ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart26f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016914.1| Zea mays clone Contig747 mRNA sequence 274 3e-70
2emb|X55981.1|ZMENOLA Maize mRNA for enolase (2-phospho-D-glycera... 274 3e-70
3gb|AY103975.1| Zea mays PCO080341 mRNA sequence 242 1e-60
4dbj|AK069316.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 2e-58
5dbj|AK104904.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 1e-20
6dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
7dbj|AP003526.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
8dbj|AP004234.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
9gb|BT016642.1| Zea mays clone Contig475 mRNA sequence 80 8e-12
10gb|AY344113.2| Cynodon dactylon pollen 2-phosphoglycerate dehydr... 80 8e-12
11gb|AF348914.1|AF348914 Chara corallina enolase (eno) gene, parti... 80 8e-12
12dbj|AK104877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
13dbj|AK099342.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
14dbj|AK073611.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 8e-12
15gb|AY103866.1| Zea mays PCO068679 mRNA sequence 80 8e-12
16gb|U17973.1|ZMU17973 Zea mays enolase (eno2) mRNA, complete cds 80 8e-12
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 76 1e-10
18dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
19gb|AC134235.2| Oryza sativa (japonica cultivar-group) chromosome... 76 1e-10
20gb|AC118672.3| Genomic sequence for Oryza sativa, Nipponbare str... 76 1e-10
21ref|NM_195031.1| Oryza sativa (japonica cultivar-group) putative... 72 2e-09
22gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 72 2e-09
23ref|XM_864856.1| PREDICTED: Bos taurus similar to Gamma enolase ... 72 2e-09
24ref|XM_604365.2| PREDICTED: Bos taurus similar to Gamma enolase ... 72 2e-09
25gb|AY335488.1| Oryza sativa (japonica cultivar-group) enolase (E... 72 2e-09
26gb|AC131375.1| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
27dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
28dbj|AK099292.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
29dbj|AK073662.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
30gb|U09450.1|OSU09450 Oryza sativa enolase mRNA, complete cds 72 2e-09
31gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
32emb|X92377.1|AGPGH1 A.glutinosa mRNA for enolase 70 8e-09
33emb|CR726296.2|CNS0GNCU Tetraodon nigroviridis full-length cDNA 66 1e-07
34emb|CR698859.2|CNS0G26V Tetraodon nigroviridis full-length cDNA 66 1e-07
35emb|CR685932.2|CNS0FS7S Tetraodon nigroviridis full-length cDNA 66 1e-07
36emb|CR685174.1|CNS0FRMQ Tetraodon nigroviridis full-length cDNA 66 1e-07
37emb|CR679338.2|CNS0FN4M Tetraodon nigroviridis full-length cDNA 66 1e-07
38emb|CR672414.2|CNS0FHT0 Tetraodon nigroviridis full-length cDNA 66 1e-07
39emb|CR656482.2|CNS0F5IG Tetraodon nigroviridis full-length cDNA 66 1e-07
40emb|CR650019.2|CNS0F0IX Tetraodon nigroviridis full-length cDNA 66 1e-07
41gb|AF516689.1| Musa acuminata clone F175 enolase mRNA, partial cds 64 5e-07
42gb|DQ334724.2| Brassica rapa subsp. chinensis los (los) mRNA, co... 64 5e-07
43gb|AF348915.1|AF348915 Nitella opaca enolase (eno) gene, partial... 64 5e-07
44ref|NM_129209.2| Arabidopsis thaliana LOS2; phosphopyruvate hydr... 62 2e-06
45gb|AY559080.1| Capsella bursa-pastoris LOS2 (los2) mRNA, complet... 62 2e-06
46gb|AY150418.1| Arabidopsis thaliana enolase (2-phospho-D-glycera... 62 2e-06
47gb|AY072095.1| Arabidopsis thaliana putative enolase (2-phospho-... 62 2e-06
48emb|BX294155.1| Pirellula sp. strain 1 complete genome; segment ... 62 2e-06
49gb|AY092986.1| Arabidopsis thaliana enolase (2-phospho-D-glycera... 62 2e-06
50gb|AF428279.1|AF428279 Arabidopsis thaliana At2g36530/F1O11.16 m... 62 2e-06
51gb|AF424603.1|AF424603 Arabidopsis thaliana At2g36530/F1O11.16 m... 62 2e-06
52gb|AY054253.1| Arabidopsis thaliana At2g36530/F1O11.16 mRNA, com... 62 2e-06
53gb|AF123457.1|AF123457 Toxoplasma gondii enolase (ENO2) mRNA, co... 62 2e-06
54gb|AY155668.1| Toxoplasma gondii strain PLK enolase 2 (ENO2) and... 62 2e-06
55gb|U85836.1|CSU85836 Calliobothrium sp. enolase mRNA, partial cds 62 2e-06
56ref|XM_862228.1| PREDICTED: Canis familiaris similar to Gamma en... 58 3e-05
57ref|XM_862219.1| PREDICTED: Canis familiaris similar to Gamma en... 58 3e-05
58ref|XM_862210.1| PREDICTED: Canis familiaris similar to Gamma en... 58 3e-05
59ref|XM_534902.2| PREDICTED: Canis familiaris similar to Gamma en... 58 3e-05
60emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete ch... 58 3e-05
61gb|AY005153.1| Amia calva beta enolase-1 mRNA, partial cds 58 3e-05
62gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 56 1e-04
63emb|AL939132.1|SCO939132 Streptomyces coelicolor A3(2) complete ... 56 1e-04
64gb|AY650330.1| Macaca fascicularis enolase 2 mRNA, partial cds 54 5e-04
65gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 54 5e-04
66gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 54 5e-04
67gb|AY181039.1| Methylobacterium extorquens enolase (eno) gene, c... 54 5e-04
68gb|AY307449.1| Brassica napus enolase mRNA, complete cds 54 5e-04
69ref|NM_001975.2| Homo sapiens enolase 2 (gamma, neuronal) (ENO2)... 54 5e-04
70ref|XM_851111.1| PREDICTED: Canis familiaris similar to Beta eno... 54 5e-04
71ref|XM_536606.2| PREDICTED: Canis familiaris similar to Beta eno... 54 5e-04
72gb|AY297757.1| Gossypium barbadense enolase mRNA, complete cds 54 5e-04
73gb|BT009876.1| Synthetic construct Homo sapiens enolase 2, (gamm... 54 5e-04
74emb|X58107.1|ATENGE A.thaliana enolase gene 54 5e-04
75emb|X51956.1|HSENO2 Human ENO2 gene for neuron specific (gamma) ... 54 5e-04
76emb|X14327.1|HSNSEMRNA Human mRNA for neurone specific gamma eno... 54 5e-04
77emb|X13120.1|HSEN1 Human mRNA fragment for neurone-specific enolase 54 5e-04
78emb|CR942276.1| Human DNA sequence from clone XX-NCIH2171_5AM21,... 54 5e-04
79emb|AJ271719.1|SOL271719 Spinacia oleracea mRNA for enolase (eno... 54 5e-04
80gb|BT007383.1| Homo sapiens enolase 2, (gamma, neuronal) mRNA, c... 54 5e-04
81emb|CR859195.1| Pongo pygmaeus mRNA; cDNA DKFZp459B1817 (from cl... 54 5e-04
82dbj|AK124656.1| Homo sapiens cDNA FLJ42665 fis, clone BRAMY20199... 54 5e-04
83gb|AC006919.6| Arabidopsis thaliana chromosome 2 clone F1O11 map... 54 5e-04
84emb|CR536582.1| Homo sapiens full open reading frame cDNA clone ... 54 5e-04
85gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 54 5e-04
86gb|AC006512.13| Homo sapiens 12 PAC RP3-461F17 (Roswell Park Can... 54 5e-04
87gb|AE009526.1| Brucella melitensis 16M chromosome I, section 83 ... 54 5e-04
88gb|U47924.1|HSU47924 Human chromosome 12p13 sequence, complete s... 54 5e-04
89gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 54 5e-04
90gb|AY892117.1| Synthetic construct Homo sapiens clone FLH026756.... 54 5e-04
91gb|AY892116.1| Synthetic construct Homo sapiens clone FLH026755.... 54 5e-04
92gb|AY889659.1| Synthetic construct Homo sapiens clone FLH026760.... 54 5e-04
93gb|AY889658.1| Synthetic construct Homo sapiens clone FLH026759.... 54 5e-04
94gb|AY893505.1| Synthetic construct Homo sapiens clone FLH131103.... 54 5e-04
95gb|BC002745.2| Homo sapiens enolase 2 (gamma, neuronal), mRNA (c... 54 5e-04
96emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 54 5e-04
97gb|M22349.1|HUMENOG Human neuron-specific gamma-2 enolase, compl... 54 5e-04
98gb|M36768.1|HUMENOGA Human gamma enolase mRNA, 3' end 54 5e-04
99emb|CR728153.1|CNS0GOSF Tetraodon nigroviridis full-length cDNA 52 0.002
100gb|AF424654.1| Phytophthora infestans clone MY-07-F-01 enolase m... 52 0.002
101gb|AY615333.1| Heterocapsa triquetra enolase 2 mRNA, partial cds 50 0.008
102gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 50 0.008
103gb|AF348916.1|AF348916 Nitellopsis obtusa enolase (eno) gene, pa... 50 0.008
104dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.008
105dbj|AP005867.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.008
106dbj|AP005637.2| Oryza sativa (japonica cultivar-group) genomic D... 50 0.008
107gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 50 0.008
108gb|U85833.1|HDU85833 Hymenolepis diminuta enolase mRNA, partial cds 50 0.008
109gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 48 0.030
110gb|S79816.1| enolase [Echinochloa phyllopogon, shoots, mRNA Part... 48 0.030
111gb|AY307448.1| Brassica rapa enolase mRNA, complete cds 48 0.030
112gb|AY725787.1| Oncometopia nigricans enolase mRNA, complete cds 46 0.12
113emb|AJ508935.1|PFR508935 Propionibacterium freudenreichii subsp.... 46 0.12
114emb|BX070348.1|CNS09QG0 Single read from an extremity of a full-... 46 0.12
115emb|BX065472.1|CNS09MOK Single read from an extremity of a full-... 46 0.12
116emb|BX061954.1|CNS09JYU Single read from an extremity of a full-... 46 0.12
117emb|BX059219.1|CNS09HUV Single read from an extremity of a full-... 46 0.12
118emb|BX057485.1|CNS09GIP Single read from an extremity of a full-... 46 0.12
119emb|BX054124.1|CNS09DXC Single read from an extremity of a full-... 46 0.12
120emb|BX051880.1|CNS09C70 Single read from an extremity of a full-... 46 0.12
121emb|BX041556.1|CNS09488 Single read from an extremity of a full-... 46 0.12
122emb|BX036808.1|CNS090KC Single read from an extremity of a full-... 46 0.12
123emb|BX033476.1|CNS08XZS Single read from an extremity of a full-... 46 0.12
124emb|BX033475.1|CNS08XZR Single read from an extremity of a full-... 46 0.12
125emb|BX031580.1|CNS08WJ4 Single read from an extremity of a full-... 46 0.12
126emb|BX028564.1|CNS08U7C Single read from an extremity of a full-... 46 0.12
127emb|BX027842.1|CNS08TNA Single read from an extremity of a full-... 46 0.12
128emb|BX027683.1|CNS08TIV Single read from an extremity of a full-... 46 0.12
129emb|BX026463.1|CNS08SKZ Single read from an extremity of a full-... 46 0.12
130emb|BX026179.1|CNS08SD3 Single read from an extremity of a full-... 46 0.12
131emb|BX023989.1|CNS08QO9 Single read from an extremity of a full-... 46 0.12
132emb|BX470161.8| Zebrafish DNA sequence from clone RP71-84I2, com... 46 0.12
133dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 46 0.12
134dbj|AB091508.1| Penicillium chrysogenum mRNA for enolase, comple... 46 0.12
135ref|XM_317673.2| Anopheles gambiae str. PEST ENSANGP00000023637 ... 46 0.12
136ref|XM_317672.2| Anopheles gambiae str. PEST ENSANGP00000018531 ... 46 0.12
137gb|AY430424.1| Heterocapsa triquetra enolase gene, partial cds 46 0.12
138gb|AF120157.1|AF120157 Cellulomonas pachnodae endo-1,4-beta-xyla... 46 0.12
139gb|U85828.1|LTU85828 Lacistorhynchus tenuis enolase mRNA, partia... 46 0.12
140dbj|AB005550.1| Desulfovibrio vulgaris gene for ferredoxin II, p... 46 0.12
141dbj|AB046715.1| Desulfovibrio vulgaris eno gene for enolase, com... 46 0.12
142gb|AC164157.3| Mus musculus BAC clone RP24-297C1 from chromosome... 44 0.47
143ref|NM_013509.2| Mus musculus enolase 2, gamma neuronal (Eno2), ... 44 0.47
144gb|BC060310.1| Rattus norvegicus enolase 2, gamma, mRNA (cDNA cl... 44 0.47
145gb|BC031739.1| Mus musculus enolase 2, gamma neuronal, mRNA (cDN... 44 0.47
146emb|BX042900.1|CNS0959K Single read from an extremity of a full-... 44 0.47
147emb|BX044062.1|CNS0965U Single read from an extremity of a full-... 44 0.47
148emb|X52380.1|MSGAEN Mouse mRNA for gamma-enolase (2-phospho-D-gl... 44 0.47
149gb|CP000133.1| Rhizobium etli CFN 42, complete genome 44 0.47
150dbj|AK131652.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 44 0.47
151dbj|AK134571.1| Mus musculus adult male medulla oblongata cDNA, ... 44 0.47
152dbj|AK146655.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 44 0.47
153dbj|AK170169.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 44 0.47
154gb|S79242.1| Pgh1b=2-phospho-D-glycerate hydrolase [Mesembryanth... 44 0.47
155gb|BC009018.1| Mus musculus enolase 2, gamma neuronal, mRNA (cDN... 44 0.47
156dbj|AK003051.1| Mus musculus adult male brain cDNA, RIKEN full-l... 44 0.47
157dbj|AB195826.1| Karenia brevis eno3b mRNA for enolase 3, partial... 44 0.47
158dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 44 0.47
159gb|AY430421.1| Phytophthora palmivora enolase gene, partial cds 44 0.47
160emb|X07728.1|RNEN3 R.norvegicus gene encoding neuron-specific en... 44 0.47
161gb|AC002397.1|AC002397 Mouse chromosome 6 BAC-284H12 (Research G... 44 0.47
162gb|AE017221.1| Thermus thermophilus HB27, complete genome 44 0.47
163gb|AF019973.1|AF019973 Rattus norvegicus neuron-specific enolase... 44 0.47
164gb|DQ241856.1| Solanum tuberosum clone 002G05 enolase-like mRNA,... 44 0.47
165ref|NM_139325.1| Rattus norvegicus enolase 2, gamma (Eno2), mRNA 44 0.47
166gb|M11931.1|RATENONS Rat brain neuron-specific enolase mRNA, com... 44 0.47
167gb|U09194.1|MCU09194 Mesembryanthemum crystallinum 2-phospho-D-g... 44 0.47
168gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.9
169gb|AC105898.2| Drosophila melanogaster clone BACR25P15, complete... 42 1.9
170gb|BC061441.1| Xenopus tropicalis similar to calsequestrin 2 (ca... 42 1.9
171gb|AC034265.9| Mus musculus chromosome 1, clone RP23-180K2, comp... 42 1.9
172gb|BT014924.1| Drosophila melanogaster AT25373 full insert cDNA 42 1.9
173gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.9
174gb|DQ089999.1|DQ089999S1 Cocos nucifera enolase (Eno) mRNA, part... 42 1.9
175gb|AC084391.1| Mus musculus BAC clone RP23-294I17 from 1, comple... 42 1.9
176emb|X17034.1|DMENOLAS Drosophila gene for enolase (2-phospho-D-g... 42 1.9
177emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.9
178gb|AC148219.15| Medicago truncatula clone mth2-21l10, complete s... 42 1.9
179gb|AY118449.1| Drosophila melanogaster SD23356 full insert cDNA 42 1.9
180ref|NM_164434.1| Drosophila melanogaster Enolase CG17654-RE, tra... 42 1.9
181ref|NM_164433.1| Drosophila melanogaster Enolase CG17654-RD, tra... 42 1.9
182ref|NM_164432.1| Drosophila melanogaster Enolase CG17654-RC, tra... 42 1.9
183ref|NM_164431.1| Drosophila melanogaster Enolase CG17654-RB, tra... 42 1.9
184ref|NM_058073.3| Drosophila melanogaster Enolase CG17654-RA, tra... 42 1.9
185gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22... 42 1.9
186gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 42 1.9
187dbj|AB195827.1| Karenia brevis eno3c mRNA for enolase 3, partial... 42 1.9
188ref|NM_203805.1| Xenopus tropicalis similar to calsequestrin 2 (... 42 1.9
189gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 ... 42 1.9
190gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 42 1.9
191gb|AC004442.1|AC004442 Drosophila melanogaster, chromosome 2L, r... 42 1.9
192gb|AC003945.1|AC003945 Drosophila melanogaster (P1 DS05247 (D90)... 42 1.9
193gb|CP000110.1| Synechococcus sp. CC9605, complete genome 40 7.3
194gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 7.3
195gb|BT016837.1| Zea mays clone Contig670 mRNA sequence 40 7.3
196gb|BC080039.1| Xenopus laevis similar to calsequestrin 2 (cardia... 40 7.3
197gb|AY693642.1| Streptomyces netropsis two component response reg... 40 7.3
198gb|AC008356.6| Drosophila melanogaster clone BACR43K14, complete... 40 7.3
199gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 40 7.3
200gb|BT013094.1| Lycopersicon esculentum clone 114360F, mRNA sequence 40 7.3
201gb|BC041283.1| Xenopus laevis similar to calsequestrin 2 (cardia... 40 7.3
202gb|BT011441.1| Drosophila melanogaster RE55714 full insert cDNA 40 7.3
203gb|AY499570.1| Cryphonectria parasitica enolase (Eno1) gene, com... 40 7.3
204ref|XM_754410.1| Ustilago maydis 521 hypothetical protein (UM033... 40 7.3
205emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 7.3
206emb|X58108.1|LEMRNAEN L.esculentum mRNA for enolase 40 7.3
207gb|BC103354.1| Bos taurus enolase 1, mRNA (cDNA clone MGC:127526... 40 7.3
208emb|AL035681.13|HS756G23 Human DNA sequence from clone RP4-756G2... 40 7.3
209ref|XM_779383.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.3
210emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genom... 40 7.3
211dbj|AK057177.1| Homo sapiens cDNA FLJ32615 fis, clone STOMA2000148 40 7.3
212ref|NM_141611.1| Drosophila melanogaster CG9746-RA (CG9746), mRNA 40 7.3
213dbj|AB195834.1| Heterocapsa triquetra GapC4-eno3 mRNA for polypr... 40 7.3
214gb|AF454545.1|AF454545 Xanthomonas campestris pv. vesicatoria ge... 40 7.3
215gb|AF371279.1|AF371279 Zea mays legumin 1 mRNA, complete cds 40 7.3
216ref|NM_174049.2| Bos taurus enolase 1 (ENO1), mRNA 40 7.3
217gb|BC097545.1| Xenopus laevis similar to calsequestrin 2 (cardia... 40 7.3
218gb|AY051557.1| Drosophila melanogaster GH20665 full length cDNA 40 7.3
219gb|AF348478.1|AF348478 Mastigamoeba balamuthi enolase (enol) gen... 40 7.3
220dbj|AB195825.1| Karenia brevis eno3a mRNA for enolase 3, partial... 40 7.3
221gb|AE004783.1| Pseudomonas aeruginosa PAO1, section 344 of 529 o... 40 7.3
222gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 7.3
223gb|AF205070.1|AF205070 Mastigamoeba balamuthi enolase mRNA, comp... 40 7.3
224dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 7.3
225gb|AF096253.1|AF096253 Lycopersicon esculentum ethylene-responsi... 40 7.3
226gb|AF149256.1|AF149256 Bos taurus alpha enolase mRNA, complete cds 40 7.3
227gb|AE003682.4| Drosophila melanogaster chromosome 3R, section 20... 40 7.3
228dbj|AB073081.2| Zea mays mRNA for uncleaved legumin-1, complete cds 40 7.3
229gb|AF082100.1|AF082100 Streptomyces sp. MA6548 FK506 peptide syn... 40 7.3
230gb|AC152923.2| Mus musculus BAC clone RP24-267O6 from 5, complet... 40 7.3
231gb|AC134525.5| Mus musculus BAC clone RP24-496F7 from 8, complet... 40 7.3
232dbj|AK074091.1| Homo sapiens mRNA for FLJ00162 protein 40 7.3

