ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart25e01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... 803 0.0
2ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0... 611 e-171
3dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 611 e-171
4dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 611 e-171
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 442 e-121
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 442 e-121
7gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome... 442 e-121
8ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA 337 2e-89
9dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 337 2e-89
10gb|AY106013.1| Zea mays PCO066457 mRNA sequence 307 2e-80
11gb|AY107461.1| Zea mays PCO108959 mRNA sequence 252 1e-63
12gb|AY130450.1| Petromyzon marinus ribosomal protein S3 mRNA, par... 202 8e-49
13gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mR... 194 2e-46
14dbj|AB246886.1| Lethenteron japonicum RPS3 mRNA for ribosomal pr... 186 5e-44
15gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA 159 1e-35
16gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence 151 3e-33
17gb|DQ448864.1| Theobroma cacao 40S ribosomal protein S3 mRNA, pa... 133 6e-28
18gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002... 131 2e-27
19dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
20dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
21dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
22gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal prote... 129 1e-26
23ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA 129 1e-26
24gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clon... 129 1e-26
25gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3... 121 2e-24
26gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot... 119 9e-24
27emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Co... 111 2e-21
28ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / str... 105 1e-19
29gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S... 105 1e-19
30gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S... 105 1e-19
31gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 ... 105 1e-19
32gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete se... 105 1e-19
33ref|NM_128718.3| Arabidopsis thaliana structural constituent of ... 103 6e-19
34gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal prote... 103 6e-19
35gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal prote... 103 6e-19
36gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; conta... 103 6e-19
37gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g3... 103 6e-19
38gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, comp... 103 6e-19
39gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mR... 103 6e-19
40emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Co... 103 6e-19
41emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Co... 103 6e-19
42gb|AF429976.1| Spodoptera frugiperda ribosomal protein S3 mRNA, ... 103 6e-19
43gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA... 96 1e-16
44emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Co... 96 1e-16
45gb|U12708.1|MSU12708 Manduca sexta ribosomal protein S3 mRNA, co... 90 8e-15
46gb|BC010721.1| Mus musculus ribosomal protein S3, mRNA (cDNA clo... 88 3e-14
47dbj|AK148030.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 88 3e-14
48dbj|AK146796.1| Mus musculus 17 days embryo stomach cDNA, RIKEN ... 88 3e-14
49dbj|AK150479.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 88 3e-14
50dbj|AK166750.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 88 3e-14
51dbj|AK168845.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 88 3e-14
52dbj|AK164077.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 88 3e-14
53dbj|AK165174.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN ... 88 3e-14
54dbj|AK167266.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 88 3e-14
55dbj|AK160526.1| Mus musculus ES cells cDNA, RIKEN full-length en... 88 3e-14
56dbj|AK159508.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 88 3e-14
57dbj|AK167210.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 88 3e-14
58dbj|AK010678.1| Mus musculus ES cells cDNA, RIKEN full-length en... 88 3e-14
59dbj|AK010579.1| Mus musculus ES cells cDNA, RIKEN full-length en... 88 3e-14
60dbj|AK003181.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 88 3e-14
61dbj|AK051243.1| Mus musculus 12 days embryo spinal ganglion cDNA... 88 3e-14
62dbj|AK012314.1| Mus musculus 11 days embryo whole body cDNA, RIK... 88 3e-14
63dbj|AK012234.1| Mus musculus 11 days embryo whole body cDNA, RIK... 88 3e-14
64dbj|AK011655.1| Mus musculus 10 days embryo whole body cDNA, RIK... 88 3e-14
65gb|U89414.1|MMU89414 Mus musculus strain BALB/c ribosomal protei... 88 3e-14
66ref|NM_012052.1| Mus musculus ribosomal protein S3 (Rps3), mRNA 88 3e-14
67emb|X76772.1|MMRIBPS3 M.musculus mRNA for ribosomal protein S3 88 3e-14
68ref|NM_122944.2| Arabidopsis thaliana structural constituent of ... 86 1e-13
69ref|XM_855394.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
70ref|XM_855358.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
71ref|XM_855322.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
72ref|XM_855288.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
73ref|XM_855253.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
74ref|XM_534008.2| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
75ref|XM_855185.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
76ref|XM_844854.1| PREDICTED: Canis familiaris similar to 40S ribo... 86 1e-13
77gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 86 1e-13
78gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, comp... 86 1e-13
79gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete s... 86 1e-13
80gb|AY769316.1| Bombyx mori ribosomal protein S3 (RpS3) mRNA, com... 84 5e-13
81emb|AM048962.1| Scarabaeus laticollis mRNA for ribosomal protein... 84 5e-13
82emb|BX071951.1|CNS09ROJ Single read from an extremity of a full-... 84 5e-13
83emb|BX071950.1|CNS09ROI Single read from an extremity of a full-... 84 5e-13
84emb|BX071838.1|CNS09RLE Single read from an extremity of a full-... 84 5e-13
85emb|BX071486.1|CNS09RBM Single read from an extremity of a full-... 84 5e-13
86emb|BX060955.1|CNS09J73 Single read from an extremity of a full-... 84 5e-13
87emb|BX069342.1|CNS09PO2 Single read from an extremity of a full-... 84 5e-13
88emb|BX068384.1|CNS09OXG Single read from an extremity of a full-... 84 5e-13
89emb|BX068060.1|CNS09OOG Single read from an extremity of a full-... 84 5e-13
90emb|BX067052.1|CNS09NWG Single read from an extremity of a full-... 84 5e-13
91emb|BX066892.1|CNS09NS0 Single read from an extremity of a full-... 84 5e-13
92emb|BX066853.1|CNS09NQX Single read from an extremity of a full-... 84 5e-13
93emb|BX065632.1|CNS09MT0 Single read from an extremity of a full-... 84 5e-13
94emb|BX065002.1|CNS09MBI Single read from an extremity of a full-... 84 5e-13
95emb|BX062894.1|CNS09KOY Single read from an extremity of a full-... 84 5e-13
96emb|BX062466.1|CNS09KD2 Single read from an extremity of a full-... 84 5e-13
97emb|BX062034.1|CNS09K12 Single read from an extremity of a full-... 84 5e-13
98emb|BX061570.1|CNS09JO6 Single read from an extremity of a full-... 84 5e-13
99emb|BX061429.1|CNS09JK9 Single read from an extremity of a full-... 84 5e-13
100emb|BX061247.1|CNS09JF7 Single read from an extremity of a full-... 84 5e-13
101emb|BX060666.1|CNS09IZ2 Single read from an extremity of a full-... 84 5e-13
102emb|BX060145.1|CNS09IKL Single read from an extremity of a full-... 84 5e-13
103emb|BX060064.1|CNS09IIC Single read from an extremity of a full-... 84 5e-13
104emb|BX060018.1|CNS09IH2 Single read from an extremity of a full-... 84 5e-13
105emb|BX056467.1|CNS09FQF Single read from an extremity of a full-... 84 5e-13
106emb|BX054555.1|CNS09E9B Single read from an extremity of a full-... 84 5e-13
107emb|BX054554.1|CNS09E9A Single read from an extremity of a full-... 84 5e-13
108emb|BX054507.1|CNS09E7Z Single read from an extremity of a full-... 84 5e-13
109emb|BX049946.1|CNS09APA Single read from an extremity of a full-... 84 5e-13
110emb|BX049133.1|CNS09A2P Single read from an extremity of a full-... 84 5e-13
111emb|BX048656.1|CNS099PG Single read from an extremity of a full-... 84 5e-13
112emb|BX048195.1|CNS099CN Single read from an extremity of a full-... 84 5e-13
113emb|BX044635.1|CNS096LR Single read from an extremity of a full-... 84 5e-13
114emb|BX043729.1|CNS095WL Single read from an extremity of a full-... 84 5e-13
115emb|BX043605.1|CNS095T5 Single read from an extremity of a full-... 84 5e-13
116emb|BX043171.1|CNS095H3 Single read from an extremity of a full-... 84 5e-13
117emb|BX042318.1|CNS094TE Single read from an extremity of a full-... 84 5e-13
118emb|BX041935.1|CNS094IR Single read from an extremity of a full-... 84 5e-13
119emb|BX041378.1|CNS0943A Single read from an extremity of a full-... 84 5e-13
120emb|BX040880.1|CNS093PG Single read from an extremity of a full-... 84 5e-13
121emb|BX040349.1|CNS093AP Single read from an extremity of a full-... 84 5e-13
122emb|BX040104.1|CNS0933W Single read from an extremity of a full-... 84 5e-13
123emb|BX039345.1|CNS092IT Single read from an extremity of a full-... 84 5e-13
124emb|BX039168.1|CNS092DW Single read from an extremity of a full-... 84 5e-13
125emb|BX038309.1|CNS091Q1 Single read from an extremity of a full-... 84 5e-13
126emb|BX036899.1|CNS090MV Single read from an extremity of a full-... 84 5e-13
127emb|BX036837.1|CNS090L5 Single read from an extremity of a full-... 84 5e-13
128emb|BX034717.1|CNS08YY9 Single read from an extremity of a full-... 84 5e-13
129emb|BX032839.1|CNS08XI3 Single read from an extremity of a full-... 84 5e-13
130emb|BX030549.1|CNS08VQH Single read from an extremity of a full-... 84 5e-13
131emb|BX022272.1|CNS08PCK Single read from an extremity of a full-... 84 5e-13
132emb|BX027874.1|CNS08TO6 Single read from an extremity of a full-... 84 5e-13
133emb|BX027294.1|CNS08T82 Single read from an extremity of a full-... 84 5e-13
134emb|BX024682.1|CNS08R7I Single read from an extremity of a full-... 84 5e-13
135emb|BX019560.1|CNS08N98 Single read from an extremity of a full-... 84 5e-13
136emb|BX020703.1|CNS08O4Z Single read from an extremity of a full-... 84 5e-13
137emb|BX018305.1|CNS08MAD Single read from an extremity of a full-... 84 5e-13
138emb|BX012403.1|CNS08HQF Single read from an extremity of a full-... 84 5e-13
139emb|BX006777.1|CNS08DE5 Single read from an extremity of a full-... 84 5e-13
140ref|XM_321155.2| Anopheles gambiae str. PEST ENSANGP00000020844 ... 84 5e-13
141emb|BX067207.1|CNS09O0R Single read from an extremity of a full-... 82 2e-12
142emb|BX071776.1|CNS09RJO Single read from an extremity of a full-... 82 2e-12
143emb|BX070615.1|CNS09QNF Single read from an extremity of a full-... 82 2e-12
144emb|BX067880.1|CNS09OJG Single read from an extremity of a full-... 82 2e-12
145emb|BX067051.1|CNS09NWF Single read from an extremity of a full-... 82 2e-12
146emb|BX065756.1|CNS09MWG Single read from an extremity of a full-... 82 2e-12
147emb|BX062033.1|CNS09K11 Single read from an extremity of a full-... 82 2e-12
148emb|BX061592.1|CNS09JOS Single read from an extremity of a full-... 82 2e-12
149emb|BX059556.1|CNS09I48 Single read from an extremity of a full-... 82 2e-12
150emb|BX059139.1|CNS09HSN Single read from an extremity of a full-... 82 2e-12
151emb|BX056167.1|CNS09FI3 Single read from an extremity of a full-... 82 2e-12
152emb|BX054567.1|CNS09E9N Single read from an extremity of a full-... 82 2e-12
153emb|BX049132.1|CNS09A2O Single read from an extremity of a full-... 82 2e-12
154emb|BX047370.1|CNS098PQ Single read from an extremity of a full-... 82 2e-12
155emb|BX046671.1|CNS0986B Single read from an extremity of a full-... 82 2e-12
156emb|BX041377.1|CNS09439 Single read from an extremity of a full-... 82 2e-12
157emb|BX040698.1|CNS093KE Single read from an extremity of a full-... 82 2e-12
158emb|BX040183.1|CNS09363 Single read from an extremity of a full-... 82 2e-12
159emb|BX040080.1|CNS09338 Single read from an extremity of a full-... 82 2e-12
160emb|BX039936.1|CNS092Z8 Single read from an extremity of a full-... 82 2e-12
161gb|DQ415986.1| Anopheles quadrimaculatus ribosomal protein S3 (R... 82 2e-12
162emb|BX053436.1|CNS09DE8 Single read from an extremity of a full-... 80 8e-12
163emb|BX071837.1|CNS09RLD Single read from an extremity of a full-... 80 8e-12
164emb|BX071741.1|CNS09RIP Single read from an extremity of a full-... 80 8e-12
165emb|BX071696.1|CNS09RHG Single read from an extremity of a full-... 80 8e-12
166emb|BX071616.1|CNS09RF8 Single read from an extremity of a full-... 80 8e-12
167emb|BX071485.1|CNS09RBL Single read from an extremity of a full-... 80 8e-12
168emb|BX070633.1|CNS09QNX Single read from an extremity of a full-... 80 8e-12
169emb|BX070555.1|CNS09QLR Single read from an extremity of a full-... 80 8e-12
170emb|BX070506.1|CNS09QKE Single read from an extremity of a full-... 80 8e-12
171emb|BX070477.1|CNS09QJL Single read from an extremity of a full-... 80 8e-12
