Clone Name | bart27d04 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_187950.1| Oryza sativa (japonica cultivar-group), Ozsa8370 predicted mRNA Length = 927 Score = 529 bits (267), Expect = e-147 Identities = 378/415 (91%) Strand = Plus / Plus Query: 186 gcgacgtcgagcttgtcagcaaaacactgcagttcgagtacaagctcttctacttcgatc 245 ||||||| ||||| |||||||| || |||||||||||| ||||||| ||||||||||||| Sbjct: 98 gcgacgtggagctcgtcagcaagacgctgcagttcgagcacaagctgttctacttcgatc 157 Query: 246 tgaaggagaacccgcgggggaggtacctcaagatctccgagaagacgtccaccacgcgct 305 |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| Sbjct: 158 tgaaggagaacccgagggggaggtacctgaagatctccgagaagacgtcctccacgcgct 217 Query: 306 ccaccatcatcgtgcccatcgctggcgtcgcctggttcctcgacctcttcgactattaca 365 ||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |||| Sbjct: 218 ccaccatcatcgtccccgtcgccggcgtcgcctggttcctcgacctcttcgactactaca 277 Query: 366 tccgcaccgacgagcgcgatgtcttcagcaaggagctacgcctcgacaccaaggtgttct 425 ||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||| Sbjct: 278 tccgcaccgacgagcgcgacgccttcagcaaggagctccgcctcgacaccaaggtgttct 337 Query: 426 acttcgatattggggagaacaagagaggccgttaccttaaggtttcggaggcatctgtca 485 ||||||||||||||||||||||||||||||| | ||| ||||| || ||||||||||||| Sbjct: 338 acttcgatattggggagaacaagagaggccgcttcctcaaggtatcagaggcatctgtca 397 Query: 486 atagaaaccgtagcacgataattgttccggctggtagctctggcgaagaaggttgggaag 545 | ||||||||||| || || ||||||||||||||||| ||||| |||||||||||||||| Sbjct: 398 acagaaaccgtagtacaatcattgttccggctggtagttctggtgaagaaggttgggaag 457 Query: 546 catttaggaatgtactgttagaaatcaatgacgaagcttcccgactctacgttct 600 |||| ||||||||| |||| ||||| || | || ||||||||||| || ||||| Sbjct: 458 cattcaggaatgtattgttggaaataaacaatgaggcttcccgactttatgttct 512
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 339 bits (171), Expect = 6e-90 Identities = 219/235 (93%) Strand = Plus / Plus Query: 186 gcgacgtcgagcttgtcagcaaaacactgcagttcgagtacaagctcttctacttcgatc 245 ||||||| ||||| |||||||| || |||||||||||| ||||||| ||||||||||||| Sbjct: 8758583 gcgacgtggagctcgtcagcaagacgctgcagttcgagcacaagctgttctacttcgatc 8758642 Query: 246 tgaaggagaacccgcgggggaggtacctcaagatctccgagaagacgtccaccacgcgct 305 |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| Sbjct: 8758643 tgaaggagaacccgagggggaggtacctgaagatctccgagaagacgtcctccacgcgct 8758702 Query: 306 ccaccatcatcgtgcccatcgctggcgtcgcctggttcctcgacctcttcgactattaca 365 ||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |||| Sbjct: 8758703 ccaccatcatcgtccccgtcgccggcgtcgcctggttcctcgacctcttcgactactaca 8758762 Query: 366 tccgcaccgacgagcgcgatgtcttcagcaaggagctacgcctcgacaccaaggt 420 ||||||||||||||||||| | ||||||||||||||| ||||||||||||||||| Sbjct: 8758763 tccgcaccgacgagcgcgacgccttcagcaaggagctccgcctcgacaccaaggt 8758817 Score = 127 bits (64), Expect = 5e-26 Identities = 112/128 (87%) Strand = Plus / Plus Query: 473 gaggcatctgtcaatagaaaccgtagcacgataattgttccggctggtagctctggcgaa 532 |||||||||||||| ||||||||||| || || ||||||||||||||||| ||||| ||| Sbjct: 8761518 gaggcatctgtcaacagaaaccgtagtacaatcattgttccggctggtagttctggtgaa 8761577 Query: 533 gaaggttgggaagcatttaggaatgtactgttagaaatcaatgacgaagcttcccgactc 592 ||||||||||||||||| ||||||||| |||| ||||| || | || ||||||||||| Sbjct: 8761578 gaaggttgggaagcattcaggaatgtattgttggaaataaacaatgaggcttcccgactt 8761637 Query: 593 tacgttct 600 || ||||| Sbjct: 8761638 tatgttct 8761645 Score = 79.8 bits (40), Expect = 9e-12 Identities = 40/40 (100%) Strand = Plus / Plus Query: 417 aggtgttctacttcgatattggggagaacaagagaggccg 456 |||||||||||||||||||||||||||||||||||||||| Sbjct: 8758911 aggtgttctacttcgatattggggagaacaagagaggccg 8758950 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||||| |||| Sbjct: 32292235 agctcgggcggcggcggcggcggcgg 32292210 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 27007444 gggcggcggcggcggcagcgg 27007424 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 42408859 ggcggcggcggcggcagcgg 42408840 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 42029930 ggcggcggcggcggcagcgg 42029911 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 39919476 ggcggcggcggcggcagcgg 39919457 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 37522292 ggcggcggcggcggcagcgg 37522273 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 33210543 ggcggcggcggcggcagcgg 33210562 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 28006025 ggcggcggcggcggcagcgg 28006006 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 17887875 ggcggcggcggcggcagcgg 17887856 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 7176594 ggcggcggcggcggcagcgg 7176575 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 5867410 ggcggcggcggcggcagcgg 5867391 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 4979187 ggcggcggcggcggcagcgg 4979168 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 172099 ggcggcggcggcggcagcgg 172118
>dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0699D11 Length = 140825 Score = 339 bits (171), Expect = 6e-90 Identities = 219/235 (93%) Strand = Plus / Plus Query: 186 gcgacgtcgagcttgtcagcaaaacactgcagttcgagtacaagctcttctacttcgatc 245 ||||||| ||||| |||||||| || |||||||||||| ||||||| ||||||||||||| Sbjct: 76040 gcgacgtggagctcgtcagcaagacgctgcagttcgagcacaagctgttctacttcgatc 76099 Query: 246 tgaaggagaacccgcgggggaggtacctcaagatctccgagaagacgtccaccacgcgct 305 |||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| Sbjct: 76100 tgaaggagaacccgagggggaggtacctgaagatctccgagaagacgtcctccacgcgct 76159 Query: 306 ccaccatcatcgtgcccatcgctggcgtcgcctggttcctcgacctcttcgactattaca 365 ||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |||| Sbjct: 76160 ccaccatcatcgtccccgtcgccggcgtcgcctggttcctcgacctcttcgactactaca 76219 Query: 366 tccgcaccgacgagcgcgatgtcttcagcaaggagctacgcctcgacaccaaggt 420 ||||||||||||||||||| | ||||||||||||||| ||||||||||||||||| Sbjct: 76220 tccgcaccgacgagcgcgacgccttcagcaaggagctccgcctcgacaccaaggt 76274 Score = 127 bits (64), Expect = 5e-26 Identities = 112/128 (87%) Strand = Plus / Plus Query: 473 gaggcatctgtcaatagaaaccgtagcacgataattgttccggctggtagctctggcgaa 532 |||||||||||||| ||||||||||| || || ||||||||||||||||| ||||| ||| Sbjct: 78975 gaggcatctgtcaacagaaaccgtagtacaatcattgttccggctggtagttctggtgaa 79034 Query: 533 gaaggttgggaagcatttaggaatgtactgttagaaatcaatgacgaagcttcccgactc 592 ||||||||||||||||| ||||||||| |||| ||||| || | || ||||||||||| Sbjct: 79035 gaaggttgggaagcattcaggaatgtattgttggaaataaacaatgaggcttcccgactt 79094 Query: 593 tacgttct 600 || ||||| Sbjct: 79095 tatgttct 79102 Score = 79.8 bits (40), Expect = 9e-12 Identities = 40/40 (100%) Strand = Plus / Plus Query: 417 aggtgttctacttcgatattggggagaacaagagaggccg 456 |||||||||||||||||||||||||||||||||||||||| Sbjct: 76368 aggtgttctacttcgatattggggagaacaagagaggccg 76407
>gb|AY106329.1| Zea mays PCO108877 mRNA sequence Length = 842 Score = 107 bits (54), Expect = 4e-20 Identities = 108/126 (85%) Strand = Plus / Plus Query: 437 ggggagaacaagagaggccgttaccttaaggtttcggaggcatctgtcaatagaaaccgt 496 |||||||||||||| ||||| | ||| |||||||| ||||| |||||||| ||||||| Sbjct: 15 ggggagaacaagaggggccgattcctcaaggtttctgaggcctctgtcaaccgaaaccgg 74 Query: 497 agcacgataattgttccggctggtagctctggcgaagaaggttgggaagcatttaggaat 556 || || ||||||||||| ||||| |||||||| ||||| || ||||||||||| |||| | Sbjct: 75 agtaccataattgttccagctggcagctctggtgaagagggctgggaagcattcaggagt 134 Query: 557 gtactg 562 |||||| Sbjct: 135 gtactg 140
>gb|BC107774.1| Homo sapiens selenoprotein S, transcript variant 1, mRNA (cDNA clone MGC:104346 IMAGE:6450503), complete cds Length = 1263 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 11 gggcggcggcggcggcggcggtcatgga 38
>gb|BC005840.2| Homo sapiens selenoprotein S, transcript variant 2, mRNA (cDNA clone MGC:2553 IMAGE:2967406), complete cds Length = 1196 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 4 gggcggcggcggcggcggcggtcatgga 31
>ref|XM_538611.2| PREDICTED: Canis familiaris similar to Solute carrier family 12, member 2 (Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1) (Basolateral Na-K-Cl symporter) (LOC481490), mRNA Length = 4340 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||||||| Sbjct: 699 ctcgggcggcggcggcggcagcgg 722
>gb|BC008759.1| Homo sapiens cDNA clone IMAGE:3344875, **** WARNING: chimeric clone **** Length = 1623 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 519 gggcggcggcggcggcggcggtcatgga 546
>gb|AY324824.1| Homo sapiens selenoprotein S mRNA, complete cds Length = 1210 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 8 gggcggcggcggcggcggcggtcatgga 35
>dbj|AK097011.1| Homo sapiens cDNA FLJ39692 fis, clone SMINT2010853 Length = 2444 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 32 gggcggcggcggcggcggcggtcatgga 59
>emb|CR599218.1| full-length cDNA clone CL0BB007ZF03 of Neuroblastoma of Homo sapiens (human) Length = 1232 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 11 gggcggcggcggcggcggcggtcatgga 38
>emb|CR595854.1| full-length cDNA clone CS0DE012YJ02 of Placenta of Homo sapiens (human) Length = 1181 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 26 gggcggcggcggcggcggcggtcatgga 53
