ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart29b08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC163998.2| Mus musculus chromosome 15, clone RP24-326H11, co... 42 0.15
2gb|AC163999.3| Mus musculus chromosome 15, clone RP24-387E19, co... 42 0.15
3emb|AL137073.13| Human DNA sequence from clone RP11-404F11 on ch... 40 0.59
4gb|AC159197.3| Mus musculus BAC clone RP23-421P10 from chromosom... 38 2.3
5gb|AC125331.4| Mus musculus chromosome 7 clone RP23-11L1, comple... 38 2.3
6gb|AC098715.3| Mus musculus BAC clone RP23-2D23 from 7, complete... 38 2.3
7gb|AC006357.5| Homo sapiens PAC clone RP5-1121A15 from 7, comple... 38 2.3
8gb|AC007861.5| Homo sapiens chromosome 16 clone RP11-189E14, com... 38 2.3
9gb|AC107742.10| Mus musculus chromosome 15, clone RP23-331D7, co... 38 2.3
10emb|BX323820.4| Zebrafish DNA sequence from clone CH211-251K4 in... 38 2.3
11gb|U07663.1|HSHB9HB1 Homo sapiens HB9 homeobox gene, exon 1 38 2.3
12gb|AC152395.9| Mus musculus chromosome 15, clone RP23-391D2, com... 38 2.3
13gb|AC060234.11| Homo sapiens chromosome 10 clone RP11-523O18, co... 38 2.3
14gb|AC084727.14| Homo sapiens chromosome 10 clone RP11-507P23, co... 38 2.3
15gb|AC104612.1| Drosophila melanogaster, chromosome 2R, region 52... 38 2.3
16ref|XM_684701.1| PREDICTED: Danio rerio similar to protocadherin... 38 2.3
17gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, r... 38 2.3
18gb|AC007572.5|AC007572 Drosophila melanogaster, chromosome 2R, r... 38 2.3
19gb|AC007614.7| Homo sapiens chromosome 16 clone RP11-491F9, comp... 38 2.3
20gb|AC147215.4| Pan troglodytes BAC clone RP43-141N5 from chromos... 38 2.3
21gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43... 38 2.3
22gb|AC004318.1|AC004318 Drosophila melanogaster DNA sequence (P1 ... 38 2.3
23gb|AC166491.8| Mus musculus chromosome 15, clone RP24-380A15, co... 36 9.3
24gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 36 9.3
25gb|AC130658.36| Mus musculus chromosome 1, clone RP23-309D5, com... 36 9.3
26gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold 36 9.3
27gb|AC146879.2| Otolemur garnettii clone CH256-29L3, complete seq... 36 9.3
28gb|AC129608.3| Mus musculus BAC clone RP23-193A2 from chromosome... 36 9.3
29gb|AC140333.2| Mus musculus BAC clone RP24-326A21 from chromosom... 36 9.3
30gb|AC100708.10| Mus musculus chromosome 10, clone RP23-169I18, c... 36 9.3
31gb|AC036146.10| Mus musculus chromosome 5, clone RP23-294A15, co... 36 9.3
32gb|AC163023.4| Mus musculus chromosome 3, clone RP24-247E19, com... 36 9.3
33gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, co... 36 9.3
34gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome... 36 9.3
35gb|AC133607.3| Mus musculus BAC clone RP23-153N7 from chromosome... 36 9.3
36emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, co... 36 9.3
37gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome ... 36 9.3
38gb|AC003009.1|HUAC003009 Homo sapiens Chromosome 16 BAC clone CI... 36 9.3
39gb|AC129303.5| Mus musculus BAC clone RP24-447E12 from chromosom... 36 9.3
40gb|AC127234.3| Mus musculus BAC clone RP24-566K14 from chromosom... 36 9.3
41gb|AC122843.2| Mus musculus BAC clone RP23-149L20 from 6, comple... 36 9.3
42gb|AC116327.4| Mus musculus BAC clone RP24-68L14 from 7, complet... 36 9.3
43emb|AL359832.33| Human DNA sequence from clone RP11-790G19 on ch... 36 9.3
44emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chr... 36 9.3
45gb|AC127173.17| Mus musculus strain C57BL/6J clone rp23-39k4 map... 36 9.3
46emb|AL138766.10| Human DNA sequence from clone RP11-469M11 on ch... 36 9.3
47emb|AL135785.10| Human DNA sequence from clone RP11-113O24 on ch... 36 9.3
48gb|AC161529.4| Mus musculus chromosome 5, clone RP24-316L21, com... 36 9.3
49gb|AC144442.3| Homo sapiens fosmid clone XXFOS-83337D2 from 4, c... 36 9.3
50gb|AC123178.4| Rattus norvegicus 7 BAC CH230-20I17 (Children's H... 36 9.3
51ref|XM_795027.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 36 9.3
52ref|XM_795022.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 36 9.3
53gb|AC161001.4| Mus musculus BAC clone RP23-30A18 from chromosome... 36 9.3
54emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on ch... 36 9.3
55emb|AL603913.14| Mouse DNA sequence from clone RP23-103H9 on chr... 36 9.3
56gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cance... 36 9.3
57gb|AC109352.3| Homo sapiens BAC clone RP11-489P20 from 4, comple... 36 9.3
58gb|AC096506.5| Homo sapiens Xp BAC RP11-64I1 (Roswell Park Cance... 36 9.3
59gb|AC093830.3| Homo sapiens BAC clone RP11-401G24 from 4, comple... 36 9.3
60gb|AC074194.6| Homo sapiens BAC clone RP11-739P1 from 4, complet... 36 9.3
61gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome 36 9.3
62gb|DP000004.1| Lemur catta target 1 genomic scaffold 36 9.3
63gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 36 9.3
64gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome... 36 9.3
65gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X... 36 9.3
66gb|AC153548.4| Mus musculus 10 BAC RP23-356G7 (Roswell Park Canc... 36 9.3
67gb|AC083816.21|AC083816 Mus musculus X BAC RP23-330G24 (Roswell ... 36 9.3
68gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 36 9.3
69gb|AC093798.3| Homo sapiens BAC clone RP11-306N14 from 2, comple... 36 9.3
70gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complet... 36 9.3
71gb|AC013444.8| Homo sapiens BAC clone RP11-470B22 from 2, comple... 36 9.3
72gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence 36 9.3
73emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 36 9.3
74ref|XM_551149.1| Anopheles gambiae str. PEST ENSANGP00000028152 ... 36 9.3
75ref|XM_321436.2| Anopheles gambiae str. PEST ENSANGP00000022055 ... 36 9.3
76gb|AC140346.4| Mus musculus BAC clone RP24-260I8 from 16, comple... 36 9.3
77emb|AL772352.8| Mouse DNA sequence from clone RP23-147F6 on chro... 36 9.3
78emb|AL928803.6| Mouse DNA sequence from clone RP23-319N14 on chr... 36 9.3
79gb|AE000512.1| Thermotoga maritima MSB8, complete genome 36 9.3
80emb|AM156932.1| Streptomyces steffisburgensis cluster for steffi... 36 9.3
81gb|AC133170.2| Mus musculus BAC clone RP24-267K11 from 3, comple... 36 9.3
82emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chr... 36 9.3 
>gb|AC163998.2| Mus musculus chromosome 15, clone RP24-326H11, complete sequence
          Length = 153996