172emb|BX070421.1|CNS09QI1 Single read from an extremity of a full-... 80 8e-12
173emb|BX070161.1|CNS09QAT Single read from an extremity of a full-... 80 8e-12
174emb|BX069948.1|CNS09Q4W Single read from an extremity of a full-... 80 8e-12
175emb|BX069682.1|CNS09PXI Single read from an extremity of a full-... 80 8e-12
176emb|BX069666.1|CNS09PX2 Single read from an extremity of a full-... 80 8e-12
177emb|BX061066.1|CNS09JA6 Single read from an extremity of a full-... 80 8e-12
178emb|BX069429.1|CNS09PQH Single read from an extremity of a full-... 80 8e-12
179emb|BX069304.1|CNS09PN0 Single read from an extremity of a full-... 80 8e-12
180emb|BX069215.1|CNS09PKJ Single read from an extremity of a full-... 80 8e-12
181emb|BX068963.1|CNS09PDJ Single read from an extremity of a full-... 80 8e-12
182emb|BX068877.1|CNS09PB5 Single read from an extremity of a full-... 80 8e-12
183emb|BX068410.1|CNS09OY6 Single read from an extremity of a full-... 80 8e-12
184emb|BX068383.1|CNS09OXF Single read from an extremity of a full-... 80 8e-12
185emb|BX068027.1|CNS09ONJ Single read from an extremity of a full-... 80 8e-12
186emb|BX067933.1|CNS09OKX Single read from an extremity of a full-... 80 8e-12
187emb|BX067909.1|CNS09OK9 Single read from an extremity of a full-... 80 8e-12
188emb|BX067157.1|CNS09NZD Single read from an extremity of a full-... 80 8e-12
189emb|BX066852.1|CNS09NQW Single read from an extremity of a full-... 80 8e-12
190emb|BX066794.1|CNS09NPA Single read from an extremity of a full-... 80 8e-12
191emb|BX066745.1|CNS09NNX Single read from an extremity of a full-... 80 8e-12
192emb|BX066721.1|CNS09NN9 Single read from an extremity of a full-... 80 8e-12
193emb|BX066470.1|CNS09NGA Single read from an extremity of a full-... 80 8e-12
194emb|BX066232.1|CNS09N9O Single read from an extremity of a full-... 80 8e-12
195emb|BX066176.1|CNS09N84 Single read from an extremity of a full-... 80 8e-12
196emb|BX065879.1|CNS09MZV Single read from an extremity of a full-... 80 8e-12
197emb|BX065812.1|CNS09MY0 Single read from an extremity of a full-... 80 8e-12
198emb|BX065503.1|CNS09MPF Single read from an extremity of a full-... 80 8e-12
199emb|BX065323.1|CNS09MKF Single read from an extremity of a full-... 80 8e-12
200emb|BX065196.1|CNS09MGW Single read from an extremity of a full-... 80 8e-12
201emb|BX065001.1|CNS09MBH Single read from an extremity of a full-... 80 8e-12
202emb|BX064962.1|CNS09MAE Single read from an extremity of a full-... 80 8e-12
203emb|BX064919.1|CNS09M97 Single read from an extremity of a full-... 80 8e-12
204emb|BX064727.1|CNS09M3V Single read from an extremity of a full-... 80 8e-12
205emb|BX064562.1|CNS09LZA Single read from an extremity of a full-... 80 8e-12
206emb|BX064439.1|CNS09LVV Single read from an extremity of a full-... 80 8e-12
207emb|BX064384.1|CNS09LUC Single read from an extremity of a full-... 80 8e-12
208emb|BX064214.1|CNS09LPM Single read from an extremity of a full-... 80 8e-12
209emb|BX064116.1|CNS09LMW Single read from an extremity of a full-... 80 8e-12
210emb|BX064054.1|CNS09LL6 Single read from an extremity of a full-... 80 8e-12
211emb|BX063320.1|CNS09L0S Single read from an extremity of a full-... 80 8e-12
212emb|BX062932.1|CNS09KQ0 Single read from an extremity of a full-... 80 8e-12
213emb|BX062893.1|CNS09KOX Single read from an extremity of a full-... 80 8e-12
214emb|BX062127.1|CNS09K3N Single read from an extremity of a full-... 80 8e-12
215emb|BX062120.1|CNS09K3G Single read from an extremity of a full-... 80 8e-12
216emb|BX061743.1|CNS09JSZ Single read from an extremity of a full-... 80 8e-12
217emb|BX061707.1|CNS09JRZ Single read from an extremity of a full-... 80 8e-12
218emb|BX061620.1|CNS09JPK Single read from an extremity of a full-... 80 8e-12
219emb|BX061569.1|CNS09JO5 Single read from an extremity of a full-... 80 8e-12
220emb|BX061480.1|CNS09JLO Single read from an extremity of a full-... 80 8e-12
221emb|BX061428.1|CNS09JK8 Single read from an extremity of a full-... 80 8e-12
222emb|BX061229.1|CNS09JEP Single read from an extremity of a full-... 80 8e-12
223emb|BX060846.1|CNS09J42 Single read from an extremity of a full-... 80 8e-12
224emb|BX060810.1|CNS09J32 Single read from an extremity of a full-... 80 8e-12
225emb|BX060665.1|CNS09IZ1 Single read from an extremity of a full-... 80 8e-12
226emb|BX060607.1|CNS09IXF Single read from an extremity of a full-... 80 8e-12
227emb|BX060402.1|CNS09IRQ Single read from an extremity of a full-... 80 8e-12
228emb|BX060375.1|CNS09IQZ Single read from an extremity of a full-... 80 8e-12
229emb|BX060144.1|CNS09IKK Single read from an extremity of a full-... 80 8e-12
230emb|BX060066.1|CNS09IIE Single read from an extremity of a full-... 80 8e-12
231emb|BX060017.1|CNS09IH1 Single read from an extremity of a full-... 80 8e-12
232emb|BX059858.1|CNS09ICM Single read from an extremity of a full-... 80 8e-12
233emb|BX059821.1|CNS09IBL Single read from an extremity of a full-... 80 8e-12
234emb|BX059045.1|CNS09HQ1 Single read from an extremity of a full-... 80 8e-12
235emb|BX059018.1|CNS09HPA Single read from an extremity of a full-... 80 8e-12
236emb|BX058900.1|CNS09HM0 Single read from an extremity of a full-... 80 8e-12
237emb|BX058711.1|CNS09HGR Single read from an extremity of a full-... 80 8e-12
238emb|BX058653.1|CNS09HF5 Single read from an extremity of a full-... 80 8e-12
239emb|BX058108.1|CNS09H00 Single read from an extremity of a full-... 80 8e-12
240emb|BX058103.1|CNS09GZV Single read from an extremity of a full-... 80 8e-12
241emb|BX056701.1|CNS09FWX Single read from an extremity of a full-... 80 8e-12
242emb|BX056662.1|CNS09FVU Single read from an extremity of a full-... 80 8e-12
243emb|BX057998.1|CNS09GWY Single read from an extremity of a full-... 80 8e-12
244emb|BX057677.1|CNS09GO1 Single read from an extremity of a full-... 80 8e-12
245emb|BX057652.1|CNS09GNC Single read from an extremity of a full-... 80 8e-12
246emb|BX057544.1|CNS09GKC Single read from an extremity of a full-... 80 8e-12
247emb|BX056968.1|CNS09G4C Single read from an extremity of a full-... 80 8e-12
248emb|BX056933.1|CNS09G3D Single read from an extremity of a full-... 80 8e-12
249emb|BX056922.1|CNS09G32 Single read from an extremity of a full-... 80 8e-12
250emb|BX056881.1|CNS09G1X Single read from an extremity of a full-... 80 8e-12
251emb|BX056500.1|CNS09FRC Single read from an extremity of a full-... 80 8e-12
252emb|BX056452.1|CNS09FQ0 Single read from an extremity of a full-... 80 8e-12
253emb|BX056428.1|CNS09FPC Single read from an extremity of a full-... 80 8e-12
254emb|BX056307.1|CNS09FLZ Single read from an extremity of a full-... 80 8e-12
255emb|BX056230.1|CNS09FJU Single read from an extremity of a full-... 80 8e-12
256emb|BX056041.1|CNS09FEL Single read from an extremity of a full-... 80 8e-12
257emb|BX055677.1|CNS09F4H Single read from an extremity of a full-... 80 8e-12
258emb|BX055410.1|CNS09EX2 Single read from an extremity of a full-... 80 8e-12
259emb|BX055261.1|CNS09ESX Single read from an extremity of a full-... 80 8e-12
260emb|BX055241.1|CNS09ESD Single read from an extremity of a full-... 80 8e-12
261emb|BX055192.1|CNS09ER0 Single read from an extremity of a full-... 80 8e-12
262emb|BX053297.1|CNS09DAD Single read from an extremity of a full-... 80 8e-12
263emb|BX053259.1|CNS09D9B Single read from an extremity of a full-... 80 8e-12
264emb|BX053160.1|CNS09D6K Single read from an extremity of a full-... 80 8e-12
265emb|BX053115.1|CNS09D5B Single read from an extremity of a full-... 80 8e-12
266emb|BX055101.1|CNS09EOH Single read from an extremity of a full-... 80 8e-12
267emb|BX054976.1|CNS09EL0 Single read from an extremity of a full-... 80 8e-12
268emb|BX054840.1|CNS09EH8 Single read from an extremity of a full-... 80 8e-12
269emb|BX054826.1|CNS09EGU Single read from an extremity of a full-... 80 8e-12
270emb|BX054822.1|CNS09EGQ Single read from an extremity of a full-... 80 8e-12
271emb|BX052983.1|CNS09D1N Single read from an extremity of a full-... 80 8e-12
272emb|BX054566.1|CNS09E9M Single read from an extremity of a full-... 80 8e-12
273emb|BX054506.1|CNS09E7Y Single read from an extremity of a full-... 80 8e-12
274emb|BX054212.1|CNS09DZS Single read from an extremity of a full-... 80 8e-12
275emb|BX054111.1|CNS09DWZ Single read from an extremity of a full-... 80 8e-12
276emb|BX054075.1|CNS09DVZ Single read from an extremity of a full-... 80 8e-12
277emb|BX054013.1|CNS09DU9 Single read from an extremity of a full-... 80 8e-12
278emb|BX053925.1|CNS09DRT Single read from an extremity of a full-... 80 8e-12
279emb|BX053867.1|CNS09DQ7 Single read from an extremity of a full-... 80 8e-12
280emb|BX053857.1|CNS09DPX Single read from an extremity of a full-... 80 8e-12
281emb|BX053809.1|CNS09DOL Single read from an extremity of a full-... 80 8e-12
282emb|BX053792.1|CNS09DO4 Single read from an extremity of a full-... 80 8e-12
283emb|BX053731.1|CNS09DMF Single read from an extremity of a full-... 80 8e-12
284emb|BX053652.1|CNS09DK8 Single read from an extremity of a full-... 80 8e-12
285emb|BX053641.1|CNS09DJX Single read from an extremity of a full-... 80 8e-12
286emb|BX052756.1|CNS09CVC Single read from an extremity of a full-... 80 8e-12
287emb|BX052547.1|CNS09CPJ Single read from an extremity of a full-... 80 8e-12
288emb|BX052229.1|CNS09CGP Single read from an extremity of a full-... 80 8e-12
289emb|BX052113.1|CNS09CDH Single read from an extremity of a full-... 80 8e-12
290emb|BX052101.1|CNS09CD5 Single read from an extremity of a full-... 80 8e-12
291emb|BX051814.1|CNS09C56 Single read from an extremity of a full-... 80 8e-12
292emb|BX051793.1|CNS09C4L Single read from an extremity of a full-... 80 8e-12
293emb|BX051525.1|CNS09BX5 Single read from an extremity of a full-... 80 8e-12
294emb|BX051501.1|CNS09BWH Single read from an extremity of a full-... 80 8e-12
295emb|BX050130.1|CNS09AUE Single read from an extremity of a full-... 80 8e-12
296emb|BX050103.1|CNS09ATN Single read from an extremity of a full-... 80 8e-12
297emb|BX051072.1|CNS09BKK Single read from an extremity of a full-... 80 8e-12
298emb|BX050743.1|CNS09BBF Single read from an extremity of a full-... 80 8e-12
299emb|BX050675.1|CNS09B9J Single read from an extremity of a full-... 80 8e-12
300emb|BX050615.1|CNS09B7V Single read from an extremity of a full-... 80 8e-12
301emb|BX050346.1|CNS09B0E Single read from an extremity of a full-... 80 8e-12
302emb|BX050277.1|CNS09AYH Single read from an extremity of a full-... 80 8e-12
303emb|BX049975.1|CNS09AQ3 Single read from an extremity of a full-... 80 8e-12
304emb|BX049945.1|CNS09AP9 Single read from an extremity of a full-... 80 8e-12
305emb|BX049331.1|CNS09A87 Single read from an extremity of a full-... 80 8e-12
306emb|BX049176.1|CNS09A3W Single read from an extremity of a full-... 80 8e-12
307emb|BX049093.1|CNS09A1L Single read from an extremity of a full-... 80 8e-12
308emb|BX049082.1|CNS09A1A Single read from an extremity of a full-... 80 8e-12
309emb|BX049080.1|CNS09A18 Single read from an extremity of a full-... 80 8e-12
310emb|BX049069.1|CNS09A0X Single read from an extremity of a full-... 80 8e-12
311emb|BX049050.1|CNS09A0E Single read from an extremity of a full-... 80 8e-12
312emb|BX048831.1|CNS099UB Single read from an extremity of a full-... 80 8e-12
313emb|BX048625.1|CNS099OL Single read from an extremity of a full-... 80 8e-12
314emb|BX048581.1|CNS099ND Single read from an extremity of a full-... 80 8e-12
315emb|BX048515.1|CNS099LJ Single read from an extremity of a full-... 80 8e-12
316emb|BX046558.1|CNS09836 Single read from an extremity of a full-... 80 8e-12
317emb|BX046517.1|CNS09821 Single read from an extremity of a full-... 80 8e-12
318emb|BX046389.1|CNS097YH Single read from an extremity of a full-... 80 8e-12
319emb|BX046379.1|CNS097Y7 Single read from an extremity of a full-... 80 8e-12
320emb|BX048251.1|CNS099E7 Single read from an extremity of a full-... 80 8e-12
321emb|BX048245.1|CNS099E1 Single read from an extremity of a full-... 80 8e-12
322emb|BX047882.1|CNS0993Y Single read from an extremity of a full-... 80 8e-12
323emb|BX047719.1|CNS098ZF Single read from an extremity of a full-... 80 8e-12
324emb|BX047704.1|CNS098Z0 Single read from an extremity of a full-... 80 8e-12
325emb|BX047545.1|CNS098UL Single read from an extremity of a full-... 80 8e-12
326emb|BX047529.1|CNS098U5 Single read from an extremity of a full-... 80 8e-12
327emb|BX047196.1|CNS098KW Single read from an extremity of a full-... 80 8e-12
328emb|BX046877.1|CNS098C1 Single read from an extremity of a full-... 80 8e-12
329emb|BX046853.1|CNS098BD Single read from an extremity of a full-... 80 8e-12
330emb|BX046792.1|CNS0989O Single read from an extremity of a full-... 80 8e-12
331emb|BX046147.1|CNS097RR Single read from an extremity of a full-... 80 8e-12
332emb|BX045769.1|CNS097H9 Single read from an extremity of a full-... 80 8e-12
333emb|BX045506.1|CNS0979Y Single read from an extremity of a full-... 80 8e-12
334emb|BX045064.1|CNS096XO Single read from an extremity of a full-... 80 8e-12
335emb|BX044921.1|CNS096TP Single read from an extremity of a full-... 80 8e-12