>gb|AC023024.6| Homo sapiens, clone RP11-299G20, complete sequence Length = 183671 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 84830 gggcggcggcggcggcggcggtcatgga 84803
>gb|AF328864.1|AF328864 Homo sapiens hypothetical protein SBBI8 mRNA, complete cds Length = 1188 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 8 gggcggcggcggcggcggcggtcatgga 35
>gb|AF157317.1|AF157317 Homo sapiens AD-015 protein mRNA, complete cds Length = 1209 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 8 gggcggcggcggcggcggcggtcatgga 35
>dbj|AK026455.1| Homo sapiens cDNA: FLJ22802 fis, clone KAIA2682, highly similar to AF157317 Homo sapiens AD-015 protein mRNA Length = 1226 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 44 gggcggcggcggcggcggcggtcatgga 71
>ref|NM_203472.1| Homo sapiens selenoprotein S (SELS), transcript variant 1, mRNA Length = 1292 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 56 gggcggcggcggcggcggcggtcatgga 83
>ref|NM_018445.4| Homo sapiens selenoprotein S (SELS), transcript variant 2, mRNA Length = 1250 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcggtcatgga 90 |||||||||||||||| ||||||||||| Sbjct: 56 gggcggcggcggcggcggcggtcatgga 83
>ref|NM_186481.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2214 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcag 80 ||||||||||||||||||||||| Sbjct: 308 agctcgggcggcggcggcggcag 286
>gb|AY532734.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiB) gene, complete cds Length = 1134 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagc 81 ||||||||||||||||||||||| Sbjct: 219 gctcgggcggcggcggcggcagc 241
>gb|AY532733.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiB) gene, complete cds Length = 1127 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagc 81 ||||||||||||||||||||||| Sbjct: 207 gctcgggcggcggcggcggcagc 229
>gb|AY532725.1| Zea mays subsp. parviglumis isolate p3b chitinase (chiB) gene, complete cds Length = 1114 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagc 81 ||||||||||||||||||||||| Sbjct: 207 gctcgggcggcggcggcggcagc 229
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 68 gcggcggcggcagcggtcatgga 90 ||||||||||||||||||||||| Sbjct: 4541144 gcggcggcggcagcggtcatgga 4541122
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggcag 80 ||||||||||||||||||||||| Sbjct: 6153494 agctcgggcggcggcggcggcag 6153516 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 19182879 cgggcggcggcggcggcagcg 19182899 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 29234679 ggcggcggcggcggcagcgg 29234660 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 28706319 ggcggcggcggcggcagcgg 28706338 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 26870185 ggcggcggcggcggcagcgg 26870166 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 gcggcggcggcggcagcggt 84 |||||||||||||||||||| Sbjct: 23001863 gcggcggcggcggcagcggt 23001844 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 92 ggtggcggaggcgtaggaggaggt 115 ||||||||||||| |||||||||| Sbjct: 22984274 ggtggcggaggcggaggaggaggt 22984297 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 gctcgggcggcggcggcggc 78 |||||||||||||||||||| Sbjct: 22071883 gctcgggcggcggcggcggc 22071864 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 18760716 ggcggcggcggcggcagcgg 18760697 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 92 ggtggcggaggcgtaggaggaggt 115 ||||||||||||| |||||||||| Sbjct: 9936573 ggtggcggaggcggaggaggaggt 9936550 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 9046917 ggcggcggcggcggcagcgg 9046936 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 8357077 ggcggcggcggcggcagcgg 8357058 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 4965726 ggcggcggcggcggcagcgg 4965745 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3942903 ggcggcggcggcggcagcgg 3942922 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3141171 ggcggcggcggcggcagcgg 3141190 Score = 40.1 bits (20), Expect = 8.2 Identities = 33/36 (91%), Gaps = 1/36 (2%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatggacggtggcgg 99 ||||||||||||||| |||| ||||| ||||||||| Sbjct: 1575805 ggcggcggcggcggcggcggccatgg-cggtggcgg 1575839
>dbj|AB189029.1| Plutella xylostella mRNA for serpin 1, complete cds Length = 1546 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcggt 84 ||||||||||||||||||||| ||||| Sbjct: 1451 agctcgggcggcggcggcggcggcggt 1425
>dbj|AP005779.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0042J07 Length = 126938 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggcag 80 ||||||||||||||||||||||| Sbjct: 56504 agctcgggcggcggcggcggcag 56526
>dbj|AP003931.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1664_D08 Length = 128553 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggcag 80 ||||||||||||||||||||||| Sbjct: 28049 agctcgggcggcggcggcggcag 28071
>gb|AY308813.1| Canis familiaris homeobox A10 gene, partial sequence Length = 454 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 250 cgggcggcggcggcggcagcgg 271
>gb|DQ214675.1| Taeniopygia guttata clone 0058P0044C06 NADH dehydrogenase (ubiquinone) Fe-S protein 6-like mRNA, complete sequence Length = 510 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 105 cgggcggcggcggcggcagcgg 84
>ref|NM_191382.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1575 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||||| |||| Sbjct: 317 agctcgggcggcggcggcggcggcgg 292
>ref|NM_019314.1| Rattus norvegicus potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (Kcnn2), mRNA Length = 1743 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 283 ggcggcggcggcggcagcgggcatgg 308
>ref|NM_002196.2| Homo sapiens insulinoma-associated 1 (INSM1), mRNA Length = 2838 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 322 cgggcggcggcggcggcagcgg 301
>gb|AC165307.6| Mus musculus chromosome 3, clone RP24-372I24, complete sequence Length = 136853 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 84963 ggcggcggcggcggcagcggtc 84984
>ref|XM_416882.1| PREDICTED: Gallus gallus similar to ubiquitin protein ligase E3A isoform 3; human papilloma virus E6-associated protein; oncogenic protein-associated protein E6-AP; CTCL tumor antigen se37-2 (LOC418686), mRNA Length = 3627 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 140 cgggcggcggcggcggcagcgg 161
>ref|XM_416567.1| PREDICTED: Gallus gallus similar to uroplakin 1B; tetraspan (LOC418345), mRNA Length = 1929 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 504 cgggcggcggcggcggcagcgg 525
>ref|NM_000523.2| Homo sapiens homeobox D13 (HOXD13), mRNA Length = 1461 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 253 cgggcggcggcggcggcagcgg 274
>gb|BC072413.1| Homo sapiens eukaryotic translation initiation factor 4 gamma, 3, mRNA (cDNA clone IMAGE:6165611), partial cds Length = 5764 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 239 ggcggcggcggcggcagcggtc 260
>ref|NM_008960.2| Mus musculus phosphatase and tensin homolog (Pten), mRNA Length = 8229 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 211 cgggcggcggcggcggcagcgg 232
>ref|NM_019937.3| Mus musculus cyclin L1 (Ccnl1), mRNA Length = 2161 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 145 ggcggcggcggcggcagcggtc 124
>gb|BC069909.1| Mus musculus cyclin L1, mRNA (cDNA clone IMAGE:5366593), partial cds Length = 2241 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 82 ggcggcggcggcggcagcggtc 61
>gb|AC146111.3| Pan troglodytes BAC clone RP43-38O16 from 7, complete sequence Length = 158242 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 20063 cgggcggcggcggcggcagcgg 20084
>ref|NM_080465.1| Mus musculus potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 (Kcnn2), mRNA Length = 2065 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 265 ggcggcggcggcggcagcgggcatgg 290
>ref|NM_015686.2| Homo sapiens transmembrane protein 28 (TMEM28), mRNA Length = 4050 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 361 cgggcggcggcggcggcagcgg 340
>gb|AY123778.1| Mus musculus small conductance calcium-activated potassium channel SK2 (Kcnn2) mRNA, complete cds Length = 2148 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 340 ggcggcggcggcggcagcgggcatgg 365
>gb|AC060781.8| Mus musculus chromosome 19, clone RP23-196A19, complete sequence Length = 207702 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 23997 cgggcggcggcggcggcagcgg 24018
>gb|AC162887.5| Mus musculus chromosome 19, clone RP23-414O6, complete sequence Length = 190704 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 4258 cgggcggcggcggcggcagcgg 4237
>gb|AC151834.7| Mus musculus BAC clone RP23-382M10 from chromosome 8, complete sequence Length = 208404 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 134420 cgggcggcggcggcggcagcgg 134441
>gb|AC134447.2| Mus musculus BAC clone RP24-186D1 from chromosome 18, complete sequence Length = 179514 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 99417 cgggcggcggcggcggcagcgg 99396
>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence Length = 141921 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 112536 cgggcggcggcggcggcagcgg 112557
>gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete genome Length = 138390 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 137996 ggcggcggcggcggcagcggtc 137975 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 105017 ggcggcggcggcggcagcggtc 105038 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 187 ggcggcggcggcggcagcggtc 166
>ref|XM_849064.1| PREDICTED: Canis familiaris homeobox A10 (HOXA10), mRNA Length = 2118 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 1157 cgggcggcggcggcggcagcgg 1178
>gb|AF533008.1| Mus musculus small-conductance calcium-activated potassium channel 2 (Kcnn2) mRNA, complete cds Length = 1725 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 265 ggcggcggcggcggcagcgggcatgg 290
>gb|AF357240.1| Mus musculus small-conductance calcium-activated potassium channel SK2 (SK2) mRNA, complete cds Length = 2065 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 265 ggcggcggcggcggcagcgggcatgg 290
>ref|XM_844161.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 2 (LOC474640), mRNA Length = 2708 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 928 ggcggcggcggcggcagcgggcatgg 953
>ref|XM_853173.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 7 (LOC474640), mRNA Length = 2031 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 251 ggcggcggcggcggcagcgggcatgg 276
>ref|XM_853129.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 6 (LOC474640), mRNA Length = 1986 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 224 ggcggcggcggcggcagcgggcatgg 249
>ref|XM_853050.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 5 (LOC474640), mRNA Length = 1363 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 251 ggcggcggcggcggcagcgggcatgg 276
>ref|XM_853011.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 4 (LOC474640), mRNA Length = 1360 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 224 ggcggcggcggcggcagcgggcatgg 249
>ref|XM_852967.1| PREDICTED: Canis familiaris similar to Small conductance calcium-activated potassium channel protein 2 (SK2), transcript variant 3 (LOC474640), mRNA Length = 777 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 224 ggcggcggcggcggcagcgggcatgg 249
>gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, complete sequence Length = 178929 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 60856 ggcggcggcggcggcagcgggcatgg 60831
>ref|XM_645391.1| Entamoeba histolytica HM-1:IMSS phosphatidylinositol 3-kinase, putative (216.t00014) partial mRNA Length = 4059 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 548 tttaggaatgtactgttagaaa 569 |||||||||||||||||||||| Sbjct: 304 tttaggaatgtactgttagaaa 325
>gb|AC098705.2| Mus musculus BAC clone RP23-1B19 from 3, complete sequence Length = 202444 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 21682 ggcggcggcggcggcagcggtc 21703
>gb|BC007177.1| Mus musculus cyclin L1, mRNA (cDNA clone IMAGE:3494871), complete cds Length = 4156 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 119 ggcggcggcggcggcagcggtc 98
>gb|BC037204.1| Mus musculus mRNA similar to cyclin L ania-6a (cDNA clone IMAGE:5364079) Length = 3416 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 83 ggcggcggcggcggcagcggtc 62
>ref|NM_023977.2| Rattus norvegicus golgi phosphoprotein 3 (Golph3), mRNA Length = 2530 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 195 cgggcggcggcggcggcagcgg 216
>emb|AL031005.2|HS329E20 Human DNA sequence from clone RP3-329E20 on chromosome 1p34.4-36.13 Contains the 5' UTR of the EIF4G3 gene for eukaryotic translation initiation factor 4 gamma, 3, the 3' end of the ECE1 gene for endothelin converting enzyme 1, a novel gene and a CpG island, complete sequence Length = 109906 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 4238 ggcggcggcggcggcagcggtc 4217
>emb|AL445072.17| Human DNA sequence from clone RP11-13E5 on chromosome X Contains a novel gene, the gene for a novel protein similar to KIAA1892 and a CpG island, complete sequence Length = 134277 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 96675 ggcggcggcggcggcagcggtc 96696
>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains the 3' end of the gene for KIAA1272 protein (similar to rat tulip proteins 1 and 2), the INSM1 gene for insulinoma-associated protein 1, the 3' end of the C20orf26 gene and a CpG island, complete sequence Length = 67356 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 34999 cgggcggcggcggcggcagcgg 34978
>emb|AL158069.16| Human DNA sequence from clone RP13-57D9 on chromosome Xq11.2-13.2 Contains the gene for TED protein (TED), the 5' end of the ED1 gene for ectodermal dysplasia 1, anhidrotic, two novel genes and three CpG islands, complete sequence Length = 186538 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 8112 cgggcggcggcggcggcagcgg 8091
>gb|BC047578.1| Homo sapiens SEC14 and spectrin domains 1, mRNA (cDNA clone MGC:48388 IMAGE:4815542), complete cds Length = 3001 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 148 cgggcggcggcggcggcagcgg 127
>emb|AL662936.4|OSJN00137 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0052P16, complete sequence Length = 155702 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 39902 ggcggcggcggcggcagcggtc 39881
>ref|NM_205792.1| Bos taurus small conductance potassium channel type 2 (KCNN2), transcript variant 1, mRNA Length = 2105 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 324 ggcggcggcggcggcagcgggcatgg 349
>ref|NM_205814.1| Bos taurus small conductance potassium channel type 2 (KCNN2), transcript variant 2, mRNA Length = 2096 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 324 ggcggcggcggcggcagcgggcatgg 349
>gb|BC092568.1| Rattus norvegicus golgi phosphoprotein 3, mRNA (cDNA clone MGC:108683 IMAGE:7307277), complete cds Length = 2530 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 195 cgggcggcggcggcggcagcgg 216
>dbj|AB032481.1| Homo sapiens HOXD13 gene for homeobox transcription factor, complete cds Length = 10739 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 9033 cgggcggcggcggcggcagcgg 9054
>dbj|AK143023.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched library, clone:E030042N12 product:Iroquois related homeobox 3 (Drosophila), full insert sequence Length = 2265 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 164 cgggcggcggcggcggcagcgg 143
>gb|AF467251.1| Mus musculus cyclin ania-6a (Ccn1) mRNA, complete cds Length = 1855 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 139 ggcggcggcggcggcagcggtc 118
>dbj|AK148736.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120441D04 product:phosphatase and tensin homolog, full insert sequence Length = 1948 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 105 cgggcggcggcggcggcagcgg 84
>dbj|AK149082.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN full-length enriched library, clone:7120481N10 product:potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, full insert sequence Length = 2560 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 953 ggcggcggcggcggcagcgggcatgg 978
>dbj|AK164302.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130016O03 product:phosphatase and tensin homolog, full insert sequence Length = 4087 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 194 cgggcggcggcggcggcagcgg 215
>gb|AF185590.1|AF185590 Mus musculus cyclin ania-6a gene, sequence Length = 27644 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 12813 ggcggcggcggcggcagcggtc 12792
>gb|AF159159.1|AF159159 Mus musculus cyclin ania-6a mRNA, complete cds Length = 2097 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 101 ggcggcggcggcggcagcggtc 80
>ref|NM_001039214.1| Mus musculus ring finger and KH domain containing 2 (Rkhd2), mRNA Length = 2052 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 350 cgggcggcggcggcggcagcgg 329
>gb|AC087098.8| Genomic sequence for Mus musculus, clone RP23-206M19, complete sequence Length = 198338 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 68328 cgggcggcggcggcggcagcgg 68349
>dbj|AK133686.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330437G16 product:hypothetical Proline-rich region profile/Alanine-rich region profile/Glutamic acid-rich region profile containing protein, full insert sequence Length = 2052 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 350 cgggcggcggcggcggcagcgg 329
>gb|AY280964.1| Mus musculus small conductance calcium-activated potassium channel SK2 splice variant (Kcnn2) mRNA, complete cds; alternatively spliced Length = 1347 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 265 ggcggcggcggcggcagcgggcatgg 290
>dbj|AK088717.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430024E20 product:phosphatase and tensin homolog, full insert sequence Length = 2095 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 190 cgggcggcggcggcggcagcgg 211
