Clone Name | bart25h01 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_483854.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1538 Score = 188 bits (95), Expect = 1e-44 Identities = 271/329 (82%), Gaps = 3/329 (0%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgcgtcgcaccgctacctgcgggatcagcaagac---gaccag 187 ||||||||| |||| | |||||||| |||||||||||||||||||||| || |||||| Sbjct: 309 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaacaccacgaccag 368 Query: 188 gccatgtcgatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggttttgca 247 ||| || |||||||| || |||||||||| ||||||||||||||||||||||||||| Sbjct: 369 gccgcttcaatgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgca 428 Query: 248 ccacctgccatgcttcctgcaccttcttctgcaaagttaaacgagttgctactgccaaaa 307 ||||| || ||| ||||||| |||||| |||||||| || || || |||| || || Sbjct: 429 ccaccaccctcgctacctgcacaatcttcttcaaagttagacaagctgttactccctaac 488 Query: 308 ccatttgacaggcctcgtgctgttttcttgatgcaaattgatggatcccatgactctgtc 367 ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| ||| || Sbjct: 489 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatgcctccgtt 548 Query: 368 gatagcttcgtatctgatgccggtagtatttacaaaaccaagattgatggtgcaaaaagt 427 || ||| || |||||| || ||||| || | |||||||| ||||||||| || | Sbjct: 549 gaaagcatcacatctgaagctggtagcatcttcaaaaccactattgatggtctaagcgat 608 Query: 428 gctgctacagggcttacagataaggatga 456 |||||||||||||||||||||||||||| Sbjct: 609 tctgctacagggcttacagataaggatga 637
>dbj|AK065186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D24, full insert sequence Length = 1538 Score = 188 bits (95), Expect = 1e-44 Identities = 271/329 (82%), Gaps = 3/329 (0%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgcgtcgcaccgctacctgcgggatcagcaagac---gaccag 187 ||||||||| |||| | |||||||| |||||||||||||||||||||| || |||||| Sbjct: 309 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaacaccacgaccag 368 Query: 188 gccatgtcgatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggttttgca 247 ||| || |||||||| || |||||||||| ||||||||||||||||||||||||||| Sbjct: 369 gccgcttcaatgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgca 428 Query: 248 ccacctgccatgcttcctgcaccttcttctgcaaagttaaacgagttgctactgccaaaa 307 ||||| || ||| ||||||| |||||| |||||||| || || || |||| || || Sbjct: 429 ccaccaccctcgctacctgcacaatcttcttcaaagttagacaagctgttactccctaac 488 Query: 308 ccatttgacaggcctcgtgctgttttcttgatgcaaattgatggatcccatgactctgtc 367 ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| ||| || Sbjct: 489 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatgcctccgtt 548 Query: 368 gatagcttcgtatctgatgccggtagtatttacaaaaccaagattgatggtgcaaaaagt 427 || ||| || |||||| || ||||| || | |||||||| ||||||||| || | Sbjct: 549 gaaagcatcacatctgaagctggtagcatcttcaaaaccactattgatggtctaagcgat 608 Query: 428 gctgctacagggcttacagataaggatga 456 |||||||||||||||||||||||||||| Sbjct: 609 tctgctacagggcttacagataaggatga 637
>gb|AY103941.1| Zea mays PCO095480 mRNA sequence Length = 1596 Score = 93.7 bits (47), Expect = 6e-16 Identities = 98/115 (85%) Strand = Plus / Plus Query: 370 tagcttcgtatctgatgccggtagtatttacaaaaccaagattgatggtgcaaaaagtgc 429 ||||||||||||||| | | | | |||| ||| |||| |||||| |||||||| | || Sbjct: 461 tagcttcgtatctgaaggcagcaacattttcaagaccaggattgaaggtgcaaacatcgc 520 Query: 430 tgctacagggcttacagataaggatgaattgattgtcattcgttcagatgaatct 484 || |||||||||||||||||||||||| || |||||||||| ||||||||||||| Sbjct: 521 tgatacagggcttacagataaggatgacttaattgtcattcattcagatgaatct 575 Score = 63.9 bits (32), Expect = 5e-07 Identities = 100/122 (81%), Gaps = 3/122 (2%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgcgtcgcaccgctacctgcgggatcagcaagacgac---cag 187 |||| ||||||||| | | |||||||||||||||| ||||| ||||||| |||| ||| Sbjct: 225 gccgtcttcatcgatgcctcgtcgcaccgctaccttcgggaccagcaagccgaccaccag 284 Query: 188 gccatgtcgatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggttttgca 247 | | || ||||| | ||||||||||||| | ||||||||||||||||||||| ||| Sbjct: 285 gacgcttcaatgtcgttaaatgaagtttctgcggttgtttctgtcttgcttggtttcgca 344 Query: 248 cc 249 || Sbjct: 345 cc 346 Score = 40.1 bits (20), Expect = 7.4 Identities = 38/44 (86%) Strand = Plus / Plus Query: 308 ccatttgacaggcctcgtgctgttttcttgatgcaaattgatgg 351 |||||||| || || |||||||||||| | ||||||||||||| Sbjct: 405 ccatttgatagaccgcgtgctgttttcctcgtgcaaattgatgg 448