336emb|BX044917.1|CNS096TL Single read from an extremity of a full-... 80 8e-12
337emb|BX042903.1|CNS0959N Single read from an extremity of a full-... 80 8e-12
338emb|BX044660.1|CNS096MG Single read from an extremity of a full-... 80 8e-12
339emb|BX044577.1|CNS096K5 Single read from an extremity of a full-... 80 8e-12
340emb|BX044157.1|CNS0968H Single read from an extremity of a full-... 80 8e-12
341emb|BX044072.1|CNS09664 Single read from an extremity of a full-... 80 8e-12
342emb|BX044027.1|CNS0964V Single read from an extremity of a full-... 80 8e-12
343emb|BX043893.1|CNS09615 Single read from an extremity of a full-... 80 8e-12
344emb|BX043373.1|CNS095MP Single read from an extremity of a full-... 80 8e-12
345emb|BX043303.1|CNS095KR Single read from an extremity of a full-... 80 8e-12
346emb|BX043170.1|CNS095H2 Single read from an extremity of a full-... 80 8e-12
347emb|BX042818.1|CNS0957A Single read from an extremity of a full-... 80 8e-12
348emb|BX042317.1|CNS094TD Single read from an extremity of a full-... 80 8e-12
349emb|BX042258.1|CNS094RQ Single read from an extremity of a full-... 80 8e-12
350emb|BX041818.1|CNS094FI Single read from an extremity of a full-... 80 8e-12
351emb|BX042054.1|CNS094M2 Single read from an extremity of a full-... 80 8e-12
352emb|BX041909.1|CNS094I1 Single read from an extremity of a full-... 80 8e-12
353emb|BX041903.1|CNS094HV Single read from an extremity of a full-... 80 8e-12
354emb|BX041451.1|CNS0945B Single read from an extremity of a full-... 80 8e-12
355emb|BX041415.1|CNS0944B Single read from an extremity of a full-... 80 8e-12
356emb|BX040911.1|CNS093QB Single read from an extremity of a full-... 80 8e-12
357emb|BX040879.1|CNS093PF Single read from an extremity of a full-... 80 8e-12
358emb|BX040582.1|CNS093H6 Single read from an extremity of a full-... 80 8e-12
359emb|BX040455.1|CNS093DN Single read from an extremity of a full-... 80 8e-12
360emb|BX040354.1|CNS093AU Single read from an extremity of a full-... 80 8e-12
361emb|BX040267.1|CNS0938F Single read from an extremity of a full-... 80 8e-12
362emb|BX039997.1|CNS0930X Single read from an extremity of a full-... 80 8e-12
363emb|BX039888.1|CNS092XW Single read from an extremity of a full-... 80 8e-12
364emb|BX039847.1|CNS092WR Single read from an extremity of a full-... 80 8e-12
365emb|BX039705.1|CNS092ST Single read from an extremity of a full-... 80 8e-12
366emb|BX039589.1|CNS092PL Single read from an extremity of a full-... 80 8e-12
367emb|BX039361.1|CNS092J9 Single read from an extremity of a full-... 80 8e-12
368emb|BX039290.1|CNS092HA Single read from an extremity of a full-... 80 8e-12
369emb|BX039254.1|CNS092GA Single read from an extremity of a full-... 80 8e-12
370emb|BX039252.1|CNS092G8 Single read from an extremity of a full-... 80 8e-12
371emb|BX036898.1|CNS090MU Single read from an extremity of a full-... 80 8e-12
372emb|BX035147.1|CNS08ZA7 Single read from an extremity of a full-... 80 8e-12
373emb|BX032838.1|CNS08XI2 Single read from an extremity of a full-... 80 8e-12
374emb|BX032753.1|CNS08XFP Single read from an extremity of a full-... 80 8e-12
375emb|BX032302.1|CNS08X36 Single read from an extremity of a full-... 80 8e-12
376emb|BX030071.1|CNS08VD7 Single read from an extremity of a full-... 80 8e-12
377emb|BX028321.1|CNS08U0L Single read from an extremity of a full-... 80 8e-12
378emb|BX027854.1|CNS08TNM Single read from an extremity of a full-... 80 8e-12
379emb|BX027305.1|CNS08T8D Single read from an extremity of a full-... 80 8e-12
380emb|BX027293.1|CNS08T81 Single read from an extremity of a full-... 80 8e-12
381emb|BX027196.1|CNS08T5C Single read from an extremity of a full-... 80 8e-12
382emb|BX025545.1|CNS08RVH Single read from an extremity of a full-... 80 8e-12
383emb|BX025174.1|CNS08RL6 Single read from an extremity of a full-... 80 8e-12
384emb|BX025112.1|CNS08RJG Single read from an extremity of a full-... 80 8e-12
385emb|BX024647.1|CNS08R6J Single read from an extremity of a full-... 80 8e-12
386emb|BX024402.1|CNS08QZQ Single read from an extremity of a full-... 80 8e-12
387emb|BX023312.1|CNS08Q5G Single read from an extremity of a full-... 80 8e-12
388emb|BX023307.1|CNS08Q5B Single read from an extremity of a full-... 80 8e-12
389emb|BX022961.1|CNS08PVP Single read from an extremity of a full-... 80 8e-12
390emb|BX021665.1|CNS08OVP Single read from an extremity of a full-... 80 8e-12
391emb|BX021215.1|CNS08OJ7 Single read from an extremity of a full-... 80 8e-12
392emb|BX021147.1|CNS08OHB Single read from an extremity of a full-... 80 8e-12
393emb|BX020311.1|CNS08NU3 Single read from an extremity of a full-... 80 8e-12
394emb|BX020007.1|CNS08NLN Single read from an extremity of a full-... 80 8e-12
395emb|BX019943.1|CNS08NJV Single read from an extremity of a full-... 80 8e-12
396emb|BX019836.1|CNS08NGW Single read from an extremity of a full-... 80 8e-12
397emb|BX019132.1|CNS08MXC Single read from an extremity of a full-... 80 8e-12
398emb|BX018448.1|CNS08MEC Single read from an extremity of a full-... 80 8e-12
399emb|BX018314.1|CNS08MAM Single read from an extremity of a full-... 80 8e-12
400emb|BX018304.1|CNS08MAC Single read from an extremity of a full-... 80 8e-12
401emb|BX017579.1|CNS08LQ7 Single read from an extremity of a full-... 80 8e-12
402emb|BX017500.1|CNS08LO0 Single read from an extremity of a full-... 80 8e-12
403emb|BX017446.1|CNS08LMI Single read from an extremity of a full-... 80 8e-12
404emb|BX017401.1|CNS08LL9 Single read from an extremity of a full-... 80 8e-12
405emb|BX016969.1|CNS08L99 Single read from an extremity of a full-... 80 8e-12
406emb|BX016747.1|CNS08L33 Single read from an extremity of a full-... 80 8e-12
407emb|BX014374.1|CNS08J96 Single read from an extremity of a full-... 80 8e-12
408emb|BX013765.1|CNS08IS9 Single read from an extremity of a full-... 80 8e-12
409emb|BX013655.1|CNS08IP7 Single read from an extremity of a full-... 80 8e-12
410emb|BX013483.1|CNS08IKF Single read from an extremity of a full-... 80 8e-12
411emb|BX013471.1|CNS08IK3 Single read from an extremity of a full-... 80 8e-12
412emb|BX013312.1|CNS08IFO Single read from an extremity of a full-... 80 8e-12
413emb|BX012758.1|CNS08I0A Single read from an extremity of a full-... 80 8e-12
414emb|BX012434.1|CNS08HRA Single read from an extremity of a full-... 80 8e-12
415emb|BX012112.1|CNS08HIC Single read from an extremity of a full-... 80 8e-12
416emb|BX012045.1|CNS08HGH Single read from an extremity of a full-... 80 8e-12
417emb|BX011732.1|CNS08H7S Single read from an extremity of a full-... 80 8e-12
418emb|BX011651.1|CNS08H5J Single read from an extremity of a full-... 80 8e-12
419emb|BX011276.1|CNS08GV4 Single read from an extremity of a full-... 80 8e-12
420emb|BX010219.1|CNS08G1R Single read from an extremity of a full-... 80 8e-12
421emb|BX009683.1|CNS08FMV Single read from an extremity of a full-... 80 8e-12
422emb|BX009634.1|CNS08FLI Single read from an extremity of a full-... 80 8e-12
423emb|BX008574.1|CNS08ES2 Single read from an extremity of a full-... 80 8e-12
424emb|BX008539.1|CNS08ER3 Single read from an extremity of a full-... 80 8e-12
425emb|BX007834.1|CNS08E7I Single read from an extremity of a full-... 80 8e-12
426emb|BX006486.1|CNS08D62 Single read from an extremity of a full-... 80 8e-12
427emb|BX006484.1|CNS08D60 Single read from an extremity of a full-... 80 8e-12
428emb|BX005659.1|CNS08CJ3 Single read from an extremity of a full-... 80 8e-12
429gb|DQ214648.1| Taeniopygia guttata clone 0061P0010D11 ribosomal ... 78 3e-11
430gb|DQ214647.1| Taeniopygia guttata clone 0058P0031F07 ribosomal ... 78 3e-11
431gb|DQ214646.1| Taeniopygia guttata clone 0061P0002D05 ribosomal ... 78 3e-11
432gb|DQ214645.1| Taeniopygia guttata clone 0058P0024B05 ribosomal ... 78 3e-11
433emb|BX071404.1|CNS09R9C Single read from an extremity of a full-... 78 3e-11
434emb|BX070556.1|CNS09QLS Single read from an extremity of a full-... 78 3e-11
435emb|BX070162.1|CNS09QAU Single read from an extremity of a full-... 78 3e-11
436emb|BX069949.1|CNS09Q4X Single read from an extremity of a full-... 78 3e-11
437emb|BX068964.1|CNS09PDK Single read from an extremity of a full-... 78 3e-11
438emb|BX067910.1|CNS09OKA Single read from an extremity of a full-... 78 3e-11
439emb|BX067461.1|CNS09O7T Single read from an extremity of a full-... 78 3e-11
440emb|BX067208.1|CNS09O0S Single read from an extremity of a full-... 78 3e-11
441emb|BX066795.1|CNS09NPB Single read from an extremity of a full-... 78 3e-11
442emb|BX066471.1|CNS09NGB Single read from an extremity of a full-... 78 3e-11
443emb|BX065197.1|CNS09MGX Single read from an extremity of a full-... 78 3e-11
444emb|BX064963.1|CNS09MAF Single read from an extremity of a full-... 78 3e-11
445emb|BX064920.1|CNS09M98 Single read from an extremity of a full-... 78 3e-11
446emb|BX064215.1|CNS09LPN Single read from an extremity of a full-... 78 3e-11
447emb|BX064055.1|CNS09LL7 Single read from an extremity of a full-... 78 3e-11
448emb|BX061621.1|CNS09JPL Single read from an extremity of a full-... 78 3e-11
449emb|BX061593.1|CNS09JOT Single read from an extremity of a full-... 78 3e-11
450emb|BX060376.1|CNS09IR0 Single read from an extremity of a full-... 78 3e-11
451emb|BX058712.1|CNS09HGS Single read from an extremity of a full-... 78 3e-11
452emb|BX058104.1|CNS09GZW Single read from an extremity of a full-... 78 3e-11
453emb|BX057999.1|CNS09GWZ Single read from an extremity of a full-... 78 3e-11
454emb|BX057678.1|CNS09GO2 Single read from an extremity of a full-... 78 3e-11
455emb|BX056231.1|CNS09FJV Single read from an extremity of a full-... 78 3e-11
456emb|BX055193.1|CNS09ER1 Single read from an extremity of a full-... 78 3e-11
457emb|BX053926.1|CNS09DRU Single read from an extremity of a full-... 78 3e-11
458emb|BX053868.1|CNS09DQ8 Single read from an extremity of a full-... 78 3e-11
459emb|BX052205.1|CNS09CG1 Single read from an extremity of a full-... 78 3e-11
460emb|BX052102.1|CNS09CD6 Single read from an extremity of a full-... 78 3e-11
461emb|BX050347.1|CNS09B0F Single read from an extremity of a full-... 78 3e-11
462emb|BX049083.1|CNS09A1B Single read from an extremity of a full-... 78 3e-11
463emb|BX048582.1|CNS099NE Single read from an extremity of a full-... 78 3e-11
464emb|BX047720.1|CNS098ZG Single read from an extremity of a full-... 78 3e-11
465emb|BX047705.1|CNS098Z1 Single read from an extremity of a full-... 78 3e-11
466emb|BX045065.1|CNS096XP Single read from an extremity of a full-... 78 3e-11
467emb|BX045180.1|CNS0970W Single read from an extremity of a full-... 78 3e-11
468emb|BX044918.1|CNS096TM Single read from an extremity of a full-... 78 3e-11
469emb|BX044073.1|CNS09665 Single read from an extremity of a full-... 78 3e-11
470emb|BX044071.1|CNS09663 Single read from an extremity of a full-... 78 3e-11
471emb|BX042259.1|CNS094RR Single read from an extremity of a full-... 78 3e-11
472emb|BX041750.1|CNS094DM Single read from an extremity of a full-... 78 3e-11
473emb|BX041416.1|CNS0944C Single read from an extremity of a full-... 78 3e-11
474emb|BX040081.1|CNS09339 Single read from an extremity of a full-... 78 3e-11
475emb|BX039998.1|CNS0930Y Single read from an extremity of a full-... 78 3e-11
476emb|BX039889.1|CNS092XX Single read from an extremity of a full-... 78 3e-11
477emb|BX039706.1|CNS092SU Single read from an extremity of a full-... 78 3e-11
478emb|BX030550.1|CNS08VQI Single read from an extremity of a full-... 78 3e-11
479emb|BX028322.1|CNS08U0M Single read from an extremity of a full-... 78 3e-11
480emb|BX027306.1|CNS08T8E Single read from an extremity of a full-... 78 3e-11
481emb|BX025113.1|CNS08RJH Single read from an extremity of a full-... 78 3e-11
482emb|BX023308.1|CNS08Q5C Single read from an extremity of a full-... 78 3e-11
483emb|BX020008.1|CNS08NLO Single read from an extremity of a full-... 78 3e-11
484emb|BX019837.1|CNS08NGX Single read from an extremity of a full-... 78 3e-11
485emb|BX018937.1|CNS08MRX Single read from an extremity of a full-... 78 3e-11
486emb|BX018449.1|CNS08MED Single read from an extremity of a full-... 78 3e-11
487emb|BX013484.1|CNS08IKG Single read from an extremity of a full-... 78 3e-11
488emb|BX009635.1|CNS08FLJ Single read from an extremity of a full-... 78 3e-11
489emb|BX008540.1|CNS08ER4 Single read from an extremity of a full-... 78 3e-11
490emb|BX006778.1|CNS08DE6 Single read from an extremity of a full-... 78 3e-11
491dbj|AK146165.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 78 3e-11
492emb|BX071304.1|CNS09R6K Single read from an extremity of a full-... 76 1e-10
493emb|BX069576.1|CNS09PUK Single read from an extremity of a full-... 76 1e-10
494emb|BX068647.1|CNS09P4R Single read from an extremity of a full-... 76 1e-10
495emb|BX068028.1|CNS09ONK Single read from an extremity of a full-... 76 1e-10
496emb|BX065504.1|CNS09MPG Single read from an extremity of a full-... 76 1e-10
497emb|BX065257.1|CNS09MIL Single read from an extremity of a full-... 76 1e-10
498emb|BX060234.1|CNS09IN2 Single read from an extremity of a full-... 76 1e-10
499emb|BX059019.1|CNS09HPB Single read from an extremity of a full-... 76 1e-10
500emb|BX058109.1|CNS09H01 Single read from an extremity of a full-... 76 1e-10