>dbj|AK087908.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN full-length enriched library, clone:E330039K23 product:potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, full insert sequence Length = 1971 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 609 ggcggcggcggcggcagcgggcatgg 634
>dbj|AK051380.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130043G23 product:cyclin L, full insert sequence Length = 3224 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 102 ggcggcggcggcggcagcggtc 81
>dbj|AK076980.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930584O19 product:phosphatase and tensin homolog, full insert sequence Length = 2110 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 167 cgggcggcggcggcggcagcgg 188
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 2403963 cgggcggcggcggcggcagcgg 2403984
>dbj|AK039033.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230088J22 product:potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, full insert sequence Length = 2848 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 951 ggcggcggcggcggcagcgggcatgg 976
>dbj|AK050390.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length enriched library, clone:C730043H01 product:potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, full insert sequence Length = 2300 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 521 ggcggcggcggcggcagcgggcatgg 546
>dbj|AK011629.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610030E23 product:cyclin L, full insert sequence Length = 980 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 102 ggcggcggcggcggcagcggtc 81
>dbj|AK078839.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030013E13 product:cyclin L, full insert sequence Length = 2138 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 326 ggcggcggcggcggcagcggtc 347
>gb|BC020464.1| Mus musculus Iroquois related homeobox 3 (Drosophila), mRNA (cDNA clone IMAGE:3482572) Length = 1391 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 61 cgggcggcggcggcggcagcgg 40
>dbj|AK033158.1| Mus musculus 15 days embryo male testis cDNA, RIKEN full-length enriched library, clone:8030448K18 product:potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2, full insert sequence Length = 3691 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 1769 ggcggcggcggcggcagcgggcatgg 1794
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 22234185 ggcggcggcggcggcagcggccatgg 22234160 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 5339188 ggcggcggcggcggcagcggtc 5339167 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 34633655 ggcggcggcggcggcagcggt 34633675 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 17198614 ggcggcggcggcggcagcggt 17198594 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 35283435 ggcggcggcggcggcagcgg 35283416 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 34266338 ggcggcggcggcggcagcgg 34266357 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 33873936 ggcggcggcggcggcagcgg 33873955 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 33386081 ggcggcggcggcggcagcgg 33386062 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23384523 ggcggcggcggcggcagcgg 23384504 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 gcggcggcggcggcagcggt 84 |||||||||||||||||||| Sbjct: 20634311 gcggcggcggcggcagcggt 20634330 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 18746980 ggcggcggcggcggcagcgg 18746961 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 11947214 ggcggcggcggcggcagcgg 11947233 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 11817497 ggcggcggcggcggcagcgg 11817478
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 89 gacggtggcggaggcgtaggaggagg 114 |||||||||||||||| ||||||||| Sbjct: 25664615 gacggtggcggaggcggaggaggagg 25664590 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 15903590 ggcggcggcggcggcagcgg 15903609 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3872453 ggcggcggcggcggcagcgg 3872472 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3776646 ggcggcggcggcggcagcgg 3776627 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcagcgg 83 |||| ||||||||||||||||||| Sbjct: 3148493 ctcgcgcggcggcggcggcagcgg 3148516 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 2747461 ggcggcggcggcggcagcgg 2747480 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcg 82 |||||||||||||||||||| Sbjct: 417424 gggcggcggcggcggcagcg 417405
>gb|BC094383.1| Mus musculus cyclin L1, mRNA (cDNA clone MGC:106660 IMAGE:30604933), complete cds Length = 2097 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 81 ggcggcggcggcggcagcggtc 60
>gb|AC009336.13|AC009336 Homo sapiens chromosome 2, clone RP11-387A1, complete sequence Length = 175667 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 77045 cgggcggcggcggcggcagcgg 77066
>dbj|AP003377.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0053G03 Length = 101901 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||||| |||| Sbjct: 24520 agctcgggcggcggcggcggcggcgg 24495
>dbj|AB114474.1| Bos taurus SK2 variant2 mRNA for small conductance potassium channel type2 variant2, complete cds Length = 2105 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 324 ggcggcggcggcggcagcgggcatgg 349
>dbj|AB114473.1| Bos taurus SK2 mRNA for small conductance potassium channel type2, complete cds Length = 2096 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 324 ggcggcggcggcggcagcgggcatgg 349
>emb|AJ333290.1|HSA333290 Homo sapiens genomic sequence surrounding NotI site, clone NR3-BK17RS Length = 737 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 182 cgggcggcggcggcggcagcgg 161
>emb|AJ335834.1|HSA335834 Homo sapiens genomic sequence surrounding NotI site, clone NR1-EF21RS Length = 738 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 173 cgggcggcggcggcggcagcgg 152
>dbj|AK103570.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132M15, full insert sequence Length = 1621 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||||| |||| Sbjct: 86 agctcgggcggcggcggcggcggcgg 61
>emb|AJ329446.1|HSA329446 Homo sapiens genomic sequence surrounding NotI site, clone NR1-DC11R Length = 558 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 182 cgggcggcggcggcggcagcgg 161
>dbj|AK061986.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-B06, full insert sequence Length = 1590 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||||| |||| Sbjct: 66 agctcgggcggcggcggcggcggcgg 41
>gb|U92437.1|MMU92437 Mus musculus mutated in multiple advanced cancers protein (MMAC1) mRNA, complete cds Length = 2160 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 291 cgggcggcggcggcggcagcgg 312
>gb|AF005219.1|HUMTFHOXD1 Homo sapiens transcription factor HOXD13 (Hoxd13) gene, exon 1 Length = 1030 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 253 cgggcggcggcggcggcagcgg 274
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 89 gacggtggcggaggcgtaggaggagg 114 |||||||||||||||| ||||||||| Sbjct: 25592791 gacggtggcggaggcggaggaggagg 25592766 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcag 80 ||||||||||||||||||||| Sbjct: 26995925 ctcgggcggcggcggcggcag 26995945 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 15856823 ggcggcggcggcggcagcgg 15856842 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3872427 ggcggcggcggcggcagcgg 3872446 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 3776620 ggcggcggcggcggcagcgg 3776601 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcagcgg 83 |||| ||||||||||||||||||| Sbjct: 3148438 ctcgcgcggcggcggcggcagcgg 3148461 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 2747405 ggcggcggcggcggcagcgg 2747424 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcg 82 |||||||||||||||||||| Sbjct: 417424 gggcggcggcggcggcagcg 417405
>emb|AL731593.2|OSJN00235 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027P08, complete sequence Length = 118959 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 104046 ggcggcggcggcggcagcggccatgg 104021
>emb|AL731881.4|CNS08C8L Oryza sativa chromosome 12, . BAC OSJNBa0002L05 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 167131 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Minus Query: 89 gacggtggcggaggcgtaggaggagg 114 |||||||||||||||| ||||||||| Sbjct: 31853 gacggtggcggaggcggaggaggagg 31828
>emb|AL732537.4|CNS08C9C Oryza sativa chromosome 12, . BAC OSJNBa0036L12 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 127003 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 89 gacggtggcggaggcgtaggaggagg 114 |||||||||||||||| ||||||||| Sbjct: 9059 gacggtggcggaggcggaggaggagg 9084
>gb|AC122424.4| Mus musculus BAC clone RP24-173E19 from 8, complete sequence Length = 175181 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 165805 cgggcggcggcggcggcagcgg 165784
>gb|BC067195.1| Mus musculus cDNA clone IMAGE:5716597, containing frame-shift errors Length = 2375 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 262 cgggcggcggcggcggcagcgg 241
