDNA, RIKEN full-length enriched library, clone:3632431I17 product:RAB6, member RAS oncogene family, full insert sequence Length = 3021 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 37 gcagccgccgccgccaccaccgcag 13
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccga 158 ||||||||||||||||||||| Sbjct: 4530736 cggcaccggcaccggcaccga 4530756 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3279683 ccggcaccggcaccggcaccg 3279663 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 3089138 ccggcaccggcaccggcaccg 3089158 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 793142 ccggcaccggcaccggcaccg 793162 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 793136 ccggcaccggcaccggcaccg 793156 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 700982 ccggcaccggcaccggcaccg 701002 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 700976 ccggcaccggcaccggcaccg 700996 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 3946830 ccggcaccggcaccggcacc 3946849 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 139 ggcaccggcaccggcaccga 158 |||||||||||||||||||| Sbjct: 3745683 ggcaccggcaccggcaccga 3745664 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 tcccggcaccggcaccggca 154 |||||||||||||||||||| Sbjct: 2672927 tcccggcaccggcaccggca 2672946 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 868348 ccggcaccggcaccggcacc 868367 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 793131 cggcaccggcaccggcaccg 793150
>dbj|AK163672.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930001B17 product:dedicator of cytokinesis 4, full insert sequence Length = 2223 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 449 ccggcaccggcaccggcaccg 429
>dbj|AK170533.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630107A01 product:suppressor of Ty 6 homolog (S. cerevisiae), full insert sequence Length = 5103 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 46 gcagccgccgccaccaccacc 26
>gb|AC097674.6| Rattus norvegicus 2 CH230-75D18 (Children's Hospital Oakland Research Institute) complete sequence Length = 227596 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188636 ccggcaccggcaccggcaccg 188656 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188630 ccggcaccggcaccggcaccg 188650 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188624 ccggcaccggcaccggcaccg 188644 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188618 ccggcaccggcaccggcaccg 188638 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188612 ccggcaccggcaccggcaccg 188632 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188606 ccggcaccggcaccggcaccg 188626 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188600 ccggcaccggcaccggcaccg 188620 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188594 ccggcaccggcaccggcaccg 188614 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188588 ccggcaccggcaccggcaccg 188608 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 188582 ccggcaccggcaccggcaccg 188602 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 188642 ccggcaccggcaccggcacc 188661
>dbj|AK084131.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130097N11 product:RAS-RELATED PROTEIN RAB-6A homolog [Mus musculus], full insert sequence Length = 1928 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 37 gcagccgccgccgccaccaccgcag 13
>dbj|AK051246.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130023A03 product:RAB6, member RAS oncogene family, full insert sequence Length = 1955 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 64 gcagccgccgccgccaccaccgcag 40
>dbj|AK083262.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630031P05 product:RAB6, member RAS oncogene family, full insert sequence Length = 3404 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccaccgcag 443 |||||||||||| |||||||||||| Sbjct: 53 gcagccgccgccgccaccaccgcag 29
>gb|AF155509.1|AF155509 Xenopus laevis seven in absentia-like protein (Siah-2) mRNA, complete cds Length = 1509 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 109 gcagccgccgccaccaccacc 129
>dbj|AK015465.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930455H04 product:unclassifiable, full insert sequence Length = 1342 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 179 ccggcaccggcaccggcaccg 159 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 173 ccggcaccggcaccggcaccg 153 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 167 ccggcaccggcaccggcaccg 147 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 161 ccggcaccggcaccggcaccg 141 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 184 cggcaccggcaccggcaccg 165
>dbj|AK043695.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830021E16 product:unclassifiable, full insert sequence Length = 2781 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 319 ccggcaccggcaccggcaccg 339 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 313 ccggcaccggcaccggcaccg 333 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 307 ccggcaccggcaccggcaccg 327 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 301 ccggcaccggcaccggcaccg 321 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 296 cggcaccggcaccggcaccg 315
>dbj|AK017210.1| Mus musculus 10 days neonate intestine cDNA, RIKEN full-length enriched library, clone:5131400N11 product:unclassifiable, full insert sequence Length = 2369 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 315 gcagccgccgccaccaccacc 295