>gb|BT016914.1| Zea mays clone Contig747 mRNA sequence
          Length = 1732

 Score =  274 bits (138), Expect = 3e-70
 Identities = 342/411 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatatcgg 189
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||  | ||
Sbjct: 118 ggtgaaggcgaggcagatcttcgacagccgcggcaaccccaccgtcgaggtggacgtggg 177

                                                                       
Query: 190 gctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccggaatcta 249
            ||||||||||| |||| ||| ||||| ||||| ||||||||||| ||||| ||||| ||
Sbjct: 178 cctcagcgacggcagctacgcgaggggggccgtacccagcggcgcatccactggaatata 237

                                                                       
Query: 250 cggggccctggagctgagggatggaggctccgattacctcggcaaaggagttctcaaggc 309
            | |||| ||||| ||||||||||||| || ||||| || ||||| || ||||| |||||
Sbjct: 238 tgaggccttggagttgagggatggaggatctgattatcttggcaagggtgttcttaaggc 297

                                                                       
Query: 310 tgtgaacaacgtanacgccatcatcggaccggcgctcatcgganaggatccgacggagca 369
           ||| | ||||||| ||  ||| || ||||| ||| |  | ||| |||| || || |||||
Sbjct: 298 tgtcagcaacgtaaacaacattattggaccagcgattgttggaaaggaccccactgagca 357

                                                                       
Query: 370 ggccgacatcgacaacttcacggtccaagaactcgacgggacctccaacgagtggggctg 429
           ||  || || |||||||||| ||||||| | || || || |||||||| |||||||||||
Sbjct: 358 ggttgagattgacaacttcatggtccaacagcttgatggaacctccaatgagtggggctg 417

                                                                       
Query: 430 gtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggc 489
           |||||| |||||||| || ||||| || ||||| ||||| || ||||| |||||||| ||
Sbjct: 418 gtgcaaacagaagcttggagcaaatgccatccttgcggtttcacttgctgtgtgcaaagc 477

                                                              
Query: 490 cggtgccatggtcaacaagatccctctttaccagcacatcgcanaccttgc 540
            || || ||||| || ||||| ||||||||||||||||||||| | |||||
Sbjct: 478 tggagctatggtgaagaagattcctctttaccagcacatcgcaaatcttgc 528



to top

>emb|X55981.1|ZMENOLA Maize mRNA for enolase (2-phospho-D-glycerate hydrolase)
          Length = 1699

 Score =  274 bits (138), Expect = 3e-70
 Identities = 342/411 (83%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatatcgg 189
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||  | ||
Sbjct: 75  ggtgaaggcgaggcagatcttcgacagccgcggcaaccccaccgtcgaggtggacgtggg 134

                                                                       
Query: 190 gctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccggaatcta 249
            ||||||||||| |||| ||| ||||| ||||| ||||||||||| ||||| ||||| ||
Sbjct: 135 cctcagcgacggcagctacgcgaggggggccgtacccagcggcgcatccactggaatata 194

                                                                       
Query: 250 cggggccctggagctgagggatggaggctccgattacctcggcaaaggagttctcaaggc 309
            | |||| ||||| ||||||||||||| || ||||| || ||||| || ||||| |||||
Sbjct: 195 tgaggccttggagttgagggatggaggatctgattatcttggcaagggtgttcttaaggc 254

                                                                       
Query: 310 tgtgaacaacgtanacgccatcatcggaccggcgctcatcgganaggatccgacggagca 369
           ||| | ||| ||| ||  ||| || ||||| ||| |  | ||| |||| || || |||||
Sbjct: 255 tgtcagcaatgtaaacaacattattggaccagcgattgttggaaaggaccccactgagca 314

                                                                       
Query: 370 ggccgacatcgacaacttcacggtccaagaactcgacgggacctccaacgagtggggctg 429
           ||  || || |||||||||| ||||||| | || ||||| |||||||| |||||||||||
Sbjct: 315 ggttgagattgacaacttcatggtccaacagcttgacggaacctccaatgagtggggctg 374

                                                                       
Query: 430 gtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggc 489
           |||||| |||||||| || ||||| || ||||| ||||| || ||||| |||||||| ||
Sbjct: 375 gtgcaaacagaagcttggagcaaatgccatccttgcggtttcacttgctgtgtgcaaagc 434