>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  803 bits (405), Expect = 0.0
 Identities = 483/509 (94%)
 Strand = Plus / Plus

                                                                       
Query: 6   cctctgcgcacgaaacccgagccgtcccctcacagctcgccgcgaacgcagcgagctctt 65
           ||||||| ||| |||||| ||||||| ||||||||||||||||  |||||||||||||| 
Sbjct: 11  cctctgcccacaaaaccctagccgtcgcctcacagctcgccgccgacgcagcgagctctc 70

                                                                       
Query: 66  cgtccaccgcaccaacgatggccacccagatcagcaagaagaagaagtttgtgagcgatg 125
           | ||||||||  |||| ||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 71  cctccaccgccgcaaccatggcgacccagatcagcaagaagaagaagtttgtgagcgatg 130

                                                                       
Query: 126 gcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggctact 185
           ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||
Sbjct: 131 gcgttttctacgccgagctgaacgagatgctgacccgggagcttgccgaggacggctact 190

                                                                       
Query: 186 ccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcgga 245
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 191 ccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcgga 250

                                                                       
Query: 246 cgcagaacgtgcttggcgagaagggccgcaggatcagggagctcacatccgtcgttcaga 305
           |||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||
Sbjct: 251 cgcagaacgtgcttggtgagaagggccgcaggatcagggagctcacctccgtcgtccaga 310

                                                                       
Query: 306 agcgcttcaatttcccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtg 365
           |||||||||| |||| ||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 311 agcgcttcaacttcctggagaacggcgttgagctttacgccgagaaggtcgtcaaccgtg 370

                                                                       
Query: 366 gcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctg 425
           |||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||| |
Sbjct: 371 gcctctgcgccatcgcccaggccgagtcactccgctacaagctcctcggaggccttgccg 430

                                                                       
Query: 426 tccgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtg 485
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 431 tccgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtg 490

                                        
Query: 486 aggtcattgtgagtggcaagcttagggcc 514
           |||||||||||||||||||||| ||||||
Sbjct: 491 aggtcattgtgagtggcaagctcagggcc 519



to top

>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  611 bits (308), Expect = e-171
 Identities = 401/432 (92%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 114 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 173

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 174 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 233

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 234 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 293

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 294 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 353

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 413

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| ||||| |||||||| ||||||||||| || ||||||||||||||||||
Sbjct: 414 caggccgagtccctccgctacaagcttcttggaggcctcgccgtccgcagggcttgctat 473

                                                                       
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggc 502
           |||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 474 ggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggtcattgtaagtgga 533

                       
Query: 503 aagcttagggcc 514
           ||||| ||||||
Sbjct: 534 aagctcagggcc 545



to top

>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  611 bits (308), Expect = e-171
 Identities = 401/432 (92%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 124 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 183

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 184 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 243

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 244 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 303

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 304 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 363

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 364 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 423

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| ||||| |||||||| ||||||||||| || ||||||||||||||||||
Sbjct: 424 caggccgagtccctccgctacaagcttcttggaggcctcgccgtccgcagggcttgctat 483

                                                                       
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggc 502
           |||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 484 ggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggtcattgtaagtgga 543

                       
Query: 503 aagcttagggcc 514
           ||||| ||||||
Sbjct: 544 aagctcagggcc 555



to top

>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  611 bits (308), Expect = e-171
 Identities = 401/432 (92%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 126 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 185

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 186 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 245

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 246 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 305

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 306 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 365

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 366 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 425

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| ||||| |||||||| ||||||||||| || ||||||||||||||||||
Sbjct: 426 caggccgagtccctccgctacaagcttcttggaggcctcgccgtccgcagggcttgctat 485

                                                                       
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggc 502
           |||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| 
Sbjct: 486 ggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggtcattgtaagtgga 545

                       
Query: 503 aagcttagggcc 514
           ||||| ||||||
Sbjct: 546 aagctcagggcc 557



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  442 bits (223), Expect = e-121
 Identities = 298/323 (92%)
 Strand = Plus / Minus

                                                                            
Query: 111      agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 170
                |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 20907649 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 20907590

                                                                            
Query: 171      cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 230
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20907589 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 20907530

                                                                            
Query: 231      tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 290
                || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 20907529 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 20907470

                                                                            
Query: 291      catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 350
                | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 20907469 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 20907410

                                                                            
Query: 351      aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 410
                ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 20907409 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 20907350

                                       
Query: 411      ttggaggccttgctgtccgcagg 433
                |||||||||| || |||||||||
Sbjct: 20907349 ttggaggcctcgccgtccgcagg 20907327



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                            
Query: 430      cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
                ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 20906255 cagggcttgctatggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggt 20906196



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 83       atggccacccagatcagcaagaagaagaag 112
                ||||| ||||||||||||||||||||||||
Sbjct: 20907755 atggcgacccagatcagcaagaagaagaag 20907726



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  442 bits (223), Expect = e-121
 Identities = 298/323 (92%)
 Strand = Plus / Minus

                                                                            
Query: 111      agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 170
                |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 20900678 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 20900619

                                                                            
Query: 171      cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 230
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20900618 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 20900559

                                                                            
Query: 231      tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 290
                || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 20900558 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 20900499

                                                                            
Query: 291      catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 350
                | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 20900498 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 20900439

                                                                            
Query: 351      aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 410
                ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 20900438 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 20900379

                                       
Query: 411      ttggaggccttgctgtccgcagg 433
                |||||||||| || |||||||||
Sbjct: 20900378 ttggaggcctcgccgtccgcagg 20900356



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                            
Query: 430      cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
                ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 20899284 cagggcttgctatggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggt 20899225



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 83       atggccacccagatcagcaagaagaagaag 112
                ||||| ||||||||||||||||||||||||
Sbjct: 20900784 atggcgacccagatcagcaagaagaagaag 20900755



to top

>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  442 bits (223), Expect = e-121
 Identities = 298/323 (92%)
 Strand = Plus / Plus

                                                                         
Query: 111   agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 170
             |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 15274 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 15333

                                                                         
Query: 171   cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 230
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15334 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 15393

                                                                         
Query: 231   tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 290
             || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 15394 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 15453

                                                                         
Query: 291   catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 350
             | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 15454 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 15513

                                                                         
Query: 351   aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 410
             ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 15514 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 15573

                                    
Query: 411   ttggaggccttgctgtccgcagg 433
             |||||||||| || |||||||||
Sbjct: 15574 ttggaggcctcgccgtccgcagg 15596



 Score =  103 bits (52), Expect = 6e-19
 Identities = 58/60 (96%)
 Strand = Plus / Plus

                                                                         
Query: 430   cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 16668 cagggcttgctatggtgttcttcgctttgttatggagagtggtgccaagggttgcgaggt 16727



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 83    atggccacccagatcagcaagaagaagaag 112
             ||||| ||||||||||||||||||||||||
Sbjct: 15168 atggcgacccagatcagcaagaagaagaag 15197



to top

>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score =  337 bits (170), Expect = 2e-89
 Identities = 359/422 (85%)
 Strand = Plus / Plus

                                                                       
Query: 92  cagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgag 151
           |||||||||||||||   ||||| |||   ||||| || |||| ||| ||||||||||||
Sbjct: 98  cagatcagcaagaagcgcaagttcgtggcggatggggtgttcttcgcggagctgaacgag 157

                                                                       
Query: 152 atgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccg 211
           |||||||| || ||||||||||||||||||||||||||||| ||||| ||||| || || 
Sbjct: 158 atgctgacgcgcgagctcgcggaggacggctactccggcgtcgaggtccgcgtcaccccc 217

                                                                       
Query: 212 atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggc 271
           |||||||| |||||||||||| | ||||| || || |||||||| || ||||||||||| 
Sbjct: 218 atgcgcaccgagatcatcatccgcgccacccgcacccagaacgtcctcggcgagaagggg 277

                                                                       
Query: 272 cgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggc 331
            | |||||| | ||||| || ||||| || |||||||| ||||| ||||||||||| |||
Sbjct: 278 aggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttcccggagaatggc 337

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           || || || || |||||||||||   |||||| ||||||||||||||||||||||| |||
Sbjct: 338 gtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatcgcccaggccgag 397

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           || ||||| ||||||||||| || ||||| || ||| | ||||| ||||||||||| || 
Sbjct: 398 tcgctccgctacaagctcctcggtggcctcgccgtcagaagggcgtgctatggtgtgctc 457

                                                                       
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagcttagg 511
            | |||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||
Sbjct: 458 aggtttgttatggagagtggtgctaagggctgtgaggttattgtgagtgggaagcttagg 517

             
Query: 512 gc 513
           ||
Sbjct: 518 gc 519



to top

>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score =  337 bits (170), Expect = 2e-89
 Identities = 359/422 (85%)
 Strand = Plus / Plus

                                                                       
Query: 92  cagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgag 151
           |||||||||||||||   ||||| |||   ||||| || |||| ||| ||||||||||||
Sbjct: 98  cagatcagcaagaagcgcaagttcgtggcggatggggtgttcttcgcggagctgaacgag 157

                                                                       
Query: 152 atgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccg 211
           |||||||| || ||||||||||||||||||||||||||||| ||||| ||||| || || 
Sbjct: 158 atgctgacgcgcgagctcgcggaggacggctactccggcgtcgaggtccgcgtcaccccc 217

                                                                       
Query: 212 atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggc 271
           |||||||| |||||||||||| | ||||| || || |||||||| || ||||||||||| 
Sbjct: 218 atgcgcaccgagatcatcatccgcgccacccgcacccagaacgtcctcggcgagaagggg 277

                                                                       
Query: 272 cgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggc 331
            | |||||| | ||||| || ||||| || |||||||| ||||| ||||||||||| |||
Sbjct: 278 aggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttcccggagaatggc 337

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           || || || || |||||||||||   |||||| ||||||||||||||||||||||| |||
Sbjct: 338 gtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatcgcccaggccgag 397

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           || ||||| ||||||||||| || ||||| || ||| | ||||| ||||||||||| || 
Sbjct: 398 tcgctccgctacaagctcctcggtggcctcgccgtcagaagggcgtgctatggtgtgctc 457

                                                                       
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagcttagg 511
            | |||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||
Sbjct: 458 aggtttgttatggagagtggtgctaagggctgtgaggttattgtgagtgggaagcttagg 517

             
Query: 512 gc 513
           ||
Sbjct: 518 gc 519



to top

>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score =  307 bits (155), Expect = 2e-80
 Identities = 353/419 (84%)
 Strand = Plus / Plus

                                                                       
Query: 95  atcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatg 154
           ||||||||||||  |||||| |||   |||||||| |||| ||| |||||||| ||||||
Sbjct: 66  atcagcaagaagcggaagttcgtggcggatggcgtgttcttcgcggagctgaatgagatg 125

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           |||||||| |||||||||||||| |||||||||||||| ||||| ||||| || || |||
Sbjct: 126 ctgacccgcgagctcgcggaggatggctactccggcgtcgaggtccgcgtcacccccatg 185

                                                                       
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgc 274
           ||||| |||||||||||| | ||||| || || |||||||| || |||||||||||||| 
Sbjct: 186 cgcaccgagatcatcatccgtgccacccgcactcagaacgttctcggcgagaagggccgg 245

                                                                       
Query: 275 aggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgtt 334
           |||||||||||||| || || || ||||||||||||||||| |||||||||   || |||
Sbjct: 246 aggatcagggagctgacttctgtggttcagaagcgcttcaacttcccggagggtggtgtt 305

                                                                       
Query: 335 gaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtca 394
           || || || || ||||||||   ||||||||||||||||||||| |||||||| ||||| 
Sbjct: 306 gagctctacgcagagaaggtgaacaaccgtggcctctgcgccattgcccaggccgagtcg 365