 Score = 42.1 bits (21), Expect = 0.15
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 30    taccttgccttctcttcctct 50
             |||||||||||||||||||||
Sbjct: 35746 taccttgccttctcttcctct 35726
to top
>gb|AC163999.3| Mus musculus chromosome 15, clone RP24-387E19, complete sequence
          Length = 163830

 Score = 42.1 bits (21), Expect = 0.15
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 30     taccttgccttctcttcctct 50
              |||||||||||||||||||||
Sbjct: 157277 taccttgccttctcttcctct 157257
to top
>emb|AL137073.13| Human DNA sequence from clone RP11-404F11 on chromosome 9p23-24.1
             Contains a novel gene encoding a protein similar to
             bacterial N-acetylneuraminic acid condensing enzyme (NEUB)
             and 3' end of the TBCID2 gene, a TRIM14 gene encoding
             tripartite motif-containing 14 (KIAA0129), the CORO2A gene
             encoding Coronin 2A (actin-binding protein), TBC1D2 gene
             encoding TBC1 domain family, member 2 (PARIS1,
             PARIS-1,DKFZP761D1823, DKFZp761D1823), and 4 CpG islands,
             complete sequence
          Length = 201300

 Score = 40.1 bits (20), Expect = 0.59
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ccttctcttcctctggctgg 56
             ||||||||||||||||||||
Sbjct: 73734 ccttctcttcctctggctgg 73715
to top
>gb|AC159197.3| Mus musculus BAC clone RP23-421P10 from chromosome 12, complete
             sequence
          Length = 188400

