ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart29g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA 708 0.0
2ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group... 708 0.0
3ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group... 708 0.0
4ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group... 708 0.0
5dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clon... 708 0.0
6dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clon... 708 0.0
7dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 708 0.0
8dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clon... 708 0.0
9gb|AY105034.1| Zea mays PCO130341 mRNA sequence 569 e-159
10gb|BT016512.1| Zea mays clone Contig345 mRNA sequence 561 e-157
11dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clon... 486 e-134
12dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clon... 486 e-134
13dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 486 e-134
14dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 365 1e-97
15dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic D... 365 1e-97
16ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predic... 347 3e-92
17dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 3e-92
18dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 3e-92
19dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 3e-92
20dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 3e-92
21gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p... 343 4e-91
22gb|BT016485.1| Zea mays clone Contig318 mRNA sequence 325 9e-86
23gb|BT016521.1| Zea mays clone Contig354 mRNA sequence 317 2e-83
24gb|AY103617.1| Zea mays PCO143386 mRNA sequence 317 2e-83
25gb|BT016624.1| Zea mays clone Contig457 mRNA sequence 280 5e-72
26dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complet... 270 5e-69
27dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 7e-62
28gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein m... 242 1e-60
29gb|AF097522.1|AF097522 Brassica napus laminin receptor-like prot... 236 7e-59
30gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associate... 234 3e-58
31ref|NM_001036190.1| Arabidopsis thaliana P40; structural constit... 230 4e-57
32ref|NM_105896.2| Arabidopsis thaliana P40; structural constituen... 230 4e-57
33gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal prote... 230 4e-57
34emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue 230 4e-57
35gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal prote... 230 4e-57
36gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal prote... 230 4e-57
37gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 230 4e-57
38gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal prote... 230 4e-57
39gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 230 4e-57
40gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 230 4e-57
41emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Co... 230 4e-57
42emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Co... 230 4e-57
43gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete s... 230 4e-57
44gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin recep... 230 4e-57
45emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associa... 222 1e-54
46gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence 194 2e-46
47gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence 194 2e-46
48emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40 184 2e-43
49emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene 184 2e-43
50gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10... 184 2e-43
51ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constitu... 172 8e-40
52ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constitu... 172 8e-40
53gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal prote... 172 8e-40
54gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, com... 172 8e-40
55gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete s... 172 8e-40
56gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mR... 172 8e-40
57gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC... 167 5e-38
58gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 165 2e-37
59gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon... 165 2e-37
60dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
61gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ... 143 7e-31
62gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se... 143 7e-31
63emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Co... 123 7e-25
64dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
65gb|BT017775.1| Zea mays clone EL01N0502H12.c mRNA sequence 98 4e-17
66gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb... 76 1e-10
67gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA 66 1e-07
68gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence 66 1e-07
69gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence 66 1e-07
70emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7 66 1e-07
71gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ... 66 1e-07
72gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA 66 1e-07
73gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA 66 1e-07
74ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, ... 66 1e-07
75ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, ... 66 1e-07
76gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end 66 1e-07
77ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, ... 66 1e-07
78gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 66 1e-07
79gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k1... 66 1e-07
80dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, parti... 66 1e-07
81emb|BX071203.1|CNS09R3R Single read from an extremity of a full-... 62 2e-06
82emb|BX070730.1|CNS09QQM Single read from an extremity of a full-... 62 2e-06
83emb|BX065339.1|CNS09MKV Single read from an extremity of a full-... 62 2e-06
84emb|BX064723.1|CNS09M3R Single read from an extremity of a full-... 62 2e-06
85emb|BX060291.1|CNS09ION Single read from an extremity of a full-... 62 2e-06
86emb|BX059559.1|CNS09I4B Single read from an extremity of a full-... 62 2e-06
87emb|BX058144.1|CNS09H10 Single read from an extremity of a full-... 62 2e-06
88emb|BX056920.1|CNS09G30 Single read from an extremity of a full-... 62 2e-06
89emb|BX056337.1|CNS09FMT Single read from an extremity of a full-... 62 2e-06
90emb|BX056336.1|CNS09FMS Single read from an extremity of a full-... 62 2e-06
91emb|BX055751.1|CNS09F6J Single read from an extremity of a full-... 62 2e-06
92emb|BX052800.1|CNS09CWK Single read from an extremity of a full-... 62 2e-06
93emb|BX049604.1|CNS09AFS Single read from an extremity of a full-... 62 2e-06
94emb|BX042876.1|CNS0958W Single read from an extremity of a full-... 62 2e-06
95emb|BX036246.1|CNS0904Q Single read from an extremity of a full-... 62 2e-06
96emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-... 62 2e-06
97emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-... 62 2e-06
98emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-... 62 2e-06
99emb|BX025854.1|CNS08S42 Single read from an extremity of a full-... 62 2e-06
100emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-... 62 2e-06
101emb|BX020718.1|CNS08O5E Single read from an extremity of a full-... 62 2e-06
102emb|BX015795.1|CNS08KCN Single read from an extremity of a full-... 62 2e-06
103emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-... 62 2e-06
104emb|BX015037.1|CNS08JRL Single read from an extremity of a full-... 62 2e-06
105emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-... 62 2e-06
106emb|BX012242.1|CNS08HLY Single read from an extremity of a full-... 62 2e-06
107emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-... 62 2e-06
108emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-... 62 2e-06
109ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 ... 62 2e-06
110emb|BX006256.1|CNS08CZO Single read from an extremity of a full-... 58 3e-05
111gb|AY857457.1| Suberites domuncula SA mRNA, complete cds 56 1e-04
112emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-... 54 5e-04
113emb|BX053371.1|CNS09DCF Single read from an extremity of a full-... 54 5e-04
114emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-... 54 5e-04
115emb|BX071531.1|CNS09RCV Single read from an extremity of a full-... 54 5e-04
116emb|BX071128.1|CNS09R1O Single read from an extremity of a full-... 54 5e-04
117emb|BX071053.1|CNS09QZL Single read from an extremity of a full-... 54 5e-04
118emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-... 54 5e-04
119emb|BX070261.1|CNS09QDL Single read from an extremity of a full-... 54 5e-04
120emb|BX070237.1|CNS09QCX Single read from an extremity of a full-... 54 5e-04
121emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-... 54 5e-04
122emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-... 54 5e-04
123emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-... 54 5e-04
124emb|BX069252.1|CNS09PLK Single read from an extremity of a full-... 54 5e-04
125emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-... 54 5e-04
126emb|BX068381.1|CNS09OXD Single read from an extremity of a full-... 54 5e-04
127emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-... 54 5e-04
128emb|BX067522.1|CNS09O9I Single read from an extremity of a full-... 54 5e-04
129emb|BX067353.1|CNS09O4T Single read from an extremity of a full-... 54 5e-04
130emb|BX067352.1|CNS09O4S Single read from an extremity of a full-... 54 5e-04
131emb|BX067347.1|CNS09O4N Single read from an extremity of a full-... 54 5e-04
132emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-... 54 5e-04
133emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-... 54 5e-04
134emb|BX067213.1|CNS09O0X Single read from an extremity of a full-... 54 5e-04
135emb|BX066172.1|CNS09N80 Single read from an extremity of a full-... 54 5e-04
136emb|BX065840.1|CNS09MYS Single read from an extremity of a full-... 54 5e-04
137emb|BX065656.1|CNS09MTO Single read from an extremity of a full-... 54 5e-04
138emb|BX065484.1|CNS09MOW Single read from an extremity of a full-... 54 5e-04
139emb|BX064630.1|CNS09M16 Single read from an extremity of a full-... 54 5e-04
140emb|BX064621.1|CNS09M0X Single read from an extremity of a full-... 54 5e-04
141emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-... 54 5e-04
142emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-... 54 5e-04
143emb|BX063172.1|CNS09KWO Single read from an extremity of a full-... 54 5e-04
144emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-... 54 5e-04
145emb|BX062187.1|CNS09K5B Single read from an extremity of a full-... 54 5e-04
146emb|BX061828.1|CNS09JVC Single read from an extremity of a full-... 54 5e-04
147emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-... 54 5e-04
148emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-... 54 5e-04
149emb|BX061413.1|CNS09JJT Single read from an extremity of a full-... 54 5e-04
150emb|BX061395.1|CNS09JJB Single read from an extremity of a full-... 54 5e-04
151emb|BX060764.1|CNS09J1S Single read from an extremity of a full-... 54 5e-04
152emb|BX060566.1|CNS09IWA Single read from an extremity of a full-... 54 5e-04
153emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-... 54 5e-04
154emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-... 54 5e-04
155emb|BX060009.1|CNS09IGT Single read from an extremity of a full-... 54 5e-04
156emb|BX059650.1|CNS09I6U Single read from an extremity of a full-... 54 5e-04
157emb|BX059479.1|CNS09I23 Single read from an extremity of a full-... 54 5e-04
158emb|BX059203.1|CNS09HUF Single read from an extremity of a full-... 54 5e-04
159emb|BX059202.1|CNS09HUE Single read from an extremity of a full-... 54 5e-04
160emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-... 54 5e-04
161emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-... 54 5e-04
162emb|BX058368.1|CNS09H78 Single read from an extremity of a full-... 54 5e-04
163emb|BX058299.1|CNS09H5B Single read from an extremity of a full-... 54 5e-04
164emb|BX058273.1|CNS09H4L Single read from an extremity of a full-... 54 5e-04
165emb|BX058069.1|CNS09GYX Single read from an extremity of a full-... 54 5e-04
166emb|BX056716.1|CNS09FXC Single read from an extremity of a full-... 54 5e-04
167emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-... 54 5e-04
168emb|BX057691.1|CNS09GOF Single read from an extremity of a full-... 54 5e-04
169emb|BX057689.1|CNS09GOD Single read from an extremity of a full-... 54 5e-04
170emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-... 54 5e-04
171emb|BX057084.1|CNS09G7K Single read from an extremity of a full-... 54 5e-04
172emb|BX056570.1|CNS09FTA Single read from an extremity of a full-... 54 5e-04