>dbj|AB209119.1| Homo sapiens mRNA for eukaryotic translation initiation factor 4 gamma, 3 variant protein Length = 6193 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 239 ggcggcggcggcggcagcggtc 260
>gb|U69882.1|RRU69882 Rattus norvegicus calcium-activated potassium channel rSK2 (SK) mRNA, complete cds Length = 1743 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatgg 89 |||||||||||||||||||| ||||| Sbjct: 283 ggcggcggcggcggcagcgggcatgg 308
>gb|M93119.1|HUMIA1X Human zinc-finger DNA-binding motifs (IA-1) mRNA, complete cds Length = 2838 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 322 cgggcggcggcggcggcagcgg 301
>emb|AJ291306.1|OCU291306 Oryctolagus cuniculus partial mRNA for c-jun transcription factor (c-jun gene) Length = 487 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcgg 83 |||||||||||||||||||||| Sbjct: 294 cgggcggcggcggcggcagcgg 315
>dbj|AB071862.1| Gibberella fujikuroi mRNA for 5-aminolevulinate synthase, partial cds Length = 1756 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggtc 85 |||||||||||||||||||||| Sbjct: 94 ggcggcggcggcggcagcggtc 73
>ref|NM_179851.2| Arabidopsis thaliana PUR ALPHA-1; nucleic acid binding AT2G32080 (PUR ALPHA-1) transcript variant AT2G32080.2 mRNA, complete cds Length = 1497 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 438 ccaaggtgttttacttcgatatcggtgagaaca 470 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 251 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 310 Query: 287 aagacgtc 294 |||||||| Sbjct: 311 aagacgtc 318
>ref|NM_128768.3| Arabidopsis thaliana PUR ALPHA-1; nucleic acid binding AT2G32080 (PUR ALPHA-1) transcript variant AT2G32080.1 mRNA, complete cds Length = 1500 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 438 ccaaggtgttttacttcgatatcggtgagaaca 470 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 251 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 310 Query: 287 aagacgtc 294 |||||||| Sbjct: 311 aagacgtc 318
>ref|XM_481278.1| Oryza sativa (japonica cultivar-group), mRNA Length = 474 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 426 ggcggcggcggcggcagcggt 406
>ref|XM_474349.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 768 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 170 ggcggcggcggcggcagcggt 150
>ref|XM_518420.1| PREDICTED: Pan troglodytes similar to Ankyrin repeat and SAM domain containing protein 1 (LOC462632), mRNA Length = 5118 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 279 gggcggcggcggcggcagcgg 299
>gb|AC162898.10| Mus musculus chromosome 5, clone RP23-391P21, complete sequence Length = 202279 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 197117 gggcggcggcggcggcagcgg 197097
>ref|NM_192491.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 864 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 681 gggcggcggcggcggcagcgg 701
>ref|NM_185178.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1140 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 3 gggcggcggcggcggcagcgg 23
>ref|XM_514243.1| PREDICTED: Pan troglodytes similar to hypothetical protein (LOC457786), mRNA Length = 1900 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 1239 ggcggcggcggcggcagcggt 1259
>ref|NM_053869.1| Rattus norvegicus paired-like homeobox 2a (Phox2a), mRNA Length = 1608 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 788 cgggcggcggcggcggcagcg 768
>ref|NM_001453.1| Homo sapiens forkhead box C1 (FOXC1), mRNA Length = 1662 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 1117 agctcgggcggcggcggcggc 1137
>gb|AY768791.1| Columba livia voltage-gated potassium channel (KCNQ3) mRNA, complete cds Length = 2579 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 53 gggcggcggcggcggcagcgg 73
>gb|BC083113.1| Mus musculus RIKEN cDNA 1700012G19 gene, mRNA (cDNA clone MGC:103027 IMAGE:5356187), complete cds Length = 1175 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcggtca 86 |||| |||||||||||||||||||| Sbjct: 41 cgggtggcggcggcggcagcggtca 65
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcag 80 ||||||||||||||||||||| Sbjct: 1267123 ctcgggcggcggcggcggcag 1267143
>gb|AC097174.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1111_A10, complete sequence Length = 155106 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 95242 cgggcggcggcggcggcagcg 95222
>gb|AC163329.6| Mus musculus chromosome 5, clone RP24-294K15, complete sequence Length = 186890 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 186103 gggcggcggcggcggcagcgg 186123
>gb|AC093198.3| Drosophila melanogaster clone BACR03G24, complete sequence Length = 182901 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 122268 ggcggcggcggcggcagcggt 122288
>gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's Hospital Oakland Research Institute) complete sequence Length = 227955 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 130927 gggcggcggcggcggcagcgg 130907
>gb|AC006402.12| Drosophila melanogaster clone BACR08D17, complete sequence Length = 174735 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 60978 ggcggcggcggcggcagcggt 60998
>gb|AY532780.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiA) gene, complete cds Length = 1131 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 199 gctcgggcggcggcggcggcggcgg 223
>gb|AY532779.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiA) gene, complete cds Length = 1094 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 202 gctcgggcggcggcggcggcggcgg 226
>gb|AY532778.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiA) gene, complete cds Length = 1094 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 202 gctcgggcggcggcggcggcggcgg 226
>gb|AY532775.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiA) gene, complete cds Length = 1094 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 199 gctcgggcggcggcggcggcggcgg 223
>gb|AY532774.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiA) gene, complete cds Length = 1132 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 205 gctcgggcggcggcggcggcggcgg 229
>gb|AY532740.1| Zea diploperennis isolate d6 chitinase (chiB) gene, complete cds Length = 1128 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 207 gctcgggcggcggcggcggcggcgg 231
>gb|AY532724.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiB) gene, complete cds Length = 1138 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 207 gctcgggcggcggcggcggcggcgg 231
>ref|XM_426787.1| PREDICTED: Gallus gallus similar to Choline kinase alpha (CK) (CHETK-alpha) (LOC429231), partial mRNA Length = 819 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 ||||| ||||||||||||||||||| Sbjct: 353 gctcgtgcggcggcggcggcagcgg 377
>gb|AC115777.16| Mus musculus chromosome 6, clone RP23-139O6, complete sequence Length = 216399 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 45432 ggcggcggcggcggcagcggt 45412
>ref|XM_616701.2| PREDICTED: Bos taurus growth differentiation factor 7 (GDF7), mRNA Length = 1665 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 435 gggcggcggcggcggcagcgg 455
>gb|AC182395.3| Pan troglodytes BAC clone CH251-484N21 from chromosome 2, complete sequence Length = 176398 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 174500 ggcggcggcggcggcagcggt 174480
>ref|XM_324203.1| Neurospora crassa OR74A hypothetical protein (NCU04847.1) partial mRNA Length = 1182 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 724 gggcggcggcggcggcagcgg 704
>ref|XM_600125.2| PREDICTED: Bos taurus similar to Nidogen-2 precursor (NID-2) (Osteonidogen) (LOC521854), mRNA Length = 5264 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 557 agctcgggcggcggcggcggc 537
>gb|BC040100.1| Mus musculus RIKEN cDNA 1700012G19 gene, mRNA (cDNA clone MGC:49690 IMAGE:4456284), complete cds Length = 1045 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcggtca 86 |||| |||||||||||||||||||| Sbjct: 3 cgggtggcggcggcggcagcggtca 27
>ref|XM_866244.1| PREDICTED: Bos taurus similar to ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1, transcript variant 2 (LOC508410), mRNA Length = 2976 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 507 cgggcggcggcggcggcagcg 527
>ref|XM_877880.1| PREDICTED: Bos taurus similar to ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1, transcript variant 5 (LOC508410), mRNA Length = 2227 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 186 cgggcggcggcggcggcagcg 206
>ref|XM_877801.1| PREDICTED: Bos taurus similar to ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1, transcript variant 3 (LOC508410), mRNA Length = 2720 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 499 cgggcggcggcggcggcagcg 519
>ref|XM_955313.1| Neurospora crassa OR74A hypothetical protein (NCU04847.1) partial mRNA Length = 1182 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 724 gggcggcggcggcggcagcgg 704
>gb|BC073166.1| Homo sapiens cDNA clone IMAGE:6194682, partial cds Length = 1040 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 352 gggcggcggcggcggcagcgg 332