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    cttgccttctcttcctctg 51
             |||||||||||||||||||
Sbjct: 79980 cttgccttctcttcctctg 79962
to top
>gb|AC125331.4| Mus musculus chromosome 7 clone RP23-11L1, complete sequence
          Length = 255921

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    catgtactaccttgccttc 41
             |||||||||||||||||||
Sbjct: 48680 catgtactaccttgccttc 48698
to top
>gb|AC098715.3| Mus musculus BAC clone RP23-2D23 from 7, complete sequence
          Length = 247835

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 23     catgtactaccttgccttc 41
              |||||||||||||||||||
Sbjct: 216509 catgtactaccttgccttc 216527
to top
>gb|AC006357.5| Homo sapiens PAC clone RP5-1121A15 from 7, complete sequence
          Length = 130492

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    ccttgccttctcttcctct 50
             |||||||||||||||||||
Sbjct: 17526 ccttgccttctcttcctct 17544
to top
>gb|AC007861.5| Homo sapiens chromosome 16 clone RP11-189E14, complete sequence
          Length = 175861

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 29     ctaccttgccttctcttcc 47
              |||||||||||||||||||
Sbjct: 126645 ctaccttgccttctcttcc 126663
to top
>gb|AC107742.10| Mus musculus chromosome 15, clone RP23-331D7, complete sequence
          Length = 223952

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    accttgccttctcttcctc 49
             |||||||||||||||||||
Sbjct: 31316 accttgccttctcttcctc 31298
to top
>emb|BX323820.4| Zebrafish DNA sequence from clone CH211-251K4 in linkage group 4
            Contains the gene for a novel protein similar to
            vertebrate calcium channel voltage-dependent alpha
            2/delta subunit 1 (CACNA2D1) and a CpG island, complete
            sequence
          Length = 172228

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 39   ttctcttcctctggctggc 57
            |||||||||||||||||||
Sbjct: 4454 ttctcttcctctggctggc 4472
to top
>gb|U07663.1|HSHB9HB1 Homo sapiens HB9 homeobox gene, exon 1
          Length = 3905

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 32   ccttgccttctcttcctct 50
            |||||||||||||||||||
Sbjct: 3550 ccttgccttctcttcctct 3568
to top
>gb|AC152395.9| Mus musculus chromosome 15, clone RP23-391D2, complete sequence
          Length = 210006

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     accttgccttctcttcctc 49
              |||||||||||||||||||
Sbjct: 142945 accttgccttctcttcctc 142927
to top
>gb|AC060234.11| Homo sapiens chromosome 10 clone RP11-523O18, complete sequence
          Length = 170073

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     ctaccttgccttctcttcc 47
              |||||||||||||||||||
Sbjct: 110941 ctaccttgccttctcttcc 110923
to top
>gb|AC084727.14| Homo sapiens chromosome 10 clone RP11-507P23, complete sequence
          Length = 188652

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   ctaccttgccttctcttcc 47
            |||||||||||||||||||
Sbjct: 9968 ctaccttgccttctcttcc 9950
to top
>gb|AC104612.1| Drosophila melanogaster, chromosome 2R, region 52F-53A, BAC clone
             BACR29I14, complete sequence
          Length = 169877

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    ccttgccttctcttcctct 50
             |||||||||||||||||||
Sbjct: 23289 ccttgccttctcttcctct 23307
to top
>ref|XM_684701.1| PREDICTED: Danio rerio similar to protocadherin 15a (LOC561298), mRNA
          Length = 2017

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 39   ttctcttcctctggctggc 57
            |||||||||||||||||||
Sbjct: 1586 ttctcttcctctggctggc 1604
to top
>gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, region 52E-53A, BAC clone
            BACR25I17, complete sequence
          Length = 157835

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 32   ccttgccttctcttcctct 50
            |||||||||||||||||||
Sbjct: 2061 ccttgccttctcttcctct 2043
to top
>gb|AC007572.5|AC007572 Drosophila melanogaster, chromosome 2R, region 53A-53B, BAC clone
             BACR21B04, complete sequence
          Length = 156823

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    ccttgccttctcttcctct 50
             |||||||||||||||||||
Sbjct: 95479 ccttgccttctcttcctct 95461
to top
>gb|AC007614.7| Homo sapiens chromosome 16 clone RP11-491F9, complete sequence
          Length = 192347