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 79.8 bits (40), Expect = 9e-12 Identities = 52/56 (92%) Strand = Plus / Plus Query: 197 atgtcacttgatgaagtttctgcagctgtttctgtcttgcttggttttgcaccacc 252 |||||||| || |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 28387363 atgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgcaccacc 28387418 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgcgtcgcaccgctacctgcgggatcagcaa 178 ||||||||| |||| | |||||||| |||||||||||||||||||||| Sbjct: 28387126 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaa 28387173 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 308 ccatttgacaggcctcgtgctgttttcttgatgcaaattgatggatcccatg 359 ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| Sbjct: 28387558 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatg 28387609 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 87 tctcctccgccgtcgccgcccctg 110 |||||||||||| ||||||||||| Sbjct: 27922132 tctcctccgccggcgccgcccctg 27922155
>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0044E16 Length = 153296 Score = 79.8 bits (40), Expect = 9e-12 Identities = 52/56 (92%) Strand = Plus / Plus Query: 197 atgtcacttgatgaagtttctgcagctgtttctgtcttgcttggttttgcaccacc 252 |||||||| || |||||||||| |||||||||||||||||||||||||||||||| Sbjct: 116169 atgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgcaccacc 116224 Score = 63.9 bits (32), Expect = 5e-07 Identities = 44/48 (91%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgcgtcgcaccgctacctgcgggatcagcaa 178 ||||||||| |||| | |||||||| |||||||||||||||||||||| Sbjct: 115932 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaa 115979 Score = 56.0 bits (28), Expect = 1e-04 Identities = 46/52 (88%) Strand = Plus / Plus Query: 308 ccatttgacaggcctcgtgctgttttcttgatgcaaattgatggatcccatg 359 ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| Sbjct: 116364 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatg 116415
>gb|BT014170.1| Lycopersicon esculentum clone 133309F, mRNA sequence Length = 1482 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 231 tcttgcttggttttgcaccacctgc 255 ||||||||||||||||||| ||||| Sbjct: 208 tcttgcttggttttgcacctcctgc 232
>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete sequence Length = 214292 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 432 ctacagggcttacagataagg 452 ||||||||||||||||||||| Sbjct: 83347 ctacagggcttacagataagg 83367
>emb|CR376837.5| Zebrafish DNA sequence from clone CH211-165B17 in linkage group 15, complete sequence Length = 77723 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 486 ctggatcagatgttcttgaca 506 ||||||||||||||||||||| Sbjct: 76080 ctggatcagatgttcttgaca 76100
>emb|AL939112.1|SCO939112 Streptomyces coelicolor A3(2) complete genome; segment 9/29 Length = 300800 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 131 gccgccttcatcgacggcgcg 151 ||||||||||||||||||||| Sbjct: 187020 gccgccttcatcgacggcgcg 187000
>emb|BX000999.9| Zebrafish DNA sequence from clone DKEY-77F5 in linkage group 15, complete sequence Length = 200989 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 486 ctggatcagatgttcttgaca 506 ||||||||||||||||||||| Sbjct: 82255 ctggatcagatgttcttgaca 82275
>gb|AY112201.1| Zea mays CL4163_1 mRNA sequence Length = 1038 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 133 cgccttcatcgacggcgcgtc 153 ||||||||||||||||||||| Sbjct: 654 cgccttcatcgacggcgcgtc 674
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 133 cgccttcatcgacggcgcgtc 153 ||||||||||||||||||||| Sbjct: 2501776 cgccttcatcgacggcgcgtc 2501756