                                                                       
Query: 395 ctccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgc 454
           || || |||||||| ||||| || || || ||  | ||||| || |||||||||||  | 
Sbjct: 366 ctacgctacaagcttcttggtggactagccgtgagaagggcatgttatggtgttctcagg 425

                                                                      
Query: 455 tttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagcttagggc 513
           ||||| |||||||||||||||||||| |||||||| ||||| ||||| ||||| |||||
Sbjct: 426 tttgtcatggagagtggtgctaagggctgtgaggttattgtaagtggtaagctcagggc 484



to top

>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  252 bits (127), Expect = 1e-63
 Identities = 198/222 (89%)
 Strand = Plus / Plus

                                                                       
Query: 293 tccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgagaag 352
           |||||||| |||||| | ||||  ||||| ||||| ||||| || ||||| |||||||||
Sbjct: 22  tccgtcgtccagaagaggttcancttccctgagaatggcgtcgagctttacgccgagaag 81

                                                                       
Query: 353 gtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcctt 412
           |||||||||||||| ||||| |||||||| ||||| ||||| ||||| ||||||||||| 
Sbjct: 82  gtcgtcaaccgtgggctctgtgccatcgcgcaggccgagtccctccgttacaagctcctc 141

                                                                       
Query: 413 ggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgttatggagagtggt 472
           ||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 142 ggaggccttgccgtccgcagggcttgctatggtgttcttcgttatgttatggagagtggt 201

                                                     
Query: 473 gctaagggttgtgaggtcattgtgagtggcaagcttagggcc 514
           || |||||||||||||| ||||||||||| ||||| ||||||
Sbjct: 202 gccaagggttgtgaggtgattgtgagtggaaagctcagggcc 243



to top

>gb|AY130450.1| Petromyzon marinus ribosomal protein S3 mRNA, partial cds
          Length = 617

 Score =  202 bits (102), Expect = 8e-49
 Identities = 318/390 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 caagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgac 159
           |||||||||||||||||||  |||||| || ||| | |||||| |||||||| | |||||
Sbjct: 18  caagaagaagaagtttgtggccgatggagtcttcaaggccgagatgaacgagttcctgac 77

                                                                       
Query: 160 ccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcac 219
            ||||| ||||| || || ||||||  |||||||||||||||||| |||||||  |||||
Sbjct: 78  tcgggaactcgctgaagatggctacagcggcgtggaggtgcgcgtcacgccgacccgcac 137

                                                                       
Query: 220 ggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggat 279
           |||||||||||||   |||||  |||| ||||| ||||| || |||||||| ||  | ||
Sbjct: 138 ggagatcatcatcctcgccaccaggacccagaatgtgctgggagagaagggacgtcgcat 197

                                                                       
Query: 280 cagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaact 339
           | | |||||||| |||||| | |||||||| ||||| ||||| |||  | ||||||| ||
Sbjct: 198 ccgcgagctcacgtccgtcatccagaagcgattcaacttccctgagggcagcgttgagct 257

                                                                       
Query: 340 ttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccg 399
            || || |||||||| |  ||||||||||| |||||||||||||||   ||||| || ||
Sbjct: 258 gtacgcggagaaggtggcgaaccgtggcctatgcgccatcgcccagtgcgagtcgctgcg 317

                                                                       
Query: 400 atacaagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgt 459
            |||||||| || ||||| || |||||||||||||| |||||||| || || |||||  |
Sbjct: 318 ctacaagctgctcggagggctcgctgtccgcagggcgtgctatggcgtgctgcgcttcat 377

                                         
Query: 460 tatggagagtggtgctaagggttgtgaggt 489
            |||||||| ||||| ||||| || |||||
Sbjct: 378 catggagagcggtgccaagggctgcgaggt 407



to top

>gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mRNA, complete cds
          Length = 886

 Score =  194 bits (98), Expect = 2e-46
 Identities = 329/406 (81%)
 Strand = Plus / Plus

                                                                       
Query: 91  ccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacga 150
           ||||||||||||||||  |||||| ||    || ||||| ||||||||||||||||||||
Sbjct: 24  ccagatcagcaagaagcggaagttcgtcgcggacggcgtgttctacgccgagctgaacga 83

                                                                       
Query: 151 gatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgcc 210
           | | |||||||| ||||| || ||||| ||||||||||| |||||||| |||||||| ||
Sbjct: 84  gctcctgacccgcgagctggccgaggatggctactccggtgtggaggtccgcgtgacccc 143

                                                                       
Query: 211 gatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
            |||||||| ||||| |||||| | || || || || ||||||||||| |||||||||||
Sbjct: 144 catgcgcactgagattatcatccgcgctacccgcacccagaacgtgctgggcgagaaggg 203

                                                                       
Query: 271 ccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacgg 330
           |||| | ||  | ||||| || || || || |||||||||||||| |||||     || |
Sbjct: 204 ccgccgcattcgcgagctgacctcggttgtgcagaagcgcttcaacttcccccctgacag 263

                                                                       
Query: 331 cgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcaga 390
           |||||| || || || |||||||||  | |||| || || ||||||||||||||||| ||
Sbjct: 264 cgttgagctgtacgctgagaaggtcagcgaccgcggtctgtgcgccatcgcccaggccga 323

                                                                       
Query: 391 gtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttct 450
           ||| || || |||||||| || || ||||| ||||| ||| | || ||||| ||||| ||
Sbjct: 324 gtcgctgcgctacaagctgctgggtggcctggctgtgcgccgtgcctgctacggtgtgct 383

                                                         
Query: 451 tcgctttgttatggagagtggtgctaagggttgtgaggtcattgtg 496
            ||||| || |||||||| || || ||||| || ||||||||||||
Sbjct: 384 gcgcttcgtgatggagagcggcgccaagggctgcgaggtcattgtg 429



to top

>dbj|AB246886.1| Lethenteron japonicum RPS3 mRNA for ribosomal protein S3, partial
           cds
          Length = 726

 Score =  186 bits (94), Expect = 5e-44
 Identities = 316/390 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 caagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgac 159
           |||||||||||||||||||  |||||| || ||| | |||||| |||||||| | |||||
Sbjct: 24  caagaagaagaagtttgtggccgatggagtcttcaaggccgagatgaacgagttcctgac 83

                                                                       
Query: 160 ccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcac 219
            ||||| ||||| || || ||||||  |||||||||||||||||| |||||||  |||||
Sbjct: 84  tcgggaactcgccgaagatggctacagcggcgtggaggtgcgcgtcacgccgacccgcac 143

                                                                       
Query: 220 ggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggat 279
           |||||||||||||   |||||  |||| ||||||||||| || |||||||| ||  | ||
Sbjct: 144 ggagatcatcatcctcgccaccaggacccagaacgtgctgggagagaagggacgtcgcat 203

                                                                       
Query: 280 cagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaact 339
           | | |||||||| |||||| | |||||||| ||||| ||||| |||  | ||||||| ||
Sbjct: 204 ccgcgagctcacgtccgtcatccagaagcgattcaacttccctgagggcagcgttgagct 263

                                                                       
Query: 340 ttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccg 399
            || || |||||||| |  ||||||||||| ||||||||||| |||   ||||| || ||
Sbjct: 264 gtacgcggagaaggtggcgaaccgtggcctgtgcgccatcgctcagtgcgagtcgctgcg 323

                                                                       
Query: 400 atacaagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgt 459
            |||||||| || ||||| || || ||||||||||| ||||| || || || |||||  |
Sbjct: 324 ctacaagctgctgggagggctcgccgtccgcagggcgtgctacggcgtgctgcgcttcat 383

                                         
Query: 460 tatggagagtggtgctaagggttgtgaggt 489
            |||||||| ||||| ||||| || |||||
Sbjct: 384 catggagagcggtgccaagggctgcgaggt 413



to top

>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score =  159 bits (80), Expect = 1e-35
 Identities = 233/284 (82%)
 Strand = Plus / Plus

                                                                       
Query: 224 atcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagg 283
           |||||||| || ||||| || || |||||||| ||||| ||||| ||  | |||||||||
Sbjct: 178 atcatcattagagccactcgtactcagaacgttcttggtgagaaaggtaggaggatcagg 237

                                                                       
Query: 284 gagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttat 343
           ||||| || || || ||||||||||| || ||||||  ||| ||| | ||||| || |||
Sbjct: 238 gagctgacttcagttgttcagaagcgttttaatttcaaggaaaacagtgttgagctctat 297

                                                                       
Query: 344 gccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatac 403
           || ||||| |||  |||  | || ||||| ||||| || |||||||||||||| ||||||
Sbjct: 298 gcagagaaagtcaacaataggggtctctgtgccattgctcaggcagagtcactgcgatac 357

                                                                       
Query: 404 aagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgttatg 463
           ||| | |||||||| ||||||||||| ||||||||||||||||||||  | ||||| |||
Sbjct: 358 aagttacttggaggacttgctgtccgaagggcttgctatggtgttctgagatttgtaatg 417

                                                       
Query: 464 gagagtggtgctaagggttgtgaggtcattgtgagtggcaagct 507
           |||||||| || ||||| || ||||| ||||| ||||| |||||
Sbjct: 418 gagagtggagccaagggatgcgaggtgattgttagtggaaagct 461



to top

>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score =  151 bits (76), Expect = 3e-33
 Identities = 232/284 (81%)
 Strand = Plus / Plus

                                                                       
Query: 224 atcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagg 283
           |||||||| || ||||| || || |||||||| ||||| ||||| ||  | |||||||||
Sbjct: 228 atcatcattagagccactcgtactcagaacgttcttggtgagaaaggtaggaggatcagg 287

                                                                       
Query: 284 gagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttat 343
           ||||| || || || ||||||||||| || ||||||  ||| |||   ||||| || |||
Sbjct: 288 gagctgacttcagttgttcagaagcgttttaatttcaaggaaaacactgttgagctctat 347

                                                                       
Query: 344 gccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatac 403
           || ||||| |||  |||  | || ||||| ||||| || |||||||||||||| ||||||
Sbjct: 348 gctgagaaagtcaacaataggggtctctgtgccattgctcaggcagagtcactgcgatac 407

                                                                       
Query: 404 aagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgttatg 463
           ||| | |||||||| ||||||||||| ||||||||||||||||||||  | ||||| |||
Sbjct: 408 aagttacttggaggacttgctgtccgaagggcttgctatggtgttctgagatttgtaatg 467

                                                       
Query: 464 gagagtggtgctaagggttgtgaggtcattgtgagtggcaagct 507
           |||||||| || ||||| || ||||| ||||| ||||| |||||
Sbjct: 468 gagagtggagccaagggatgcgaggtgattgttagtggaaagct 511



to top

>gb|DQ448864.1| Theobroma cacao 40S ribosomal protein S3 mRNA, partial cds
          Length = 257

 Score =  133 bits (67), Expect = 6e-28
 Identities = 169/203 (83%)
 Strand = Plus / Plus

                                                                       
Query: 299 gttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgagaaggtcgtc 358
           |||||||| || ||||| || || |||||| | || ||||| ||||| ||||||||   |
Sbjct: 46  gttcagaaacggttcaagtttccagagaacagtgtagaactctatgctgagaaggttaac 105

                                                                       
Query: 359 aaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggc 418
           ||| | || || || ||||| || ||||||||||| || || ||||||||||||||||||
Sbjct: 106 aacaggggtctttgtgccattgctcaggcagagtccctgcgttacaagctccttggaggc 165

                                                                       
Query: 419 cttgctgtccgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaag 478
           |||||||| || ||||||||||||||||||||  | ||| | ||||||||||| || |||
Sbjct: 166 cttgctgttcggagggcttgctatggtgttctcagatttatcatggagagtggggccaag 225

                                  
Query: 479 ggttgtgaggtcattgtgagtgg 501
           || ||||||||||| ||||||||
Sbjct: 226 ggatgtgaggtcatggtgagtgg 248



to top

>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                          
Query: 122    gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 181
              ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 121244 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 121303

                                                                          
Query: 182    tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 241
              ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 121304 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 121363

                            
Query: 242    cggacgcagaacgt 255
              || || ||||||||
Sbjct: 121364 cgcacccagaacgt 121377



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Plus

                                                                          
Query: 260    ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 319
              |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 121485 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 121544

                                                                          
Query: 320    ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 379
              |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 121545 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 121604

                                                       
Query: 380    gcccaggcagagtcactccgatacaagctccttggaggcct 420
              |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 121605 gcccaggccgagtcgctccgctacaagctcctcggtggcct 121645



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                          
Query: 430    cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
              |||||| ||||||||||| ||  | |||||||||||||||||||||||||| ||||||||
Sbjct: 122457 cagggcgtgctatggtgtgctcaggtttgttatggagagtggtgctaagggctgtgaggt 122516



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 486    aggtcattgtgagtggcaagcttagggc 513
              |||| ||||||||||| |||||||||||
Sbjct: 122599 aggttattgtgagtgggaagcttagggc 122626



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                            
Query: 122      gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 181
                ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 24967909 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 24967850

                                                                            
Query: 182      tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 241
                ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 24967849 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 24967790

                              
Query: 242      cggacgcagaacgt 255
                || || ||||||||
Sbjct: 24967789 cgcacccagaacgt 24967776



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                            
Query: 260      ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 319
                |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 24967668 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 24967609

                                                                            
Query: 320      ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 379
                |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 24967608 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 24967549

                                                         
Query: 380      gcccaggcagagtcactccgatacaagctccttggaggcct 420
                |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 24967548 gcccaggccgagtcgctccgctacaagctcctcggtggcct 24967508



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                            
Query: 430      cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
                |||||| ||||||||||| ||  | |||||||||||||||||||||||||| ||||||||
Sbjct: 24966696 cagggcgtgctatggtgtgctcaggtttgttatggagagtggtgctaagggctgtgaggt 24966637



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 486      aggtcattgtgagtggcaagcttagggc 513
                |||| ||||||||||| |||||||||||
Sbjct: 24966554 aggttattgtgagtgggaagcttagggc 24966527



to top

>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                          
Query: 122    gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 181
              ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 151541 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 151482

                                                                          
Query: 182    tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 241
              ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 151481 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 151422