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    ctaccttgccttctcttcc 47
             |||||||||||||||||||
Sbjct: 17717 ctaccttgccttctcttcc 17735
to top
>gb|AC147215.4| Pan troglodytes BAC clone RP43-141N5 from chromosome 7, complete
             sequence
          Length = 179309

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    ccttgccttctcttcctct 50
             |||||||||||||||||||
Sbjct: 39834 ccttgccttctcttcctct 39816
to top
>gb|AE003807.3| Drosophila melanogaster chromosome 2R, section 43 of 73 of the complete
             sequence
          Length = 258223

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    ccttgccttctcttcctct 50
             |||||||||||||||||||
Sbjct: 37676 ccttgccttctcttcctct 37658
to top
>gb|AC004318.1|AC004318 Drosophila melanogaster DNA sequence (P1 DS06464 (D212)), complete
            sequence
          Length = 86188

 Score = 38.2 bits (19), Expect = 2.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 32   ccttgccttctcttcctct 50
            |||||||||||||||||||
Sbjct: 3420 ccttgccttctcttcctct 3402
to top
>gb|AC166491.8| Mus musculus chromosome 15, clone RP24-380A15, complete sequence
          Length = 154673

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 132533 acatgtactaccttgcct 132516
to top
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 42      tcttcctctggctggcgg 59
               ||||||||||||||||||
Sbjct: 2728033 tcttcctctggctggcgg 2728016
to top
>gb|AC130658.36| Mus musculus chromosome 1, clone RP23-309D5, complete sequence
          Length = 184094

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    acatgtactaccttgcct 39
             ||||||||||||||||||
Sbjct: 21476 acatgtactaccttgcct 21459
to top
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 37     ccttctcttcctctggct 54
              ||||||||||||||||||
Sbjct: 651685 ccttctcttcctctggct 651668
to top
>gb|AC146879.2| Otolemur garnettii clone CH256-29L3, complete sequence
          Length = 166428

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 37    ccttctcttcctctggct 54
             ||||||||||||||||||
Sbjct: 67860 ccttctcttcctctggct 67843
to top
>gb|AC129608.3| Mus musculus BAC clone RP23-193A2 from chromosome 5, complete sequence
          Length = 240180

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 39    ttctcttcctctggctgg 56
             ||||||||||||||||||
Sbjct: 29748 ttctcttcctctggctgg 29765
to top
>gb|AC140333.2| Mus musculus BAC clone RP24-326A21 from chromosome 10, complete
             sequence
          Length = 157738

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    acatgtactaccttgcct 39
             ||||||||||||||||||
Sbjct: 18526 acatgtactaccttgcct 18543
to top
>gb|AC100708.10| Mus musculus chromosome 10, clone RP23-169I18, complete sequence
          Length = 196776

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 33    cttgccttctcttcctct 50
             ||||||||||||||||||
Sbjct: 74138 cttgccttctcttcctct 74121
to top
>gb|AC036146.10| Mus musculus chromosome 5, clone RP23-294A15, complete sequence
          Length = 196168

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 39     ttctcttcctctggctgg 56
              ||||||||||||||||||
Sbjct: 101926 ttctcttcctctggctgg 101909
to top
>gb|AC163023.4| Mus musculus chromosome 3, clone RP24-247E19, complete sequence
          Length = 166206

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 36    gccttctcttcctctggc 53
             ||||||||||||||||||
Sbjct: 21780 gccttctcttcctctggc 21763
to top
>gb|AC099621.12| Mus musculus chromosome 15, clone RP23-468J2, complete sequence
          Length = 178810

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 130878 acatgtactaccttgcct 130895
to top
>gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome 5, complete sequence
          Length = 198890

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    acatgtactaccttgcct 39
             ||||||||||||||||||
Sbjct: 83429 acatgtactaccttgcct 83412
to top
>gb|AC133607.3| Mus musculus BAC clone RP23-153N7 from chromosome 18, complete sequence
          Length = 223708

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 197303 acatgtactaccttgcct 197320
to top
>emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, complete sequence
          Length = 195301

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 34    ttgccttctcttcctctg 51
             ||||||||||||||||||
Sbjct: 93132 ttgccttctcttcctctg 93149
to top
>gb|AC116656.5| Mus musculus BAC clone RP23-10A7 from chromosome 15, complete sequence
          Length = 198019