>gb|AC101689.12| Mus musculus chromosome 1, clone RP23-217C21, complete sequence Length = 189241 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 392 agtatttacaaaaccaagat 411 |||||||||||||||||||| Sbjct: 184354 agtatttacaaaaccaagat 184373
>ref|XM_483755.1| Oryza sativa (japonica cultivar-group), mRNA Length = 936 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 87 tctcctccgccgtcgccgcccctg 110 |||||||||||| ||||||||||| Sbjct: 12 tctcctccgccggcgccgcccctg 35
>gb|BT019291.1| Zea mays clone Contig964.F mRNA sequence Length = 725 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 tctcctccgccgtcgccgcc 106 |||||||||||||||||||| Sbjct: 278 tctcctccgccgtcgccgcc 259
>gb|AC166488.5| Mus musculus chromosome 1, clone RP23-245C4, complete sequence Length = 194413 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 392 agtatttacaaaaccaagat 411 |||||||||||||||||||| Sbjct: 121184 agtatttacaaaaccaagat 121165
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome Length = 5237682 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 ttttcttgatgcaaattgat 349 |||||||||||||||||||| Sbjct: 3154069 ttttcttgatgcaaattgat 3154088
>ref|XM_367879.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein (MG07783.4) partial mRNA Length = 1059 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 113 ggtcagggacacgccgctgccgcc 136 |||||||||| ||||||||||||| Sbjct: 555 ggtcagggactcgccgctgccgcc 578
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome Length = 5227419 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 ttttcttgatgcaaattgat 349 |||||||||||||||||||| Sbjct: 3076174 ttttcttgatgcaaattgat 3076193
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome Length = 5228663 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 ttttcttgatgcaaattgat 349 |||||||||||||||||||| Sbjct: 3076740 ttttcttgatgcaaattgat 3076759
>gb|AY359575.1| Zea mays W64A acc oxidase (ACO20) mRNA, complete cds Length = 1262 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 ccgccgtcgccgcccctgag 112 |||||||||||||||||||| Sbjct: 689 ccgccgtcgccgcccctgag 670
>gb|AY359574.1| Zea mays B73 acc oxidase (ACO20) gene, partial cds Length = 1516 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 ccgccgtcgccgcccctgag 112 |||||||||||||||||||| Sbjct: 470 ccgccgtcgccgcccctgag 451
>gb|AF211176.2| Botryotinia fuckeliana cystathionine beta-lyase (metC) gene, complete cds Length = 2921 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 ttgatgaagtttctgcagct 223 |||||||||||||||||||| Sbjct: 397 ttgatgaagtttctgcagct 378
>ref|XM_445693.1| Candida glabrata CBS138, CAGL0D06622g partial mRNA Length = 3537 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 gtttctgtcttgcttggttt 243 |||||||||||||||||||| Sbjct: 283 gtttctgtcttgcttggttt 264
>gb|CP000001.1| Bacillus cereus E33L, complete genome Length = 5300915 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 ttttcttgatgcaaattgat 349 |||||||||||||||||||| Sbjct: 3123419 ttttcttgatgcaaattgat 3123438
>gb|AC107980.8| Homo sapiens chromosome 15, clone CTD-3118D7, complete sequence Length = 141868 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 419 gcaaaaagtgctgctacagg 438 |||||||||||||||||||| Sbjct: 103321 gcaaaaagtgctgctacagg 103302
>emb|CR380950.1| Candida glabrata strain CBS138 chromosome D complete sequence Length = 651701 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 gtttctgtcttgcttggttt 243 |||||||||||||||||||| Sbjct: 632577 gtttctgtcttgcttggttt 632596