                                                              
Query: 490 cggtgccatggtcaacaagatccctctttaccagcacatcgcanaccttgc 540
            || || ||||| || ||||| ||||||||||||||||||||| | |||||
Sbjct: 435 tggagctatggtgaagaagattcctctttaccagcacatcgcaaatcttgc 485



to top

>gb|AY103975.1| Zea mays PCO080341 mRNA sequence
          Length = 1884

 Score =  242 bits (122), Expect = 1e-60
 Identities = 338/411 (82%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatatcgg 189
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||  | ||
Sbjct: 222 ggtgaaggcgaggcagatcttcgacagccgcggcaaccccaccgtcgaggtggacgtggg 281

                                                                       
Query: 190 gctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccggaatcta 249
            ||||||||||| |||| ||| ||||| ||||| ||||||||||| ||||| ||||| ||
Sbjct: 282 cctcagcgacggcagctacgcgaggggggccgtacccagcggcgcatccactggaatata 341

                                                                       
Query: 250 cggggccctggagctgagggatggaggctccgattacctcggcaaaggagttctcaaggc 309
            | |||| ||||| ||||||||||||| || ||||| || ||||| || ||||| |||||
Sbjct: 342 tgaggccttggagttgagggatggaggatctgattatcttggcaagggtgttcttaaggc 401

                                                                       
Query: 310 tgtgaacaacgtanacgccatcatcggaccggcgctcatcgganaggatccgacggagca 369
           ||| | ||| ||| |   ||| || ||||| ||  |  | ||| |||| || || |||||
Sbjct: 402 tgtcagcaatgtaaataacattattggaccagcaattgttggaaaggaccccactgagca 461

                                                                       
Query: 370 ggccgacatcgacaacttcacggtccaagaactcgacgggacctccaacgagtggggctg 429
           ||  || || |||||||||| ||||||| | || || || |||||||| |||||||||||
Sbjct: 462 ggttgagattgacaacttcatggtccaacagcttgatggaacctccaatgagtggggctg 521

                                                                       
Query: 430 gtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggc 489
           |||||| |||||||| || ||||| || || || ||||| || ||||| |||||||| ||
Sbjct: 522 gtgcaaacagaagcttggagcaaatgccattcttgcggtttcacttgctgtgtgcaaagc 581

                                                              
Query: 490 cggtgccatggtcaacaagatccctctttaccagcacatcgcanaccttgc 540
            || || ||||| || ||||| ||||||||||||||||||||| | |||||
Sbjct: 582 tggagctatggtgaagaagattcctctttaccagcacatcgcaaatcttgc 632



to top

>dbj|AK069316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013C22, full
           insert sequence
          Length = 1677

 Score =  234 bits (118), Expect = 2e-58
 Identities = 346/423 (81%)
 Strand = Plus / Plus

                                                                       
Query: 118 gacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcga 177
           |||||||||||| ||||||||| |||||||||||||||||||||| |||||||| || ||
Sbjct: 90  gacgatccagtccgtgaaggcgaggcagatcttcgacagccgcgggaaccccacggtgga 149

                                                                       
Query: 178 ggtggatatcgggctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctc 237
           ||||||  | || |||||||| || |||||||| |||||||||||||| ||||| || ||
Sbjct: 150 ggtggacgtgggactcagcgatggcagcttcgcgaggggcgccgtgccgagcggtgcttc 209

                                                                       
Query: 238 caccggaatctacggggccctggagctgagggatggaggctccgattacctcggcaaagg 297
           ||||||||| || | |||| ||||| | || |||||||| ||||| || || ||||||||
Sbjct: 210 caccggaatatatgaggccttggagttaagagatggaggatccgactatcttggcaaagg 269

                                                                       
Query: 298 agttctcaaggctgtgaacaacgtanacgccatcatcggaccggcgctcatcgganagga 357
            || ||||||||||||| ||| ||| || | || || || || || ||||||||| ||||
Sbjct: 270 tgtactcaaggctgtgagcaatgtaaacactattattgggccagcactcatcggaaagga 329

                                                                       
Query: 358 tccgacggagcaggccgacatcgacaacttcacggtccaagaactcgacgggacctccaa 417
           ||| || ||||| |  ||||| || ||||||| ||| ||| | || || || ||||||||
Sbjct: 330 tcccactgagcaagttgacattgataacttcatggttcaacagcttgatggaacctccaa 389

                                                                       
Query: 418 cgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgc 477
           | | |||||||||||||| || ||||| || ||||| || || || || || || |||||
Sbjct: 390 caactggggctggtgcaaacaaaagcttggagcaaatgctattcttgctgtttcacttgc 449

                                                                       
Query: 478 agtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacct 537
            |||||||| || || |||||||| || ||||| || |||||||||||||| ||| | ||
Sbjct: 450 tgtgtgcaaagcaggagccatggtgaagaagattcccctttaccagcacattgcaaatct 509

              
Query: 538 tgc 540
           |||
Sbjct: 510 tgc 512



to top

>dbj|AK104904.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-F09, full
           insert sequence
          Length = 1424

 Score =  109 bits (55), Expect = 1e-20
 Identities = 217/272 (79%)
 Strand = Plus / Plus

                                                                       
Query: 269 gatggaggctccgattacctcggcaaaggagttctcaaggctgtgaacaacgtanacgcc 328
           |||||||| ||||| || || |||||||| || ||||||||||||| ||| ||| || | 
Sbjct: 5   gatggaggatccgactatcttggcaaaggtgtactcaaggctgtgagcaatgtaaacact 64

                                                                       
Query: 329 atcatcggaccggcgctcatcgganaggatccgacggagcaggccgacatcgacaacttc 388
           || || || || || ||||||||| ||||||| || ||||| |  ||||| || ||||||
Sbjct: 65  attattgggccagcactcatcggaaaggatcccactgagcaagttgacattgataacttc 124

                                                                       
Query: 389 acggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcagaagctcggg 448
           | ||| ||| | || || || ||||||||| | |||||||||||||| || ||||| || 
Sbjct: 125 atggttcaacagcttgatggaacctccaacaactggggctggtgcaaacaaaagcttgga 184

                                                                       
Query: 449 gcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggccggtgccatggtcaacaag 508
           ||||| || || || || || || ||||| |||||||| || || |||||||| || |||
Sbjct: 185 gcaaatgctattcttgctgtttcacttgctgtgtgcaaagcaggagccatggtgaagaag 244

                                           
Query: 509 atccctctttaccagcacatcgcanaccttgc 540
           || || |||||||||||||| ||| | |||||
Sbjct: 245 attcccctttaccagcacattgcaaatcttgc 276



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                           
Query: 118     gacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcga 177
               |||||||||||| ||||||||| |||||||||||||||||||||| |||||||| || ||
Sbjct: 1935280 gacgatccagtccgtgaaggcgaggcagatcttcgacagccgcgggaaccccacggtgga 1935221

                  
Query: 178     ggt 180
               |||
Sbjct: 1935220 ggt 1935218



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                    
Query: 191     ctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccgg 243
               |||||||| || |||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 1935053 ctcagcgatggcagcttcgcgaggggcgccgtgccgagcggtgcttccaccgg 1935001



to top

>dbj|AP003526.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0548D03
          Length = 156709

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                         
Query: 118   gacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcga 177
             |||||||||||| ||||||||| |||||||||||||||||||||| |||||||| || ||
Sbjct: 64060 gacgatccagtccgtgaaggcgaggcagatcttcgacagccgcgggaaccccacggtgga 64001

                
Query: 178   ggt 180
             |||
Sbjct: 64000 ggt 63998



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                  
Query: 191   ctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccgg 243
             |||||||| || |||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 63833 ctcagcgatggcagcttcgcgaggggcgccgtgccgagcggtgcttccaccgg 63781



to top

>dbj|AP004234.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0001H02
          Length = 147160

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                          
Query: 118    gacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcga 177
              |||||||||||| ||||||||| |||||||||||||||||||||| |||||||| || ||
Sbjct: 135758 gacgatccagtccgtgaaggcgaggcagatcttcgacagccgcgggaaccccacggtgga 135699

                 
Query: 178    ggt 180
              |||
Sbjct: 135698 ggt 135696



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                   
Query: 191    ctcagcgacgggagcttcgccaggggcgccgtgcccagcggcgcctccaccgg 243
              |||||||| || |||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 135531 ctcagcgatggcagcttcgcgaggggcgccgtgccgagcggtgcttccaccgg 135479



to top

>gb|BT016642.1| Zea mays clone Contig475 mRNA sequence
          Length = 1701

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           |||||||||| || ||||||||||| |||||||| ||||||||||||||||| || ||||
Sbjct: 54  cgacgatccaatccgtgaaggcgcgccagatctttgacagccgcggcaaccctacagtcg 113

               
Query: 177 aggt 180
           ||||
Sbjct: 114 aggt 117



to top

>gb|AY344113.2| Cynodon dactylon pollen 2-phosphoglycerate dehydrogenase 2
           precursor, mRNA, complete cds
          Length = 1575

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           |||||||||| || ||||||||||| |||||||| ||||||||||||||||| || ||||
Sbjct: 54  cgacgatccaatccgtgaaggcgcgccagatctttgacagccgcggcaaccctacagtcg 113

               
Query: 177 aggt 180
           ||||
Sbjct: 114 aggt 117



to top

>gb|AF348914.1|AF348914 Chara corallina enolase (eno) gene, partial cds
          Length = 1066

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 416 aacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgctt 475
           ||||||||||| ||||||||||||| ||| ||||| || |||||||| ||||||| ||| 
Sbjct: 161 aacgagtggggatggtgcaagcagaggctaggggcgaatgcgatcctggcggtgttgctg 220

                                                                   
Query: 476 gcagtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgc 531
           ||||| || |||||||| |||   |  || ||||||||||| || |||||||||||
Sbjct: 221 gcagtctgtaaggccggcgccggcgcgaagaagatccctctctatcagcacatcgc 276



to top

>dbj|AK104877.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-E09, full
           insert sequence
          Length = 1596

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 131 gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatat 186
           |||||||| || ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 106 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggttgatat 161



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 416 aacgagtggggctggtgcaagcagaagct 444
           ||||||||||||||||||||||| |||||
Sbjct: 390 aacgagtggggctggtgcaagcaaaagct 418



to top

>dbj|AK099342.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025E02, full
           insert sequence
          Length = 1624

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 131 gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatat 186
           |||||||| || ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 109 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggttgatat 164



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 416 aacgagtggggctggtgcaagcagaagct 444
           ||||||||||||||||||||||| |||||
Sbjct: 394 aacgagtggggctggtgcaagcaaaagct 422



to top

>dbj|AK073611.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048H19, full
           insert sequence
          Length = 1689

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 131 gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatat 186
           |||||||| || ||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 185 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggttgatat 240



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 416 aacgagtggggctggtgcaagcagaagct 444
           ||||||||||||||||||||||| |||||
Sbjct: 470 aacgagtggggctggtgcaagcaaaagct 498



to top

>gb|AY103866.1| Zea mays PCO068679 mRNA sequence
          Length = 1802

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           |||||||||| || ||||||||||| |||||||| ||||||||||||||||| || ||||
Sbjct: 166 cgacgatccaatccgtgaaggcgcgccagatctttgacagccgcggcaaccctacagtcg 225

               
Query: 177 aggt 180
           ||||
Sbjct: 226 aggt 229



to top

>gb|U17973.1|ZMU17973 Zea mays enolase (eno2) mRNA, complete cds
          Length = 1575

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           |||||||||| || ||||||||||| |||||||| ||||||||||||||||| || ||||
Sbjct: 54  cgacgatccaatccgtgaaggcgcgccagatctttgacagccgcggcaaccctacagtcg 113

               
Query: 177 aggt 180
           ||||
Sbjct: 114 aggt 117



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                 
Query: 131     gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
               |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 7823466 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggt 7823417



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 416     aacgagtggggctggtgcaagca 438
               |||||||||||||||||||||||
Sbjct: 7821707 aacgagtggggctggtgcaagca 7821685



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                 
Query: 131     gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
               |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 7821301 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggt 7821252



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 416     aacgagtggggctggtgcaagca 438
               |||||||||||||||||||||||
Sbjct: 7819542 aacgagtggggctggtgcaagca 7819520



to top

>gb|AC134235.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
            OSJNBa0030J04, complete sequence
          Length = 153431

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 131  gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
            |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 9064 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggt 9015



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 416  aacgagtggggctggtgcaagca 438
            |||||||||||||||||||||||
Sbjct: 7305 aacgagtggggctggtgcaagca 7283



to top

>gb|AC118672.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0078P24, from chromosome 3, complete sequence
          Length = 146930

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                               
Query: 131   gtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
             |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 30666 gtgaaggcccgccagatcttcgacagccgtggcaaccccaccgtcgaggt 30715