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 120522 acatgtactaccttgcct 120505
to top
>gb|AC003009.1|HUAC003009 Homo sapiens Chromosome 16 BAC clone CIT987-SK502C10, complete sequence
          Length = 152503

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 33    cttgccttctcttcctct 50
             ||||||||||||||||||
Sbjct: 72765 cttgccttctcttcctct 72782
to top
>gb|AC129303.5| Mus musculus BAC clone RP24-447E12 from chromosome 10, complete
             sequence
          Length = 135245

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    acatgtactaccttgcct 39
             ||||||||||||||||||
Sbjct: 84657 acatgtactaccttgcct 84674
to top
>gb|AC127234.3| Mus musculus BAC clone RP24-566K14 from chromosome 18, complete
             sequence
          Length = 181515

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    acatgtactaccttgcct 39
             ||||||||||||||||||
Sbjct: 31395 acatgtactaccttgcct 31412
to top
>gb|AC122843.2| Mus musculus BAC clone RP23-149L20 from 6, complete sequence
          Length = 207070

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 32     ccttgccttctcttcctc 49
              ||||||||||||||||||
Sbjct: 104374 ccttgccttctcttcctc 104357
to top
>gb|AC116327.4| Mus musculus BAC clone RP24-68L14 from 7, complete sequence
          Length = 194290

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 151885 acatgtactaccttgcct 151902
to top
>emb|AL359832.33| Human DNA sequence from clone RP11-790G19 on chromosome 10 Contains
            the 5' end of the gene for transmembrane receptor Unc5H2
            (UNC5H2),the 3'end of a novel gene and two CpG islands,
            complete sequence
          Length = 195130

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 34   ttgccttctcttcctctg 51
            ||||||||||||||||||
Sbjct: 8975 ttgccttctcttcctctg 8992
to top
>emb|AL359262.9| Human DNA sequence from clone RP11-334O13 on chromosome 13 Contains a
              high-mobility group pseudogene, complete sequence
          Length = 162763

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 28     actaccttgccttctcttcctc 49
              ||||||||||||| ||||||||
Sbjct: 148730 actaccttgccttatcttcctc 148709
to top
>gb|AC127173.17| Mus musculus strain C57BL/6J clone rp23-39k4 map 10, complete sequence
          Length = 228883

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 28    actaccttgccttctctt 45
             ||||||||||||||||||
Sbjct: 47762 actaccttgccttctctt 47745
to top
>emb|AL138766.10| Human DNA sequence from clone RP11-469M11 on chromosome 10, complete
             sequence
          Length = 131207

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 35    tgccttctcttcctctggctgg 56
             ||||| ||||||||||||||||
Sbjct: 54665 tgcctcctcttcctctggctgg 54686
to top
>emb|AL135785.10| Human DNA sequence from clone RP11-113O24 on chromosome 9p11-13.3
             Contains a novel gene, possible ortholog of mouse
             insulin-like growth factor binding protein 7 (IGFBP7), a
             novel gene similar to aldehyde dehydrogenase 1 family,
             member B1 (ALDH5, ALDHX, MGC2230) (ALDH1B1), a novel gene
             and four CpG islands, complete sequence
          Length = 166207

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 32    ccttgccttctcttcctc 49
             ||||||||||||||||||
Sbjct: 82064 ccttgccttctcttcctc 82081
to top
>gb|AC161529.4| Mus musculus chromosome 5, clone RP24-316L21, complete sequence
          Length = 184502

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 39     ttctcttcctctggctgg 56
              ||||||||||||||||||
Sbjct: 111850 ttctcttcctctggctgg 111867
to top
>gb|AC144442.3| Homo sapiens fosmid clone XXFOS-83337D2 from 4, complete sequence
          Length = 41051

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 40   tctcttcctctggctggc 57
            ||||||||||||||||||
Sbjct: 2387 tctcttcctctggctggc 2370
to top
>gb|AC123178.4| Rattus norvegicus 7 BAC CH230-20I17 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 221236

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 212305 acatgtactaccttgcct 212322
to top
>ref|XM_795027.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
            LOC581103 (LOC581103), mRNA
          Length = 1548

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 33   cttgccttctcttcctct 50
            ||||||||||||||||||
Sbjct: 1367 cttgccttctcttcctct 1350
to top
>ref|XM_795022.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
            LOC581042 (LOC581042), mRNA
          Length = 2067