>gb|AC008352.2|AC008352 Drosophila melanogaster, chromosome 2R, region 59C-59D, BAC clone BACR08P09, complete sequence Length = 181463 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 417 cggcagccgccgccaccaccaccgc 441 |||| |||||||||||||||||||| Sbjct: 112552 cggccgccgccgccaccaccaccgc 112576
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 425 gccgccaccaccaccgcagga 445 ||||||||||||||||||||| Sbjct: 14500305 gccgccaccaccaccgcagga 14500325 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 474 ctccgtcgccggcgccgtcgtcgcg 498 ||||||||||| ||||||||||||| Sbjct: 10363989 ctccgtcgccgccgccgtcgtcgcg 10364013 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 415 gccggcagccgccgccaccaccac 438 |||||| ||||||||||||||||| Sbjct: 25815016 gccggcggccgccgccaccaccac 25814993
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 24481765 ccggcaccggcaccggcaccg 24481785 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 423 ccgccgccaccaccaccgcaggat 446 ||||||||||||||||||| |||| Sbjct: 18213015 ccgccgccaccaccaccgctggat 18213038 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 15521236 gccgccgccaccaccaccgc 15521217 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 atggccgccgcggcagcagc 185 |||||||||||||||||||| Sbjct: 251818 atggccgccgcggcagcagc 251837
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 465 cgtcacgctctccgtcgccggcgcc 489 ||||||||||| ||||||||||||| Sbjct: 29667507 cgtcacgctctgcgtcgccggcgcc 29667531 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 22419114 gccgccgccaccaccaccgc 22419095 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 20558595 gccgccgccaccaccaccgc 20558614 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 420 cagccgccgccaccaccacc 439 |||||||||||||||||||| Sbjct: 1549535 cagccgccgccaccaccacc 1549554
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 25742248 ccggcaccggcaccggcaccg 25742268 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 18743538 gccgccgccaccaccaccgc 18743519 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 18131531 gccgccgccaccaccaccgc 18131550 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 18106248 gccgccgccaccaccaccgc 18106267 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 17520495 cggcaccggcaccggcaccg 17520514
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ccgtcgccggcgccgtcgtcg 496 ||||||||||||||||||||| Sbjct: 28265003 ccgtcgccggcgccgtcgtcg 28265023 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 169 gccgccgcggcagcagctgccgcgtccgcgtcg 201 ||||||||||||||||| | |||||| |||||| Sbjct: 15859602 gccgccgcggcagcagcaggcgcgtcggcgtcg 15859634 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cgtcgccggcgccgtcgtcgc 497 ||||||||||||||||||||| Sbjct: 2875108 cgtcgccggcgccgtcgtcgc 2875128 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 35397162 gccgccgccaccaccaccgc 35397181 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgc 441 |||||||||||||||||||| Sbjct: 27758738 gccgccgccaccaccaccgc 27758719 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 476 ccgtcgccggcgccgtcgtcgcgc 499 ||||||||| |||||||||||||| Sbjct: 24953842 ccgtcgccgccgccgtcgtcgcgc 24953865
>gb|AF204951.2|AF204951 Ectocarpus siliculosus virus, complete genome Length = 335593 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 227042 ccggcaccggcaccggcaccg 227022 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcacc 156 |||||||||||||||||||| Sbjct: 227036 ccggcaccggcaccggcacc 227017
>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence Length = 229269 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 92907 gcagccgccgccaccaccacc 92927
>gb|AF154645.1| Nicotiana tabacum clone PR26 mRNA sequence Length = 1141 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 92 ccggcaccggcaccggcaccg 112
>ref|XM_225008.3| PREDICTED: Rattus norvegicus MYST histone acetyltransferase (monocytic leukemia) 3 (predicted) (Myst3_predicted), mRNA Length = 5997 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 4920 gcagccgccgccaccaccacc 4940
>gb|AY086455.1| Arabidopsis thaliana clone 25204 mRNA, complete sequence Length = 1060 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 416 ccggcagccgccgccaccacc 436 ||||||||||||||||||||| Sbjct: 154 ccggcagccgccgccaccacc 174
>gb|AY190941.1| Drosophila erecta clone DERF01_12_N08 (D1431) genomic sequence Length = 43101 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 417 cggcagccgccgccaccaccaccgc 441 |||| |||||||||||||||||||| Sbjct: 28719 cggccgccgccgccaccaccaccgc 28743
>gb|AC021043.4|AC021043 Arabidopsis thaliana chromosome I BAC F28N24 genomic sequence, complete sequence Length = 154716 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 48471 gccgccgccaccaccaccgca 48451
>dbj|AP000836.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0038F12 Length = 190014 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 170979 ccggcaccggcaccggcaccg 170959
>gb|AC008548.6| Homo sapiens chromosome 5 clone CTC-505D13, complete sequence Length = 116730 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 6925 gccgccgccaccaccaccgca 6905
>gb|AF272899.1|AF272899 Homo sapiens PR-domain zinc finger protein 6 isoform B (PRDM6) mRNA, partial cds; alternatively spliced Length = 2374 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 507 gccgccgccaccaccaccgca 487