>ref|XM_958764.1| Neurospora crassa OR74A hypothetical protein (NCU02120.1) partial mRNA Length = 5190 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 154 gggcggcggcggcggcagcgg 134
>ref|XM_329309.1| Neurospora crassa OR74A hypothetical protein (NCU02120.1) partial mRNA Length = 5190 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 154 gggcggcggcggcggcagcgg 134
>gb|BC016138.1| Homo sapiens chromosome X open reading frame 17, mRNA (cDNA clone IMAGE:3921622), complete cds Length = 1176 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 413 gggcggcggcggcggcagcgg 393
>ref|NM_017848.3| Homo sapiens chromosome X open reading frame 17 (CXorf17), mRNA Length = 4231 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 390 gggcggcggcggcggcagcgg 370
>gb|BT011869.1| Arabidopsis thaliana At2g32080 mRNA sequence Length = 885 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 305 ccaaggtgttttacttcgatatcggtgagaaca 337 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 118 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 177 Query: 287 aagacgtc 294 |||||||| Sbjct: 178 aagacgtc 185
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 35449838 gggcggcggcggcggcagcgg 35449858 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 10315417 ggcggcggcggcggcagcggt 10315397 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 34886993 ggcggcggcggcggcagcgg 34887012 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 34570098 ggcggcggcggcggcagcgg 34570117 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 33769666 ggcggcggcggcggcagcgg 33769647 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 gcggcggcggcggcagcggt 84 |||||||||||||||||||| Sbjct: 32164436 gcggcggcggcggcagcggt 32164417 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 30628727 ggcggcggcggcggcagcgg 30628746 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 29560296 ggcggcggcggcggcagcgg 29560315 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 28797636 ggcggcggcggcggcagcgg 28797655 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 24235780 ggcggcggcggcggcagcgg 24235799 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23943918 ggcggcggcggcggcagcgg 23943899 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23862697 ggcggcggcggcggcagcgg 23862678 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 22476592 ggcggcggcggcggcagcgg 22476573 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||| |||| Sbjct: 15500150 ctcgggcggcggcggcggcggcgg 15500173 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 10247275 ggcggcggcggcggcagcgg 10247294 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 9424438 ggcggcggcggcggcagcgg 9424419 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 6105003 ggcggcggcggcggcagcgg 6105022
>gb|AC114645.9| Mus musculus chromosome 9, clone RP24-131G14, complete sequence Length = 214734 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 181215 ggcggcggcggcggcagcggt 181235
>ref|XM_549367.2| PREDICTED: Canis familiaris similar to interleukin-1 receptor-associated kinase 1 isoform 1 (LOC492247), mRNA Length = 2340 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatggacggtgg 96 ||||||||||||||| |||| ||||| |||||| Sbjct: 150 ggcggcggcggcggcggcggccatggccggtgg 182
>gb|AC183107.3| Pan troglodytes BAC clone CH251-566P2 from chromosome 16, complete sequence Length = 194054 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 tgggaggcatggtgggacccg 158 ||||||||||||||||||||| Sbjct: 150279 tgggaggcatggtgggacccg 150299
>gb|BC016462.1| Mus musculus nuclear receptor subfamily 3, group C, member 1, mRNA (cDNA clone IMAGE:4036433), containing frame-shift errors Length = 1638 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 11 gggcggcggcggcggcagcgg 31
>ref|XM_535544.2| PREDICTED: Canis familiaris similar to Cytochrome c oxidase polypeptide Va, mitochondrial precursor (LOC478370), mRNA Length = 749 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 133 gctcgggcggcggcggcggcggcgg 109
>ref|XM_861858.1| PREDICTED: Canis familiaris similar to Ariadne-1 protein homolog (ARI-1) (Ubiquitin-conjugating enzyme E2-binding protein 1) (UbcH7-binding protein) (UbcM4-interacting protein 77), transcript variant 3 (LOC478359), mRNA Length = 2505 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 197 cgggcggcggcggcggcagcg 217
>ref|XM_861844.1| PREDICTED: Canis familiaris similar to Ariadne-1 protein homolog (ARI-1) (Ubiquitin-conjugating enzyme E2-binding protein 1) (UbcH7-binding protein) (UbcM4-interacting protein 77), transcript variant 2 (LOC478359), mRNA Length = 1864 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 197 cgggcggcggcggcggcagcg 217
>ref|XM_535533.2| PREDICTED: Canis familiaris similar to Ariadne-1 protein homolog (ARI-1) (Ubiquitin-conjugating enzyme E2-binding protein 1) (UbcH7-binding protein) (UbcM4-interacting protein 77), transcript variant 1 (LOC478359), mRNA Length = 3897 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 197 cgggcggcggcggcggcagcg 217
>ref|XM_001003797.1| PREDICTED: Mus musculus RNA binding protein with multiple splicing 2, transcript variant 2 (Rbpms2), mRNA Length = 2182 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 343 gggcggcggcggcggcagcgg 323
>ref|XM_993666.1| PREDICTED: Mus musculus hypothetical protein LOC667980 (LOC667980), mRNA Length = 531 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 109 ggcggcggcggcggcagcggt 129
>ref|XM_977327.1| PREDICTED: Mus musculus hypothetical protein LOC665498 (LOC665498), mRNA Length = 1596 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 828 gggcggcggcggcggcagcgg 848
>gb|AC130969.4| Rattus norvegicus 2 BAC CH230-105B13 (Children's Hospital Oakland Research Institute) complete sequence Length = 238254 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 65351 gggcggcggcggcggcagcgg 65371
>gb|AC117098.6| Rattus norvegicus 2 BAC CH230-271M7 (Children's Hospital Oakland Research Institute) complete sequence Length = 174234 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 167163 gggcggcggcggcggcagcgg 167183
>ref|XM_985899.1| PREDICTED: Mus musculus chromodomain helicase DNA binding protein 7, transcript variant 2 (Chd7), mRNA Length = 4982 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 66 ggcggcggcggcggcagcggt 86
>emb|CR956415.12| Pig DNA sequence from clone PigE-223M7 on chromosome 6, complete sequence Length = 209049 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 202652 gggcggcggcggcggcagcgg 202672
>gb|AY150025.1| Homo sapiens unknown mRNA Length = 4231 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 390 gggcggcggcggcggcagcgg 370
>gb|AC139934.9| Mus musculus chromosome 12, clone RP23-39G14, complete sequence Length = 312488 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 490 aaaccgtagcacgataattgt 510 ||||||||||||||||||||| Sbjct: 249540 aaaccgtagcacgataattgt 249520
>gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosome 17, complete sequence Length = 192971 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcggtca 86 |||| |||||||||||||||||||| Sbjct: 174010 cgggtggcggcggcggcagcggtca 173986
>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence Length = 208417 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 tgggaggcatggtgggacccg 158 ||||||||||||||||||||| Sbjct: 36045 tgggaggcatggtgggacccg 36065
>gb|AC121979.3| Mus musculus BAC clone RP24-289L14 from chromosome 9, complete sequence Length = 155274 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 44875 gggcggcggcggcggcagcgg 44855
>gb|AC115785.9| Mus musculus chromosome 12, clone RP23-170K17, complete sequence Length = 261721 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 490 aaaccgtagcacgataattgt 510 ||||||||||||||||||||| Sbjct: 55753 aaaccgtagcacgataattgt 55733
>gb|BC043247.2| Homo sapiens transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila), mRNA (cDNA clone MGC:44362 IMAGE:5296274), complete cds Length = 3733 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 449 ggcggcggcggcggcagcggt 469
>gb|BC086310.1| Homo sapiens cDNA clone IMAGE:6282177, **** WARNING: chimeric clone **** Length = 3163 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 239 gggcggcggcggcggcagcgg 259
>emb|Z84469.1|HS390O13 Human DNA sequence from clone RP3-390O13 on chromosome Xp11 Contains the 5' end of a novel gene, the 3' end of the PRKWNK3 for lysine deficient protein kinase 3, a ribosomal protein L7A (RPL7A) pseudogene and two CpG islands, complete sequence Length = 144676 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 25013 gggcggcggcggcggcagcgg 25033
>gb|BC031934.1| Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1A, mRNA (cDNA clone MGC:42354 IMAGE:4819948), complete cds Length = 3624 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 246 gggcggcggcggcggcagcgg 266
>ref|NM_023079.2| Homo sapiens ubiquitin-conjugating enzyme E2Z (putative) (UBE2Z), mRNA Length = 3053 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 140 gggcggcggcggcggcagcgg 160