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 33   cttgccttctcttcctct 50
            ||||||||||||||||||
Sbjct: 1532 cttgccttctcttcctct 1515



 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 33   cttgccttctcttcctct 50
            ||||||||||||||||||
Sbjct: 1514 cttgccttctcttcctct 1497
to top
>gb|AC161001.4| Mus musculus BAC clone RP23-30A18 from chromosome 14, complete sequence
          Length = 215474

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 34    ttgccttctcttcctctg 51
             ||||||||||||||||||
Sbjct: 54951 ttgccttctcttcctctg 54934
to top
>emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on chromosome 11 Contains the
              P4ha2 gene for procollagen-proline 2-oxoglutarate
              4-dioxygenase (proline 4-hydroxylase) alpha II polypeptide,
              a novel pseudogene, two novel genes, a diazepam binding
              inhibitor (Dbi) pseudogene, the Csf2 gene for colony
              stimulating factor 2 (granulocyte-macrophage), the Il3 gene
              for interleukin 3 and a CpG island, complete sequence
          Length = 199500

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 35     tgccttctcttcctctgg 52
              ||||||||||||||||||
Sbjct: 139328 tgccttctcttcctctgg 139311
to top
>emb|AL603913.14| Mouse DNA sequence from clone RP23-103H9 on chromosome 11 Contains the
             gene for a novel protein (3732413I11Rik), a novel gene
             (4930597A21Rik), the 5' end of the Ebf1 gene for early
             B-cell factor 1, a novel gene and a CpG island, complete
             sequence
          Length = 215524

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 23    catgtactaccttgcctt 40
             ||||||||||||||||||
Sbjct: 13302 catgtactaccttgcctt 13285
to top
>gb|AC108709.3| Homo sapiens 3 BAC RP11-81P15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179223

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 34    ttgccttctcttcctctg 51
             ||||||||||||||||||
Sbjct: 15220 ttgccttctcttcctctg 15203
to top
>gb|AC109352.3| Homo sapiens BAC clone RP11-489P20 from 4, complete sequence
          Length = 157443

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 40   tctcttcctctggctggc 57
            ||||||||||||||||||
Sbjct: 1295 tctcttcctctggctggc 1312
to top
>gb|AC096506.5| Homo sapiens Xp BAC RP11-64I1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 120135

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 34    ttgccttctcttcctctg 51
             ||||||||||||||||||
Sbjct: 24265 ttgccttctcttcctctg 24248
to top
>gb|AC093830.3| Homo sapiens BAC clone RP11-401G24 from 4, complete sequence
          Length = 153887

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 40     tctcttcctctggctggc 57
              ||||||||||||||||||
Sbjct: 153182 tctcttcctctggctggc 153199
to top
>gb|AC074194.6| Homo sapiens BAC clone RP11-739P1 from 4, complete sequence
          Length = 177273

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 33     cttgccttctcttcctct 50
              ||||||||||||||||||
Sbjct: 112716 cttgccttctcttcctct 112733
to top
>gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome
          Length = 1176248

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 33     cttgccttctcttcctct 50
              ||||||||||||||||||
Sbjct: 946810 cttgccttctcttcctct 946827
to top
>gb|DP000004.1| Lemur catta target 1 genomic scaffold
          Length = 1399362

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 28      actaccttgccttctctt 45
               ||||||||||||||||||
Sbjct: 1341023 actaccttgccttctctt 1341006
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 45      tcctctggctggcggccc 62
               ||||||||||||||||||
Sbjct: 2754372 tcctctggctggcggccc 2754355
to top
>gb|AC157941.4| Mus musculus BAC clone RP24-253I2 from chromosome 3, complete sequence
          Length = 204323

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 40     tctcttcctctggctggc 57
              ||||||||||||||||||
Sbjct: 108220 tctcttcctctggctggc 108203
to top
>gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X, complete sequence
          Length = 181559

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 34    ttgccttctcttcctctg 51
             ||||||||||||||||||
Sbjct: 22265 ttgccttctcttcctctg 22248
to top
>gb|AC153548.4| Mus musculus 10 BAC RP23-356G7 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 194511

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 28    actaccttgccttctctt 45
             ||||||||||||||||||
Sbjct: 96038 actaccttgccttctctt 96055
to top
>gb|AC083816.21|AC083816 Mus musculus X BAC RP23-330G24 (Roswell Park Cancer Institute Mouse BAC
              Library) complete sequence
          Length = 187691