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 416   aacgagtggggctggtgcaagca 438
             |||||||||||||||||||||||
Sbjct: 32425 aacgagtggggctggtgcaagca 32447



to top

>ref|NM_195031.1| Oryza sativa (japonica cultivar-group) putative enolase
           (2-phospho-D-glycerate hydroylase) (OSJNAb0015J03.9),
           mRNA
          Length = 1287

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 8   cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 67

               
Query: 177 aggt 180
           ||||
Sbjct: 68  aggt 71



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||||||||| || || || || ||||| || ||||| || || 
Sbjct: 310 gagtgggggtggtgcaagcagaagcttggtgctaatgcaatcctggctgtgtcactggcc 369

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
            | ||||| || || || ||  |||| ||||| ||||| ||||||||||| ||  |||||
Sbjct: 370 atttgcaaagctggagctatcatcaagaagattcctctgtaccagcacattgccaacctt 429

             
Query: 539 gc 540
           ||
Sbjct: 430 gc 431



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Minus

                                                       
Query: 144     agatcttcgacagccgcggcaaccccaccgtcgaggtgga 183
               ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1134508 agatcctcgacagccgcggcaaccccaccgtcgaggtgga 1134469



to top

>ref|XM_864856.1| PREDICTED: Bos taurus similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 2 (LOC526006), mRNA
          Length = 2200

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 218 gccgtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||||||||| || ||||||||||| ||||||| |||||||||||| ||||||||
Sbjct: 221 gccgtgcccagtggagcctccaccggtatctacgaggccctggagctaagggatgg 276



to top

>ref|XM_604365.2| PREDICTED: Bos taurus similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 1 (LOC526006), mRNA
          Length = 2431

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 218 gccgtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||||||||| || ||||||||||| ||||||| |||||||||||| ||||||||
Sbjct: 145 gccgtgcccagtggagcctccaccggtatctacgaggccctggagctaagggatgg 200



to top

>gb|AY335488.1| Oryza sativa (japonica cultivar-group) enolase (Eno1) mRNA,
           complete cds
          Length = 1659

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 71  cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 130

               
Query: 177 aggt 180
           ||||
Sbjct: 131 aggt 134



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||||||||| || || || || ||||| || ||||| || || 
Sbjct: 373 gagtgggggtggtgcaagcagaagcttggtgctaatgcaatcctggctgtgtcactggcc 432

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
            | ||||| || || || ||  |||| ||||| ||||| ||||||||||| ||  |||||
Sbjct: 433 atttgcaaagctggagctatcatcaagaagattcctctgtaccagcacattgccaacctt 492

             
Query: 539 gc 540
           ||
Sbjct: 493 gc 494



to top

>gb|AC131375.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0015J03, complete sequence
          Length = 165933

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                         
Query: 117   cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
             ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 62430 cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 62371

                 
Query: 177   aggt 180
             ||||
Sbjct: 62370 aggt 62367



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 419   gagtggggctggtgcaagcagaag 442
             |||||||| |||||||||||||||
Sbjct: 60720 gagtgggggtggtgcaagcagaag 60697



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                           
Query: 117     cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
               ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 4294889 cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 4294830

                   
Query: 177     aggt 180
               ||||
Sbjct: 4294829 aggt 4294826



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 419     gagtggggctggtgcaagcagaag 442
               |||||||| |||||||||||||||
Sbjct: 4293179 gagtgggggtggtgcaagcagaag 4293156



to top

>dbj|AK099292.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133I04, full
           insert sequence
          Length = 1603

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 54  cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 113

               
Query: 177 aggt 180
           ||||
Sbjct: 114 aggt 117



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||||||||| || || || || ||||| || ||||| || || 
Sbjct: 356 gagtgggggtggtgcaagcagaagcttggtgctaatgcaatcctggctgtgtcactggcc 415

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
            | ||||| || || || ||  |||| ||||| ||||| ||||||||||| ||  |||||
Sbjct: 416 atttgcaaagctggagctatcatcaagaagattcctctgtaccagcacattgccaacctt 475

             
Query: 539 gc 540
           ||
Sbjct: 476 gc 477



to top

>dbj|AK073662.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048K07, full
           insert sequence
          Length = 1651

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 102 cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 161

               
Query: 177 aggt 180
           ||||
Sbjct: 162 aggt 165



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||||||||| || || || || ||||| || ||||| || || 
Sbjct: 404 gagtgggggtggtgcaagcagaagcttggtgctaatgcaatcctggctgtgtcactggcc 463

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
            | ||||| || || || ||  |||| ||||| ||||| ||||||||||| ||  |||||
Sbjct: 464 atttgcaaagctggagctatcatcaagaagattcctctgtaccagcacattgccaacctt 523

             
Query: 539 gc 540
           ||
Sbjct: 524 gc 525



to top

>gb|U09450.1|OSU09450 Oryza sativa enolase mRNA, complete cds
          Length = 1687

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 117 cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
           ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 88  cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 147

               
Query: 177 aggt 180
           ||||
Sbjct: 148 aggt 151



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 97/122 (79%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||||||||| || || || || ||||| || ||||| || || 
Sbjct: 390 gagtgggggtggtgcaagcagaagcttggtgctaatgcaatcctggctgtgtcactggcc 449

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
            | ||||| || || || ||  |||| ||||| ||||| ||||||||||| ||  |||||
Sbjct: 450 atttgcaaagctggagctatcatcaagaagattcctctgtaccagcacattgccaacctt 509

             
Query: 539 gc 540
           ||
Sbjct: 510 gc 511



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                           
Query: 117     cgacgatccagtcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcg 176
               ||||||||  ||| || |||||||| ||||||||||||||| | ||||||||||||||||
Sbjct: 4295710 cgacgatcgtgtccgtcaaggcgcgccagatcttcgacagcaggggcaaccccaccgtcg 4295651

                   
Query: 177     aggt 180
               ||||
Sbjct: 4295650 aggt 4295647



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 419     gagtggggctggtgcaagcagaag 442
               |||||||| |||||||||||||||
Sbjct: 4294000 gagtgggggtggtgcaagcagaag 4293977



to top

>emb|X92377.1|AGPGH1 A.glutinosa mRNA for enolase
          Length = 1655

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                       
Query: 419 gagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttgca 478
           |||||||| ||||||||||| |||||||| ||||| || || || || ||||| ||||||
Sbjct: 448 gagtggggttggtgcaagcaaaagctcggagcaaatgccatactggcagtgtctcttgca 507

                                                                       
Query: 479 gtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgcanacctt 538
           || |||||||| || || |  || || || |||||||||||| |||| || ||| |||||
Sbjct: 508 gtctgcaaggctggggctagtgttaaaaaaatccctctttacaagcatattgcaaacctt 567

             
Query: 539 gc 540
           ||
Sbjct: 568 gc 569



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgagg 179
           ||||| || ||||||||||||||||| ||||| || || |||||||
Sbjct: 160 aaggcacgccagatcttcgacagccgtggcaatccgacggtcgagg 205



to top

>emb|CR726296.2|CNS0GNCU Tetraodon nigroviridis full-length cDNA
          Length = 1641

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 212 cccagcggcgcctccaccggcatctacgaggccctggagct 252



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 148 ccgcggcaaccccaccgtggaggt 171



to top

>emb|CR698859.2|CNS0G26V Tetraodon nigroviridis full-length cDNA
          Length = 1594

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 165 cccagcggcgcctccaccggcatctacgaggccctggagct 205



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 101 ccgcggcaaccccaccgtggaggt 124



to top

>emb|CR685932.2|CNS0FS7S Tetraodon nigroviridis full-length cDNA
          Length = 1513

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 88  cccagcggcgcctccaccggcatctacgaggccctggagct 128



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 24  ccgcggcaaccccaccgtggaggt 47



to top

>emb|CR685174.1|CNS0FRMQ Tetraodon nigroviridis full-length cDNA
          Length = 1626

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 209 cccagcggcgcctccaccggcatctacgaggccctggagct 249



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 145 ccgcggcaaccccaccgtggaggt 168



to top

>emb|CR679338.2|CNS0FN4M Tetraodon nigroviridis full-length cDNA
          Length = 1605

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 176 cccagcggcgcctccaccggcatctacgaggccctggagct 216



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 112 ccgcggcaaccccaccgtggaggt 135



to top

>emb|CR672414.2|CNS0FHT0 Tetraodon nigroviridis full-length cDNA
          Length = 1638

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 206 cccagcggcgcctccaccggcatctacgaggccctggagct 246



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 142 ccgcggcaaccccaccgtggaggt 165



to top

>emb|CR656482.2|CNS0F5IG Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 164 cccagcggcgcctccaccggcatctacgaggccctggagct 204



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 100 ccgcggcaaccccaccgtggaggt 123



to top

>emb|CR650019.2|CNS0F0IX Tetraodon nigroviridis full-length cDNA
          Length = 1611

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||||||||||||||| ||||||| ||||||||||||
Sbjct: 180 cccagcggcgcctccaccggcatctacgaggccctggagct 220



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 116 ccgcggcaaccccaccgtggaggt 139



to top

>gb|AF516689.1| Musa acuminata clone F175 enolase mRNA, partial cds
          Length = 520

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 410 acctccaacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtg 469
           ||||| ||||||||||| |||||||| || ||||| |||||||| || || || || || 
Sbjct: 363 acctcaaacgagtggggttggtgcaaacaaaagctaggggcaaatgctatactggctgtt 422

                                                                   
Query: 470 tcgcttgcagtgtgcaaggccggtgccatggtcaacaagatccctctttaccagca 525
           || ||||| |||||||| || || ||||  || || ||||| ||||||||||||||
Sbjct: 423 tctcttgctgtgtgcaaagctggagccagtgtgaagaagatacctctttaccagca 478



to top

>gb|DQ334724.2| Brassica rapa subsp. chinensis los (los) mRNA, complete cds
          Length = 1666

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||| ||||||||||||||||| |||||
Sbjct: 107 ggcagatcttcgacagtcgcggcaaccccaccgttgaggt 146



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| || || |||   ||||||||||| ||||||||||| 
Sbjct: 346 gacaacttcatggtccatgaacttgatggaacccagaacgagtggggttggtgcaagcaa 405

                                                             
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggc 489
           ||||| || || || || || || || ||||| ||||| || ||||||||
Sbjct: 406 aagcttggagctaatgctattcttgctgtgtctcttgccgtctgcaaggc 455



to top

>gb|AF348915.1|AF348915 Nitella opaca enolase (eno) gene, partial cds
          Length = 1066

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 416 aacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgctt 475
           ||||||||||| ||||||||||||| ||| || || ||||| ||||||||||| ||  | 
Sbjct: 161 aacgagtggggatggtgcaagcagaggctaggtgccaacgccatcctcgcggtttccttg 220

                                                                   
Query: 476 gcagtgtgcaaggccggtgccatggtcaacaagatccctctttaccagcacatcgc 531
           || ||||||||||| || ||    | ||| ||||| |||||||| |||||||||||
Sbjct: 221 gcggtgtgcaaggctggcgctggcgccaaaaagattcctctttatcagcacatcgc 276



to top

>ref|NM_129209.2| Arabidopsis thaliana LOS2; phosphopyruvate hydratase AT2G36530
           (LOS2) mRNA, complete cds
          Length = 1740

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 348 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 407

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 408 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 454



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 111 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 155



to top

>gb|AY559080.1| Capsella bursa-pastoris LOS2 (los2) mRNA, complete cds
          Length = 1694

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           ||||||||||||||||||| || ||||||||||| ||||| ||||||
Sbjct: 115 ggcagatcttcgacagccgtggtaaccccaccgttgaggttgatatc 161



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| || || |||   || |||||||| ||||||||||| 
Sbjct: 354 gacaacttcatggtccatgaacttgatggaacccagaatgagtggggttggtgcaagcaa 413

                                                                
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggccgg 492
           ||||| || || || || || || || ||||| |||||||| ||||| |||||
Sbjct: 414 aagcttggagccaatgctattcttgctgtgtctcttgcagtctgcaaagccgg 466



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 236 tccaccggaatctacggggccctggagctgagggatggagg 276
           ||||| |||||||||| ||| || |||||||||||||||||
Sbjct: 210 tccactggaatctacgaggctcttgagctgagggatggagg 250



to top

>gb|AY150418.1| Arabidopsis thaliana enolase (2-phospho-D-glycerate hydroylase)
           (At2g36530) mRNA, complete cds
          Length = 1366

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 268 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 327

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 328 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 374



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 31  cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 75



to top

>gb|AY072095.1| Arabidopsis thaliana putative enolase (2-phospho-D-glycerate
           hydroylase) (At2g36530) mRNA, complete cds
          Length = 1670