>emb|AL034344.24|HS118B18 Human DNA sequence from clone RP1-118B18 on chromosome 6p24.1-25.3 Contains the FOXC1 gene for forkhead box C1 gene, the 3' end of the GMDS gene for GDP-mannose 4 6-dehydratase and four CpG Islands, complete sequence Length = 104729 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 66276 agctcgggcggcggcggcggc 66296
>emb|AL035415.22|HS705F19 Human DNA sequence from clone RP4-705F19 on chromosome 1p32.2-34.2 Contains the 5' end of the SSBP3 gene for single stranded DNA binding protein 3, two novel genes and a CpG island, complete sequence Length = 136502 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 61665 ggcggcggcggcggcagcggt 61685
>emb|AL033520.16|HS349A12 Human DNA sequence from clone RP3-349A12 on chromosome 6p21.31-22.2 Contains the 3' end of gene FLJ20302, the TAF11 gene for TAF11 RNA polymerase II (TATA box binding protein (TBP)-associated factor, 28 kD), the 5' end of gene KIAA0229 for novel Ank, SAM (Sterile alpha motif) and Phosphotyrosine interaction (PTB/PID) domain containing protein (KIAA0229) and a CpG island, complete sequence Length = 132948 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 46754 gggcggcggcggcggcagcgg 46774
>emb|AJ966348.1| Hordeum vulgare subsp. vulgare mRNA for putative mitochondrial carrier protein (mc1 gene) Length = 1532 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 201 gctcgggcggcggcggcggcggcgg 177
>emb|AJ966347.1| Hordeum vulgare subsp. vulgare partial mRNA for putative mitochondrial carrier protein (mc1 gene) Length = 1092 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 61 gctcgggcggcggcggcggcggcgg 37
>gb|BC052950.1| Homo sapiens G protein-regulated inducer of neurite outgrowth 1, mRNA (cDNA clone MGC:43428 IMAGE:5267189), complete cds Length = 4222 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 58 gctcgggcggcggcggcggcggcgg 82
>emb|AL606668.2|OSJN00083 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064G10, complete sequence Length = 150206 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 87776 ggcggcggcggcggcagcggt 87796
>emb|CR860942.1| Pongo pygmaeus mRNA; cDNA DKFZp469D1431 (from clone DKFZp469D1431) Length = 2165 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 132 ggcggcggcggcggcagcggt 152
>gb|AC118670.2| Genomic sequence for Oryza sativa, Nipponbare stain, clone OSJNBb0036D03, from chromosome 3, complete sequence Length = 125800 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 28883 ggcggcggcggcggcagcggt 28863
>gb|AY121803.1| Homo sapiens BJ-HCC-21 tumor antigen mRNA, complete cds Length = 1176 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 413 gggcggcggcggcggcagcgg 393
>gb|AC091133.11| Homo sapiens chromosome 17, clone RP11-501C14, complete sequence Length = 168613 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 132127 gggcggcggcggcggcagcgg 132107
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 74583 cgggcggcggcggcggcagcg 74603 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 ctcgggcggcggcggcggca 79 |||||||||||||||||||| Sbjct: 3524009 ctcgggcggcggcggcggca 3523990
>ref|NM_008264.1| Mus musculus homeo box A13 (Hoxa13), mRNA Length = 1318 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 216 gggcggcggcggcggcagcgg 236
>dbj|AK098314.1| Homo sapiens cDNA FLJ40995 fis, clone UTERU2015830 Length = 2575 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 261 gggcggcggcggcggcagcgg 281
>dbj|AK122770.1| Homo sapiens cDNA FLJ16310 fis, clone SMINT2005368, weakly similar to Homo sapiens ubiquitin-conjugating BIR-domain enzyme APOLLON mRNA Length = 2303 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 170 gggcggcggcggcggcagcgg 190
>emb|CR609945.1| full-length cDNA clone CS0DF003YB09 of Fetal brain of Homo sapiens (human) Length = 2166 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 95 gctcgggcggcggcggcggcggcgg 119
>dbj|AK024030.1| Homo sapiens cDNA FLJ13968 fis, clone Y79AA1001493, weakly similar to UBIQUITIN-CONJUGATING ENZYME E2-17 KD 9 (EC 6.3.2.19) Length = 2934 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 170 gggcggcggcggcggcagcgg 190
>gb|AY061804.1| Zea mays Mo17 calpain-like protein (dek1) gene, complete cds Length = 23975 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 343 gggcggcggcggcggcagcgg 323
>ref|NM_136191.2| Drosophila melanogaster CG31688-RA (CG31688), mRNA Length = 3211 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 626 ggcggcggcggcggcagcggt 646
>dbj|D86982.1| Homo sapiens mRNA for KIAA0229 gene, partial cds Length = 6335 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 262 gggcggcggcggcggcagcgg 282
>gb|U40945.3| Caenorhabditis elegans cosmid F10D7, complete sequence Length = 34923 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 205 caaaacactgcagttcgagta 225 ||||||||||||||||||||| Sbjct: 27919 caaaacactgcagttcgagta 27939
>dbj|AK148096.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370015L17 product:Similar to UNCHARACTERIZED bone marrow protein BM044 (Fragment) homolog [Mus musculus], full insert sequence Length = 910 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 19 ggcggcggcggcggcagcggt 39
>dbj|AK155050.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630118J21 product:programmed cell death protein 7, full insert sequence Length = 2414 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 317 ggcggcggcggcggcagcggt 297
>gb|AC091934.2| Homo sapiens chromosome 5 clone RP11-31J6, complete sequence Length = 132832 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||||||||||||||||||| |||| Sbjct: 53095 gctcgggcggcggcggcggcggcgg 53119
>gb|AY075513.1| Drosophila melanogaster RE64176 full length cDNA Length = 3395 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 626 ggcggcggcggcggcagcggt 646
>dbj|AK146818.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920061G05 product:Similar to UNCHARACTERIZED bone marrow protein BM044 (Fragment), full insert sequence Length = 1686 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 40 ggcggcggcggcggcagcggt 60
>gb|AF443204.1|AF443204 Chlamydomonas reinhardtii WD40-repeat-containing protein (Mut11) mRNA, complete cds Length = 1113 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 905 gggcggcggcggcggcagcgg 925
>gb|AF446882.1|AF446882 Arabidopsis thaliana At2g32080/F22D22.17 mRNA, complete cds Length = 891 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 308 ccaaggtgttttacttcgatatcggtgagaaca 340 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 121 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 180 Query: 287 aagacgtc 294 |||||||| Sbjct: 181 aagacgtc 188
>ref|NM_025954.2| Mus musculus RIKEN cDNA 1700012G19 gene (1700012G19Rik), mRNA Length = 1045 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 62 cgggcggcggcggcggcagcggtca 86 |||| |||||||||||||||||||| Sbjct: 3 cgggtggcggcggcggcagcggtca 27
>gb|AF419556.1|AF419556 Arabidopsis thaliana At2g32080/F22D22.17 mRNA, complete cds Length = 1423 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 421 ccaaggtgttttacttcgatatcggtgagaaca 453 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 234 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 293 Query: 287 aagacgtc 294 |||||||| Sbjct: 294 aagacgtc 301
>gb|BC022396.1| Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1A, mRNA (cDNA clone IMAGE:4618556), containing frame-shift errors Length = 1560 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 265 gggcggcggcggcggcagcgg 285
>ref|NM_015245.1| Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1A (ANKS1A), mRNA Length = 6364 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 262 gggcggcggcggcggcagcgg 282
>ref|XM_702542.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 3 (LOC565233), mRNA Length = 1000 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 398 tgaaggagaaccagcgggggaggttcctc 426
>ref|XM_702541.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 2 (LOC565233), mRNA Length = 1003 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 401 tgaaggagaaccagcgggggaggttcctc 429
>ref|XM_679654.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 1 (LOC565233), mRNA Length = 1160 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 440 tgaaggagaaccagcgggggaggttcctc 468
>ref|XM_702360.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 3 (LOC564840), mRNA Length = 997 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 395 tgaaggagaaccagcgggggaggttcctc 423
>ref|XM_702359.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 2 (LOC564840), mRNA Length = 1003 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 401 tgaaggagaaccagcgggggaggttcctc 429
>ref|XM_679215.1| PREDICTED: Danio rerio similar to Purine-rich element binding protein B, transcript variant 1 (LOC564840), mRNA Length = 1160 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 440 tgaaggagaaccagcgggggaggttcctc 468
>dbj|AK162678.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched library, clone:9930013N07 product:Similar to UNCHARACTERIZED bone marrow protein BM044 (Fragment), full insert sequence Length = 1673 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 29 ggcggcggcggcggcagcggt 49