>gb|AY233907.1| Ceratocystis polonica strain CMW5026 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233906.1| Ceratocystis polonica strain CMW1165 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233905.1| Ceratocystis polonica strain CMW7149 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233904.1| Ceratocystis polonica strain CMW7143 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233903.1| Ceratocystis polonica strain CMW7133 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233902.1| Ceratocystis polonica strain CMW7152 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233901.1| Ceratocystis polonica strain CMW1164 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233900.1| Ceratocystis polonica strain CMW7754 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233899.1| Ceratocystis polonica strain CMW7748 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233898.1| Ceratocystis polonica strain CMW10522 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233897.1| Ceratocystis polonica strain CMW2210 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233896.1| Ceratocystis polonica strain CMW7151 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233895.1| Ceratocystis polonica strain CMW2286 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233894.1| Ceratocystis polonica strain CMW2284 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233893.1| Ceratocystis polonica strain CMW2272 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233892.1| Ceratocystis polonica strain CMW7138 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233891.1| Ceratocystis polonica strain CMW8874 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233890.1| Ceratocystis polonica strain CMW8845 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233889.1| Ceratocystis polonica strain CMW8830 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>gb|AY233888.1| Ceratocystis polonica strain CMW8873 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence Length = 528 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 385 tgccggtagtatttacaaaa 404 |||||||||||||||||||| Sbjct: 80 tgccggtagtatttacaaaa 99
>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+ transporting ATP synthase mitochondrial F0 complex subunit g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1) pseudogene, three novel genes, the gene for a novel ENTH domain containing protein, the 5' end of the Sox30 gene for SRY-box containing gene 30 and three Cpg islands, complete sequence Length = 207877 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 246 caccacctgccatgcttcct 265 |||||||||||||||||||| Sbjct: 126869 caccacctgccatgcttcct 126888
>emb|BX470109.3| Mouse DNA sequence from clone RP23-59I3 on chromosome 4, complete sequence Length = 228869 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 atgccggtagtatttacaaa 403 |||||||||||||||||||| Sbjct: 124753 atgccggtagtatttacaaa 124772
>emb|BX323006.12| Zebrafish DNA sequence from clone CH211-145H19 in linkage group 15, complete sequence Length = 161776 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 214 ttctgcagctgtttctgtct 233 |||||||||||||||||||| Sbjct: 129193 ttctgcagctgtttctgtct 129212
>emb|CR858889.1| Pongo pygmaeus mRNA; cDNA DKFZp459N191 (from clone DKFZp459N191) Length = 3376 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 83 gctttctcctccgccgtcgccgcc 106 |||||||||||||||| ||||||| Sbjct: 37 gctttctcctccgccgccgccgcc 14
>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence Length = 1877212 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 tcgtgctgttttcttgatgc 341 |||||||||||||||||||| Sbjct: 1817818 tcgtgctgttttcttgatgc 1817837
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 tctcctccgccgtcgccgcc 106 |||||||||||||||||||| Sbjct: 115900 tctcctccgccgtcgccgcc 115881
>emb|BX470247.5| Zebrafish DNA sequence from clone DKEY-96N2 in linkage group 24, complete sequence Length = 59900 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 ccacctgccatgcttcctgc 267 |||||||||||||||||||| Sbjct: 18658 ccacctgccatgcttcctgc 18677
>ref|XM_685844.1| PREDICTED: Danio rerio similar to p130Cas-associated protein (p140Cap) (SNAP-25-interacting protein) (SNIP) (LOC562465), mRNA Length = 6326 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 ccacctgccatgcttcctgc 267 |||||||||||||||||||| Sbjct: 3050 ccacctgccatgcttcctgc 3069