173emb|BX056269.1|CNS09FKX Single read from an extremity of a full-... 54 5e-04
174emb|BX056116.1|CNS09FGO Single read from an extremity of a full-... 54 5e-04
175emb|BX056090.1|CNS09FFY Single read from an extremity of a full-... 54 5e-04
176emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-... 54 5e-04
177emb|BX054928.1|CNS09EJO Single read from an extremity of a full-... 54 5e-04
178emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-... 54 5e-04
179emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-... 54 5e-04
180emb|BX053590.1|CNS09DII Single read from an extremity of a full-... 54 5e-04
181emb|BX052798.1|CNS09CWI Single read from an extremity of a full-... 54 5e-04
182emb|BX052551.1|CNS09CPN Single read from an extremity of a full-... 54 5e-04
183emb|BX052477.1|CNS09CNL Single read from an extremity of a full-... 54 5e-04
184emb|BX052476.1|CNS09CNK Single read from an extremity of a full-... 54 5e-04
185emb|BX051837.1|CNS09C5T Single read from an extremity of a full-... 54 5e-04
186emb|BX051209.1|CNS09BOD Single read from an extremity of a full-... 54 5e-04
187emb|BX049918.1|CNS09AOI Single read from an extremity of a full-... 54 5e-04
188emb|BX049879.1|CNS09ANF Single read from an extremity of a full-... 54 5e-04
189emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-... 54 5e-04
190emb|BX049364.1|CNS09A94 Single read from an extremity of a full-... 54 5e-04
191emb|BX049219.1|CNS09A53 Single read from an extremity of a full-... 54 5e-04
192emb|BX049063.1|CNS09A0R Single read from an extremity of a full-... 54 5e-04
193emb|BX048945.1|CNS099XH Single read from an extremity of a full-... 54 5e-04
194emb|BX048268.1|CNS099EO Single read from an extremity of a full-... 54 5e-04
195emb|BX047396.1|CNS098QG Single read from an extremity of a full-... 54 5e-04
196emb|BX046740.1|CNS09888 Single read from an extremity of a full-... 54 5e-04
197emb|BX046217.1|CNS097TP Single read from an extremity of a full-... 54 5e-04
198emb|BX046120.1|CNS097R0 Single read from an extremity of a full-... 54 5e-04
199emb|BX045820.1|CNS097IO Single read from an extremity of a full-... 54 5e-04
200emb|BX045707.1|CNS097FJ Single read from an extremity of a full-... 54 5e-04
201emb|BX044948.1|CNS096UG Single read from an extremity of a full-... 54 5e-04
202emb|BX044495.1|CNS096HV Single read from an extremity of a full-... 54 5e-04
203emb|BX043740.1|CNS095WW Single read from an extremity of a full-... 54 5e-04
204emb|BX043445.1|CNS095OP Single read from an extremity of a full-... 54 5e-04
205emb|BX043330.1|CNS095LI Single read from an extremity of a full-... 54 5e-04
206emb|BX042850.1|CNS09586 Single read from an extremity of a full-... 54 5e-04
207emb|BX042652.1|CNS0952O Single read from an extremity of a full-... 54 5e-04
208emb|BX042358.1|CNS094UI Single read from an extremity of a full-... 54 5e-04
209emb|BX042337.1|CNS094TX Single read from an extremity of a full-... 54 5e-04
210emb|BX041420.1|CNS0944G Single read from an extremity of a full-... 54 5e-04
211emb|BX041297.1|CNS09411 Single read from an extremity of a full-... 54 5e-04
212emb|BX041242.1|CNS093ZI Single read from an extremity of a full-... 54 5e-04
213emb|BX039405.1|CNS092KH Single read from an extremity of a full-... 54 5e-04
214emb|BX039319.1|CNS092I3 Single read from an extremity of a full-... 54 5e-04
215emb|BX037243.1|CNS090WF Single read from an extremity of a full-... 54 5e-04
216emb|BX036479.1|CNS090B7 Single read from an extremity of a full-... 54 5e-04
217emb|BX036426.1|CNS0909Q Single read from an extremity of a full-... 54 5e-04
218emb|BX036415.1|CNS0909F Single read from an extremity of a full-... 54 5e-04
219emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-... 54 5e-04
220emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-... 54 5e-04
221emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-... 54 5e-04
222emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-... 54 5e-04
223emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-... 54 5e-04
224emb|BX034628.1|CNS08YVS Single read from an extremity of a full-... 54 5e-04
225emb|BX034627.1|CNS08YVR Single read from an extremity of a full-... 54 5e-04
226emb|BX034339.1|CNS08YNR Single read from an extremity of a full-... 54 5e-04
227emb|BX034214.1|CNS08YKA Single read from an extremity of a full-... 54 5e-04
228emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-... 54 5e-04
229emb|BX033175.1|CNS08XRF Single read from an extremity of a full-... 54 5e-04
230emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-... 54 5e-04
231emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-... 54 5e-04
232emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-... 54 5e-04
233emb|BX032290.1|CNS08X2U Single read from an extremity of a full-... 54 5e-04
234emb|BX032289.1|CNS08X2T Single read from an extremity of a full-... 54 5e-04
235emb|BX032041.1|CNS08WVX Single read from an extremity of a full-... 54 5e-04
236emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-... 54 5e-04
237emb|BX031898.1|CNS08WRY Single read from an extremity of a full-... 54 5e-04
238emb|BX031717.1|CNS08WMX Single read from an extremity of a full-... 54 5e-04
239emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-... 54 5e-04
240emb|BX031483.1|CNS08WGF Single read from an extremity of a full-... 54 5e-04
241emb|BX031337.1|CNS08WCD Single read from an extremity of a full-... 54 5e-04
242emb|BX031303.1|CNS08WBF Single read from an extremity of a full-... 54 5e-04
243emb|BX030674.1|CNS08VTY Single read from an extremity of a full-... 54 5e-04
244emb|BX031154.1|CNS08W7A Single read from an extremity of a full-... 54 5e-04
245emb|BX031118.1|CNS08W6A Single read from an extremity of a full-... 54 5e-04
246emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-... 54 5e-04
247emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-... 54 5e-04
248emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-... 54 5e-04
249emb|BX029939.1|CNS08V9J Single read from an extremity of a full-... 54 5e-04
250emb|BX029906.1|CNS08V8M Single read from an extremity of a full-... 54 5e-04
251emb|BX029898.1|CNS08V8E Single read from an extremity of a full-... 54 5e-04
252emb|BX029447.1|CNS08UVV Single read from an extremity of a full-... 54 5e-04
253emb|BX028713.1|CNS08UBH Single read from an extremity of a full-... 54 5e-04
254emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-... 54 5e-04
255emb|BX028388.1|CNS08U2G Single read from an extremity of a full-... 54 5e-04
256emb|BX028172.1|CNS08TWG Single read from an extremity of a full-... 54 5e-04
257emb|BX027823.1|CNS08TMR Single read from an extremity of a full-... 54 5e-04
258emb|BX027638.1|CNS08THM Single read from an extremity of a full-... 54 5e-04
259emb|BX027470.1|CNS08TCY Single read from an extremity of a full-... 54 5e-04
260emb|BX026965.1|CNS08SYX Single read from an extremity of a full-... 54 5e-04
261emb|BX026808.1|CNS08SUK Single read from an extremity of a full-... 54 5e-04
262emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-... 54 5e-04
263emb|BX026536.1|CNS08SN0 Single read from an extremity of a full-... 54 5e-04
264emb|BX026482.1|CNS08SLI Single read from an extremity of a full-... 54 5e-04
265emb|BX026481.1|CNS08SLH Single read from an extremity of a full-... 54 5e-04
266emb|BX025749.1|CNS08S15 Single read from an extremity of a full-... 54 5e-04
267emb|BX025670.1|CNS08RYY Single read from an extremity of a full-... 54 5e-04
268emb|BX025450.1|CNS08RSU Single read from an extremity of a full-... 54 5e-04
269emb|BX025107.1|CNS08RJB Single read from an extremity of a full-... 54 5e-04
270emb|BX025103.1|CNS08RJ7 Single read from an extremity of a full-... 54 5e-04
271emb|BX024846.1|CNS08RC2 Single read from an extremity of a full-... 54 5e-04
272emb|BX024832.1|CNS08RBO Single read from an extremity of a full-... 54 5e-04
273emb|BX024754.1|CNS08R9I Single read from an extremity of a full-... 54 5e-04
274emb|BX024652.1|CNS08R6O Single read from an extremity of a full-... 54 5e-04
275emb|BX024344.1|CNS08QY4 Single read from an extremity of a full-... 54 5e-04
276emb|BX024069.1|CNS08QQH Single read from an extremity of a full-... 54 5e-04
277emb|BX024000.1|CNS08QOK Single read from an extremity of a full-... 54 5e-04
278emb|BX023999.1|CNS08QOJ Single read from an extremity of a full-... 54 5e-04
279emb|BX023957.1|CNS08QND Single read from an extremity of a full-... 54 5e-04
280emb|BX023956.1|CNS08QNC Single read from an extremity of a full-... 54 5e-04
281emb|BX023909.1|CNS08QM1 Single read from an extremity of a full-... 54 5e-04
282emb|BX023824.1|CNS08QJO Single read from an extremity of a full-... 54 5e-04
283emb|BX023742.1|CNS08QHE Single read from an extremity of a full-... 54 5e-04
284emb|BX023643.1|CNS08QEN Single read from an extremity of a full-... 54 5e-04
285emb|BX023296.1|CNS08Q50 Single read from an extremity of a full-... 54 5e-04
286emb|BX023108.1|CNS08PZS Single read from an extremity of a full-... 54 5e-04
287emb|BX022975.1|CNS08PW3 Single read from an extremity of a full-... 54 5e-04
288emb|BX021908.1|CNS08P2G Single read from an extremity of a full-... 54 5e-04
289emb|BX021737.1|CNS08OXP Single read from an extremity of a full-... 54 5e-04
290emb|BX021571.1|CNS08OT3 Single read from an extremity of a full-... 54 5e-04
291emb|BX021462.1|CNS08OQ2 Single read from an extremity of a full-... 54 5e-04
292emb|BX021331.1|CNS08OMF Single read from an extremity of a full-... 54 5e-04
293emb|BX020818.1|CNS08O86 Single read from an extremity of a full-... 54 5e-04
294emb|BX020770.1|CNS08O6U Single read from an extremity of a full-... 54 5e-04
295emb|BX020438.1|CNS08NXM Single read from an extremity of a full-... 54 5e-04
296emb|BX019922.1|CNS08NJA Single read from an extremity of a full-... 54 5e-04
297emb|BX019254.1|CNS08N0Q Single read from an extremity of a full-... 54 5e-04
298emb|BX019220.1|CNS08MZS Single read from an extremity of a full-... 54 5e-04
299emb|BX018801.1|CNS08MO5 Single read from an extremity of a full-... 54 5e-04
300emb|BX018535.1|CNS08MGR Single read from an extremity of a full-... 54 5e-04
301emb|BX017379.1|CNS08LKN Single read from an extremity of a full-... 54 5e-04
302emb|BX017311.1|CNS08LIR Single read from an extremity of a full-... 54 5e-04
303emb|BX017271.1|CNS08LHN Single read from an extremity of a full-... 54 5e-04
304emb|BX017270.1|CNS08LHM Single read from an extremity of a full-... 54 5e-04
305emb|BX016954.1|CNS08L8U Single read from an extremity of a full-... 54 5e-04
306emb|BX016896.1|CNS08L78 Single read from an extremity of a full-... 54 5e-04
307emb|BX016856.1|CNS08L64 Single read from an extremity of a full-... 54 5e-04
308emb|BX016665.1|CNS08L0T Single read from an extremity of a full-... 54 5e-04
309emb|BX015859.1|CNS08KEF Single read from an extremity of a full-... 54 5e-04
310emb|BX015858.1|CNS08KEE Single read from an extremity of a full-... 54 5e-04
311emb|BX015743.1|CNS08KB7 Single read from an extremity of a full-... 54 5e-04
312emb|BX016230.1|CNS08KOQ Single read from an extremity of a full-... 54 5e-04
313emb|BX015945.1|CNS08KGT Single read from an extremity of a full-... 54 5e-04
314emb|BX015925.1|CNS08KG9 Single read from an extremity of a full-... 54 5e-04
315emb|BX015611.1|CNS08K7J Single read from an extremity of a full-... 54 5e-04
316emb|BX014926.1|CNS08JOI Single read from an extremity of a full-... 54 5e-04
317emb|BX014301.1|CNS08J75 Single read from an extremity of a full-... 54 5e-04
318emb|BX013989.1|CNS08IYH Single read from an extremity of a full-... 54 5e-04
319emb|BX013507.1|CNS08IL3 Single read from an extremity of a full-... 54 5e-04
320emb|BX013495.1|CNS08IKR Single read from an extremity of a full-... 54 5e-04
321emb|BX013299.1|CNS08IFB Single read from an extremity of a full-... 54 5e-04
322emb|BX013295.1|CNS08IF7 Single read from an extremity of a full-... 54 5e-04
323emb|BX013103.1|CNS08I9V Single read from an extremity of a full-... 54 5e-04
324emb|BX012511.1|CNS08HTF Single read from an extremity of a full-... 54 5e-04
325emb|BX012147.1|CNS08HJB Single read from an extremity of a full-... 54 5e-04
326emb|BX012005.1|CNS08HFD Single read from an extremity of a full-... 54 5e-04
327emb|BX011777.1|CNS08H91 Single read from an extremity of a full-... 54 5e-04
328emb|BX011776.1|CNS08H90 Single read from an extremity of a full-... 54 5e-04
329emb|BX011772.1|CNS08H8W Single read from an extremity of a full-... 54 5e-04
330emb|BX011603.1|CNS08H47 Single read from an extremity of a full-... 54 5e-04
331emb|BX011581.1|CNS08H3L Single read from an extremity of a full-... 54 5e-04
332emb|BX011489.1|CNS08H11 Single read from an extremity of a full-... 54 5e-04
333emb|BX011488.1|CNS08H10 Single read from an extremity of a full-... 54 5e-04