                            
Query: 242    cggacgcagaacgt 255
              || || ||||||||
Sbjct: 151421 cgcacccagaacgt 151408



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                          
Query: 260    ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 319
              |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 151300 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 151241

                                                                          
Query: 320    ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 379
              |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 151240 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 151181

                                                       
Query: 380    gcccaggcagagtcactccgatacaagctccttggaggcct 420
              |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 151180 gcccaggccgagtcgctccgctacaagctcctcggtggcct 151140



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                          
Query: 430    cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
              |||||| ||||||||||| ||  | |||||||||||||||||||||||||| ||||||||
Sbjct: 150328 cagggcgtgctatggtgtgctcaggtttgttatggagagtggtgctaagggctgtgaggt 150269



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 486    aggtcattgtgagtggcaagcttagggc 513
              |||| ||||||||||| |||||||||||
Sbjct: 150186 aggttattgtgagtgggaagcttagggc 150159



to top

>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                        
Query: 122  gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 181
            ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 8589 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 8530

                                                                        
Query: 182  tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 241
            ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 8529 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 8470

                          
Query: 242  cggacgcagaacgt 255
            || || ||||||||
Sbjct: 8469 cgcacccagaacgt 8456



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                        
Query: 260  ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 319
            |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 8348 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 8289

                                                                        
Query: 320  ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 379
            |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 8288 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 8229

                                                     
Query: 380  gcccaggcagagtcactccgatacaagctccttggaggcct 420
            |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 8228 gcccaggccgagtcgctccgctacaagctcctcggtggcct 8188



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                        
Query: 430  cagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
            |||||| ||||||||||| ||  | |||||||||||||||||||||||||| ||||||||
Sbjct: 7376 cagggcgtgctatggtgtgctcaggtttgttatggagagtggtgctaagggctgtgaggt 7317



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 486  aggtcattgtgagtggcaagcttagggc 513
            |||| ||||||||||| |||||||||||
Sbjct: 7234 aggttattgtgagtgggaagcttagggc 7207



to top

>gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal protein S3 (RPS3) mRNA,
           complete cds
          Length = 804

 Score =  129 bits (65), Expect = 1e-26
 Identities = 281/353 (79%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||||||||||||| | ||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 66  gccgagctgaacgagttcctgactcgggagctggccgaggatggttactccggtgtggag 125

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           ||||| ||||| ||||   | || ||||||||||||  ||| ||  |||| |||| ||| 
Sbjct: 126 gtgcgagtgactccgaccaggaccgagatcatcatcctggctacaaggacccagagcgtc 185

                                                                       
Query: 257 cttggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaat 316
           || || |||||||| ||  ||||||| ||||| ||  | || || |||||| | |||   
Sbjct: 186 ctgggagagaaggggcgtcggatcagagagctgaccgctgtggtccagaagaggttcggc 245

                                                                       
Query: 317 ttcccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgcc 376
           ||||| |||  | |||| || || ||||| |||||||||| || ||||||  | || |||
Sbjct: 246 ttccctgagggcagcgtggagctgtatgctgagaaggtcgccacccgtggtttgtgtgcc 305

                                                                       
Query: 377 atcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggct 436
           ||||| ||||||||||| || || |||||||| || |||||||| ||||| || ||||| 
Sbjct: 306 atcgctcaggcagagtctctgcgctacaagctgctcggaggcctggctgttcgtagggcc 365

                                                                
Query: 437 tgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           ||||||||||||||  | ||  | |||||||| ||||||||||| ||||||||
Sbjct: 366 tgctatggtgttctgaggttcatcatggagagcggtgctaagggctgtgaggt 418



to top

>ref|NM_201153.1| Danio rerio ribosomal protein S3 (rps3), mRNA
          Length = 850

 Score =  129 bits (65), Expect = 1e-26
 Identities = 281/353 (79%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||||||||| ||| | |||||||| |||||||| ||||| || || ||||||||||||
Sbjct: 82  gccgagctgaatgagtttctgacccgagagctcgccgaggatggttattccggcgtggag 141

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || || || |   | || ||||||||||||  ||||||  |||| ||||| || 
Sbjct: 142 gtccgtgtcacaccaacaagaacagagatcatcatcctggccaccaggactcagaatgtt 201

                                                                       
Query: 257 cttggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaat 316
           || || ||||| |||||| | ||  | ||||| ||  | || ||||||||||| |||   
Sbjct: 202 ctgggagagaaaggccgccgcattcgtgagctgaccgctgtggttcagaagcgattcggc 261

                                                                       
Query: 317 ttcccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgcc 376
           ||||| |||  ||| ||||| || || || |||||||| |  | |||||| ||||| |||
Sbjct: 262 ttccctgagggcggtgttgagctgtacgctgagaaggttgcgacccgtggtctctgtgcc 321

                                                                       
Query: 377 atcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggct 436
           ||||| ||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 322 atcgctcaggcagagtctctgcgctacaagctgctcggaggactggctgtccgtagggcc 381

                                                                
Query: 437 tgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           ||||||||||| || |||||  |||||||||| || |||||||||||||||||
Sbjct: 382 tgctatggtgtgctgcgcttcattatggagagcggggctaagggttgtgaggt 434



to top

>gb|BC045902.1| Danio rerio ribosomal protein S3, mRNA (cDNA clone MGC:56088
           IMAGE:5410588), complete cds
          Length = 850

 Score =  129 bits (65), Expect = 1e-26
 Identities = 281/353 (79%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||||||||| ||| | |||||||| |||||||| ||||| || || ||||||||||||
Sbjct: 82  gccgagctgaatgagtttctgacccgagagctcgccgaggatggttattccggcgtggag 141

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || || || |   | || ||||||||||||  ||||||  |||| ||||| || 
Sbjct: 142 gtccgtgtcacaccaacaagaacagagatcatcatcctggccaccaggactcagaatgtt 201

                                                                       
Query: 257 cttggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaat 316
           || || ||||| |||||| | ||  | ||||| ||  | || ||||||||||| |||   
Sbjct: 202 ctgggagagaaaggccgccgcattcgtgagctgaccgctgtggttcagaagcgattcggc 261

                                                                       
Query: 317 ttcccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgcc 376
           ||||| |||  ||| ||||| || || || |||||||| |  | |||||| ||||| |||
Sbjct: 262 ttccctgagggcggtgttgagctgtacgctgagaaggttgcgacccgtggtctctgtgcc 321

                                                                       
Query: 377 atcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggct 436
           ||||| ||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 322 atcgctcaggcagagtctctgcgctacaagctgctcggaggactggctgtccgtagggcc 381

                                                                
Query: 437 tgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           ||||||||||| || |||||  |||||||||| || |||||||||||||||||
Sbjct: 382 tgctatggtgtgctgcgcttcattatggagagcggggctaagggttgtgaggt 434



to top

>gb|AY394937.1| Danio rerio clone RK045A1H03 ribosomal protein S3 mRNA, complete
           cds
          Length = 821

 Score =  121 bits (61), Expect = 2e-24
 Identities = 112/129 (86%)
 Strand = Plus / Plus

                                                                       
Query: 361 ccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggcct 420
           |||||| |||||||||||||| ||||||||||| || || |||||||| || ||||| ||
Sbjct: 280 ccgtggtctctgcgccatcgctcaggcagagtctctgcgctacaagctgctcggaggact 339

                                                                       
Query: 421 tgctgtccgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaaggg 480
            |||||||| ||||| ||||||||||| || |||||  |||||||||| || ||||||||
Sbjct: 340 ggctgtccgtagggcctgctatggtgtgctgcgcttcattatggagagcggggctaaggg 399

                    
Query: 481 ttgtgaggt 489
           |||||||||
Sbjct: 400 ttgtgaggt 408



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||||||||| ||| | |||||||| |||||||| ||||| || || ||||||||||||
Sbjct: 56  gccgagctgaatgagtttctgacccgagagctcgccgaggatggttattccggcgtggag 115

             
Query: 197 gt 198
           ||
Sbjct: 116 gt 117



to top

>gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal protein-like protein
           mRNA, complete cds
          Length = 968

 Score =  119 bits (60), Expect = 9e-24
 Identities = 201/248 (81%)
 Strand = Plus / Plus

                                                                       
Query: 224 atcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagg 283
           |||||||| || ||||| || || |||||||| ||||| ||||| ||  | |||||||||
Sbjct: 175 atcatcattagagccactcgtactcagaacgttcttggtgagaaaggtaggaggatcagg 234

                                                                       
Query: 284 gagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttat 343
             ||| || || || ||||||||||| || ||||||  ||| ||| | || || || |||
Sbjct: 235 tcgctgacttcagttgttcagaagcgttttaatttcaaggaaaacagtgtagagctctat 294

                                                                       
Query: 344 gccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatac 403
           || ||||| |||  |||  | || ||||| ||||| || |||||||||||||| ||||||
Sbjct: 295 gcagagaaagtcaacaataggggtctctgtgccattgctcaggcagagtcactgcgatac 354

                                                                       
Query: 404 aagctccttggaggccttgctgtccgcagggcttgctatggtgttcttcgctttgttatg 463
           ||| | |||||||| ||||||||||| ||||||||||||||||||||  | ||||| |||
Sbjct: 355 aagttacttggaggacttgctgtccgaagggcttgctatggtgttctgagatttgtaatg 414

                   
Query: 464 gagagtgg 471
           ||||||||
Sbjct: 415 gagagtgg 422



to top

>emb|BX824880.1|CNS0A5OP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZC06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Plus

                                                                       
Query: 333 ttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagt 392
           |||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| ||||
Sbjct: 284 ttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgagt 343

                                                                       
Query: 393 cactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttcttc 452
           |  | || |||||||| ||||| || || ||||| || |||||||||||||||||| |  
Sbjct: 344 ctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgttttga 403

                                                                   
Query: 453 gctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
           | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 404 ggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 459



to top

>ref|NM_115247.2| Arabidopsis thaliana nucleic acid binding / structural constituent
           of ribosome AT3G53870 mRNA, complete cds
          Length = 976

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           ||||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| |||
Sbjct: 303 gttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgag 362

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           ||  | || |||||||| ||||| || || ||||| || |||||||||||||||||  | 
Sbjct: 363 tctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgtgttg 422

                                                                    
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
            | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 423 aggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 479



to top

>gb|AY059090.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 781

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           ||||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| |||
Sbjct: 250 gttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgag 309

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           ||  | || |||||||| ||||| || || ||||| || |||||||||||||||||  | 
Sbjct: 310 tctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgtgttg 369

                                                                    
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
            | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 370 aggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 426



to top

>gb|AY035022.1| Arabidopsis thaliana putative ribosomal protein S3a homolog
           (At3g53870) mRNA, complete cds
          Length = 957

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           ||||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| |||
Sbjct: 303 gttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgag 362

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           ||  | || |||||||| ||||| || || ||||| || |||||||||||||||||  | 
Sbjct: 363 tctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgtgttg 422

                                                                    
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
            | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 423 aggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 479



to top

>gb|AF428405.1|AF428405 Arabidopsis thaliana AT3g53870/F5K20_170 mRNA, complete cds
          Length = 926

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           ||||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| |||
Sbjct: 303 gttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgag 362

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           ||  | || |||||||| ||||| || || ||||| || |||||||||||||||||  | 
Sbjct: 363 tctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgtgttg 422

                                                                    
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
            | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 423 aggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 479



to top

>gb|AY088808.1| Arabidopsis thaliana clone 9568 mRNA, complete sequence
          Length = 970

 Score =  105 bits (53), Expect = 1e-19
 Identities = 146/177 (82%)
 Strand = Plus / Plus

                                                                       
Query: 332 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 391
           ||||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| |||
Sbjct: 304 gttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgag 363

                                                                       
Query: 392 tcactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttctt 451
           ||  | || |||||||| ||||| || || ||||| || |||||||||||||||||  | 
Sbjct: 364 tctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgctatggtgtgttg 423

                                                                    
Query: 452 cgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
            | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 424 aggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 480



to top

>ref|NM_128718.3| Arabidopsis thaliana structural constituent of ribosome AT2G31610
           mRNA, complete cds
          Length = 1077

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 357 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 416

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 417 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 476

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 477 gtcatcgtgagtggaaagct 496



to top

>gb|AY091208.1| Arabidopsis thaliana putative 40S ribosomal protein (At2g31610)
           mRNA, complete cds
          Length = 784

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 286 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 345

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 346 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 405

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 406 gtcatcgtgagtggaaagct 425



to top

>gb|AY046041.1| Arabidopsis thaliana putative 40S ribosomal protein; contains
           C-terminal domain (At2g31610) mRNA, complete cds
          Length = 987

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 357 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 416

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 417 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 476

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 477 gtcatcgtgagtggaaagct 496



to top

>gb|AY081517.1| Arabidopsis thaliana 40S ribosomal protein; contains C-terminal
           domain (At2g31610) mRNA, complete cds
          Length = 863

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 286 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 345

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 346 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 405

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 406 gtcatcgtgagtggaaagct 425



to top

>gb|AY054622.1| Arabidopsis thaliana 40S ribosomal protein (At2g31610; T9H9.13)
           mRNA, complete cds
          Length = 992

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 357 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 416

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 417 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 476

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 477 gtcatcgtgagtggaaagct 496



to top

>gb|AY052749.1| Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 753

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 286 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 345

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 346 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 405

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 406 gtcatcgtgagtggaaagct 425



to top

>gb|AF378887.1|AF378887 Arabidopsis thaliana At2g31610/T9H9.13 mRNA, complete cds
          Length = 956

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 357 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 416

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 417 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 476

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 477 gtcatcgtgagtggaaagct 496



to top

>emb|BX818844.1|CNS0A8YC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZG02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 969

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 319 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 378

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 379 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 438

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 439 gtcatcgtgagtggaaagct 458



to top

>emb|BX819975.1|CNS0A8H0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score =  103 bits (52), Expect = 6e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 368 ctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtc 427
           ||||| ||||| || ||||| ||||| || || |||||||| || || || |||||||| 
Sbjct: 335 ctctgtgccattgctcaggctgagtctctacgttacaagcttctcggtggtcttgctgtt 394