>emb|AL111267.1|CNS0196Z Botrytis cinerea strain T4 cDNA library Length = 780 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 ttgatgaagtttctgcagct 223 |||||||||||||||||||| Sbjct: 261 ttgatgaagtttctgcagct 280
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 cctgccatgcttcctgcacc 270 |||||||||||||||||||| Sbjct: 13900542 cctgccatgcttcctgcacc 13900523
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 401 aaaaccaagattgatggtgcaaaa 424 ||||||||||||| |||||||||| Sbjct: 4301930 aaaaccaagattgttggtgcaaaa 4301907
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 cgccgctgccgccttcatcg 143 |||||||||||||||||||| Sbjct: 16899790 cgccgctgccgccttcatcg 16899771
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 gccgccttcatcgacggcgc 150 |||||||||||||||||||| Sbjct: 8802346 gccgccttcatcgacggcgc 8802365
>dbj|AP006048.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1423D04 Length = 154474 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 cgccgctgccgccttcatcg 143 |||||||||||||||||||| Sbjct: 32812 cgccgctgccgccttcatcg 32793
>dbj|AP003521.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0025G03 Length = 139560 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 124 cgccgctgccgccttcatcg 143 |||||||||||||||||||| Sbjct: 129948 cgccgctgccgccttcatcg 129929
>dbj|AP003800.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1014_E09 Length = 184624 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 401 aaaaccaagattgatggtgcaaaa 424 ||||||||||||| |||||||||| Sbjct: 122984 aaaaccaagattgttggtgcaaaa 122961
>emb|BX088547.12| Zebrafish DNA sequence from clone DKEY-238O14, complete sequence Length = 256446 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 214 ttctgcagctgtttctgtct 233 |||||||||||||||||||| Sbjct: 249740 ttctgcagctgtttctgtct 249721
>dbj|AP003928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1150_A11 Length = 142010 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 87 tctcctccgccgtcgccgcccctg 110 |||||||||||| ||||||||||| Sbjct: 130210 tctcctccgccggcgccgcccctg 130233
>dbj|AK061522.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-B06, full insert sequence Length = 936 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 87 tctcctccgccgtcgccgcccctg 110 |||||||||||| ||||||||||| Sbjct: 12 tctcctccgccggcgccgcccctg 35
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome Length = 5227293 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 330 ttttcttgatgcaaattgat 349 |||||||||||||||||||| Sbjct: 3076046 ttttcttgatgcaaattgat 3076065
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 cctgccatgcttcctgcacc 270 |||||||||||||||||||| Sbjct: 13854822 cctgccatgcttcctgcacc 13854803
>emb|AL928747.3|CNS08CBK Oryza sativa chromosome 12, . BAC OSJNBa0017A21 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144552 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 cctgccatgcttcctgcacc 270 |||||||||||||||||||| Sbjct: 37170 cctgccatgcttcctgcacc 37151
>gb|AC131699.4| Mus musculus BAC clone RP23-440F17 from 1, complete sequence Length = 200544 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 atcccatgactctgtcgata 371 |||||||||||||||||||| Sbjct: 134929 atcccatgactctgtcgata 134948
>gb|AC167197.6| Mus musculus chromosome 1, clone RP23-62B14, complete sequence Length = 220763 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 atcccatgactctgtcgata 371 |||||||||||||||||||| Sbjct: 117451 atcccatgactctgtcgata 117470 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,580,119 Number of Sequences: 3902068 Number of extensions: 4580119 Number of successful extensions: 106266 Number of sequences better than 10.0: 71 Number of HSP's better than 10.0 without gapping: 71 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105321 Number of HSP's gapped (non-prelim): 942 length of query: 549 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 526 effective length of database: 17,143,297,704 effective search space: 9017374592304 effective search space used: 9017374592304 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)