334emb|BX011178.1|CNS08GSE Single read from an extremity of a full-... 54 5e-04
335emb|BX010356.1|CNS08G5K Single read from an extremity of a full-... 54 5e-04
336emb|BX010071.1|CNS08FXN Single read from an extremity of a full-... 54 5e-04
337emb|BX009592.1|CNS08FKC Single read from an extremity of a full-... 54 5e-04
338emb|BX008659.1|CNS08EUF Single read from an extremity of a full-... 54 5e-04
339emb|BX008395.1|CNS08EN3 Single read from an extremity of a full-... 54 5e-04
340emb|BX008250.1|CNS08EJ2 Single read from an extremity of a full-... 54 5e-04
341emb|BX007865.1|CNS08E8D Single read from an extremity of a full-... 54 5e-04
342emb|BX007549.1|CNS08DZL Single read from an extremity of a full-... 54 5e-04
343emb|BX007204.1|CNS08DQ0 Single read from an extremity of a full-... 54 5e-04
344emb|BX007203.1|CNS08DPZ Single read from an extremity of a full-... 54 5e-04
345emb|BX007147.1|CNS08DOF Single read from an extremity of a full-... 54 5e-04
346emb|BX006304.1|CNS08D10 Single read from an extremity of a full-... 54 5e-04
347emb|BX005921.1|CNS08CQD Single read from an extremity of a full-... 54 5e-04
348emb|BX005588.1|CNS08CH4 Single read from an extremity of a full-... 54 5e-04
349emb|BX064114.1|CNS09LMU Single read from an extremity of a full-... 52 0.002
350emb|BX045530.1|CNS097AM Single read from an extremity of a full-... 52 0.002
351emb|BX045222.1|CNS09722 Single read from an extremity of a full-... 52 0.002
352emb|BX039672.1|CNS092RW Single read from an extremity of a full-... 52 0.002
353emb|BX029512.1|CNS08UXO Single read from an extremity of a full-... 52 0.002
354emb|BX014555.1|CNS08JE7 Single read from an extremity of a full-... 52 0.002
355ref|XM_655684.1| Aspergillus nidulans FGSC A4 hypothetical prote... 50 0.008
356dbj|AB032439.1| Drosophila orena sta gene for stubarista, partia... 50 0.008
357dbj|AB032438.1| Drosophila erecta sta gene for stubarista, parti... 50 0.008
358ref|XM_513840.1| PREDICTED: Pan troglodytes LOC457348 (LOC457348... 48 0.033
359ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predi... 48 0.033
360emb|BX048785.1|CNS099T1 Single read from an extremity of a full-... 48 0.033
361gb|AF402808.1| Ictalurus punctatus 40S ribosomal protein Sa mRNA... 48 0.033
362gb|AC004876.2|AC004876 Homo sapiens PAC clone RP4-747G18 from 7q... 48 0.033
363emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 48 0.033
364emb|X15006.1|HSPK1 Human cHD4 pseudogene K1 48 0.033
365ref|XM_527842.1| PREDICTED: Pan troglodytes similar to monoacylg... 46 0.13
366gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.13
367ref|XM_572918.1| Cryptococcus neoformans var. neoformans JEC21 4... 46 0.13
368emb|BX062255.1|CNS09K77 Single read from an extremity of a full-... 46 0.13
369emb|BX062254.1|CNS09K76 Single read from an extremity of a full-... 46 0.13
370emb|BX059338.1|CNS09HY6 Single read from an extremity of a full-... 46 0.13
371emb|BX056727.1|CNS09FXN Single read from an extremity of a full-... 46 0.13
372emb|BX030897.1|CNS08W05 Single read from an extremity of a full-... 46 0.13
373emb|BX047263.1|CNS098MR Single read from an extremity of a full-... 46 0.13
374emb|BX044457.1|CNS096GT Single read from an extremity of a full-... 46 0.13
375emb|BX035793.1|CNS08ZS5 Single read from an extremity of a full-... 46 0.13
376emb|BX035678.1|CNS08ZOY Single read from an extremity of a full-... 46 0.13
377emb|BX035677.1|CNS08ZOX Single read from an extremity of a full-... 46 0.13
378emb|BX033928.1|CNS08YCC Single read from an extremity of a full-... 46 0.13
379emb|BX032604.1|CNS08XBK Single read from an extremity of a full-... 46 0.13
380emb|BX027127.1|CNS08T3F Single read from an extremity of a full-... 46 0.13
381emb|BX027126.1|CNS08T3E Single read from an extremity of a full-... 46 0.13
382emb|BX026703.1|CNS08SRN Single read from an extremity of a full-... 46 0.13
383emb|BX022896.1|CNS08PTW Single read from an extremity of a full-... 46 0.13
384emb|BX024221.1|CNS08QUP Single read from an extremity of a full-... 46 0.13
385emb|BX023584.1|CNS08QD0 Single read from an extremity of a full-... 46 0.13
386emb|BX019733.1|CNS08NE1 Single read from an extremity of a full-... 46 0.13
387emb|BX021163.1|CNS08OHR Single read from an extremity of a full-... 46 0.13
388emb|BX020765.1|CNS08O6P Single read from an extremity of a full-... 46 0.13
389emb|BX020707.1|CNS08O53 Single read from an extremity of a full-... 46 0.13
390emb|BX018984.1|CNS08MT8 Single read from an extremity of a full-... 46 0.13
391emb|BX018151.1|CNS08M63 Single read from an extremity of a full-... 46 0.13
392emb|BX012873.1|CNS08I3H Single read from an extremity of a full-... 46 0.13
393emb|BX012174.1|CNS08HK2 Single read from an extremity of a full-... 46 0.13
394emb|BX011604.1|CNS08H48 Single read from an extremity of a full-... 46 0.13
395emb|BX011136.1|CNS08GR8 Single read from an extremity of a full-... 46 0.13
396emb|BX007568.1|CNS08E04 Single read from an extremity of a full-... 46 0.13
397dbj|AB225911.1| Aspergillus oryzae cDNA, contig sequence: AoEST2766 46 0.13
398ref|XM_935481.1| PREDICTED: Homo sapiens similar to monoacylglyc... 46 0.13
399ref|XM_936414.1| PREDICTED: Homo sapiens similar to monoacylglyc... 46 0.13
400ref|XM_929335.1| PREDICTED: Homo sapiens similar to monoacylglyc... 46 0.13
401gb|AC097711.2| Homo sapiens BAC clone RP11-162K6 from 4, complet... 46 0.13
402ref|XM_511102.1| PREDICTED: Pan troglodytes similar to laminin r... 44 0.51
403ref|XM_520081.1| PREDICTED: Pan troglodytes similar to protein 4... 44 0.51
404gb|AY351649.1| Acanthamoeba healyi laminin-binding protein mRNA,... 44 0.51
405gb|DQ148158.1| Macaca mulatta clone sl1_f08_t7_373 ribosomal pro... 44 0.51
406emb|AL391868.16| Human DNA sequence from clone RP11-422N19 on ch... 44 0.51
407emb|AL359641.10| Human DNA sequence from clone RP11-402K9 on chr... 44 0.51
408emb|AL162591.16| Human DNA sequence from clone RP11-350G8 on chr... 44 0.51
409gb|AC009871.21| Homo sapiens chromosome , clone RP11-86O7, compl... 44 0.51
410emb|AL136306.11| Human DNA sequence from clone RP3-334F4 on chro... 44 0.51
411emb|BX027639.1|CNS08THN Single read from an extremity of a full-... 44 0.51
412gb|AC009812.17| Homo sapiens chromosome 8, clone RP11-48B3, comp... 44 0.51
413gb|AE012147.1| Xanthomonas campestris pv. campestris str. ATCC 3... 44 0.51
414gb|AC119737.3| Homo sapiens 3 BAC RP11-179A18 (Roswell Park Canc... 44 0.51
415gb|AC097639.2| Homo sapiens chromosome 3 clone RP11-384L8, compl... 44 0.51
416gb|AC091699.6| Homo sapiens chromosome 10 clone RP11-296D9, comp... 44 0.51
417gb|AC022026.7| Homo sapiens chromosome 10 clone RP11-506B4, comp... 44 0.51
418ref|XM_936918.1| PREDICTED: Homo sapiens similar to laminin rece... 44 0.51
419ref|XM_497133.2| PREDICTED: Homo sapiens similar to laminin rece... 44 0.51
420ref|XM_944094.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
421ref|XM_944090.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
422ref|XM_939293.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
423ref|XM_944083.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
424ref|XM_933904.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
425ref|XM_933900.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
426ref|XM_372048.4| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
427ref|XM_933889.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 44 0.51
428ref|XM_938530.1| PREDICTED: Homo sapiens similar to laminin rece... 44 0.51
429ref|XM_371273.3| PREDICTED: Homo sapiens similar to laminin rece... 44 0.51
430ref|NM_174379.2| Bos taurus laminin receptor 1 (ribosomal protei... 44 0.51
431gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 44 0.51
432gb|BC102490.1| Bos taurus laminin receptor 1 (ribosomal protein ... 44 0.51
433gb|AC148670.1| Macaca mulatta Major Histocompatibility Complex B... 44 0.51
434gb|AC092128.3| Homo sapiens chromosome 16 clone RP11-133M24, com... 44 0.51
435gb|DQ343296.1| Cercopithecus aethiops laminin receptor 1 (LAMR1)... 44 0.51
436ref|NG_002507.1| Homo sapiens ribosomal protein SA pseudogene 5 ... 44 0.51
437emb|AL133367.4|CNS01DUS Human chromosome 14 DNA sequence BAC R-6... 44 0.51
438dbj|AB099011.1| Bos taurus mRNA for similar to 40S ribosomal pro... 44 0.51
439emb|AJ295225.1|MMU295225 Macaca mulatta partial LAMR1 pseudogene... 44 0.51
440gb|M64923.1|BOVLMELR Bovine C10 protein, complete cds 44 0.51
441emb|X13712.1|HSLBP32P Human HLBP32 pseudogene 44 0.51
442gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 42 2.0
443ref|XM_846011.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
444ref|XM_534299.2| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
445ref|XM_855691.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
446ref|XM_855653.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
447ref|XM_855619.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
448ref|XM_534228.2| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
449ref|XM_855553.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
450ref|XM_855525.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
451ref|XM_855491.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
452ref|XM_855454.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
453ref|XM_855425.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
454ref|XM_844936.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
455ref|XM_855360.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
456ref|XM_855323.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
457ref|XM_533909.2| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
458ref|XM_862517.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
459ref|XM_847853.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
460ref|XM_861523.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
461ref|XM_861510.1| PREDICTED: Canis familiaris similar to 40S ribo... 42 2.0
462ref|XM_852569.1| PREDICTED: Canis familiaris similar to laminin ... 42 2.0
463ref|XM_843892.1| PREDICTED: Canis familiaris similar to laminin ... 42 2.0
464ref|XM_964976.1| PREDICTED: Tribolium castaneum similar to 40S r... 42 2.0
465emb|BX047397.1|CNS098QH Single read from an extremity of a full-... 42 2.0
466emb|BX043446.1|CNS095OQ Single read from an extremity of a full-... 42 2.0
467emb|BX005516.1|CNS08CF4 Single read from an extremity of a full-... 42 2.0
468emb|AL113982.1|CNS01BAE Botrytis cinerea strain T4 cDNA library 42 2.0
469ref|XM_521025.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
470ref|XM_510146.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
471ref|XM_509209.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
472ref|XM_509565.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
473ref|XM_508104.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
474ref|XM_518697.1| PREDICTED: Pan troglodytes similar to 40S ribos... 40 8.0
475ref|XM_468611.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.0
476ref|XM_515504.1| PREDICTED: Pan troglodytes LOC459267 (LOC459267... 40 8.0
477ref|XM_513106.1| PREDICTED: Pan troglodytes solute carrier famil... 40 8.0
478gb|AY190671.1| Pagrus major 40S ribosomal protein Sa mRNA, parti... 40 8.0
479gb|AY208917.2| Pseudomonas sp. ND6 plasmid pND6-1, complete sequ... 40 8.0
480ref|XM_416653.1| PREDICTED: Gallus gallus similar to myelin prot... 40 8.0
481ref|XM_322650.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.0
482ref|XM_951747.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.0
483ref|XM_953899.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.0
484ref|XM_331436.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.0
485ref|NM_201649.2| Homo sapiens solute carrier family 6 (neurotran... 40 8.0
486ref|XM_709588.1| Candida albicans SC5314 putative cytosolic ribo... 40 8.0
487gb|AY730625.1| Xenopus laevis 67kD laminin receptor precursor, m... 40 8.0
488ref|XM_824062.1| Trypanosoma brucei TREU927 40S ribosomal protei... 40 8.0
489ref|XM_824050.1| Trypanosoma brucei TREU927 40S ribosomal protei... 40 8.0
490ref|XM_845810.1| PREDICTED: Canis familiaris similar to solute c... 40 8.0
491ref|XM_539643.2| PREDICTED: Canis familiaris similar to solute c... 40 8.0
492ref|XM_857471.1| PREDICTED: Canis familiaris similar to solute c... 40 8.0
493ref|XM_857445.1| PREDICTED: Canis familiaris similar to solute c... 40 8.0
494gb|BC053370.1| Homo sapiens ribosomal protein SA, transcript var... 40 8.0
495gb|BC084569.1| Homo sapiens cDNA clone IMAGE:6379047, **** WARNI... 40 8.0
496gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNI... 40 8.0
497ref|NM_008135.3| Mus musculus solute carrier family 6 (neurotran... 40 8.0
498ref|XM_792701.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.0
499emb|AL365214.16| Human DNA sequence from clone RP11-506B6 on chr... 40 8.0
500ref|NM_002295.4| Homo sapiens ribosomal protein SA (RPSA), trans... 40 8.0