                                                                       
Query: 428 cgcagggcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgag 487
           |||||||| || ||||||||| |  | ||||||||||||||||| |||||||| ||||||
Sbjct: 395 cgcagggcctgttatggtgttttgagatttgttatggagagtggagctaagggatgtgag 454

                               
Query: 488 gtcattgtgagtggcaagct 507
           ||||| |||||||| |||||
Sbjct: 455 gtcatcgtgagtggaaagct 474



to top

>gb|AF429976.1| Spodoptera frugiperda ribosomal protein S3 mRNA, complete cds
          Length = 855

 Score =  103 bits (52), Expect = 6e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                       
Query: 156 tgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgc 215
           ||||| ||||||| || ||||| ||||||||||| ||||||||||| || || ||||  |
Sbjct: 131 tgaccagggagcttgctgaggatggctactccggtgtggaggtgcgtgtcaccccgactc 190

                                                                       
Query: 216 gcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgca 275
           || ||||||||||||| | ||| ||| |||| ||||  ||||| || |||||||||||||
Sbjct: 191 gctcggagatcatcattatggctacgaggacacagagtgtgctcggagagaagggccgca 250

                                           
Query: 276 ggatcagggagctcacatccgtcgttcagaag 307
           | ||| | ||||| || |||||||||||||||
Sbjct: 251 gaatccgtgagctgacttccgtcgttcagaag 282



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 362 cgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggcctt 421
           ||||| || ||||||||||||||||| ||||| ||| ||||||| ||| ||||||| |||
Sbjct: 337 cgtggtctgtgcgccatcgcccaggccgagtctctcagatacaaactcattggaggtctt 396

             
Query: 422 gc 423
           ||
Sbjct: 397 gc 398



to top

>gb|AF402810.1| Ictalurus punctatus 40S ribosomal protein S3 mRNA, complete cds
          Length = 799

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 99/116 (85%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           |||||||| |||||||| || || || |||||||| || ||||| || ||||||||||| 
Sbjct: 297 gccatcgctcaggcagaatctctgcgctacaagctgctcggaggtctggctgtccgcaga 356

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || |||||||||||||| |||||  | |||||||||||||| ||||| ||||||||
Sbjct: 357 gcctgctatggtgttctgcgcttcatcatggagagtggtgccaagggctgtgaggt 412



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||||||||||||| | |||||||| ||||| || ||||| || |||||||| ||||||
Sbjct: 60  gccgagctgaacgagttcctgacccgagagcttgctgaggatgggtactccggtgtggag 119

             
Query: 197 gt 198
           ||
Sbjct: 120 gt 121



to top

>emb|BX823126.1|CNS0A5V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZH06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 144/176 (81%)
 Strand = Plus / Plus

                                                                       
Query: 333 ttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagt 392
           |||| |||||||||||||||||   |||| | || ||||| |||||||| ||||| ||||
Sbjct: 287 ttgagctttatgccgagaaggttaacaacagaggtctctgtgccatcgctcaggctgagt 346

                                                                       
Query: 393 cactccgatacaagctccttggaggccttgctgtccgcagggcttgctatggtgttcttc 452
           |  | || |||||||| ||||| || || ||||| || |||||||| ||||||||  |  
Sbjct: 347 ctttacgttacaagcttcttggtggtctcgctgttcgtagggcttgatatggtgtgttga 406

                                                                   
Query: 453 gctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtggcaagctt 508
           | ||||||||||||||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 407 ggtttgttatggagagtggagctaagggatgcgaggttatcgtgagtggaaagctt 462



to top

>gb|U12708.1|MSU12708 Manduca sexta ribosomal protein S3 mRNA, complete cds
          Length = 778

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 186/233 (79%)
 Strand = Plus / Plus

                                                                       
Query: 161 cgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacg 220
           |||||||| || ||||| ||||||||||||||||||||||| || || || |  ||  ||
Sbjct: 101 cgggagctggctgaggatggctactccggcgtggaggtgcgtgtcacccctacccgatcg 160

                                                                       
Query: 221 gagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatc 280
           ||||||||||||| ||||||  |||| |||| |||||| || |||||||||||| | |||
Sbjct: 161 gagatcatcatcatggccaccaggacacagagcgtgctcggagagaagggccgccgcatc 220

                                                                       
Query: 281 agggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactt 340
            | ||| | || || ||||| |||||||| |||||  |||||||  |   ||| || || 
Sbjct: 221 cgcgagttgacttcggtcgtgcagaagcggttcaacatcccggaacagtccgtggagctg 280

                                                                
Query: 341 tatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtc 393
           || || ||||| || | || |||||| |||||||||||||| ||||| |||||
Sbjct: 281 tacgctgagaaagttgccacccgtggtctctgcgccatcgctcaggccgagtc 333



to top

>gb|BC010721.1| Mus musculus ribosomal protein S3, mRNA (cDNA clone MGC:6565
           IMAGE:2811930), complete cds
          Length = 835

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 310 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 369

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 370 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 425



to top

>dbj|AK148030.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270146M21 product:ribosomal protein S3, full
           insert sequence
          Length = 833

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 322 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 381

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 382 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 437



to top

>dbj|AK146796.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length
           enriched library, clone:I920057H11 product:ribosomal
           protein S3, full insert sequence
          Length = 828

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 323 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 382

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 383 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 438



to top

>dbj|AK150479.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830008E12 product:ribosomal
           protein S3, full insert sequence
          Length = 818

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 316 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 375

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 376 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 431



to top

>dbj|AK166750.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0008L11 product:ribosomal protein S3,
           full insert sequence
          Length = 829

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 324 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 383

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 384 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 439



to top

>dbj|AK168845.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920060E02 product:ribosomal protein S3,
           full insert sequence
          Length = 814

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 312 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 371

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 372 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 427



to top

>dbj|AK164077.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530001F06 product:ribosomal
           protein S3, full insert sequence
          Length = 1818

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 323 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 382

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 383 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 438



to top

>dbj|AK165174.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN full-length
           enriched library, clone:E860101I01 product:ribosomal
           protein S3, full insert sequence
          Length = 814

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 312 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 371

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 372 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 427



to top

>dbj|AK167266.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0048B03 product:ribosomal protein S3,
           full insert sequence
          Length = 814

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 312 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 371

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 372 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 427



to top

>dbj|AK160526.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2400004M03 product:ribosomal protein S3, full
           insert sequence
          Length = 841

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 322 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 381

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 382 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 437



to top

>dbj|AK159508.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420022F20 product:ribosomal protein S3,
           full insert sequence
          Length = 825

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 323 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 382

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 383 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 438



to top

>dbj|AK167210.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0040O11 product:ribosomal protein S3,
           full insert sequence
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 322 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 381

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 382 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 437



to top

>dbj|AK010678.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410046D10 product:ribosomal protein S3, full
           insert sequence
          Length = 823

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 321 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 380

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 381 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 436



to top

>dbj|AK010579.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410024F19 product:ribosomal protein S3, full
           insert sequence
          Length = 829

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 323 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 382

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 383 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 438



to top

>dbj|AK003181.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001J14 product:ribosomal
           protein S3, full insert sequence
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 318 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 377

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 378 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 433



to top

>dbj|AK051243.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130020M13 product:ribosomal
           protein S3, full insert sequence
          Length = 835

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 323 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 382

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 383 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 438



to top

>dbj|AK012314.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700033D19 product:ribosomal
           protein S3, full insert sequence
          Length = 824

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 322 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 381

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 382 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 437



to top

>dbj|AK012234.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700010N02 product:ribosomal
           protein S3, full insert sequence
          Length = 827

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 322 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 381

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 382 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 437



to top

>dbj|AK011655.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610034C13 product:ribosomal
           protein S3, full insert sequence
          Length = 823

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 318 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 377

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 378 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 433



to top

>gb|U89414.1|MMU89414 Mus musculus strain BALB/c ribosomal protein S3 mRNA, partial cds
          Length = 370

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 98  gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 157

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 158 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 213



to top

>ref|NM_012052.1| Mus musculus ribosomal protein S3 (Rps3), mRNA
          Length = 818

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 297 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 356

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 357 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 412



to top

>emb|X76772.1|MMRIBPS3 M.musculus mRNA for ribosomal protein S3
          Length = 818

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                       
Query: 374 gccatcgcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagg 433
           ||||| |||||||||||||| || || ||||| ||||||||||| ||||| || || |||
Sbjct: 297 gccattgcccaggcagagtctctacgctacaaactccttggagggcttgcggttcgaagg 356

                                                                   
Query: 434 gcttgctatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggt 489
           || ||||||||||| ||||| ||  ||||||||||||| || ||||| || |||||
Sbjct: 357 gcctgctatggtgtgcttcggttcattatggagagtggggccaagggctgcgaggt 412



to top

>ref|NM_122944.2| Arabidopsis thaliana structural constituent of ribosome AT5G35530
           mRNA, complete cds
          Length = 1028

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 325/419 (77%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||  ||||| ||   |||||| || || ||||| || 
Sbjct: 66  atggcgacccagatcagcaagaagagaaagttcgtagccgatggtgtgttttacgctgaa 125

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           || || ||| | || ||| | ||||| || ||||| || ||||| || || ||||| |||
Sbjct: 126 ctcaatgaggttctaaccagagagcttgctgaggatggttactctggtgttgaggttcgc 185

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           || || || ||||| || ||||||||||| || ||||| || || || ||||| || || 
Sbjct: 186 gtcactcctatgcgtactgagatcatcattagagccactcgtactcaaaacgttctcggt 245

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           ||||||||  | ||||| |||||  | |||||  | || || ||| | ||||| || || 
Sbjct: 246 gagaagggaaggaggattagggaattgacatctcttgtacaaaagagattcaaatttcct 305

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
            || || | ||||| |||||||| |||||||| |  ||| | || || || || || || 
Sbjct: 306 caggacagtgttgagctttatgctgagaaggttgctaacagaggtctttgtgctattgct 365

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| || || |||||||| ||||| || |||||||| || ||||| ||||||
Sbjct: 366 caggctgagtctcttcgttacaagcttcttggtggtcttgctgttcgtagggcgtgctat 425

                                                                      
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtgg 501
           |||||| |  | ||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 426 ggtgttttaaggtttgttatggagagtggagctaaaggatgcgaagtcattgtgagtgg 484



to top

>ref|XM_855394.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 9 (LOC476804), mRNA
          Length = 690

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 349 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 408

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 409 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 459



to top

>ref|XM_855358.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 8 (LOC476804), mRNA
          Length = 758

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 349 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 408

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 409 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 459



to top

>ref|XM_855322.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 7 (LOC476804), mRNA
          Length = 1138

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 275 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 334

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 335 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 385



to top

>ref|XM_855288.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 6 (LOC476804), mRNA
          Length = 1175

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 312 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 371

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 372 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 422



to top

>ref|XM_855253.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 5 (LOC476804), mRNA
          Length = 1155

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 292 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 351

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 352 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 402



to top

>ref|XM_534008.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 1 (LOC476804), mRNA
          Length = 1212

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 349 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 408

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 409 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 459



to top

>ref|XM_855185.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 4 (LOC476804), mRNA
          Length = 1193

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 349 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 408

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 409 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 459



to top

>ref|XM_844854.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3,
           transcript variant 3 (LOC476804), mRNA
          Length = 1106

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 380 gcccaggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgc 439
           ||||||||||||||||| || ||||| ||||| |||||||||||||| || ||||| |||
Sbjct: 349 gcccaggcagagtcactgcgttacaaactcctaggaggccttgctgtgcggagggcctgc 408

                                                              
Query: 440 tatggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtc 490
           |||||||| || || ||  | ||||||||||| || || || |||||||||
Sbjct: 409 tatggtgtgctgcggttcatcatggagagtggggccaaaggctgtgaggtc 459



to top

>gb|AY098949.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 747

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 325/419 (77%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||  ||||| ||   |||||| || || ||||| || 
Sbjct: 1   atggcgacccagatcagcaagaagagaaagttcgtagccgatggtgtgttttacgctgaa 60

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           || || ||| | || ||| | ||||| || ||||| || ||||| || || ||||| |||
Sbjct: 61  ctcaatgaggttctaaccagagagcttgctgaggatggttactctggtgttgaggttcgc 120

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           || || || ||||| || ||||||||||| || ||||| || || || ||||| || || 
Sbjct: 121 gtcactcctatgcgtactgagatcatcattagagccactcgtactcaaaacgttctcggt 180

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           ||||||||  | ||||| |||||  | |||||  | || || ||| | ||||| || || 
Sbjct: 181 gagaagggaaggaggattagggaattgacatctcttgtacaaaagagattcaaatttcct 240

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
            || || | ||||| |||||||| |||||||| |  ||| | || || || || || || 
Sbjct: 241 caggacagtgttgagctttatgctgagaaggttgctaacagaggtctttgtgctattgct 300

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| || || |||||||| ||||| || |||||||| || ||||| ||||||
Sbjct: 301 caggctgagtctcttcgttacaagcttcttggtggtcttgctgttcgtagggcgtgctat 360

                                                                      
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtgg 501
           |||||| |  | ||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 361 ggtgttttaaggtttgttatggagagtggagctaaaggatgcgaagtcattgtgagtgg 419



to top

>gb|AY058057.1| Arabidopsis thaliana AT5g35530/MOK9_14 mRNA, complete cds
          Length = 955

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 325/419 (77%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||  ||||| ||   |||||| || || ||||| || 
Sbjct: 65  atggcgacccagatcagcaagaagagaaagttcgtagccgatggtgtgttttacgctgaa 124

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           || || ||| | || ||| | ||||| || ||||| || ||||| || || ||||| |||
Sbjct: 125 ctcaatgaggttctaaccagagagcttgctgaggatggttactctggtgttgaggttcgc 184

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           || || || ||||| || ||||||||||| || ||||| || || || ||||| || || 
Sbjct: 185 gtcactcctatgcgtactgagatcatcattagagccactcgtactcaaaacgttctcggt 244

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           ||||||||  | ||||| |||||  | |||||  | || || ||| | ||||| || || 
Sbjct: 245 gagaagggaaggaggattagggaattgacatctcttgtacaaaagagattcaaatttcct 304