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 344 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 403

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 404 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 450



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 107 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 151



to top

>emb|BX294155.1| Pirellula sp. strain 1 complete genome; segment 23/24
          Length = 306550

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                   
Query: 140  cggcagatcttcgacagccgcggcaaccccaccgtcgag 178
            ||||| ||||| |||||||||||||||||||||||||||
Sbjct: 3493 cggcaaatcttggacagccgcggcaaccccaccgtcgag 3531



to top

>gb|AY092986.1| Arabidopsis thaliana enolase (2-phospho-D-glycerate hydroylase)
           (At2g36530) mRNA, complete cds
          Length = 1653

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 345 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 404

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 405 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 451



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 108 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 152



to top

>gb|AF428279.1|AF428279 Arabidopsis thaliana At2g36530/F1O11.16 mRNA, complete cds
          Length = 1632

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 345 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 404

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 405 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 451



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 108 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 152



to top

>gb|AF424603.1|AF424603 Arabidopsis thaliana At2g36530/F1O11.16 mRNA, complete cds
          Length = 1604

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 341 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 400

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 401 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 447



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 104 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 148



to top

>gb|AY054253.1| Arabidopsis thaliana At2g36530/F1O11.16 mRNA, complete cds
          Length = 1643

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| ||||| |||   ||||||||||| ||||||||||| 
Sbjct: 338 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagcaa 397

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || ||||| || || ||||| ||||| || |||||
Sbjct: 398 aagcttggagccaatgcgattcttgctgtgtctcttgctgtctgcaa 444



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggtggatatc 187
           |||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 101 cagatcttcgacagtcgtggtaatcccaccgttgaggttgatatc 145



to top

>gb|AF123457.1|AF123457 Toxoplasma gondii enolase (ENO2) mRNA, complete cds
          Length = 1634

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 416 aacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcct 462
           |||||||||||||||||||||  ||||||||| || |||||||||||
Sbjct: 330 aacgagtggggctggtgcaagtcgaagctcggcgcgaacgcgatcct 376



to top

>gb|AY155668.1| Toxoplasma gondii strain PLK enolase 2 (ENO2) and enolase 1 (ENO1)
            genes, complete cds
          Length = 9346

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                           
Query: 416  aacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcct 462
            |||||||||||||||||||||  ||||||||| || |||||||||||
Sbjct: 2884 aacgagtggggctggtgcaagtcgaagctcggcgcgaacgcgatcct 2930



to top

>gb|U85836.1|CSU85836 Calliobothrium sp. enolase mRNA, partial cds
          Length = 560

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 146 atcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| |||||||||||||||||||||||||||||
Sbjct: 78  atctttgacagccgcggcaaccccaccgtcgaggt 112



to top

>ref|XM_862228.1| PREDICTED: Canis familiaris similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 5 (LOC477709), mRNA
          Length = 1281

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           |||||||| || |||||||| || ||||| | |||||||||||||||||||||
Sbjct: 145 gtgcccagtggagcctccactggtatctatgaggccctggagctgagggatgg 197



to top

>ref|XM_862219.1| PREDICTED: Canis familiaris similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 4 (LOC477709), mRNA
          Length = 2384

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           |||||||| || |||||||| || ||||| | |||||||||||||||||||||
Sbjct: 297 gtgcccagtggagcctccactggtatctatgaggccctggagctgagggatgg 349



to top

>ref|XM_862210.1| PREDICTED: Canis familiaris similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 3 (LOC477709), mRNA
          Length = 1430

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           |||||||| || |||||||| || ||||| | |||||||||||||||||||||
Sbjct: 297 gtgcccagtggagcctccactggtatctatgaggccctggagctgagggatgg 349



to top

>ref|XM_534902.2| PREDICTED: Canis familiaris similar to Gamma enolase
           (2-phospho-D-glycerate hydro-lyase) (Neural enolase)
           (Neuron-specific enolase) (NSE) (Enolase 2), transcript
           variant 2 (LOC477709), mRNA
          Length = 2357

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           |||||||| || |||||||| || ||||| | |||||||||||||||||||||
Sbjct: 297 gtgcccagtggagcctccactggtatctatgaggccctggagctgagggatgg 349



to top

>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12
          Length = 329100

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                   
Query: 144    agatcttcgacagccgcggcaaccccaccgtcgaggt 180
              ||||| ||||||||||||||||||| |||||||||||
Sbjct: 101128 agatcctcgacagccgcggcaacccgaccgtcgaggt 101164



to top

>gb|AY005153.1| Amia calva beta enolase-1 mRNA, partial cds
          Length = 1092

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 218 gccgtgcccagcggcgcctccaccggaatctacggggccctggagctgaggga 270
           |||||||||||||| || ||||| || ||||||| ||| ||||||||||||||
Sbjct: 27  gccgtgcccagcggagcatccactgggatctacgaggcgctggagctgaggga 79



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 439 gaagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggccggtgc 495
           |||| |||| || ||||||||||| |  ||||| || || |||||||||||||||||
Sbjct: 239 gaagttcggtgccaacgcgatcctgggcgtgtctctggctgtgtgcaaggccggtgc 295



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 150    tcgacagccgcggcaaccccaccgtcga 177
              ||||||||||||||||||||||||||||
Sbjct: 538094 tcgacagccgcggcaaccccaccgtcga 538121



to top

>emb|AL939132.1|SCO939132 Streptomyces coelicolor A3(2) complete genome; segment 29/29
          Length = 302007

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                  
Query: 145    gatcttcgacagccgcggcaaccccaccgtcgaggt 180
              |||| |||||||||||||||||||||| ||||||||
Sbjct: 102602 gatcatcgacagccgcggcaaccccacggtcgaggt 102567



to top

>gb|AY650330.1| Macaca fascicularis enolase 2 mRNA, partial cds
          Length = 1260

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| ||||| ||||| | ||||||||||||||| |||||||
Sbjct: 82  gtgcccagtggagcctctaccggcatctatgaggccctggagctgagagatggag 136



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 150     tcgacagccgcggcaaccccaccgtcgaggtggat 184
               ||||||||||||||||||| |||||||| ||||||
Sbjct: 1110922 tcgacagccgcggcaacccgaccgtcgaagtggat 1110888



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 150     tcgacagccgcggcaaccccaccgtcgaggt 180
               ||||||||||||||||||| |||||||||||
Sbjct: 2001074 tcgacagccgcggcaacccgaccgtcgaggt 2001044



to top

>gb|AY181039.1| Methylobacterium extorquens enolase (eno) gene, complete cds
          Length = 1290

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 150 tcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||||| ||||||||||||||||||||
Sbjct: 38  tcgacagccgtggcaaccccaccgtcgaggt 68



to top

>gb|AY307449.1| Brassica napus enolase mRNA, complete cds
          Length = 1624

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| || || |||   ||||||||||| ||||||||||| 
Sbjct: 287 gacaacttcatggtccatgaacttgatggaacccagaacgagtggggttggtgcaagcaa 346

                                                          
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaa 486
           ||||| || || || || ||||| || ||||| ||||| || |||||
Sbjct: 347 aagcttggagccaatgccatccttgctgtgtcccttgctgtttgcaa 393



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||| || ||||| ||||| || |||||
Sbjct: 48  ggcagatcttcgacagtcgtggcaatcccacggttgaggt 87



to top

>ref|NM_001975.2| Homo sapiens enolase 2 (gamma, neuronal) (ENO2), mRNA
          Length = 2423

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 325 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 379



to top

>ref|XM_851111.1| PREDICTED: Canis familiaris similar to Beta enolase
           (2-phospho-D-glycerate hydro-lyase) (Muscle-specific
           enolase) (MSE) (Skeletal muscle enolase) (Enolase 3),
           transcript variant 2 (LOC479469), mRNA
          Length = 1398

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           ||||||||||| |||||||| || |||||||  |||||||| ||||| |||||||
Sbjct: 103 gtgcccagcggagcctccactggtatctacgaagccctggaactgagagatggag 157



to top

>ref|XM_536606.2| PREDICTED: Canis familiaris similar to Beta enolase
           (2-phospho-D-glycerate hydro-lyase) (Muscle-specific
           enolase) (MSE) (Skeletal muscle enolase) (Enolase 3),
           transcript variant 1 (LOC479469), mRNA
          Length = 1389

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           ||||||||||| |||||||| || |||||||  |||||||| ||||| |||||||
Sbjct: 103 gtgcccagcggagcctccactggtatctacgaagccctggaactgagagatggag 157



to top

>gb|AY297757.1| Gossypium barbadense enolase mRNA, complete cds
          Length = 1580

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 227 agcggcgcctccaccggaatctacggggccctggagctgagggatggaggctccgattac 286
           ||||| || ||||| ||||| |||| ||| || ||| |||| |||||||| |||||||||
Sbjct: 137 agcggtgcatccactggaatttacgaggctcttgagttgagagatggaggttccgattac 196

                      
Query: 287 ctcggcaaagg 297
           ||||| |||||
Sbjct: 197 ctcggtaaagg 207



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||||||||||||||||| || || ||||| || |||||
Sbjct: 51  ggcagatcttcgacagccgtggaaatcccactgttgaggt 90



to top

>gb|BT009876.1| Synthetic construct Homo sapiens enolase 2, (gamma, neuronal) mRNA,
           partial cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>emb|X58107.1|ATENGE A.thaliana enolase gene
          Length = 4553

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 380  gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagca 438
            |||||||||| |||||| ||||| ||||| |||   ||||||||||| |||||||||||
Sbjct: 1884 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagca 1942



to top

>emb|X51956.1|HSENO2 Human ENO2 gene for neuron specific (gamma) enolase
          Length = 10905

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 221  gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
            |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 3061 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 3115



to top

>emb|X14327.1|HSNSEMRNA Human mRNA for neurone specific gamma enolase (NSE), EC
           number=4.2.1.11
          Length = 1299

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 100 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 154



to top

>emb|X13120.1|HSEN1 Human mRNA fragment for neurone-specific enolase
          Length = 1299

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 100 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 154



to top

>emb|CR942276.1| Human DNA sequence from clone XX-NCIH2171_5AM21, complete sequence
          Length = 110743

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 221    gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
              |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 101706 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 101760



to top

>emb|AJ271719.1|SOL271719 Spinacia oleracea mRNA for enolase (eno gene)
          Length = 1754

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgagg 179
           ||||||||||||||||||| || ||||| ||||||||||
Sbjct: 131 ggcagatcttcgacagccgtggtaaccctaccgtcgagg 169



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| ||| ||||||||||| || ||| | || || ||||| ||||||||||| 
Sbjct: 370 gacaacttcatggttcaagaactcgatggaaccacaaatgaatggggttggtgcaagcaa 429

                                                             
Query: 440 aagctcggggcaaacgcgatcctcgcggtgtcgcttgcagtgtgcaaggc 489
           ||| | || ||||| || ||| | || ||||| ||||| || ||||||||
Sbjct: 430 aagttgggagcaaatgccatcttggctgtgtctcttgctgtctgcaaggc 479



to top

>gb|BT007383.1| Homo sapiens enolase 2, (gamma, neuronal) mRNA, complete cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>emb|CR859195.1| Pongo pygmaeus mRNA; cDNA DKFZp459B1817 (from clone DKFZp459B1817)
          Length = 2289

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 170 gtgcccagtggagcctctacgggtatctatgaggccctggagctgagggatggag 224



to top

>dbj|AK124656.1| Homo sapiens cDNA FLJ42665 fis, clone BRAMY2019989, highly  similar
           to Gamma enolase (EC 4.2.1.11)
          Length = 2827

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 729 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 783



to top

>gb|AC006919.6| Arabidopsis thaliana chromosome 2 clone F1O11 map g6825, complete
             sequence
          Length = 104364

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 380   gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagca 438
             |||||||||| |||||| ||||| ||||| |||   ||||||||||| |||||||||||
Sbjct: 72011 gacaacttcatggtccatgaacttgacggaacccaaaacgagtgggggtggtgcaagca 71953



to top

>emb|CR536582.1| Homo sapiens full open reading frame cDNA clone RZPDo834F1122D for
           gene ENO2, enolase 2, (gamma, neuronal); complete cds,
           incl. stopcodon
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 150     tcgacagccgcggcaaccccaccgtcgaggt 180
               ||||||||||||||||||| |||||||||||
Sbjct: 3166867 tcgacagccgcggcaacccgaccgtcgaggt 3166837



to top

>gb|AC006512.13| Homo sapiens 12 PAC RP3-461F17 (Roswell Park Cancer Institute Human
           PAC Library) complete sequence
          Length = 155975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 860 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 914



to top

>gb|AE009526.1| Brucella melitensis 16M chromosome I, section 83 of 195 of the
            complete sequence
          Length = 13776