>ref|XM_479167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1280

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 93  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 393 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 452

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 453 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 512

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 513 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 572

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 573 gttgatattggtattcctgctaa 595



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74



to top

>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1298

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 95  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 395 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 454

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 455 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 514

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 515 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 574

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 575 gttgatattggtattcctgctaa 597



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76



to top

>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1310

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 96  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 396 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 455

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 456 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 515

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 516 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 575

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 576 gttgatattggtattcctgctaa 598



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77



to top

>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1343

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 98  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 157

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 158 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 217

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 218 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 277

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 278 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 337

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 338 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 397

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 398 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 457

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 458 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 517

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 518 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 577

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 578 gttgatattggtattcctgctaa 600



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 39 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 79



to top

>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full
           insert sequence
          Length = 1298

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 95  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 395 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 454

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 455 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 514

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 515 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 574

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 575 gttgatattggtattcctgctaa 597



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76



to top

>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full
           insert sequence
          Length = 1280

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 93  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 393 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 452

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 453 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 512

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 513 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 572

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 573 gttgatattggtattcctgctaa 595



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74



to top

>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full
           insert sequence
          Length = 1342

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 97  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 156

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 157 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 216

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 217 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 276

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 277 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 336

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 337 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 396

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 397 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 456

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 457 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 516

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 517 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 576

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 577 gttgatattggtattcctgctaa 599



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 38 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 78



to top

>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full
           insert sequence
          Length = 1310

 Score =  708 bits (357), Expect = 0.0
 Identities = 467/503 (92%), Gaps = 3/503 (0%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
           |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 96  atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155

                                                                       
Query: 141 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215

                                                                       
Query: 201 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 260
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275

                                                                       
Query: 261 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 320
           ||||| ||| |||| || |||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335

                                                                       
Query: 321 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 380
           || ||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395

                                                                       
Query: 381 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 440
            |||||||||||||||||||||||||||||||||| ||||||||| |||| || || |||
Sbjct: 396 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 455

                                                                       
Query: 441 agtgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggag 500
           ||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||
Sbjct: 456 agtgagccacgccttcttatcctgactgaccccaggactgatcatcagccaattaaggag 515

                                                                       
Query: 501 tctgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttac 560
           |||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || 
Sbjct: 516 tctgcacttggaaacattcctaccattgccttctgtgacactgactctccaatgcgctat 575

                                  
Query: 561 gttgatattggcattcctgctaa 583
           ||||||||||| |||||||||||
Sbjct: 576 gttgatattggtattcctgctaa 598



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                   
Query: 33 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
          ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77



to top

>gb|AY105034.1| Zea mays PCO130341 mRNA sequence
          Length = 1213

 Score =  569 bits (287), Expect = e-159
 Identities = 419/463 (90%)
 Strand = Plus / Plus

                                                                       
Query: 115 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 174
           |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 76  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135

                                                                       
Query: 175 agaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatttaca 234
           |||||||||| |||||| ||||||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195

                                                                       
Query: 235 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 294
           |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| |
Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255

                                                                       
Query: 295 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 354
           |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| |
Sbjct: 256 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 315

                                                                       
Query: 355 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggtacat 414
           |||||||||| ||||||||||||||  | ||||||||||| |||||||||||||||||||
Sbjct: 316 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 375

                                                                       
Query: 415 tcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgacccca 474
           ||||||||||| ||||||| || |||||||||||||||||||||||| |||||||||| |
Sbjct: 376 tcaccaaccagttgcaaacctccttcagtgagccacgccttcttatcctgactgacccga 435

                                                                       
Query: 475 ggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgccttct 534
           |||||||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 436 ggactgatcatcagcccattaaggagtctgcgcttggaaacattcccaccatcgccttct 495

                                                      
Query: 535 gcgacactgactctccgatgcgttacgttgatattggcattcc 577
           | || ||||| || || ||||| || |||||||| ||||||||
Sbjct: 496 gtgatactgattcccctatgcgctatgttgatatcggcattcc 538



to top

>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence
          Length = 1208

 Score =  561 bits (283), Expect = e-157
 Identities = 418/463 (90%)
 Strand = Plus / Plus

                                                                       
Query: 115 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 174
           |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 73  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132

                                                                       
Query: 175 agaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatttaca 234
           |||||||||| |||||| ||||||||||||| ||||||||||||||||| ||||| || |
Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192

                                                                       
Query: 235 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 294
           |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| |
Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252

                                                                       
Query: 295 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 354
           |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| |
Sbjct: 253 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 312

                                                                       
Query: 355 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggtacat 414
           |||||||||| ||||||||||||||  | ||||||||||| |||||||||||||||||||
Sbjct: 313 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 372

                                                                       
Query: 415 tcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgacccca 474
           ||||||||||| ||||||| || |||||||||||||||||||||||| | |||||||| |
Sbjct: 373 tcaccaaccagttgcaaacctccttcagtgagccacgccttcttatccttactgacccga 432

                                                                       
Query: 475 ggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgccttct 534
           |||||||||| ||||| |||||||||||||| |||||||||||||||||||| || ||||
Sbjct: 433 ggactgatcatcagcccattaaggagtctgcgcttggaaacattcccaccatcgcattct 492

                                                      
Query: 535 gcgacactgactctccgatgcgttacgttgatattggcattcc 577
           | || |||||||| || ||||| || |||||||||||||||||
Sbjct: 493 gtgatactgactcccctatgcgctatgttgatattggcattcc 535



to top

>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full
           insert sequence
          Length = 1264

 Score =  486 bits (245), Expect = e-134
 Identities = 416/473 (87%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           |||||||| |||||||| |||||||||||||||||||||||||| || ||||||||||||
Sbjct: 121 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 180

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||  | ||||| 
Sbjct: 181 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 240

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || |||
Sbjct: 241 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 300

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 301 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 360

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           ||||| ||||||||||| |||||||| || ||| | ||||||||||| ||||||||||||
Sbjct: 361 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 420

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||||||  ||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 421 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttctcatccttact 480

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||||||||| ||||| ||||| || ||||||||||| ||||||||||| ||||| |||
Sbjct: 481 gaccccaggacagatcatcagccaatcaaggagtctgctcttggaaacatccccactatt 540

                                                                
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcattcctgc 580
           || ||||| |||||||| ||||| ||||| || || || ||||| ||||||||
Sbjct: 541 gctttctgtgacactgattctcccatgcgctatgtcgacattggtattcctgc 593



to top

>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full
           insert sequence
          Length = 1176

 Score =  486 bits (245), Expect = e-134
 Identities = 416/473 (87%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           |||||||| |||||||| |||||||||||||||||||||||||| || ||||||||||||
Sbjct: 124 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 183

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||  | ||||| 
Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 243

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || |||
Sbjct: 244 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 303

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 304 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 363

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           ||||| ||||||||||| |||||||| || ||| | ||||||||||| ||||||||||||
Sbjct: 364 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 423

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||||||  ||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 424 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttctcatccttact 483

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||||||||| ||||| ||||| || ||||||||||| ||||||||||| ||||| |||
Sbjct: 484 gaccccaggacagatcatcagccaatcaaggagtctgctcttggaaacatccccactatt 543

                                                                
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcattcctgc 580
           || ||||| |||||||| ||||| ||||| || || || ||||| ||||||||
Sbjct: 544 gctttctgtgacactgattctcccatgcgctatgtcgacattggtattcctgc 596



to top

>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full
           insert sequence
          Length = 1245

 Score =  486 bits (245), Expect = e-134
 Identities = 416/473 (87%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           |||||||| |||||||| |||||||||||||||||||||||||| || ||||||||||||
Sbjct: 127 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 186

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||  | ||||| 
Sbjct: 187 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 246

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || |||
Sbjct: 247 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 306

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 307 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 366

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           ||||| ||||||||||| |||||||| || ||| | ||||||||||| ||||||||||||
Sbjct: 367 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 426

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||||||  ||||||| || |||||||||||||| ||||| ||| | |||
Sbjct: 427 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttctcatccttact 486

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||||||||| ||||| ||||| || ||||||||||| ||||||||||| ||||| |||
Sbjct: 487 gaccccaggacagatcatcagccaatcaaggagtctgctcttggaaacatccccactatt 546

                                                                
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcattcctgc 580
           || ||||| |||||||| ||||| ||||| || || || ||||| ||||||||
Sbjct: 547 gctttctgtgacactgattctcccatgcgctatgtcgacattggtattcctgc 599



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  365 bits (184), Expect = 1e-97
 Identities = 241/260 (92%)
 Strand = Plus / Minus

                                                                            
Query: 225      ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
                ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || ||||||
Sbjct: 25361297 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 25361238

                                                                            
Query: 285      attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
                |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 25361237 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 25361178

                                                                            
Query: 345      agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
                |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 25361177 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 25361118

                                                                            
Query: 405      cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
                ||||||||||| ||||||||| |||| || || |||||||||||||||||||||||| ||
Sbjct: 25361117 cctggtacatttaccaaccagctgcagacctcattcagtgagccacgccttcttatcctg 25361058

                                    
Query: 465      actgaccccaggactgatca 484
                ||||||||||||||||||||
Sbjct: 25361057 actgaccccaggactgatca 25361038



 Score =  218 bits (110), Expect = 2e-53
 Identities = 139/148 (93%), Gaps = 3/148 (2%)
 Strand = Plus / Minus

                                                                            
Query: 84       atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
                |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 25362009 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 25361950

                                                                            
Query: 141      atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
                |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 25361949 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 25361890

                                            
Query: 201      tacgtctacaagcgccgcactgacggta 228
                ||||||||||||||||||||||||||||
Sbjct: 25361889 tacgtctacaagcgccgcactgacggta 25361862



 Score =  139 bits (70), Expect = 1e-29
 Identities = 91/98 (92%)
 Strand = Plus / Minus

                                                                            
Query: 486      cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
                ||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 25360948 cagccaattaaggagtctgcacttggaaacattcctaccattgccttctgtgacactgac 25360889

                                                      
Query: 546      tctccgatgcgttacgttgatattggcattcctgctaa 583
                ||||| ||||| || ||||||||||| |||||||||||
Sbjct: 25360888 tctccaatgcgctatgttgatattggtattcctgctaa 25360851



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                         
Query: 33       cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
                ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 25362068 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 25362028



to top

>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1056G08
          Length = 168173

 Score =  365 bits (184), Expect = 1e-97
 Identities = 241/260 (92%)
 Strand = Plus / Minus

                                                                         
Query: 225   ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
             ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || ||||||
Sbjct: 54387 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 54328

                                                                         
Query: 285   attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
             |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| |||
Sbjct: 54327 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 54268

                                                                         
Query: 345   agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
             |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||
Sbjct: 54267 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 54208

                                                                         
Query: 405   cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
             ||||||||||| ||||||||| |||| || || |||||||||||||||||||||||| ||
Sbjct: 54207 cctggtacatttaccaaccagctgcagacctcattcagtgagccacgccttcttatcctg 54148

                                 
Query: 465   actgaccccaggactgatca 484
             ||||||||||||||||||||
Sbjct: 54147 actgaccccaggactgatca 54128



 Score =  218 bits (110), Expect = 2e-53
 Identities = 139/148 (93%), Gaps = 3/148 (2%)
 Strand = Plus / Minus

                                                                         
Query: 84    atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 140
             |||||||| |||||||||| || |   ||||||||||||||||| |||||||||||||||
Sbjct: 55099 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 55040

                                                                         
Query: 141   atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 200
             |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 55039 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 54980

                                         
Query: 201   tacgtctacaagcgccgcactgacggta 228
             ||||||||||||||||||||||||||||
Sbjct: 54979 tacgtctacaagcgccgcactgacggta 54952



 Score =  139 bits (70), Expect = 1e-29
 Identities = 91/98 (92%)
 Strand = Plus / Minus

                                                                         
Query: 486   cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
             ||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 54038 cagccaattaaggagtctgcacttggaaacattcctaccattgccttctgtgacactgac 53979

                                                   
Query: 546   tctccgatgcgttacgttgatattggcattcctgctaa 583
             ||||| ||||| || ||||||||||| |||||||||||
Sbjct: 53978 tctccaatgcgctatgttgatattggtattcctgctaa 53941



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 33    cctccgctctctcgcgcacggggctcgcgtccgaaacccta 73
             ||||||||||||||||||||| || |||| ||||| |||||
Sbjct: 55158 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 55118



to top

>ref|XM_470555.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 918

 Score =  347 bits (175), Expect = 3e-92
 Identities = 394/467 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 28  cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 87

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 88  ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 147

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 148 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 207

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| |||||||||||||||||||| || || ||  | ||||| || ||| | 
Sbjct: 208 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 267

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || |||
Sbjct: 268 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 327

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | |||
Sbjct: 328 ggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctcact 387

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||| ||||| ||||||||||| || ||||||||||| || |||||||| || ||||||
Sbjct: 388 gacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgaccatt 447

                                                          
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 448 gccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 494



to top

>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full
           insert sequence
          Length = 1310

 Score =  347 bits (175), Expect = 3e-92
 Identities = 394/467 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| |||||||||||||||||||| || || ||  | ||||| || ||| | 
Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || |||
Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | |||
Sbjct: 412 ggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctcact 471

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||| ||||| ||||||||||| || ||||||||||| || |||||||| || ||||||
Sbjct: 472 gacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgaccatt 531

                                                          
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 532 gccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 578



to top

>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full
           insert sequence
          Length = 1276

 Score =  347 bits (175), Expect = 3e-92
 Identities = 394/467 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| |||||||||||||||||||| || || ||  | ||||| || ||| | 
Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || |||
Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | |||
Sbjct: 412 ggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctcact 471

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||| ||||| ||||||||||| || ||||||||||| || |||||||| || ||||||
Sbjct: 472 gacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgaccatt 531

                                                          
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 532 gccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 578



to top

>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full
           insert sequence
          Length = 1223

 Score =  347 bits (175), Expect = 3e-92
 Identities = 394/467 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| |||||||||||||||||||| || || ||  | ||||| || ||| | 
Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || |||
Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | |||
Sbjct: 412 ggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctcact 471