>gb|AC160646.2| Gallus gallus BAC clone CH261-24P2 from chromosome unknown, complete sequence Length = 212960 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 135535 cgggcggcggcggcggcagcg 135515
>gb|AY052714.1| Arabidopsis thaliana At2g32080/F22D22.17 mRNA, complete cds Length = 1431 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 422 ccaaggtgttttacttcgatatcggtgagaaca 454 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 235 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 294 Query: 287 aagacgtc 294 |||||||| Sbjct: 295 aagacgtc 302
>gb|AY228705.1| Homo sapiens non-functional forkhead winged/helix transcription factor mutant 3 (FOXC1) gene, complete sequence Length = 1663 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 1117 agctcgggcggcggcggcggc 1137
>gb|AY228704.1| Homo sapiens forkhead winged/helix transcription factor mutant 2 (FOXC1) gene, complete cds Length = 1663 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 1117 agctcgggcggcggcggcggc 1137
>gb|AY228703.1| Homo sapiens non-functional forkhead winged/helix transcription factor mutant 1 (FOXC1) gene, complete sequence Length = 1663 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggc 78 ||||||||||||||||||||| Sbjct: 1117 agctcgggcggcggcggcggc 1137
>dbj|AK050640.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920027A05 product:similar to UNCHARACTERIZED BONE MARROW PROTEIN BM044 (BM-003) (HYPOTHETICAL 31.0 KDA PROTEIN) [Homo sapiens], full insert sequence Length = 983 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 29 ggcggcggcggcggcagcggt 49
>dbj|AK038286.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130092P05 product:PUTATIVE WHSC1 PROTEIN homolog [Homo sapiens], full insert sequence Length = 3704 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 34 gggcggcggcggcggcagcgg 14
>dbj|AK032853.1| Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720463B03 product:hepatitis B virus x associated protein, full insert sequence Length = 2970 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 1 gggcggcggcggcggcagcgg 21
>gb|AC160090.4| Mus musculus 6 BAC RP23-322E20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206093 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 124061 ggcggcggcggcggcagcggt 124041
>gb|AF136152.1|AF136152 Arabidopsis thaliana PUR alpha-1 mRNA, complete cds Length = 1442 Score = 42.1 bits (21), Expect = 2.1 Identities = 30/33 (90%) Strand = Plus / Plus Query: 414 ccaaggtgttctacttcgatattggggagaaca 446 |||||||||| ||||||||||| || ||||||| Sbjct: 434 ccaaggtgttttacttcgatatcggtgagaaca 466 Score = 40.1 bits (20), Expect = 8.2 Identities = 56/68 (82%) Strand = Plus / Plus Query: 227 aagctcttctacttcgatctgaaggagaacccgcgggggaggtacctcaagatctccgag 286 ||||| ||||| || ||||| |||||||| || || || ||||| || ||||| || ||| Sbjct: 247 aagctattctattttgatcttaaggagaatcctcgtggaaggtatctaaagatatcggag 306 Query: 287 aagacgtc 294 |||||||| Sbjct: 307 aagacgtc 314
>emb|BX322550.7| Zebrafish DNA sequence from clone DKEY-202N14 in linkage group 5, complete sequence Length = 184426 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 246 tgaaggagaacccgcgggggaggtacctc 274 |||||||||||| ||||||||||| |||| Sbjct: 13641 tgaaggagaaccagcgggggaggttcctc 13613
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 11247933 ggcggcggcggcggcagcggt 11247913 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 27322317 ggcggcggcggcggcagcgg 27322298 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 27216226 ggcggcggcggcggcagcgg 27216245 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 tcgggcggcggcggcggcagcggt 84 |||||||||||||||||| ||||| Sbjct: 27135087 tcgggcggcggcggcggcggcggt 27135110 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 58 agctcgggcggcggcggcggcagcggtcatgg 89 ||||||| ||||||||||||| |||| ||||| Sbjct: 25972468 agctcggtcggcggcggcggcggcggccatgg 25972499 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23641045 ggcggcggcggcggcagcgg 23641064 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 22005777 ggcggcggcggcggcagcgg 22005758 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 20040130 ggcggcggcggcggcagcgg 20040149 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcg 82 |||||||||||||||||||| Sbjct: 2751791 gggcggcggcggcggcagcg 2751772 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcg 82 |||||||||||||||||||| Sbjct: 2745814 gggcggcggcggcggcagcg 2745795 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 728620 ggcggcggcggcggcagcgg 728639
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcggtcatg 88 |||||||||||||||||||| |||| Sbjct: 19882989 ggcggcggcggcggcagcggccatg 19883013 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 59 gctcgggcggcggcggcggcagcgg 83 |||| |||||||||||||||||||| Sbjct: 4217042 gctccggcggcggcggcggcagcgg 4217018 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 29646200 ggcggcggcggcggcagcgg 29646181 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23706720 ggcggcggcggcggcagcgg 23706739
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 cgggcggcggcggcggcagcg 82 ||||||||||||||||||||| Sbjct: 5180739 cgggcggcggcggcggcagcg 5180719 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 26093663 ggcggcggcggcggcagcgg 26093682 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 21858853 ggcggcggcggcggcagcgg 21858872 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 127 cggcggcggggtgggaggca 146 |||||||||||||||||||| Sbjct: 17103450 cggcggcggggtgggaggca 17103431 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 51 aaaccctagctcgggcggcggcggcggc 78 |||||||||||| || |||||||||||| Sbjct: 8738697 aaaccctagctctggtggcggcggcggc 8738670 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 6298655 ggcggcggcggcggcagcgg 6298674
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 35539910 gggcggcggcggcggcagcgg 35539930 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcggt 84 ||||||||||||||||||||| Sbjct: 10313518 ggcggcggcggcggcagcggt 10313498 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 34977065 ggcggcggcggcggcagcgg 34977084 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 34660170 ggcggcggcggcggcagcgg 34660189 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 33860138 ggcggcggcggcggcagcgg 33860119 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 gcggcggcggcggcagcggt 84 |||||||||||||||||||| Sbjct: 32254948 gcggcggcggcggcagcggt 32254929 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 30720149 ggcggcggcggcggcagcgg 30720168 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 29651718 ggcggcggcggcggcagcgg 29651737 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 28888960 ggcggcggcggcggcagcgg 28888979 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 24153249 ggcggcggcggcggcagcgg 24153268 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 23855785 ggcggcggcggcggcagcgg 23855766 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 22469621 ggcggcggcggcggcagcgg 22469602 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 60 ctcgggcggcggcggcggcagcgg 83 ||||||||||||||||||| |||| Sbjct: 15494684 ctcgggcggcggcggcggcggcgg 15494707 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 10245376 ggcggcggcggcggcagcgg 10245395 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 9422559 ggcggcggcggcggcagcgg 9422540 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 ggcggcggcggcggcagcgg 83 |||||||||||||||||||| Sbjct: 6104216 ggcggcggcggcggcagcgg 6104235
>gb|AC136624.3| Homo sapiens chromosome 16 clone RP11-517A5, complete sequence Length = 211896 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 138 tgggaggcatggtgggacccg 158 ||||||||||||||||||||| Sbjct: 148413 tgggaggcatggtgggacccg 148433
>gb|AC092559.4| Oryza sativa chromosome 3 BAC OSJNBb0096M04 genomic sequence, complete sequence Length = 133846 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 37788 gggcggcggcggcggcagcgg 37768
>gb|AC091167.19| Homo sapiens chromosome 15, clone RP11-697E2, complete sequence Length = 202381 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 63379 gggcggcggcggcggcagcgg 63359
>ref|XM_575481.1| PREDICTED: Rattus norvegicus similar to transcription factor HOXA13 (LOC500129), mRNA Length = 2441 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gggcggcggcggcggcagcgg 83 ||||||||||||||||||||| Sbjct: 139 gggcggcggcggcggcagcgg 159 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,481,310 Number of Sequences: 3902068 Number of extensions: 4481310 Number of successful extensions: 284823 Number of sequences better than 10.0: 1738 Number of HSP's better than 10.0 without gapping: 1797 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 236314 Number of HSP's gapped (non-prelim): 44630 length of query: 600 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 577 effective length of database: 17,143,297,704 effective search space: 9891682775208 effective search space used: 9891682775208 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)