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 150  tcgacagccgcggcaaccccaccgtcgaggtggat 184
            ||||||||||||||||||| |||||||| ||||||
Sbjct: 5456 tcgacagccgcggcaacccgaccgtcgaagtggat 5490



to top

>gb|U47924.1|HSU47924 Human chromosome 12p13 sequence, complete sequence
          Length = 222930

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 221    gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
              |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 128444 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 128498



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 150     tcgacagccgcggcaaccccaccgtcgaggtggat 184
               ||||||||||||||||||| |||||||| ||||||
Sbjct: 1128285 tcgacagccgcggcaacccgaccgtcgaagtggat 1128251



to top

>gb|AY892117.1| Synthetic construct Homo sapiens clone FLH026756.01L enolase 2
           (ENO2) mRNA, partial cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|AY892116.1| Synthetic construct Homo sapiens clone FLH026755.01L enolase 2
           (ENO2) mRNA, partial cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|AY889659.1| Synthetic construct Homo sapiens clone FLH026760.01X enolase 2
           (ENO2) mRNA, complete cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|AY889658.1| Synthetic construct Homo sapiens clone FLH026759.01X enolase 2
           (ENO2) mRNA, complete cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|AY893505.1| Synthetic construct Homo sapiens clone FLH131103.01X enolase 2
           (ENO2) mRNA, complete cds
          Length = 1305

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 103 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 157



to top

>gb|BC002745.2| Homo sapiens enolase 2 (gamma, neuronal), mRNA (cDNA clone MGC:3520
           IMAGE:3629603), complete cds
          Length = 2309

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 179 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 233



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 150     tcgacagccgcggcaaccccaccgtcgaggtggat 184
               ||||||||||||||||||| |||||||| ||||||
Sbjct: 1125437 tcgacagccgcggcaacccgaccgtcgaagtggat 1125403



to top

>gb|M22349.1|HUMENOG Human neuron-specific gamma-2 enolase, complete cds
          Length = 2274

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 177 gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 231



to top

>gb|M36768.1|HUMENOGA Human gamma enolase mRNA, 3' end
          Length = 1733

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagctgagggatggag 275
           |||||||| || ||||| || || ||||| | |||||||||||||||||||||||
Sbjct: 25  gtgcccagtggagcctctacgggcatctatgaggccctggagctgagggatggag 79



to top

>emb|CR728153.1|CNS0GOSF Tetraodon nigroviridis full-length cDNA
          Length = 1637

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 231 gcgcctccaccggaatctacggggccctggagct 264
           ||||||||||||| ||||||| ||||||||||||
Sbjct: 215 gcgcctccaccggcatctacgaggccctggagct 248



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 157 ccgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||| |||||
Sbjct: 143 ccgcggcaaccccaccgtggaggt 166



to top

>gb|AF424654.1| Phytophthora infestans clone MY-07-F-01 enolase mRNA, complete cds
          Length = 1510

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 416 aacgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgctt 475
           |||||||||||||||| |||| ||||||| || || |||||||| || |  |||||||||
Sbjct: 348 aacgagtggggctggtacaagaagaagctgggcgccaacgcgattctgggtgtgtcgctt 407

             
Query: 476 gc 477
           ||
Sbjct: 408 gc 409



to top

>gb|AY615333.1| Heterocapsa triquetra enolase 2 mRNA, partial cds
          Length = 1290

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 144 agatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||||| |||||||| ||||||||||| ||||||||
Sbjct: 26  agatcttggacagccgtggcaaccccacggtcgaggt 62



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                        
Query: 150     tcgacagccgcggcaaccccaccgt 174
               |||||||||||||||||||||||||
Sbjct: 2691800 tcgacagccgcggcaaccccaccgt 2691824



to top

>gb|AF348916.1|AF348916 Nitellopsis obtusa enolase (eno) gene, partial cds
          Length = 1066

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 61/73 (83%)
 Strand = Plus / Plus

                                                                       
Query: 417 acgagtggggctggtgcaagcagaagctcggggcaaacgcgatcctcgcggtgtcgcttg 476
           |||| |||||||||||||| |||||||| || || || ||||| || || || ||||| |
Sbjct: 162 acgaatggggctggtgcaaacagaagcttggtgcgaatgcgattcttgcagtctcgctgg 221

                        
Query: 477 cagtgtgcaaggc 489
           | |||||||||||
Sbjct: 222 ccgtgtgcaaggc 234



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                             
Query: 136      ggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
                |||| |||||||| | ||||||||||| ||||||||||| |||||
Sbjct: 12490874 ggcgaggcagatcgtggacagccgcgggaaccccaccgtggaggt 12490830



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 221      gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
                |||||||||||||| ||||| || ||||||| ||| || |||||
Sbjct: 12490789 gtgcccagcggcgcatccacggggatctacgaggcgctcgagct 12490746



to top

>dbj|AP005867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0599F09
          Length = 157415

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                           
Query: 136    ggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
              |||| |||||||| | ||||||||||| ||||||||||| |||||
Sbjct: 156458 ggcgaggcagatcgtggacagccgcgggaaccccaccgtggaggt 156414



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 221    gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
              |||||||||||||| ||||| || ||||||| ||| || |||||
Sbjct: 156373 gtgcccagcggcgcatccacggggatctacgaggcgctcgagct 156330



to top

>dbj|AP005637.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0711A01
          Length = 162400

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 136  ggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
            |||| |||||||| | ||||||||||| ||||||||||| |||||
Sbjct: 6201 ggcgaggcagatcgtggacagccgcgggaaccccaccgtggaggt 6157



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 221  gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
            |||||||||||||| ||||| || ||||||| ||| || |||||
Sbjct: 6116 gtgcccagcggcgcatccacggggatctacgaggcgctcgagct 6073



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 152     gacagccgcggcaaccccaccgtcgaggt 180
               |||||||||||||| ||||||||||||||
Sbjct: 2498283 gacagccgcggcaatcccaccgtcgaggt 2498255



to top

>gb|U85833.1|HDU85833 Hymenolepis diminuta enolase mRNA, partial cds
          Length = 542

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 146 atcttcgacagccgcggcaaccccaccgt 174
           |||||||||||||| ||||||||||||||
Sbjct: 69  atcttcgacagccgtggcaaccccaccgt 97



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                           
Query: 150     tcgacagccgcggcaaccccaccgtcgaggtggatatcgggctc 193
               |||| |||||||||||||| ||||||||||| ||| ||| ||||
Sbjct: 3138462 tcgatagccgcggcaacccgaccgtcgaggtcgatgtcgtgctc 3138419



to top

>gb|S79816.1| enolase [Echinochloa phyllopogon, shoots, mRNA Partial, 541 nt]
          Length = 541

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 506 aagatccctctttaccagcacatcgcanaccttgc 540
           ||||||||||||||||||||||| ||| | |||||
Sbjct: 280 aagatccctctttaccagcacattgcaaatcttgc 314



to top

>gb|AY307448.1| Brassica rapa enolase mRNA, complete cds
          Length = 1580

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 141 ggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||||||||||||||||| ||||| ||||| || |||||
Sbjct: 48  ggcagatcttcgacagccgtggcaatcccacggttgaggt 87



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 380 gacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaagcag 439
           |||||||||| |||||| ||||| || || |||   ||||| ||||| ||||||||||| 
Sbjct: 287 gacaacttcatggtccatgaacttgatggaacccagaacgaatggggatggtgcaagcaa 346

                
Query: 440 aagct 444
           |||||
Sbjct: 347 aagct 351



to top

>gb|AY725787.1| Oncometopia nigricans enolase mRNA, complete cds
          Length = 1302

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 253 ggccctggagctgagggatggag 275
           |||||||||||||||||||||||
Sbjct: 135 ggccctggagctgagggatggag 157



to top

>emb|AJ508935.1|PFR508935 Propionibacterium freudenreichii subsp. shermanii eno1 gene for
           enolase 1
          Length = 1290

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 158 cgcggcaaccccaccgtcgaggt 180
           |||||||||||||||||||||||
Sbjct: 46  cgcggcaaccccaccgtcgaggt 68



to top

>emb|BX070348.1|CNS09QG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 127 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 173



to top

>emb|BX065472.1|CNS09MOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 94  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 140



to top

>emb|BX061954.1|CNS09JYU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 104 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 150



to top

>emb|BX059219.1|CNS09HUV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 283 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 237



to top

>emb|BX057485.1|CNS09GIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 463

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 83  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 129



to top

>emb|BX054124.1|CNS09DXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 146 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 192



to top

>emb|BX051880.1|CNS09C70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 87  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 133



to top

>emb|BX041556.1|CNS09488 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 300

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 56  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 102



to top

>emb|BX036808.1|CNS090KC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 102 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 148



to top

>emb|BX033476.1|CNS08XZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 246

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 77  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 31



to top

>emb|BX033475.1|CNS08XZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 249

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 118 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 164



to top

>emb|BX031580.1|CNS08WJ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 117 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 163



to top

>emb|BX028564.1|CNS08U7C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 101 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 147



to top

>emb|BX027842.1|CNS08TNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 138 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 184



to top

>emb|BX027683.1|CNS08TIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1070

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 153 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 199



to top

>emb|BX026463.1|CNS08SKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 94  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 140



to top

>emb|BX026179.1|CNS08SD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 98  aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 144



to top

>emb|BX023989.1|CNS08QO9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 101 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 147



to top

>emb|BX470161.8| Zebrafish DNA sequence from clone RP71-84I2, complete sequence
          Length = 197615

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 143   cagatcttcgacagccgcggcaaccccaccgtcga 177
             ||||| ||||||||||| |||||||| ||||||||
Sbjct: 50848 cagattttcgacagccgtggcaacccgaccgtcga 50882



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 150     tcgacagccgcggcaaccccaccgtcgaggt 180
               |||||||||| ||||| ||||||||||||||
Sbjct: 5314017 tcgacagccgtggcaatcccaccgtcgaggt 5313987



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 102     ccatggcgtcgacgacgacg 121
               ||||||||||||||||||||
Sbjct: 5573437 ccatggcgtcgacgacgacg 5573456



to top

>dbj|AB091508.1| Penicillium chrysogenum mRNA for enolase, complete cds
          Length = 1504

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 158 cgcggcaaccccaccgtcgaggtggat 184
           ||||||||||||||||| |||||||||
Sbjct: 81  cgcggcaaccccaccgttgaggtggat 107



to top

>ref|XM_317673.2| Anopheles gambiae str. PEST ENSANGP00000023637
           (ENSANGG00000016042), partial mRNA
          Length = 804

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 124 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 170



to top

>ref|XM_317672.2| Anopheles gambiae str. PEST ENSANGP00000018531
           (ENSANGG00000016042), mRNA
          Length = 1886

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 134 aaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||| || ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 147 aaggcccgtcagatcttcgactcccgtggcaacccgaccgtcgaggt 193



to top

>gb|AY430424.1| Heterocapsa triquetra enolase gene, partial cds
          Length = 1302

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 137 gcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggtgga 183
           ||||| ||| ||||||||||||| |||||||| || || ||||||||
Sbjct: 22  gcgcgccaggtcttcgacagccggggcaacccgactgtggaggtgga 68



to top

>gb|AF120157.1|AF120157 Cellulomonas pachnodae endo-1,4-beta-xylanase (xyn10B) gene, complete
            cds
          Length = 4237

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 158  cgcggcaaccccaccgtcgaggt 180
            |||||||||||||||||||||||
Sbjct: 3953 cgcggcaaccccaccgtcgaggt 3975



to top

>gb|U85828.1|LTU85828 Lacistorhynchus tenuis enolase mRNA, partial cds
          Length = 554

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 146 atcttcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||||||||| ||||||||||| || |||||
Sbjct: 76  atcttcgacagccgtggcaaccccactgttgaggt 110



to top

>dbj|AB005550.1| Desulfovibrio vulgaris gene for ferredoxin II, phosphopyruvate
           hydratase, partial and complete cds
          Length = 3664

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 157 ccgcggcaaccccaccgtcgaggtgga 183
           |||||| ||||||||||||||||||||
Sbjct: 451 ccgcgggaaccccaccgtcgaggtgga 425



to top

>dbj|AB046715.1| Desulfovibrio vulgaris eno gene for enolase, complete cds
          Length = 2167

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 157 ccgcggcaaccccaccgtcgaggtgga 183
           |||||| ||||||||||||||||||||
Sbjct: 420 ccgcgggaaccccaccgtcgaggtgga 446



to top

>gb|AC164157.3| Mus musculus BAC clone RP24-297C1 from chromosome 6, complete sequence
          Length = 176868