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||| ||||| ||||||||||| || ||||||||||| || |||||||| || ||||||
Sbjct: 472 gacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgaccatt 531

                                                          
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 532 gccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 578



to top

>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full
           insert sequence
          Length = 1320

 Score =  347 bits (175), Expect = 3e-92
 Identities = 394/467 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 122 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 181

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 241

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 242 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 301

                                                                       
Query: 288 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 347
           ||||| ||||| |||||||||||||||||||| || || ||  | ||||| || ||| | 
Sbjct: 302 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 361

                                                                       
Query: 348 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 407
           || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || |||
Sbjct: 362 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 421

                                                                       
Query: 408 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgact 467
           |||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | |||
Sbjct: 422 ggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctcact 481

                                                                       
Query: 468 gaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccatt 527
           ||||| ||||| ||||||||||| || ||||||||||| || |||||||| || ||||||
Sbjct: 482 gacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgaccatt 541

                                                          
Query: 528 gccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 542 gccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 588



to top

>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds
          Length = 1141

 Score =  343 bits (173), Expect = 4e-91
 Identities = 380/449 (84%)
 Strand = Plus / Plus

                                                                       
Query: 132 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 191
           ||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 118 gacatccagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaa 177

                                                                       
Query: 192 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 251
           ||||| || ||| ||| |||||||||||  ||||| ||||||||||| |||||||| |||
Sbjct: 178 atggaacgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaag 237

                                                                       
Query: 252 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 311
           || ||||||||||||||| | || || ||||| || ||||| ||||| ||||||||||| 
Sbjct: 238 acgtgggagaagcttcagctagcagctagggttatagttgcaattgagaacccccaggat 297

                                                                       
Query: 312 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 371
           |||||||| |||||||| ||||| ||||| || || || ||||| |||||||| ||||||
Sbjct: 298 atcattgttcaatctgcaaggccttatgggcaaagagcggttctgaagtttgctcagtac 357

                                                                       
Query: 372 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 431
           ||||||||| | || |||||||| ||||||||||||||||| |||||||| ||| | |||
Sbjct: 358 actggtgctcatgctattgctggaaggcacactcctggtaccttcaccaatcagcttcaa 417

                                                                       
Query: 432 acttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcaccagcct 491
           ||||| ||||| ||||| || || |||||  | || || || || || ||||||||||||
Sbjct: 418 acttccttcagcgagcctcgtctccttattcttaccgatccaagaacagatcaccagcct 477

                                                                       
Query: 492 attaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgactctccg 551
           ||||||||  |||| ||||| || |||||||||||||| ||||| ||||| || || || 
Sbjct: 478 attaaggaagctgctcttgggaatattcccaccattgctttctgtgacaccgattcacct 537

                                        
Query: 552 atgcgttacgttgatattggcattcctgc 580
           ||| | ||||| || ||||| ||||||||
Sbjct: 538 atgaggtacgtggacattggaattcctgc 566



to top

>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence
          Length = 1267

 Score =  325 bits (164), Expect = 9e-86
 Identities = 389/464 (83%)
 Strand = Plus / Plus

                                                                       
Query: 111 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 170
           ||||||||||||   ||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||||||||||||||||||||||||||| | ||  ||||||||||| ||||| || 
Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           ||||| ||||||||||||||||| |||||||| || ||| | || || ||||| || |||
Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || || || ||||| ||||||||||| || || || ||  | |||||||| ||| | |||
Sbjct: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctatggccagcgtgct 378

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           || |||||||| || ||||||||||| ||| | ||||| ||||| |||||||| ||||||
Sbjct: 379 gtcctcaagttcgctcagtacactggcgctcatgccatcgctgggaggcacacccctggt 438

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || ||||| |||||| | || || || ||||| ||||| || || || ||| | || |||
Sbjct: 439 accttcactaaccagctccagacctccttcagcgagcctcggctgctcatccttaccgac 498

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || |||||||| || ||||| |||||||||||||| || || ||||| ||||||||||||
Sbjct: 499 ccaaggactgaccatcagccaattaaggagtctgctctggggaacatccccaccattgcc 558

                                                       
Query: 531 ttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           ||||| || ||||||||||| ||||| || || ||||| |||||
Sbjct: 559 ttctgtgatactgactctcccatgcggtatgtcgatatcggcat 602



to top

>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence
          Length = 1275

 Score =  317 bits (160), Expect = 2e-83
 Identities = 388/464 (83%)
 Strand = Plus / Plus

                                                                       
Query: 111 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 170
           ||||||||||||   ||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           ||||||||||||||||||||||||||||| || ||||  ||||| ||||| ||||| || 
Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| ||||||
Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| || |||||||| || || || ||  | ||||| || ||| | |||
Sbjct: 358 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 417

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           || |||||||| || ||||||||||| ||  | ||||| ||||| |||||||| ||||||
Sbjct: 418 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 477

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| ||| | || || || ||||| ||||| ||||| || ||| | ||||||
Sbjct: 478 accttcaccaatcagctccagacctctttcagcgagcctcgcctgctcatccttactgac 537

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || |||||||| || ||||| || ||||||||||| || || ||||| || |||||||||
Sbjct: 538 ccaaggactgaccatcagccaatcaaggagtctgctctggggaacatcccgaccattgcc 597

                                                       
Query: 531 ttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 598 ttctgcgacactgactctcccatgcggtatgtcgatatcggcat 641



to top

>gb|AY103617.1| Zea mays PCO143386 mRNA sequence
          Length = 1516

 Score =  317 bits (160), Expect = 2e-83
 Identities = 388/464 (83%)
 Strand = Plus / Plus

                                                                       
Query: 111 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 170
           ||||||||||||   ||||||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           ||||||||||||||||||||||||||||| || ||||  ||||| ||||| ||||| || 
Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| ||||||
Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| || |||||||| || || || ||  | ||||| || ||| | |||
Sbjct: 397 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 456

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           || |||||||| || ||||||||||| ||  | ||||| ||||| |||||||| ||||||
Sbjct: 457 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 516

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| ||| | || || || ||||| ||||| ||||| || ||| | ||||||
Sbjct: 517 accttcaccaatcagctccagacctctttcagcgagcctcgcctgctcatccttactgac 576

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || |||||||| || ||||| || ||||||||||| || || ||||| || |||||||||
Sbjct: 577 ccaaggactgaccatcagccaatcaaggagtctgctctggggaacatcccgaccattgcc 636

                                                       
Query: 531 ttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           |||||||||||||||||||| ||||| || || ||||| |||||
Sbjct: 637 ttctgcgacactgactctcccatgcgatatgtcgatatcggcat 680



to top

>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence
          Length = 1418

 Score =  280 bits (141), Expect = 5e-72
 Identities = 372/449 (82%)
 Strand = Plus / Plus

                                                                       
Query: 126 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 185
           ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 145 gagcaggacatacagatgatgctcgccgccgacgtccaccttggcaccaagaactgcgat 204

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           ||||||| ||||||||| ||||  ||||||||  | ||||| || ||||| ||||| |||
Sbjct: 205 ttccagacggagcgctatgtctttaagcgccgttccgacggcatctacatcatcaatctt 264

                                                                       
Query: 246 ggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccc 305
           |||||||| ||||| || || ||| | || || ||||| || ||||| || || ||||| 
Sbjct: 265 ggcaagacatgggataaactccagcttgcagcgagggttatcgttgccatcgagaacccg 324

                                                                       
Query: 306 caggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcc 365
           ||||||||||| || || |||||  | || ||||| ||| | ||||| |||||||| || 
Sbjct: 325 caggacatcatcgtccagtctgcccgcccatatggccagcgtgctgtcctcaagttcgct 384

                                                                       
Query: 366 cagtacactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccag 425
           ||||||||||| ||  | ||||| ||||| |||||||| |||||||||||||| || |||
Sbjct: 385 cagtacactggcgcccatgccatcgctgggaggcacacccctggtacattcactaatcag 444

                                                                       
Query: 426 atgcaaacttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcac 485
            | || || || ||||| ||||| || || || ||| | |||||||| |||||||| || 
Sbjct: 445 ctccagacctccttcagcgagcctcgactgctcatccttactgacccaaggactgaccat 504

                                                                       
Query: 486 cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
           ||||| || ||||||||||| || || ||||| || ||||||||||| || |||||||||
Sbjct: 505 cagccaatcaaggagtctgctctggggaacatcccgaccattgccttttgtgacactgac 564

                                        
Query: 546 tctccgatgcgttacgttgatattggcat 574
           ||||| ||||| ||||| ||||| |||||
Sbjct: 565 tctcccatgcggtacgtcgatatcggcat 593



to top

>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds
          Length = 1111

 Score =  270 bits (136), Expect = 5e-69
 Identities = 346/416 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 ctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgac 224
           ||||||||||| ||||| ||||||||||||||||| || |||| ||||||||| |  || 
Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212

                                                                       
Query: 225 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
           |||||||| || |||||  | || ||||| ||||||||||||  | |||| || ||||| 
Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagcttatgttggctgctagggtt 272

                                                                       
Query: 285 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
           |||||| | ||||| || ||||||||||||||||| || ||||||||||| || || |||
Sbjct: 273 attgtttctattgagaatccccaggacatcattgtccagtctgctaggccttacggtcag 332

                                                                       
Query: 345 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
           || |||||  | |||||||| ||||| ||||||||| | || ||||||||| | ||||||
Sbjct: 333 agagctgtcttgaagtttgctcagtatactggtgctcatgctattgctggtcgtcacact 392

                                                                       
Query: 405 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
           || || || |||||||| ||| | || || ||||| || ||||| || |||||||| |||
Sbjct: 393 cccggaactttcaccaatcagcttcagacgtcgtttagcgagcctcgtcttcttattttg 452

                                                                       
Query: 465 actgaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccacc 524
           ||||| || || ||||| |||||||||||||||||  |||| ||||||||||| ||||||
Sbjct: 453 actgatcctagaactgaccaccagcctattaaggaagctgctcttggaaacatccccacc 512

                                                                   
Query: 525 attgccttctgcgacactgactctccgatgcgttacgttgatattggcattcctgc 580
           ||||| ||||| |||||||| || || ||||| || ||||||||||||||||||||
Sbjct: 513 attgctttctgtgacactgattccccaatgcgatatgttgatattggcattcctgc 568



to top

>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full
           insert sequence
          Length = 1182

 Score =  246 bits (124), Expect = 7e-62
 Identities = 190/212 (89%)
 Strand = Plus / Plus

                                                                       
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
           ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 113 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 172

                                                                       
Query: 168 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 227
           ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || |||
Sbjct: 173 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 232

                                                                       
Query: 228 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 287
           || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| |||
Sbjct: 233 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 292

                                           
Query: 288 gttgcgattgaaaacccccaggacatcattgt 319
           ||||| ||||| ||||||||||||||||||||
Sbjct: 293 gttgccattgagaacccccaggacatcattgt 324



 Score =  111 bits (56), Expect = 3e-21
 Identities = 158/192 (82%)
 Strand = Plus / Plus

                                                                       
Query: 383 cgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttcag 442
           |||||||||||| ||||| || ||||||||||| ||||| ||| | || || || |||||
Sbjct: 335 cgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctccttcag 394

                                                                       
Query: 443 tgagccacgccttcttatcttgactgaccccaggactgatcaccagcctattaaggagtc 502
            ||||| || || || ||| | |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 395 cgagccccgtctgctcatcctcactgacccaaggaccgatcaccagccaatcaaggagtc 454

                                                                       
Query: 503 tgcacttggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgt 562
           ||| || |||||||| || |||||||||||||| ||||| || || || ||||| || ||
Sbjct: 455 tgctctgggaaacatcccgaccattgccttctgtgacaccgattccccaatgcggtatgt 514

                       
Query: 563 tgatattggcat 574
            ||||| |||||
Sbjct: 515 cgatatcggcat 526



to top

>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds
          Length = 1061

 Score =  242 bits (122), Expect = 1e-60
 Identities = 347/422 (82%)
 Strand = Plus / Plus

                                                                       
Query: 159 gtccacctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 218
           ||||||||||| || |||||||| || ||||| ||||| || ||||||| |||||| |||
Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162

                                                                       
Query: 219 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 278
           |  |||||||| || ||||| |||  ||| ||||| ||||| ||||| || ||||| || 
Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagctgcatatggcagct 222

                                                                       
Query: 279 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 338
           || || |||||| | ||||| || || ||||||||||||||||||||||| |||||||||
Sbjct: 223 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 282

                                                                       
Query: 339 ggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtagg 398
           |||||||| || ||  | ||||| || || || ||||||||  | |||||||||||  | 
Sbjct: 283 ggacagagagccgtcttgaagttcgcacaatatactggtgcacatgccattgctggccgt 342

                                                                       
Query: 399 cacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttctt 458
           ||||| |||||||| || ||||| ||| | || ||||| | |||||||||||| ||||| 
Sbjct: 343 cacacccctggtacctttaccaatcagcttcagacttcatacagtgagccacgacttctc 402