>gb|AF272898.1|AF272898 Homo sapiens PR-domain zinc finger protein 6 isoform A (PRDM6) mRNA, partial cds; alternatively spliced Length = 2627 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 gccgccgccaccaccaccgca 442 ||||||||||||||||||||| Sbjct: 507 gccgccgccaccaccaccgca 487
>dbj|AP004131.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1057_F01 Length = 120026 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 169 gccgccgcggcagcagctgccgcgtccgcgtcg 201 ||||||||||||||||| | |||||| |||||| Sbjct: 3277 gccgccgcggcagcagcaggcgcgtcggcgtcg 3309
>dbj|AB195309.1| Rattus norvegicus MOZ mRNA for monocytic leukemia zinc finger protein, partial cds Length = 5978 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 419 gcagccgccgccaccaccacc 439 ||||||||||||||||||||| Sbjct: 4901 gcagccgccgccaccaccacc 4921
>dbj|AP005463.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0712G01 Length = 87056 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 465 cgtcacgctctccgtcgccggcgcc 489 ||||||||||| ||||||||||||| Sbjct: 40621 cgtcacgctctgcgtcgccggcgcc 40645
>dbj|AP004329.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1663_H12 Length = 125422 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 465 cgtcacgctctccgtcgccggcgcc 489 ||||||||||| ||||||||||||| Sbjct: 111092 cgtcacgctctgcgtcgccggcgcc 111116
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 188 ccgcgtccgcgtcgccgtcga 208 ||||||||||||||||||||| Sbjct: 4317027 ccgcgtccgcgtcgccgtcga 4317007
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cgtcgccggcgccgtcgtcgc 497 ||||||||||||||||||||| Sbjct: 4317530 cgtcgccggcgccgtcgtcgc 4317550
>gb|AF225924.1|AF225924 Drosophila virilis staufen gene, complete cds Length = 8409 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 424 cgccgccaccaccaccgcagg 444 ||||||||||||||||||||| Sbjct: 2941 cgccgccaccaccaccgcagg 2961
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 344 tcgcctcctgcggcaccgcct 364 ||||||||||||||||||||| Sbjct: 1652052 tcgcctcctgcggcaccgcct 1652072 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 876240 ccggcaccggcaccggcaccg 876260 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 484 ggcgccgtcgtcgcgcgcaccgccgtca 511 ||||||| | |||||||||||||||||| Sbjct: 295848 ggcgccgacatcgcgcgcaccgccgtca 295875
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0050G13 Length = 150685 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cgtcgccggcgccgtcgtcgc 497 ||||||||||||||||||||| Sbjct: 143336 cgtcgccggcgccgtcgtcgc 143356
>dbj|AP007224.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0463E12 Length = 161081 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 cgtcgccggcgccgtcgtcgc 497 ||||||||||||||||||||| Sbjct: 747 cgtcgccggcgccgtcgtcgc 767
>dbj|AP004230.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ2013_G04 Length = 73667 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 31575 ccggcaccggcaccggcaccg 31595
>dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1342_D02 Length = 125460 Score = 42.1 bits (21), Expect = 1.8 Identities = 30/33 (90%) Strand = Plus / Plus Query: 169 gccgccgcggcagcagctgccgcgtccgcgtcg 201 ||||||||||||||||| | |||||| |||||| Sbjct: 117542 gccgccgcggcagcagcaggcgcgtcggcgtcg 117574
>dbj|AK109421.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-E04, full insert sequence Length = 1402 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 425 gccgccaccaccaccgcagga 445 ||||||||||||||||||||| Sbjct: 653 gccgccaccaccaccgcagga 673
>dbj|AB016872.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21P3 Length = 86001 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccgattt 161 ||||||||||||||||| ||||||| Sbjct: 52414 ccggcaccggcaccggccccgattt 52390
>dbj|AP004096.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1743_B12 Length = 175645 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ccgtcgccggcgccgtcgtcg 496 ||||||||||||||||||||| Sbjct: 56760 ccgtcgccggcgccgtcgtcg 56780
>dbj|AK121236.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023094P08, full insert sequence Length = 2301 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 465 cgtcacgctctccgtcgccggcgcc 489 ||||||||||| ||||||||||||| Sbjct: 151 cgtcacgctctgcgtcgccggcgcc 175
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2007 ccggcaccggcaccggcaccg 2027 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 2001 ccggcaccggcaccggcaccg 2021 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 cggcaccggcaccggcaccg 157 |||||||||||||||||||| Sbjct: 1996 cggcaccggcaccggcaccg 2015
>emb|X97916.1|HVBLT141 H.vulgare blt14.1 gene Length = 963 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 137 ccggcaccggcaccggcaccg 157 ||||||||||||||||||||| Sbjct: 542 ccggcaccggcaccggcaccg 522 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,747,788 Number of Sequences: 3902068 Number of extensions: 4747788 Number of successful extensions: 145996 Number of sequences better than 10.0: 653 Number of HSP's better than 10.0 without gapping: 688 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 128633 Number of HSP's gapped (non-prelim): 17160 length of query: 534 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 511 effective length of database: 17,143,297,704 effective search space: 8760225126744 effective search space used: 8760225126744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)