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 224    cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
              ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 163648 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 163599



to top

>ref|NM_013509.2| Mus musculus enolase 2, gamma neuronal (Eno2), mRNA
          Length = 2656

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 194 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 243



to top

>gb|BC060310.1| Rattus norvegicus enolase 2, gamma, mRNA (cDNA clone MGC:72663
           IMAGE:6888358), complete cds
          Length = 1636

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || |||||||| || ||||| | |||||||||||| ||||||||
Sbjct: 165 cccagtggggcctccactggcatctatgaggccctggagctaagggatgg 214



to top

>gb|BC031739.1| Mus musculus enolase 2, gamma neuronal, mRNA (cDNA clone MGC:25270
           IMAGE:4527274), complete cds
          Length = 2656

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 194 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 243



to top

>emb|BX042900.1|CNS0959K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 12  cagatcttcgactcccgtggcaacccgaccgtcgaggt 49



to top

>emb|BX044062.1|CNS0965U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           ||||||||||||  ||| |||||||| |||||||||||
Sbjct: 41  cagatcttcgactcccgtggcaacccgaccgtcgaggt 78



to top

>emb|X52380.1|MSGAEN Mouse mRNA for gamma-enolase (2-phospho-D-glycerate hydrolase) (EC
           4.2.1.11)
          Length = 2341

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 219 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 268



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 144     agatcttcgacagccgcggcaaccccaccgtcga 177
               ||||| |||| ||||| |||||||||||||||||
Sbjct: 2014813 agatcctcgatagccgtggcaaccccaccgtcga 2014846



to top

>dbj|AK131652.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1520403G13 product:enolase 2, gamma
           neuronal, full insert sequence
          Length = 2367

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 240 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 289



to top

>dbj|AK134571.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330416H12 product:enolase 2,
           gamma neuronal, full insert sequence
          Length = 2250

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 124 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 173



to top

>dbj|AK146655.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:I920038O04 product:enolase 2, gamma
           neuronal, full insert sequence
          Length = 2641

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 206 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 255



to top

>dbj|AK170169.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630024I08
           product:enolase 2, gamma neuronal, full insert sequence
          Length = 2487

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 121 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 170



to top

>gb|S79242.1| Pgh1b=2-phospho-D-glycerate hydrolase [Mesembryanthemum
           crystallinum=common ice plant, mRNA Partial, 1683 nt]
          Length = 1683

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 377 atcgacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaag 436
           ||||||||||||| ||| ||| |||| || || |||   ||||||||||| |||||||||
Sbjct: 295 atcgacaacttcatggttcaacaacttgatggaaccgtgaacgagtggggttggtgcaag 354

             
Query: 437 ca 438
           ||
Sbjct: 355 ca 356



to top

>gb|BC009018.1| Mus musculus enolase 2, gamma neuronal, mRNA (cDNA clone
           IMAGE:3711960), partial cds
          Length = 1960

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 176 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 225



to top

>dbj|AK003051.1| Mus musculus adult male brain cDNA, RIKEN full-length enriched
           library, clone:0710008M22 product:enolase 2, gamma
           neuronal, full insert sequence
          Length = 2323

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 201 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 250



to top

>dbj|AB195826.1| Karenia brevis eno3b mRNA for enolase 3, partial cds, strain:
           CCMP2229
          Length = 1075

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 419 gagtggggctggtgcaagcagaagct 444
           |||||||||||||||||| |||||||
Sbjct: 167 gagtggggctggtgcaagaagaagct 192



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 233  gcctccaccggaatctacggggccctggagctgaggga 270
            ||||||||||||| | ||| |||||||||||| |||||
Sbjct: 1355 gcctccaccggaacccacgaggccctggagctcaggga 1392



to top

>gb|AY430421.1| Phytophthora palmivora enolase gene, partial cds
          Length = 1203

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 416 aacgagtggggctggtgcaagcagaa 441
           ||||||||||||||||||||| ||||
Sbjct: 256 aacgagtggggctggtgcaagaagaa 281



to top

>emb|X07728.1|RNEN3 R.norvegicus gene encoding neuron-specific enolase, exons 3-7
          Length = 2050

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || |||||||| || ||||| | |||||||||||| ||||||||
Sbjct: 68  cccagtggggcctccactggcatctatgaggccctggagctaagggatgg 117



to top

>gb|AC002397.1|AC002397 Mouse chromosome 6 BAC-284H12 (Research Genetics mouse BAC library)
              complete sequence
          Length = 227538

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 224    cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
              ||||| || ||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 130034 cccagtggagcctccaccggcatctatgaggccctggaactaagggatgg 130083



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                     
Query: 233     gcctccaccggaatctacggggccctggagctgaggga 270
               ||||||||||||| | ||| |||||||||||| |||||
Sbjct: 1525942 gcctccaccggaacccacgaggccctggagctcaggga 1525979



to top

>gb|AF019973.1|AF019973 Rattus norvegicus neuron-specific enolase (NSE) mRNA, complete cds
          Length = 2222

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || |||||||| || ||||| | |||||||||||| ||||||||
Sbjct: 174 cccagtggggcctccactggcatctatgaggccctggagctaagggatgg 223



to top

>gb|DQ241856.1| Solanum tuberosum clone 002G05 enolase-like mRNA, complete cds
          Length = 1624

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 143 cagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||| |||||||| || ||||||||||| |||||
Sbjct: 35  cagatctttgacagccgtggtaaccccaccgttgaggt 72



to top

>ref|NM_139325.1| Rattus norvegicus enolase 2, gamma (Eno2), mRNA
          Length = 2284

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || |||||||| || ||||| | |||||||||||| ||||||||
Sbjct: 239 cccagtggggcctccactggcatctatgaggccctggagctaagggatgg 288



to top

>gb|M11931.1|RATENONS Rat brain neuron-specific enolase mRNA, complete cds
          Length = 2218

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 224 cccagcggcgcctccaccggaatctacggggccctggagctgagggatgg 273
           ||||| || |||||||| || ||||| | |||||||||||| ||||||||
Sbjct: 174 cccagtggggcctccactggcatctatgaggccctggagctaagggatgg 223



to top

>gb|U09194.1|MCU09194 Mesembryanthemum crystallinum 2-phospho-D-glycerate hydrolase,
           enolase, mRNA, complete cds
          Length = 1628

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 377 atcgacaacttcacggtccaagaactcgacgggacctccaacgagtggggctggtgcaag 436
           ||||||||||||| ||| ||| |||| || || |||   ||||||||||| |||||||||
Sbjct: 295 atcgacaacttcatggttcaacaacttgatggaaccgtgaacgagtggggttggtgcaag 354

             
Query: 437 ca 438
           ||
Sbjct: 355 ca 356



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 158     cgcggcaaccccaccgtcgag 178
               |||||||||||||||||||||
Sbjct: 1759514 cgcggcaaccccaccgtcgag 1759494



to top

>gb|AC105898.2| Drosophila melanogaster clone BACR25P15, complete sequence
          Length = 169913

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 217  cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
            ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 2093 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 2045



to top

>gb|BC061441.1| Xenopus tropicalis similar to calsequestrin 2 (cardiac muscle),
           mRNA (cDNA clone MGC:76326 IMAGE:5380471), complete cds
          Length = 1743

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 221 gtgcccagcggcgcctccacc 241
           |||||||||||||||||||||
Sbjct: 201 gtgcccagcggcgcctccacc 221



to top

>gb|AC034265.9| Mus musculus chromosome 1, clone RP23-180K2, complete sequence
          Length = 218310

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 253    ggccctggagctgagggatgg 273
              |||||||||||||||||||||
Sbjct: 162109 ggccctggagctgagggatgg 162129



to top

>gb|BT014924.1| Drosophila melanogaster AT25373 full insert cDNA
          Length = 3840

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                             
Query: 217  cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
            ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 2424 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 2472



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 158     cgcggcaaccccaccgtcgag 178
               |||||||||||||||||||||
Sbjct: 3005001 cgcggcaaccccaccgtcgag 3004981



to top

>gb|DQ089999.1|DQ089999S1 Cocos nucifera enolase (Eno) mRNA, partial cds
          Length = 652

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 128 tcggtgaaggcgcggcagatcttcgacagccgcggcaaccccaccgtcgaggt 180
           |||||||||||| |||||||| | |||||| | || || ||||| ||||||||
Sbjct: 159 tcggtgaaggcgaggcagatcatagacagcagggggaatcccacggtcgaggt 211



to top

>gb|AC084391.1| Mus musculus BAC clone RP23-294I17 from 1, complete sequence
          Length = 166182

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 253    ggccctggagctgagggatgg 273
              |||||||||||||||||||||
Sbjct: 110467 ggccctggagctgagggatgg 110447



to top

>emb|X17034.1|DMENOLAS Drosophila gene for enolase (2-phospho-D-glycerate hydrolase) (EC
           4.2.1.11)
          Length = 1302

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 99  cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 147



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 158     cgcggcaaccccaccgtcgag 178
               |||||||||||||||||||||
Sbjct: 2734972 cgcggcaaccccaccgtcgag 2734952



to top

>gb|AC148219.15| Medicago truncatula clone mth2-21l10, complete sequence
          Length = 118023

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 264   tgagggatggaggctccgattacctcggcaaaggagttctcaagg 308
             |||||||||||||||| || ||||| || ||||| ||||| ||||
Sbjct: 72173 tgagggatggaggctcagactaccttgggaaaggtgttcttaagg 72217



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 419   gagtggggctggtgcaagcagaag 442
             |||||||| |||||||||||||||
Sbjct: 72678 gagtggggatggtgcaagcagaag 72701



to top

>gb|AY118449.1| Drosophila melanogaster SD23356 full insert cDNA
          Length = 2194

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 606 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 654



to top

>ref|NM_164434.1| Drosophila melanogaster Enolase CG17654-RE, transcript variant E
           (Eno), mRNA
          Length = 2403

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 830 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 878



to top

>ref|NM_164433.1| Drosophila melanogaster Enolase CG17654-RD, transcript variant D
           (Eno), mRNA
          Length = 2153

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 580 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 628



to top

>ref|NM_164432.1| Drosophila melanogaster Enolase CG17654-RC, transcript variant C
           (Eno), mRNA
          Length = 2256

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 683 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 731



to top

>ref|NM_164431.1| Drosophila melanogaster Enolase CG17654-RB, transcript variant B
           (Eno), mRNA
          Length = 2179

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 606 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 654



to top

>ref|NM_058073.3| Drosophila melanogaster Enolase CG17654-RA, transcript variant A
           (Eno), mRNA
          Length = 1753

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 217 cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
           ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 180 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 228



to top

>gb|AC104630.1| Drosophila melanogaster, chromosome 2L, region 22B-22C, BAC clone
             BACR19B15, complete sequence
          Length = 180088

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                              
Query: 217   cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
             ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 28856 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 28904



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 150     tcgacagccgcggcaaccccaccgt 174
               ||||||||||||||||||| |||||
Sbjct: 2366947 tcgacagccgcggcaacccgaccgt 2366923



to top

>dbj|AB195827.1| Karenia brevis eno3c mRNA for enolase 3, partial cds, strain:
           CCMP2229
          Length = 1147

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 221 gtgcccagcggcgcctccaccggaatcta 249
           |||||||||||||| ||||| ||||||||
Sbjct: 35  gtgcccagcggcgcttccacaggaatcta 63



to top

>ref|NM_203805.1| Xenopus tropicalis similar to calsequestrin 2 (cardiac muscle)
           (MGC76326), mRNA
          Length = 1743

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 221 gtgcccagcggcgcctccacc 241
           |||||||||||||||||||||
Sbjct: 201 gtgcccagcggcgcctccacc 221



to top

>gb|AE003585.5| Drosophila melanogaster chromosome 2L, section 6 of 83 of the complete
              sequence
          Length = 343161

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 217    cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
              ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 185176 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 185128



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 290     ggcaaaggagttctcaaggctgtgaacaacgta 322
               |||||||| || |||||||||||||| ||||||
Sbjct: 1919343 ggcaaaggtgtcctcaaggctgtgaagaacgta 1919311



to top

>gb|AC004442.1|AC004442 Drosophila melanogaster, chromosome 2L, region 22A3-22A7, P1 clone
             DS04260, complete sequence
          Length = 80376

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 217   cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
             ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 80228 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 80180



to top

>gb|AC003945.1|AC003945 Drosophila melanogaster (P1 DS05247 (D90)) DNA sequence, complete
            sequence
          Length = 53865