                                                                       
Query: 459 atcttgactgaccccaggactgatcaccagcctattaaggagtctgcacttggaaacatt 518
           ||  | |||||||| || ||||||||||||||||| |||||  |||||||||||||||| 
Sbjct: 403 attctcactgaccctagaactgatcaccagcctatcaaggaagctgcacttggaaacatc 462

                                                                       
Query: 519 cccaccattgccttctgcgacactgactctccgatgcgttacgttgatattggcattcct 578
           ||||| ||||||||||| |||||||| || || |||||||| ||||| ||||| || |||
Sbjct: 463 cccactattgccttctgtgacactgattcaccaatgcgttatgttgacattggtatccct 522

             
Query: 579 gc 580
           ||
Sbjct: 523 gc 524



to top

>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete
           cds
          Length = 1138

 Score =  236 bits (119), Expect = 7e-59
 Identities = 344/419 (82%)
 Strand = Plus / Plus

                                                                       
Query: 132 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 191
           |||||| ||||||||  ||| || || || |||||||| |||||||||||| | | ||| 
Sbjct: 88  gacatcaagatgatgtgcgctgctgaggttcacctcggaaccaagaactgcaactaccaa 147

                                                                       
Query: 192 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 251
           |||||||| ||||||| |||| | ||||  ||||||||||||||  | |||||||| |||
Sbjct: 148 atggagcgttacgtcttcaagagacgcaacgacggtatttacatctttaaccttggaaag 207

                                                                       
Query: 252 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 311
           || |||||||||||   |||||| ||| | ||||| ||||| || || ||||| || |||
Sbjct: 208 acatgggagaagctgatgatggctgcacgagtcatcgttgctatcgagaacccacaagac 267

                                                                       
Query: 312 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 371
           ||||||||||| || |||||||||||||| ||||| |||||| | ||||| || ||||||
Sbjct: 268 atcattgtgcagtcagctaggccctatggtcagagagctgttttgaagttcgctcagtac 327

                                                                       
Query: 372 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 431
           ||||| ||||| ||||||||||| ||||||||||||||||| |||||||| |||||||| 
Sbjct: 328 actggagctaatgccattgctggaaggcacactcctggtactttcaccaatcagatgcag 387

                                                                       
Query: 432 acttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcaccagcct 491
           ||||||||||| |||||| | ||| | ||  | ||||| ||  | || || |||||||| 
Sbjct: 388 acttcgttcagcgagccaaggcttttgattcttactgatccacgtaccgaccaccagccc 447

                                                                      
Query: 492 attaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgactctcc 550
           || |||||   |||  | ||||||||||| | |||||| ||||| ||||||||||||||
Sbjct: 448 atcaaggaaggtgctttgggaaacattccaatcattgctttctgtgacactgactctcc 506



to top

>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like
           mRNA, complete cds
          Length = 1106

 Score =  234 bits (118), Expect = 3e-58
 Identities = 346/422 (81%)
 Strand = Plus / Plus

                                                                       
Query: 159 gtccacctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 218
           ||||||||||| || |||||||| || ||||| ||||| || ||||||| |||||| |||
Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173

                                                                       
Query: 219 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 278
           |  |||||||| |||||||| |||  ||| ||||| ||||| ||||| || ||||| || 
Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagctgcatatggcagct 233

                                                                       
Query: 279 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 338
           || || |||||| | ||||| || || ||||||||||||||||||||||| |||||||||
Sbjct: 234 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 293

                                                                       
Query: 339 ggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtagg 398
           |||||||| || ||  | ||||| || || || ||||||||  | |||||||||||  | 
Sbjct: 294 ggacagagagccgtcttgaagttcgcacaatatactggtgcacatgccattgctggccgt 353

                                                                       
Query: 399 cacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttctt 458
           ||||| |||||||| || || || ||| | || ||||| | ||| |||||||| ||||| 
Sbjct: 354 cacacccctggtacctttacgaatcagcttcagacttcatacagcgagccacgacttctc 413

                                                                       
Query: 459 atcttgactgaccccaggactgatcaccagcctattaaggagtctgcacttggaaacatt 518
           ||  | |||||||| || ||||||||||||||||| |||||  |||||||||||||||| 
Sbjct: 414 attctcactgaccctagaactgatcaccagcctatcaaggaagctgcacttggaaacatc 473

                                                                       
Query: 519 cccaccattgccttctgcgacactgactctccgatgcgttacgttgatattggcattcct 578
           ||||| ||||||||||| |||||||| || || |||||||| ||||| ||||| || |||
Sbjct: 474 cccactattgccttctgtgacactgattcaccaatgcgttatgttgacattggtatccct 533

             
Query: 579 gc 580
           ||
Sbjct: 534 gc 535



to top

>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.2 mRNA,
           complete cds
          Length = 1173

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 475

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 476 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 535

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 536 ttctgtgacacagactctcc 555



to top

>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.1 mRNA,
           complete cds
          Length = 1185

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 475

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 476 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 535

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 536 ttctgtgacacagactctcc 555



to top

>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1032

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 390

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 391 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 450

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 451 ttctgtgacacagactctcc 470



to top

>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue
          Length = 1073

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 96  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 216 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 275

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 276 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 335

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 336 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 395

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 396 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 455

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 456 ttctgtgacacagactctcc 475



to top

>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1103

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 273 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 332

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 333 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 392

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 393 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 452

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 453 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 512

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 513 ttctgtgacacagactctcc 532



to top

>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1042

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 390

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 391 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 450

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 451 ttctgtgacacagactctcc 470



to top

>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 897

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 390

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 391 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 450

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 451 ttctgtgacacagactctcc 470



to top

>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370; T10D10.16) mRNA,
           complete cds
          Length = 1151

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 413 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 472

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 473 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 532

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 533 ttctgtgacacagactctcc 552



to top

>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1182

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 475

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 476 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 535

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 536 ttctgtgacacagactctcc 555



to top

>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1168

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 276 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 335

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 336 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 395

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 396 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 455

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 456 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 515

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 516 ttctgtgacacagactctcc 535



to top

>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1096

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 280 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 339

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 340 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 399

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 400 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 459

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 460 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 519

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 520 ttctgtgacacagactctcc 539



to top

>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1126

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 266 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 325

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 326 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 385

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 386 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 445

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 446 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 505

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 506 ttctgtgacacagactctcc 525



to top

>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence
          Length = 1177

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 413 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 472

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 473 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 532

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 533 ttctgtgacacagactctcc 552



to top

>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA,
           complete cds
          Length = 1137

 Score =  230 bits (116), Expect = 4e-57
 Identities = 314/380 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 230
           |||||||| ||| ||| |||||||||||| ||||||| |||| | ||||  || ||||||
Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204

                                                                       
Query: 231 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 290
           |||||  ||||||||||||| || ||||| ||||| |||||||| || || || ||||||
Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264

                                                                       
Query: 291 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 350
           || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| |||
Sbjct: 265 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 324

                                                                       
Query: 351 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 410
           ||  | |||||||| ||||||||||| || || ||||||||||| || ||||||||||||
Sbjct: 325 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 384

                                                                       
Query: 411 acattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttgactgac 470
           || |||||||| |||||||| || || |||||||| ||| | ||  | ||  | ||||||
Sbjct: 385 accttcaccaatcagatgcagacatccttcagtgaaccaaggctgttgattcttactgac 444

                                                                       
Query: 471 cccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccaccattgcc 530
           || || ||||| ||||||||||| |||||   |||  | ||||||||||| | |||||| 
Sbjct: 445 ccaagaactgaccaccagcctatcaaggaaggtgctttgggaaacattccaatcattgct 504

                               
Query: 531 ttctgcgacactgactctcc 550
           ||||| ||||| ||||||||
Sbjct: 505 ttctgtgacacagactctcc 524



to top

>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40
          Length = 1169

 Score =  222 bits (112), Expect = 1e-54
 Identities = 367/452 (81%)
 Strand = Plus / Plus

                                                                       
Query: 132 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 191
           ||||||||||||||| | || ||||| || |||||||| |||||||||||  | ||||||
Sbjct: 114 gacatccagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccag 173

                                                                       
Query: 192 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 251
           |||||||| ||| | |  || ||||||| ||| |||||||| || || || ||||| |||
Sbjct: 174 atggagcgttacatttttaaacgccgcaatgatggtatttatatcataaatcttggaaag 233

                                                                       
Query: 252 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 311
           || ||||| || ||| |  | || || ||| |||||||||| ||||| ||  | ||||||
Sbjct: 234 acatgggataaacttaaccttgctgctaggatcattgttgccattgagaattctcaggac 293

                                                                       
Query: 312 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 371
           |||||||| |||||||| || || |||||||| || ||||||||||| ||||| ||||||
Sbjct: 294 atcattgttcaatctgcaagaccttatggacaaagagctgttctcaaatttgctcagtac 353

                                                                       
Query: 372 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 431
           ||||| ||| | || |||||||| |||||||||||||| || |||||||| ||| | |||
Sbjct: 354 actggagctcatgctattgctggaaggcacactcctggaaccttcaccaatcagctacaa 413

                                                                       
Query: 432 acttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcaccagcct 491
           ||||| |||||||| ||  |  | |||||| | || || || || || ||||||||||| 
Sbjct: 414 acttccttcagtgaacctaggttgcttatcctcaccgatccaagaacagatcaccagcca 473

                                                                       
Query: 492 attaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgactctccg 551
           || |||||  |||| |||||||| |||||||||||||| ||||| ||||| || ||||| 
Sbjct: 474 atcaaggaagctgctcttggaaatattcccaccattgctttctgtgacaccgattctcca 533

                                           
Query: 552 atgcgttacgttgatattggcattcctgctaa 583
           |||  ||| ||||| ||||| |||||||||||
Sbjct: 534 atgaattatgttgacattggaattcctgctaa 565



to top

>gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence
          Length = 405672

 Score =  194 bits (98), Expect = 2e-46
 Identities = 159/178 (89%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                         
Query: 311   catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 370
             |||||||||||| ||||||||||||||||  ||||||||||| |||||||||||  ||||
Sbjct: 25882 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 25823

                                                                         
Query: 371   cactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgca 430
             |||||||||| | |||||||| || |||||||||||||||||||||||||||||| ||||
Sbjct: 25822 cactggtgctcatgccattgccggcaggcacactcctggtacattcaccaaccagttgca 25763

                                                                       
Query: 431   aacttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcaccag 488
             ||| || ||||| |||||||||||||||||| | |||||  ||||||||| |||||||
Sbjct: 25762 aacctccttcagcgagccacgccttcttatcctcactga-tccaggactggtcaccag 25706



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                         
Query: 510   ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
             |||||||||||||||||||||||||| ||||| ||||| || ||||| || || ||||| 
Sbjct: 25442 ggaaacattcccaccattgccttctgtgacaccgactcccctatgcgctatgtcgatatc 25383

                        
Query: 570   ggcattcctgc 580
             |||||||||||
Sbjct: 25382 ggcattcctgc 25372



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                         
Query: 126   gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 185
             |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| || || 
Sbjct: 26632 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaattgggac 26573

                       
Query: 186   ttccagatgg 195
             ||| ||||||
Sbjct: 26572 ttctagatgg 26563



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 225   ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 274
             ||||| |||||||| ||||||||||||||||| |||||||||||| ||||
Sbjct: 25949 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 25900



to top

>gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence
          Length = 323584

 Score =  194 bits (98), Expect = 2e-46
 Identities = 159/178 (89%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                        
Query: 311  catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 370
            |||||||||||| ||||||||||||||||  ||||||||||| |||||||||||  ||||
Sbjct: 6056 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 5997

                                                                        
Query: 371  cactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgca 430
            |||||||||| | |||||||| || |||||||||||||||||||||||||||||| ||||
Sbjct: 5996 cactggtgctcatgccattgccggcaggcacactcctggtacattcaccaaccagttgca 5937

                                                                      
Query: 431  aacttcgttcagtgagccacgccttcttatcttgactgaccccaggactgatcaccag 488
            ||| || ||||| |||||||||||||||||| | |||||  ||||||||| |||||||
Sbjct: 5936 aacctccttcagcgagccacgccttcttatcctcactga-tccaggactggtcaccag 5880



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                        
Query: 510  ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
            |||||||||||||||||||||||||| ||||| ||||| || ||||| || || ||||| 
Sbjct: 5616 ggaaacattcccaccattgccttctgtgacaccgactcccctatgcgctatgtcgatatc 5557

                       
Query: 570  ggcattcctgc 580
            |||||||||||
Sbjct: 5556 ggcattcctgc 5546



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                        
Query: 126  gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 185
            |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| || || 
Sbjct: 6806 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaattgggac 6747

                      
Query: 186  ttccagatgg 195
            ||| ||||||
Sbjct: 6746 ttctagatgg 6737



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 225  ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 274
            ||||| |||||||| ||||||||||||||||| |||||||||||| ||||
Sbjct: 6123 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 6074



to top

>emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40
          Length = 3690