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 170818 acatgtactaccttgcct 170801
to top
>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 28      actaccttgccttctctt 45
               ||||||||||||||||||
Sbjct: 1408019 actaccttgccttctctt 1408002
to top
>gb|AC093798.3| Homo sapiens BAC clone RP11-306N14 from 2, complete sequence
          Length = 233877

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 39   ttctcttcctctggctgg 56
            ||||||||||||||||||
Sbjct: 3553 ttctcttcctctggctgg 3536
to top
>gb|AC012450.9| Homo sapiens BAC clone RP11-351J7 from 2, complete sequence
          Length = 183695

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 39    ttctcttcctctggctgg 56
             ||||||||||||||||||
Sbjct: 94462 ttctcttcctctggctgg 94445
to top
>gb|AC013444.8| Homo sapiens BAC clone RP11-470B22 from 2, complete sequence
          Length = 192815

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 33    cttgccttctcttcctct 50
             ||||||||||||||||||
Sbjct: 39848 cttgccttctcttcctct 39831
to top
>gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence
          Length = 222919

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 28     actaccttgccttctctt 45
              ||||||||||||||||||
Sbjct: 164580 actaccttgccttctctt 164563
to top
>emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chromosome X, complete
             sequence
          Length = 216656

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 37    ccttctcttcctctggct 54
             ||||||||||||||||||
Sbjct: 39383 ccttctcttcctctggct 39366
to top
>ref|XM_551149.1| Anopheles gambiae str. PEST ENSANGP00000028152
          (ENSANGG00000022697), partial mRNA
          Length = 2019

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 17 gccgaacatgtactacct 34
          ||||||||||||||||||
Sbjct: 37 gccgaacatgtactacct 20
to top
>ref|XM_321436.2| Anopheles gambiae str. PEST ENSANGP00000022055 (ENSANGG00000019566),
            partial mRNA
          Length = 1899

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 17   gccgaacatgtactacct 34
            ||||||||||||||||||
Sbjct: 1830 gccgaacatgtactacct 1847
to top
>gb|AC140346.4| Mus musculus BAC clone RP24-260I8 from 16, complete sequence
          Length = 185587

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 29    ctaccttgccttctcttc 46
             ||||||||||||||||||
Sbjct: 80570 ctaccttgccttctcttc 80587
to top
>emb|AL772352.8| Mouse DNA sequence from clone RP23-147F6 on chromosome 2, complete
              sequence
          Length = 204438

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     acatgtactaccttgcct 39
              ||||||||||||||||||
Sbjct: 188291 acatgtactaccttgcct 188308
to top
>emb|AL928803.6| Mouse DNA sequence from clone RP23-319N14 on chromosome 2, complete
             sequence
          Length = 109092

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 24    atgtactaccttgccttctctt 45
             |||| |||||||||||||||||
Sbjct: 97570 atgttctaccttgccttctctt 97549
to top
>gb|AE000512.1| Thermotoga maritima MSB8, complete genome
          Length = 1860725

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 30      taccttgccttctcttcc 47
               ||||||||||||||||||
Sbjct: 1640717 taccttgccttctcttcc 1640734
to top
>emb|AM156932.1| Streptomyces steffisburgensis cluster for steffimycin biosynthesis,
            strain NRRL 3193
          Length = 42877

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    agatccaccggccgaaca 24
            ||||||||||||||||||
Sbjct: 4973 agatccaccggccgaaca 4956
to top
>gb|AC133170.2| Mus musculus BAC clone RP24-267K11 from 3, complete sequence
          Length = 158692

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 40     tctcttcctctggctggc 57
              ||||||||||||||||||
Sbjct: 128982 tctcttcctctggctggc 128999
to top
>emb|AL772271.11| Mouse DNA sequence from clone RP23-17P12 on chromosome 2, complete
             sequence
          Length = 204136

 Score = 36.2 bits (18), Expect = 9.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 32    ccttgccttctcttcctc 49
             ||||||||||||||||||
Sbjct: 29369 ccttgccttctcttcctc 29386


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 624,564
Number of Sequences: 3902068
Number of extensions: 624564
Number of successful extensions: 56466
Number of sequences better than 10.0: 82
Number of HSP's better than 10.0 without gapping: 82
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56256
Number of HSP's gapped (non-prelim): 210
length of query: 63
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 42
effective length of database: 17,151,101,840
effective search space: 720346277280
effective search space used: 720346277280
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top