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 217  cgccgtgcccagcggcgcctccaccggaatctacggggccctggagctg 265
            ||||||||||  |||||||||||| ||  || ||| |||||||||||||
Sbjct: 1839 cgccgtgccctccggcgcctccactggcgtccacgaggccctggagctg 1791



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 360     cgacggagcaggccgacatcgaca 383
               ||||| ||||||||||||||||||
Sbjct: 1279430 cgacgcagcaggccgacatcgaca 1279453



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 158     cgcggcaaccccaccgtcga 177
               ||||||||||||||||||||
Sbjct: 2480418 cgcggcaaccccaccgtcga 2480399



to top

>gb|BT016837.1| Zea mays clone Contig670 mRNA sequence
          Length = 1778

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 ccatggcgtcgacgacgacg 121
           ||||||||||||||||||||
Sbjct: 359 ccatggcgtcgacgacgacg 340



to top

>gb|BC080039.1| Xenopus laevis similar to calsequestrin 2 (cardiac muscle), mRNA
           (cDNA clone IMAGE:5571738), partial cds
          Length = 1615

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 tgcccagcggcgcctccacc 241
           ||||||||||||||||||||
Sbjct: 212 tgcccagcggcgcctccacc 231



to top

>gb|AY693642.1| Streptomyces netropsis two component response regulator-like gene,
            partial cds; netropsin resistance protein subunit 1
            (netP1) and netropsin resistance protein subunit 2
            (netP2) genes, complete cds; and acyl-CoA synthetase-like
            gene, partial cds
          Length = 5919

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 108  cgtcgacgacgacgatccagtcgg 131
            |||||||||||||||||| |||||
Sbjct: 4679 cgtcgacgacgacgatccggtcgg 4656



to top

>gb|AC008356.6| Drosophila melanogaster clone BACR43K14, complete sequence
          Length = 162593

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   cgcggcagatcttcgacagc 157
             ||||||||||||||||||||
Sbjct: 57909 cgcggcagatcttcgacagc 57928



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 43/51 (84%)
 Strand = Plus / Plus

                                                                  
Query: 283     ttacctcggcaaaggagttctcaaggctgtgaacaacgtanacgccatcat 333
               |||||| ||||| |||||||||||||| ||  |||||||  ||| ||||||
Sbjct: 2503342 ttacctgggcaagggagttctcaaggccgtcgacaacgtgaacgacatcat 2503392



to top

>gb|BT013094.1| Lycopersicon esculentum clone 114360F, mRNA sequence
          Length = 1655

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 236 tccaccggaatctacggggccctggagctgagggatggaggctccgattacctcgg 291
           ||||||||||| ||||  ||||| ||  ||||||||||||| || || ||||||||
Sbjct: 183 tccaccggaatttacgaagcccttgaattgagggatggaggatctgactacctcgg 238



to top

>gb|BC041283.1| Xenopus laevis similar to calsequestrin 2 (cardiac muscle), mRNA
           (cDNA clone IMAGE:4681496), partial cds
          Length = 1663

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 tgcccagcggcgcctccacc 241
           ||||||||||||||||||||
Sbjct: 261 tgcccagcggcgcctccacc 280



to top

>gb|BT011441.1| Drosophila melanogaster RE55714 full insert cDNA
          Length = 2933

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 138  cgcggcagatcttcgacagc 157
            ||||||||||||||||||||
Sbjct: 2258 cgcggcagatcttcgacagc 2277



to top

>gb|AY499570.1| Cryphonectria parasitica enolase (Eno1) gene, complete cds
          Length = 2719

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 ggcaaccccaccgtcgaggt 180
           ||||||||||||||||||||
Sbjct: 729 ggcaaccccaccgtcgaggt 748



to top

>ref|XM_754410.1| Ustilago maydis 521 hypothetical protein (UM03356.1) partial mRNA
          Length = 1338

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 164 aaccccaccgtcgaggtgga 183
           ||||||||||||||||||||
Sbjct: 49  aaccccaccgtcgaggtgga 68



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 147     tcttcgacagccgcggcaac 166
               ||||||||||||||||||||
Sbjct: 4943920 tcttcgacagccgcggcaac 4943901



to top

>emb|X58108.1|LEMRNAEN L.esculentum mRNA for enolase
          Length = 1553

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 236 tccaccggaatctacggggccctggagctgagggatggaggctccgattacctcgg 291
           ||||||||||| ||||  ||||| ||  ||||||||||||| || || ||||||||
Sbjct: 184 tccaccggaatttacgaagcccttgaattgagggatggaggatctgactacctcgg 239



to top

>gb|BC103354.1| Bos taurus enolase 1, mRNA (cDNA clone MGC:127526 IMAGE:7948635),
           complete cds
          Length = 1806

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||| ||||| || || |||||||| | ||||||||||||
Sbjct: 241 gtgcccagtggcgcttcaactggaatctatgaggccctggagct 284



to top

>emb|AL035681.13|HS756G23 Human DNA sequence from clone RP4-756G23 on chromosome 22q13.31-13.33,
             complete sequence
          Length = 89948

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   gccctggagctgagggatggaggc 277
             ||||||||||||||||| ||||||
Sbjct: 10635 gccctggagctgagggagggaggc 10658



to top

>ref|XM_779383.1| PREDICTED: Strongylocentrotus purpuratus similar to enolase 1,
           (alpha) (LOC579256), mRNA
          Length = 1227

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 239 accggaatctacggggccctggagctgaggga 270
           ||||| ||||| | ||||||||||||||||||
Sbjct: 106 accgggatctatgaggccctggagctgaggga 137



to top

>emb|BX572602.1| Rhodopseudomonas palustris CGA009 complete genome; segment 10/16
          Length = 349981

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 150    tcgacagccgcggcaaccccaccgtcga 177
              |||||||||||||||| || ||||||||
Sbjct: 112087 tcgacagccgcggcaatccgaccgtcga 112060



to top

>dbj|AK057177.1| Homo sapiens cDNA FLJ32615 fis, clone STOMA2000148
          Length = 2230

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 254 gccctggagctgagggatggaggc 277
           ||||||||||||||||| ||||||
Sbjct: 149 gccctggagctgagggagggaggc 126



to top

>ref|NM_141611.1| Drosophila melanogaster CG9746-RA (CG9746), mRNA
          Length = 4188

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 138  cgcggcagatcttcgacagc 157
            ||||||||||||||||||||
Sbjct: 2257 cgcggcagatcttcgacagc 2276



to top

>dbj|AB195834.1| Heterocapsa triquetra GapC4-eno3 mRNA for polyprotein, partial cds,
            strain: CCMP449
          Length = 2913

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 221  gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
            ||||||||||| || ||||| || ||||||| ||| ||||||||
Sbjct: 1258 gtgcccagcggtgcatccacaggcatctacgaggcgctggagct 1301



to top

>gb|AF454545.1|AF454545 Xanthomonas campestris pv. vesicatoria gene sequence
          Length = 10505

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 147 tcttcgacagccgcggcaac 166
           ||||||||||||||||||||
Sbjct: 138 tcttcgacagccgcggcaac 157



to top

>gb|AF371279.1|AF371279 Zea mays legumin 1 mRNA, complete cds
          Length = 1670

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 ccatggcgtcgacgacgacg 121
           ||||||||||||||||||||
Sbjct: 328 ccatggcgtcgacgacgacg 309



to top

>ref|NM_174049.2| Bos taurus enolase 1 (ENO1), mRNA
          Length = 1806

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||| ||||| || || |||||||| | ||||||||||||
Sbjct: 241 gtgcccagtggcgcttcaactggaatctatgaggccctggagct 284



to top

>gb|BC097545.1| Xenopus laevis similar to calsequestrin 2 (cardiac muscle), mRNA
           (cDNA clone MGC:114674 IMAGE:5516132), complete cds
          Length = 1595

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 tgcccagcggcgcctccacc 241
           ||||||||||||||||||||
Sbjct: 193 tgcccagcggcgcctccacc 212



to top

>gb|AY051557.1| Drosophila melanogaster GH20665 full length cDNA
          Length = 2613

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 138 cgcggcagatcttcgacagc 157
           ||||||||||||||||||||
Sbjct: 648 cgcggcagatcttcgacagc 667



to top

>gb|AF348478.1|AF348478 Mastigamoeba balamuthi enolase (enol) gene, complete cds
          Length = 1682

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 ggcaaccccaccgtcgaggt 180
           ||||||||||||||||||||
Sbjct: 73  ggcaaccccaccgtcgaggt 92



to top

>dbj|AB195825.1| Karenia brevis eno3a mRNA for enolase 3, partial cds, strain:
           CCMP2229
          Length = 1315

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||| ||||| ||||| || |||||||  |||||||||||
Sbjct: 212 gtgcccagtggcgcatccacgggcatctacgaagccctggagct 255



to top

>gb|AE004783.1| Pseudomonas aeruginosa PAO1, section 344 of 529 of the complete
            genome
          Length = 12207

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 452  aacgcgatcctcgcggtgtc 471
            ||||||||||||||||||||
Sbjct: 6738 aacgcgatcctcgcggtgtc 6719



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 157     ccgcggcaaccccaccgtcgaggt 180
               ||||||||||||||| ||||||||
Sbjct: 1883386 ccgcggcaaccccacggtcgaggt 1883409



to top

>gb|AF205070.1|AF205070 Mastigamoeba balamuthi enolase mRNA, complete cds
          Length = 1515

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 ggcaaccccaccgtcgaggt 180
           ||||||||||||||||||||
Sbjct: 79  ggcaaccccaccgtcgaggt 98



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 157     ccgcggcaaccccaccgtcgaggt 180
               |||||| |||||||||||||||||
Sbjct: 5072060 ccgcggaaaccccaccgtcgaggt 5072037



to top

>gb|AF096253.1|AF096253 Lycopersicon esculentum ethylene-responsive enolase (ER28) mRNA,
           partial cds
          Length = 222

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 236 tccaccggaatctacggggccctggagctgagggatggaggctccgattacctcgg 291
           ||||||||||| ||||  ||||| ||  ||||||||||||| || || ||||||||
Sbjct: 28  tccaccggaatttacgaagcccttgaattgagggatggaggatctgactacctcgg 83



to top

>gb|AF149256.1|AF149256 Bos taurus alpha enolase mRNA, complete cds
          Length = 1305

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 221 gtgcccagcggcgcctccaccggaatctacggggccctggagct 264
           |||||||| ||||| || || |||||||| | ||||||||||||
Sbjct: 103 gtgcccagtggcgcttcaactggaatctatgaggccctggagct 146



to top

>gb|AE003682.4| Drosophila melanogaster chromosome 3R, section 20 of 118 of the
            complete sequence
          Length = 224614

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 138  cgcggcagatcttcgacagc 157
            ||||||||||||||||||||
Sbjct: 5397 cgcggcagatcttcgacagc 5378



to top

>dbj|AB073081.2| Zea mays mRNA for uncleaved legumin-1, complete cds
          Length = 1726

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 102 ccatggcgtcgacgacgacg 121
           ||||||||||||||||||||
Sbjct: 318 ccatggcgtcgacgacgacg 299



to top

>gb|AF082100.1|AF082100 Streptomyces sp. MA6548 FK506 peptide synthetase (fkbP), FK506 oxidase
             (fkbO), and FK506 polyketide synthase (fkbB) genes,
             complete cds
          Length = 28732

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   ggcgtcgacgacgacgatcc 125
             ||||||||||||||||||||
Sbjct: 22603 ggcgtcgacgacgacgatcc 22584



to top

>gb|AC152923.2| Mus musculus BAC clone RP24-267O6 from 5, complete sequence
          Length = 187438

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 498    tggtcaacaagatccctctt 517
              ||||||||||||||||||||
Sbjct: 106102 tggtcaacaagatccctctt 106083



to top

>gb|AC134525.5| Mus musculus BAC clone RP24-496F7 from 8, complete sequence
          Length = 215900

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   cggggccctggagctgaggg 269
             ||||||||||||||||||||
Sbjct: 72008 cggggccctggagctgaggg 72027



to top

>dbj|AK074091.1| Homo sapiens mRNA for FLJ00162 protein
          Length = 5875

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 254 gccctggagctgagggatggaggc 277
           ||||||||||||||||| ||||||
Sbjct: 649 gccctggagctgagggagggaggc 672


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,563,332
Number of Sequences: 3902068
Number of extensions: 2563332
Number of successful extensions: 51214
Number of sequences better than 10.0: 232
Number of HSP's better than 10.0 without gapping: 232
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49286
Number of HSP's gapped (non-prelim): 1924
length of query: 540
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 517
effective length of database: 17,143,297,704
effective search space: 8863084912968
effective search space used: 8863084912968
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top