 Score =  184 bits (93), Expect = 2e-43
 Identities = 189/221 (85%)
 Strand = Plus / Plus

                                                                        
Query: 225  ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
            |||||||||||  ||||||||||||| || ||||| ||||| |||||||| || || || 
Sbjct: 2279 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 2338

                                                                        
Query: 285  attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
            |||||||| ||||| ||||| ||||||||||| || || || ||||||||||||||||||
Sbjct: 2339 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 2398

                                                                        
Query: 345  agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
            || |||||  | |||||||| ||||||||||| || || ||||||||||| || ||||||
Sbjct: 2399 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 2458

                                                     
Query: 405  cctggtacattcaccaaccagatgcaaacttcgttcagtga 445
            |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 2459 cctggtaccttcaccaatcagatgcagacatccttcagtga 2499



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 171  accaagaactgcgatttccagatggagcgctacgtctacaag 212
            |||||||| ||| ||| |||||||||||| ||||||| ||||
Sbjct: 1688 accaagaattgcaattaccagatggagcgttacgtcttcaag 1729



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 510  ggaaacattcccaccattgccttctgcgacactgactctcc 550
            ||||||||||| | |||||| ||||| ||||| ||||||||
Sbjct: 2643 ggaaacattccaatcattgctttctgtgacacagactctcc 2683



to top

>emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene
          Length = 2049

 Score =  184 bits (93), Expect = 2e-43
 Identities = 189/221 (85%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
           |||||||||||  ||||||||||||| || ||||| ||||| |||||||| || || || 
Sbjct: 768 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 827

                                                                       
Query: 285 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
           |||||||| ||||| ||||| ||||||||||| || || || ||||||||||||||||||
Sbjct: 828 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 887

                                                                       
Query: 345 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
           || |||||  | |||||||| ||||||||||| || || ||||||||||| || ||||||
Sbjct: 888 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 947

                                                    
Query: 405 cctggtacattcaccaaccagatgcaaacttcgttcagtga 445
           |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 948 cctggtaccttcaccaatcagatgcagacatccttcagtga 988



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 171 accaagaactgcgatttccagatggagcgctacgtctacaag 212
           |||||||| ||| ||| |||||||||||| ||||||| ||||
Sbjct: 177 accaagaattgcaattaccagatggagcgttacgtcttcaag 218



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                     
Query: 510  ggaaacattcccaccattgccttctgcgacactgactctcc 550
            ||||||||||| | |||||| ||||| ||||| ||||||||
Sbjct: 1132 ggaaacattccaatcattgctttctgtgacacagactctcc 1172



to top

>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete
             sequence
          Length = 87039

 Score =  184 bits (93), Expect = 2e-43
 Identities = 189/221 (85%)
 Strand = Plus / Plus

                                                                         
Query: 225   ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
             |||||||||||  ||||||||||||| || ||||| ||||| |||||||| || || || 
Sbjct: 69070 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 69129

                                                                         
Query: 285   attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
             |||||||| ||||| ||||| ||||||||||| || || || ||||||||||||||||||
Sbjct: 69130 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 69189

                                                                         
Query: 345   agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
             || |||||  | |||||||| ||||||||||| || || ||||||||||| || ||||||
Sbjct: 69190 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 69249

                                                      
Query: 405   cctggtacattcaccaaccagatgcaaacttcgttcagtga 445
             |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 69250 cctggtaccttcaccaatcagatgcagacatccttcagtga 69290



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 171   accaagaactgcgatttccagatggagcgctacgtctacaag 212
             |||||||| ||| ||| |||||||||||| ||||||| ||||
Sbjct: 68477 accaagaattgcaattaccagatggagcgttacgtcttcaag 68518



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 510   ggaaacattcccaccattgccttctgcgacactgactctcc 550
             ||||||||||| | |||||| ||||| ||||| ||||||||
Sbjct: 69434 ggaaacattccaatcattgctttctgtgacacagactctcc 69474



to top

>ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constituent of ribosome
           AT3G04770 (RPSAB) transcript variant AT3G04770.1 mRNA,
           complete cds
          Length = 1200

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 464 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 523

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 524 ggtattcctgctaa 537



to top

>ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constituent of ribosome
           AT3G04770 (RPSAB) transcript variant AT3G04770.2 mRNA,
           complete cds
          Length = 1124

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 464 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 523

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 524 ggtattcctgctaa 537



to top

>gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal protein
           (At3g04770/F7O18_26) mRNA, complete cds
          Length = 999

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 145 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 204

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 205 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 264

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 265 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 324

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 325 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 371



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 433 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 492

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 493 ggtattcctgctaa 506



to top

>gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, complete cds
          Length = 1157

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 464 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 523

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 524 ggtattcctgctaa 537



to top

>gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete sequence
          Length = 1027

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 178 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 237

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 238 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 297

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 298 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 357

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 358 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 404



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 466 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 525

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 526 ggtattcctgctaa 539



to top

>gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mRNA, complete cds
          Length = 1105

 Score =  172 bits (87), Expect = 8e-40
 Identities = 192/227 (84%)
 Strand = Plus / Plus

                                                                       
Query: 222 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 281
           |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 157 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 216

                                                                       
Query: 282 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 341
           || ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| ||||||
Sbjct: 217 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 276

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           || || |||||  | |||||||| ||||||||||||| ||| || |||||||| || |||
Sbjct: 277 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 336

                                                          
Query: 402 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
           ||||||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 337 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 383



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 510 ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
           ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 445 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 504

                         
Query: 570 ggcattcctgctaa 583
           || |||||||||||
Sbjct: 505 ggtattcctgctaa 518



to top

>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence,
             complete sequence
          Length = 95310

 Score =  167 bits (84), Expect = 5e-38
 Identities = 189/224 (84%)
 Strand = Plus / Minus

                                                                         
Query: 225   ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
             ||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||||| 
Sbjct: 88836 ggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagggtt 88777

                                                                         
Query: 285   attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
             ||||| || || ||||||||  | ||||| ||||| ||||| || ||||| |||||||| 
Sbjct: 88776 attgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatggacaa 88717

                                                                         
Query: 345   agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
             || |||||  | |||||||| ||||||||||||| ||| || |||||||| || ||||||
Sbjct: 88716 agagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacacact 88657

                                                         
Query: 405   cctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 448
             |||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 88656 cctggtactttcactaaccaaatgcagacttctttcagtgagcc 88613



 Score = 44.1 bits (22), Expect = 0.51
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                         
Query: 510   ggaaacattcccaccattgccttctgcgacactgactctccgatgcgttacgttgatatt 569
             ||||||||||| || ||||||||||| ||||| || ||||| ||| | |  || || |||
Sbjct: 88462 ggaaacattccaactattgccttctgtgacacggattctccaatgggatttgtcgacatt 88403

                           
Query: 570   ggcattcctgctaa 583
             || |||||||||||
Sbjct: 88402 ggtattcctgctaa 88389



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  165 bits (83), Expect = 2e-37
 Identities = 104/111 (93%)
 Strand = Plus / Minus

                                                                           
Query: 108     cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
               ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 4320455 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320396

                                                                  
Query: 168     ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 218
               ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 4320395 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320345



 Score =  143 bits (72), Expect = 7e-31
 Identities = 216/264 (81%)
 Strand = Plus / Minus

                                                                           
Query: 225     ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
               ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| 
Sbjct: 4319939 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319880

                                                                           
Query: 285     attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
               |||||||| ||||| |||||||||||||||||||| || || ||  | ||||| || |||
Sbjct: 4319879 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319820

                                                                           
Query: 345     agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
                | || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || 
Sbjct: 4319819 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 4319760

                                                                           
Query: 405     cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
               ||||||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | 
Sbjct: 4319759 cctggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctc 4319700

                                       
Query: 465     actgaccccaggactgatcaccag 488
               |||||||| ||||| |||||||||
Sbjct: 4319699 actgacccaaggaccgatcaccag 4319676



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                           
Query: 486     cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
               ||||| || ||||||||||| || |||||||| || |||||||||||||| ||||| || 
Sbjct: 4319589 cagccaatcaaggagtctgctctgggaaacatcccgaccattgccttctgtgacaccgat 4319530

                                            
Query: 546     tctccgatgcgttacgttgatattggcat 574
               || || ||||| || || ||||| |||||
Sbjct: 4319529 tccccaatgcggtatgtcgatatcggcat 4319501



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 145      tgctcgccgccgacgtccacctcg 168
                ||||||||||||||||| ||||||
Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027



to top

>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score =  165 bits (83), Expect = 2e-37
 Identities = 104/111 (93%)
 Strand = Plus / Plus

                                                                          
Query: 108    cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
              ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 106042 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 106101

                                                                 
Query: 168    ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 218
              ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 106102 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 106152



 Score =  143 bits (72), Expect = 7e-31
 Identities = 216/264 (81%)
 Strand = Plus / Plus

                                                                          
Query: 225    ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
              ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| 
Sbjct: 106558 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 106617

                                                                          
Query: 285    attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
              |||||||| ||||| |||||||||||||||||||| || || ||  | ||||| || |||
Sbjct: 106618 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 106677

                                                                          
Query: 345    agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
               | || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || 
Sbjct: 106678 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 106737

                                                                          
Query: 405    cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
              ||||||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | 
Sbjct: 106738 cctggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctc 106797

                                      
Query: 465    actgaccccaggactgatcaccag 488
              |||||||| ||||| |||||||||
Sbjct: 106798 actgacccaaggaccgatcaccag 106821



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                          
Query: 486    cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
              ||||| || ||||||||||| || |||||||| || |||||||||||||| ||||| || 
Sbjct: 106908 cagccaatcaaggagtctgctctgggaaacatcccgaccattgccttctgtgacaccgat 106967

                                           
Query: 546    tctccgatgcgttacgttgatattggcat 574
              || || ||||| || || ||||| |||||
Sbjct: 106968 tccccaatgcggtatgtcgatatcggcat 106996



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  165 bits (83), Expect = 2e-37
 Identities = 104/111 (93%)
 Strand = Plus / Minus

                                                                           
Query: 108     cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 167
               ||||||||||| |||   ||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 4320570 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320511

                                                                  
Query: 168     ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 218
               ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 4320510 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320460



 Score =  143 bits (72), Expect = 7e-31
 Identities = 216/264 (81%)
 Strand = Plus / Minus

                                                                           
Query: 225     ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
               ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| 
Sbjct: 4320054 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319995

                                                                           
Query: 285     attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
               |||||||| ||||| |||||||||||||||||||| || || ||  | ||||| || |||
Sbjct: 4319994 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319935

                                                                           
Query: 345     agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
                | || || |||||||| || ||||||||||| ||  ||||||||||||| ||||| || 
Sbjct: 4319934 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 4319875

                                                                           
Query: 405     cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
               ||||||||||| ||||| ||| | || || || ||||| ||||| || || || ||| | 
Sbjct: 4319874 cctggtacatttaccaatcagctccagacctccttcagcgagccccgtctgctcatcctc 4319815

                                       
Query: 465     actgaccccaggactgatcaccag 488
               |||||||| ||||| |||||||||
Sbjct: 4319814 actgacccaaggaccgatcaccag 4319791



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                           
Query: 486     cagcctattaaggagtctgcacttggaaacattcccaccattgccttctgcgacactgac 545
               ||||| || ||||||||||| || |||||||| || |||||||||||||| ||||| || 
Sbjct: 4319704 cagccaatcaaggagtctgctctgggaaacatcccgaccattgccttctgtgacaccgat 4319645

                                            
Query: 546     tctccgatgcgttacgttgatattggcat 574
               || || ||||| || || ||||| |||||
Sbjct: 4319644 tccccaatgcggtatgtcgatatcggcat 4319616



 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 145      tgctcgccgccgacgtccacctcg 168
                ||||||||||||||||| ||||||
Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660



to top

>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score =  143 bits (72), Expect = 7e-31
 Identities = 216/264 (81%)
 Strand = Plus / Minus

                                                                         
Query: 225   ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
             |||||||| || || || ||||| || || |||||||| |||||  | || || ||||||
Sbjct: 42238 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 42179

                                                                         
Query: 285   attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
             || ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 42178 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 42119

                                                                         
Query: 345   agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
             || || ||||| |||||||| ||||||||||| ||||| || |||||||| || ||||||
Sbjct: 42118 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 42059

                                                                         
Query: 405   cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
             ||||| || || || || || ||||||  ||| ||||||||||| || ||||| ||| | 
Sbjct: 42058 cctggaacctttactaatcaaatgcaagtttccttcagtgagcctcgtcttctcatcctc 41999

                                     
Query: 465   actgaccccaggactgatcaccag 488
             ||||| || || ||||| ||||||
Sbjct: 41998 actgatcctagaactgaccaccag 41975



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 132   gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 191
             ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| 
Sbjct: 42991 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaa 42932

                  
Query: 192   atgga 196
             |||||
Sbjct: 42931 atgga 42927



to top

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score =  143 bits (72), Expect = 7e-31
 Identities = 216/264 (81%)
 Strand = Plus / Minus

                                                                        
Query: 225  ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 284
            |||||||| || || || ||||| || || |||||||| |||||  | || || ||||||
Sbjct: 7758 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 7699

                                                                        
Query: 285  attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 344
            || ||||| || || |||||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 7698 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 7639

                                                                        
Query: 345  agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 404
            || || ||||| |||||||| ||||||||||| ||||| || |||||||| || ||||||
Sbjct: 7638 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 7579

                                                                        
Query: 405  cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatcttg 464
            ||||| || || || || || ||||||  ||| ||||||||||| || ||||| ||| | 
Sbjct: 7578 cctggaacctttactaatcaaatgcaagtttccttcagtgagcctcgtcttctcatcctc 7519

                                    
Query: 465  actgaccccaggactgatcaccag 488
            ||||| || || ||||| ||||||
Sbjct: 7518 actgatcctagaactgaccaccag 7495



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 132  gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 191
            ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| 
Sbjct: 8511 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaa 8452

                 
Query: 192  atgga 196
            |||||
Sbjct: 8451 atgga 8447



to top

>emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH91ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1125

 Score =  123 bits (62), Expect = 7e-25
 Identities = 209/258 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 ccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttgg 247
           |||||||||||| ||||||| | || | |||   || ||||||||| |  || |||||||
Sbjct: 179 ccagatggagcgttacgtcttcgagagacgcgacgatggtatttacgtcttcgaccttgg 238

                                                                       
Query: 248 caagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaaccccca 307
           |||||  ||||| ||||| |||||||| || || || |||||||| ||||| ||||| ||
Sbjct: 239 caagagatgggaaaagctccagatggctgctagagttattgttgccattgagaacccaca 298

                                                                       
Query: 308 ggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgccca 367
           | ||||||| || || |  |||||||||||||||||||| |||||| | |||||||| ||
Sbjct: 299 gaacatcatcgtccagtgagctaggccctatggacagagagctgttttgaagtttgctca 358

                                                                       
Query: 368 gtacactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagat 427
           ||| ||||| || || |||||| |||| ||  | ||||||||||| ||||| || |||||
Sbjct: 359 gtagactggagcgaatgccatttctggcagaaaaactcctggtaccttcacaaatcagat 418

                             
Query: 428 gcaaacttcgttcagtga 445
           ||| || || ||||||||
Sbjct: 419 gcagacatccttcagtga 436



to top

>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full
           insert sequence
          Length = 1144

 Score =  119 bits (60), Expect = 1e-23
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 ctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctggga 259
           ||||||||||||||||||| | || ||||| ||||| |||||||| |||||||| |||||
Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225

                                                                       
Query: 260 gaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgt 319
           |||||| ||| | || || ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgt 285



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                       
Query: 465 actgaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcccacc 524
           |||||||| ||||| ||||||||||| || ||||||||||| || |||||||| || |||
Sbjct: 390 actgacccaaggaccgatcaccagccaatcaaggagtctgctctgggaaacatcccgacc 449

                                                             
Query: 525 attgccttctgcgacactgactctccgatgcgttacgttgatattggcat 574
           ||||||||||| ||||| || || || ||||| || || ||||| |||||
Sbjct: 450 attgccttctgtgacaccgattccccaatgcggtatgtcgatatcggcat 499



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 108 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtc 161
           ||||||||||| |||   ||||||||| | |||||||||||||||||| |||||
Sbjct: 119 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgcctacgtc 172



to top

>gb|BT017775.1| Zea mays clone EL01N0502H12.c mRNA sequence
          Length = 903

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 191/237 (80%), Gaps = 1/237 (0%)
 Strand = Plus / Plus

                                                                       
Query: 342 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 401
           ||||||||||  ||||| ||||| | | ||||||||||    ||||||||||| ||||||
Sbjct: 5   cagagggctgacctcaaatttgcgctgaacactggtgcccgtgccattgctggaaggcac 64

                                                                       
Query: 402 actcctggtacattcaccaaccag-atgcaaacttcgttcagtgagccacgccttcttat 460
           ||||||||||||| |||| ||||  ||||  || || |||  ||||||||  ||||||||
Sbjct: 65  actcctggtacatacaccgaccaatatgcttacctccttcgttgagccacttcttcttat 124

                                                                       
Query: 461 cttgactgaccccaggactgatcaccagcctattaaggagtctgcacttggaaacattcc 520
           |   |||||||| | ||||||||| ||||| |||||||||||||   ||| |||||||||
Sbjct: 125 ccatactgacccaatgactgatcatcagcccattaaggagtctgtgattgtaaacattcc 184

                                                                    
Query: 521 caccattgccttctgcgacactgactctccgatgcgttacgttgatattggcattcc 577
           | |||| |  ||||| || |||||||| || ||||  || |||||||||||| ||||
Sbjct: 185 ctccatcgtattctgtgatactgactcccctatgcactatgttgatattggctttcc 241



to top

>gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb001_104_J07, complete
             sequence
          Length = 103334

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                         
Query: 336   tatggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggt 395
             ||||| ||||| || |||||||||||||| ||||||| ||||||| | ||||||||||| 
Sbjct: 67616 tatgggcagagagcagttctcaagtttgctcagtacattggtgcttatgccattgctgga 67557

                                                                         
Query: 396   aggcacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgcctt 455
             ||||| || | || ||| |||| |||  || | |||||||| ||||||||||  ||||||
Sbjct: 67556 aggcatacccttgatactttcaacaattagcttcaaacttccttcagtgagcatcgcctt 67497

               
Query: 456   ct 457
             ||
Sbjct: 67496 ct 67495



to top

>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA
          Length = 2515

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                        
Query: 186  ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
            |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 1683 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 1742

                                         
Query: 246  ggcaagacctgggagaagcttcagatggc 274
            |||||||||||||||||||| ||| ||||
Sbjct: 1743 ggcaagacctgggagaagctgcagctggc 1771



to top

>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence
          Length = 627

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| | || ||  || ||||  ||||||| 
Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 195

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 196 ggcaagacctgggagaagctgcagctggc 224



to top

>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence
          Length = 579

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| | || ||  || ||||  ||||||| 
Sbjct: 61  ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 120

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 121 ggcaagacctgggagaagctgcagctggc 149



to top

>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7
          Length = 45861

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                         
Query: 186   ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
             |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 16963 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 16904

                                          
Query: 246   ggcaagacctgggagaagcttcagatggc 274
             |||||||||||||||||||| ||| ||||
Sbjct: 16903 ggcaagacctgggagaagctgcagctggc 16875



to top

>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                          
Query: 186    ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
              |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 159534 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 159475

                                           
Query: 246    ggcaagacctgggagaagcttcagatggc 274
              |||||||||||||||||||| ||| ||||
Sbjct: 159474 ggcaagacctgggagaagctgcagctggc 159446



to top

>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA
          Length = 1104

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362



to top

>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA
          Length = 964

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 759 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 700

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 699 ggcaagacctgggagaagctgcagctggc 671



to top

>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D
           (sta), mRNA
          Length = 1041

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 223 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 282

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 283 ggcaagacctgggagaagctgcagctggc 311



to top

>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B
           (sta), mRNA
          Length = 1089

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362



to top

>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end
          Length = 1272

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 176 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 235

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 236 ggcaagacctgggagaagctgcagctggc 264



to top

>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A
           (sta), mRNA
          Length = 1236

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 421 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 480

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 481 ggcaagacctgggagaagctgcagctggc 509



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                         
Query: 186   ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
             |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 22118 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 22059

                                          
Query: 246   ggcaagacctgggagaagcttcagatggc 274
             |||||||||||||||||||| ||| ||||
Sbjct: 22058 ggcaagacctgggagaagctgcagctggc 22030



to top

>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds
          Length = 902

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| |||| ||  |  ||||  ||||||| 
Sbjct: 93  ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 152

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 153 ggcaagacctgggagaagctgcagctggc 181



to top

>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds
          Length = 1545

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 245
           |||||||||||||  ||||| |||||||||||| | || ||  || ||||  ||||||| 
Sbjct: 723 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 782

                                        
Query: 246 ggcaagacctgggagaagcttcagatggc 274
           |||||||||||||||||||| ||| ||||
Sbjct: 783 ggcaagacctgggagaagctgcagctggc 811



to top

>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195



to top

>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197



to top

>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 198



to top

>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215



to top

>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 206



to top

>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 96  ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 154



to top

>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 164 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 222



to top

>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 212



to top

>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 981 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 923



to top

>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 223



to top

>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219



to top

>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219



to top

>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 228



to top

>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195



to top

>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 216



to top

>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207



to top

>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 214



to top

>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208



to top

>emb|BX025854.1|CNS08S42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 210



to top

>emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195



to top

>emb|BX020718.1|CNS08O5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207



to top

>emb|BX015795.1|CNS08KCN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208



to top

>emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197



to top

>emb|BX015037.1|CNS08JRL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215



to top

>emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203



to top

>emb|BX012242.1|CNS08HLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 359

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203



to top

>emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 126 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 184



to top

>emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226



to top

>ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171
           (ENSANGG00000017682), partial mRNA
          Length = 803

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226



to top

>emb|BX006256.1|CNS08CZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 184 atttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacc 243
           |||||||||||||||  ||||| |||||||||||||| |||||| |  |||| |||||||
Sbjct: 134 atttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

            
Query: 244 t 244
           |
Sbjct: 194 t 194



to top

>gb|AY857457.1| Suberites domuncula SA mRNA, complete cds
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 ttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggta 411
           |||||||||||||||| |||||||| ||   | ||||||||||| |   |||||||||||
Sbjct: 260 ttctcaagtttgcccactacactggrgccttccccattgctggtcgtttcactcctggta 319

                           
Query: 412 cattcaccaaccagat 427
           | ||||| ||||||||
Sbjct: 320 cgttcactaaccagat 335



to top

>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163



to top

>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223



to top

>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198



to top

>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206



to top

>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193



to top

>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214



to top

>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 99  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 157



to top

>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 116 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 174



to top

>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202



to top

>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211



to top

>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207



to top

>emb|BX069252.1|CNS09PLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217



to top

>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214



to top

>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181



to top

>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 572

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203



to top

>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 962 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 904



to top

>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200



to top

>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204



to top

>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 162 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 220



to top

>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897



to top

>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199



to top

>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206



to top

>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211



to top

>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204



to top

>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 194



to top

>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210



to top

>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204



to top

>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218



to top

>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212



to top

>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199



to top

>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204



to top

>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196



to top

>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 169 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 227



to top

>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210



to top

>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213



to top

>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  || || ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 954 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 896



to top

>emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  || || ||||||||||||||||||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 211



to top

>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219



to top

>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203



to top

>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacct 897



to top

>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206



to top

>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211



to top

>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211



to top

>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217



to top

>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198



to top

>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219



to top

>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219



to top

>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204



to top

>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196



to top

>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214



to top

>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 93  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 151



to top

>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 131 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 189



to top

>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202



to top

>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 193

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 97  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 155



to top

>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211



to top

>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 107 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 165



to top

>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 977 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 919



to top

>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187



to top

>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 58  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 116



to top

>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213



to top

>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 285

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212



to top

>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213



to top

>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 228



to top

>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181



to top

>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218



to top

>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163



to top

>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 121 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 179



to top

>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 163 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 221



to top

>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199



to top

>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217



to top

>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 338

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186



to top

>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 215



to top

>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 166 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 224



to top

>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186



to top

>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212



to top

>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203



to top

>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202



to top

>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214



to top

>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195



to top

>emb|BX041242.1|CNS093ZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 864 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 806



to top

>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180



to top

>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 226



to top

>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193



to top

>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 83  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 141



to top

>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195



to top

>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180



to top

>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 216



to top

>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 82  ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 140



to top

>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187



to top

>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207



to top

>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897



to top

>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1079

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200



to top

>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219



to top

>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201



to top

>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206



to top

>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 979 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 921



to top

>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209



to top

>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210



to top

>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 991 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 933



to top

>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223



to top

>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200



to top

>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 984 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 926



to top

>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218



to top

>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205



to top

>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213



to top

>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203



to top

>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212



to top

>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213



to top

>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217



to top

>emb|BX031154.1|CNS08W7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208



to top

>emb|BX031118.1|CNS08W6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210



to top

>emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206



to top

>emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195



to top

>emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 194



to top

>emb|BX029939.1|CNS08V9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202



to top

>emb|BX029906.1|CNS08V8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 186 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 244
           |||||||||||||  ||||| |||||||||||||| |||||| |  |||| ||||||||
Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,121,771
Number of Sequences: 3902068
Number of extensions: 4121771
Number of successful extensions: 90504
Number of sequences better than 10.0: 633
Number of HSP's better than 10.0 without gapping: 526
Number of HSP's successfully gapped in prelim test: 109
Number of HSP's that attempted gapping in prelim test: 89115
Number of HSP's gapped (non-prelim): 1314
length of query: 586
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 563
effective length of database: 17,143,297,704
effective search space: 9651676607352
effective search space used: 9651676607352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top