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
            || || | ||||| |||||||| |||||||| |  ||| | || || || || || || 
Sbjct: 305 caggacagtgttgagctttatgctgagaaggttgctaacagaggtctttgtgctattgct 364

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| || || |||||||| ||||| || |||||||| || ||||| ||||||
Sbjct: 365 caggctgagtctcttcgttacaagcttcttggtggtcttgctgttcgtagggcgtgctat 424

                                                                      
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtgg 501
           |||||| |  | ||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 425 ggtgttttaaggtttgttatggagagtggagctaaaggatgcgaagtcattgtgagtgg 483



to top

>gb|AY084320.1| Arabidopsis thaliana clone 10394 mRNA, complete sequence
          Length = 985

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 325/419 (77%)
 Strand = Plus / Plus

                                                                       
Query: 83  atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 142
           ||||| |||||||||||||||||||  ||||| ||   |||||| || || ||||| || 
Sbjct: 66  atggcgacccagatcagcaagaagagaaagttcgtagccgatggtgtgttttacgctgaa 125

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           || || ||| | || ||| | ||||| || ||||| || ||||| || || ||||| |||
Sbjct: 126 ctcaatgaggttctaaccagagagcttgctgaggatggttactctggtgttgaggttcgc 185

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           || || || ||||| || ||||||||||| || ||||| || || || ||||| || || 
Sbjct: 186 gtcactcctatgcgtactgagatcatcattagagccactcgtactcaaaacgttctcggt 245

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           ||||||||  | ||||| |||||  | |||||  | || || ||| | ||||| || || 
Sbjct: 246 gagaagggaaggaggattagggaattgacatctcttgtacaaaagagattcaaatttcct 305

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
            || || | ||||| |||||||| |||||||| |  ||| | || || || || || || 
Sbjct: 306 caggacagtgttgagctttatgctgagaaggttgctaacagaggtctttgtgctattgct 365

                                                                       
Query: 383 caggcagagtcactccgatacaagctccttggaggccttgctgtccgcagggcttgctat 442
           ||||| ||||| || || |||||||| ||||| || |||||||| || ||||| ||||||
Sbjct: 366 caggctgagtctcttcgttacaagcttcttggtggtcttgctgttcgtagggcgtgctat 425

                                                                      
Query: 443 ggtgttcttcgctttgttatggagagtggtgctaagggttgtgaggtcattgtgagtgg 501
           |||||| |  | ||||||||||||||||| ||||| || || || ||||||||||||||
Sbjct: 426 ggtgttttaaggtttgttatggagagtggagctaaaggatgcgaagtcattgtgagtgg 484



to top

>gb|AY769316.1| Bombyx mori ribosomal protein S3 (RpS3) mRNA, complete cds
          Length = 805

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 126/154 (81%)
 Strand = Plus / Plus

                                                                       
Query: 162 gggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacgg 221
           ||||||| || ||||||||||||||||||||||| ||||| || || || || ||| |||
Sbjct: 107 gggagctggccgaggacggctactccggcgtggaagtgcgggtcactcccatccgctcgg 166

                                                                       
Query: 222 agatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatca 281
           ||||||| || | ||||||  |||| ||||  ||||| || ||||| || ||||| ||| 
Sbjct: 167 agatcattattatggccaccaggacacagagtgtgctcggagagaaaggacgcagaatcc 226

                                             
Query: 282 gggagctcacatccgtcgttcagaagcgcttcaa 315
           | |||||||| ||||| || |||||||| |||||
Sbjct: 227 gtgagctcacttccgtagtacagaagcgattcaa 260



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 362 cgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggcctt 421
           |||||||| ||||| ||||||||||| || || ||  ||||||||||  | ||||| || 
Sbjct: 307 cgtggcctttgcgctatcgcccaggccgaatctctaagatacaagcttatcggaggtctc 366

                                        
Query: 422 gctgtccgcagggcttgctatggtgttct 450
           ||||| ||  | |||||||||||||||||
Sbjct: 367 gctgtacgtcgtgcttgctatggtgttct 395



to top

>emb|AM048962.1| Scarabaeus laticollis mRNA for ribosomal protein S3e (rpS3e gene)
          Length = 726

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 210/266 (78%)
 Strand = Plus / Plus

                                                                       
Query: 143 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 202
           ||||||||| | || ||| ||||||| || ||||| || |||||||| || |||||  | 
Sbjct: 61  ctgaacgagttcctcaccagggagctggctgaggatggatactccggggttgaggttagg 120

                                                                       
Query: 203 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 262
           || || ||||  ||||| ||||||||||||| ||| || || |||||||||||||| || 
Sbjct: 121 gtcaccccgactcgcaccgagatcatcatcatggcgacccgcacgcagaacgtgctggga 180

                                                                       
Query: 263 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 322
           |||||||| ||| | ||| | ||||| || || ||||| |||||||| ||||| || || 
Sbjct: 181 gagaaggggcgccgcatccgagagctgacgtcggtcgtccagaagcgtttcaactttccc 240

                                                                       
Query: 323 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 382
           ||| ||   || || || || || || ||||| | || | | || |||||||||||||||
Sbjct: 241 gagcactctgtcgagctgtacgcggaaaaggtggccaccaggggtctctgcgccatcgcc 300

                                     
Query: 383 caggcagagtcactccgatacaagct 408
           ||||| ||||| ||||| ||||||||
Sbjct: 301 caggcggagtctctccgctacaagct 326



to top

>emb|BX071951.1|CNS09ROJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 841 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 782

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 781 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 722

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 721 ctgggtgagaaggg 708



to top

>emb|BX071950.1|CNS09ROI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 155 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 214

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 215 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 274

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 275 ctgggtgagaaggg 288



to top

>emb|BX071838.1|CNS09RLE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746



to top

>emb|BX071486.1|CNS09RBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746



to top

>emb|BX060955.1|CNS09J73 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 77  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 136

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 137 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 196

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 197 ctgggtgagaaggg 210



to top

>emb|BX069342.1|CNS09PO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 111 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 170

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 171 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 230

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 231 ctgggtgagaaggg 244



to top

>emb|BX068384.1|CNS09OXG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 894 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 835

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 834 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 775

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 774 ctgggtgagaaggg 761



to top

>emb|BX068060.1|CNS09OOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 110 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 169

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 170 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 229

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 230 ctgggtgagaaggg 243



to top

>emb|BX067052.1|CNS09NWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 891 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 832

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 831 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 772

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 771 ctgggtgagaaggg 758



to top

>emb|BX066892.1|CNS09NS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 99  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 158

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 159 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 218

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 219 ctgggtgagaaggg 232



to top

>emb|BX066853.1|CNS09NQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 878 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 819

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 818 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 759

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 758 ctgggtgagaaggg 745



to top

>emb|BX065632.1|CNS09MT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 74  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 133

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 134 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 193

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 194 ctgggtgagaaggg 207



to top

>emb|BX065002.1|CNS09MBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 874 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 815

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 814 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 755

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 754 ctgggtgagaaggg 741



to top

>emb|BX062894.1|CNS09KOY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 881 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 822

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 821 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 762

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 761 ctgggtgagaaggg 748



to top

>emb|BX062466.1|CNS09KD2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 104 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 163

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 164 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 223

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 224 ctgggtgagaaggg 237



to top

>emb|BX062034.1|CNS09K12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 882 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 823

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 822 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 763

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 762 ctgggtgagaaggg 749



to top

>emb|BX061570.1|CNS09JO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 881 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 822

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 821 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 762

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 761 ctgggtgagaaggg 748



to top

>emb|BX061429.1|CNS09JK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 873 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 814

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 813 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 754

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 753 ctgggtgagaaggg 740



to top

>emb|BX061247.1|CNS09JF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 96  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 155

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 156 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 215

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 216 ctgggtgagaaggg 229



to top

>emb|BX060666.1|CNS09IZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 870 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 811

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 810 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 751

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 750 ctgggtgagaaggg 737



to top

>emb|BX060145.1|CNS09IKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 872 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 813

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 812 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 753

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 752 ctgggtgagaaggg 739



to top

>emb|BX060064.1|CNS09IIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 89  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 148

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 149 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 208

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 209 ctgggtgagaaggg 222



to top

>emb|BX060018.1|CNS09IH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 885 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 826

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 825 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 766

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 765 ctgggtgagaaggg 752



to top

>emb|BX056467.1|CNS09FQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 97  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 156

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 157 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 216

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 217 ctgggtgagaaggg 230



to top

>emb|BX054555.1|CNS09E9B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 873 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 814

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 813 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 754

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 753 ctgggtgagaaggg 740



to top

>emb|BX054554.1|CNS09E9A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 550 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 609

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 610 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 669

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 670 ctgggtgagaaggg 683



to top

>emb|BX054507.1|CNS09E7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 892 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 833

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 832 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 773

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 772 ctgggtgagaaggg 759



to top

>emb|BX049946.1|CNS09APA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 886 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 827

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 826 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 767

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 766 ctgggtgagaaggg 753



to top

>emb|BX049133.1|CNS09A2P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746



to top

>emb|BX048656.1|CNS099PG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 83  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 142

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 143 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 202

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 203 ctgggtgagaaggg 216



to top

>emb|BX048195.1|CNS099CN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 115 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 174

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 175 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 234

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 235 ctgggtgagaaggg 248



to top

>emb|BX044635.1|CNS096LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 110 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 169

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 170 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 229

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 230 ctgggtgagaaggg 243



to top

>emb|BX043729.1|CNS095WL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 89  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 148

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 149 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 208

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 209 ctgggtgagaaggg 222



to top

>emb|BX043605.1|CNS095T5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 111 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 170

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 171 gtccgtgtcacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 230

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 231 ctgggtgagaaggg 244



to top

>emb|BX043171.1|CNS095H3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 884 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 825

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 824 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 765

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 764 ctgggtgagaaggg 751



to top

>emb|BX042318.1|CNS094TE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 888 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 829

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 828 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 769

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 768 ctgggtgagaaggg 755



to top

>emb|BX041935.1|CNS094IR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 113 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 172

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 173 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 232

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 233 ctgggtgagaaggg 246



to top

>emb|BX041378.1|CNS0943A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 700 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 641

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 640 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 581

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 580 ctgggtgagaaggg 567



to top

>emb|BX040880.1|CNS093PG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 906 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 847

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 846 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 787

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 786 ctgggtgagaaggg 773



to top

>emb|BX040349.1|CNS093AP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 129 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 188

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 189 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 248

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 249 ctgggtgagaaggg 262



to top

>emb|BX040104.1|CNS0933W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 108 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 167

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 168 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 227

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 228 ctgggtgagaaggg 241



to top

>emb|BX039345.1|CNS092IT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 94  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 153

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 154 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 213

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 214 ctgggtgagaaggg 227



to top

>emb|BX039168.1|CNS092DW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 638

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 132 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 191

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 192 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 251

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 252 ctgggtgagaaggg 265



to top

>emb|BX038309.1|CNS091Q1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 117 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 176

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 177 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 236

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 237 ctgggtgagaaggg 250



to top

>emb|BX036899.1|CNS090MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 892 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 833

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 832 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 773

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 772 ctgggtgagaaggg 759



to top

>emb|BX036837.1|CNS090L5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 382

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 86  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 145

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 146 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 205

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 206 ctgggtgagaaggg 219



to top

>emb|BX034717.1|CNS08YY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 100 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 159

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 160 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 219

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 220 ctgggtgagaaggg 233



to top

>emb|BX032839.1|CNS08XI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 883 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 824

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 823 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 764

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 763 ctgggtgagaaggg 750



to top

>emb|BX030549.1|CNS08VQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 147 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 206

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 207 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 266

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 267 ctgggtgagaaggg 280



to top

>emb|BX022272.1|CNS08PCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 169 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 228

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 229 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 288

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 289 ctgggtgagaaggg 302



to top

>emb|BX027874.1|CNS08TO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 166 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 225

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 226 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 285

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 286 ctgggtgagaaggg 299



to top

>emb|BX027294.1|CNS08T82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 893 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 834

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 833 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 774

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 773 ctgggtgagaaggg 760



to top

>emb|BX024682.1|CNS08R7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 93  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 152

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 153 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 212

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 213 ctgggtgagaaggg 226



to top

>emb|BX019560.1|CNS08N98 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 256

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 23  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 82

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 83  gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 142

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 143 ctgggtgagaaggg 156



to top

>emb|BX020703.1|CNS08O4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 169 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 228

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 229 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 288

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 289 ctgggtgagaaggg 302



to top

>emb|BX018305.1|CNS08MAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 875 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 816

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 815 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 756

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 755 ctgggtgagaaggg 742



to top

>emb|BX012403.1|CNS08HQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 160 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 219

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 220 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 279

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 280 ctgggtgagaaggg 293



to top

>emb|BX006777.1|CNS08DE5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 156 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 215

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 216 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 275

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 276 ctgggtgagaaggg 289



to top

>ref|XM_321155.2| Anopheles gambiae str. PEST ENSANGP00000020844
           (ENSANGG00000018355), partial mRNA
          Length = 702

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 137 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 196
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 28  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 87

                                                                       
Query: 197 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 256
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 88  gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 147

                         
Query: 257 cttggcgagaaggg 270
           || || ||||||||
Sbjct: 148 ctgggtgagaaggg 161



to top

>emb|BX067207.1|CNS09O0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 89  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 148

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 149 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 208

                
Query: 266 aaggg 270
           |||||
Sbjct: 209 aaggg 213



to top

>emb|BX071776.1|CNS09RJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 112 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 171

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 172 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 231

                
Query: 266 aaggg 270
           |||||
Sbjct: 232 aaggg 236



to top

>emb|BX070615.1|CNS09QNF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 95  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 154

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 155 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 214

                
Query: 266 aaggg 270
           |||||
Sbjct: 215 aaggg 219



to top

>emb|BX067880.1|CNS09OJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 114 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 173

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 174 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 233

                
Query: 266 aaggg 270
           |||||
Sbjct: 234 aaggg 238



to top

>emb|BX067051.1|CNS09NWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 108 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 167

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 168 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 227

                
Query: 266 aaggg 270
           |||||
Sbjct: 228 aaggg 232



to top

>emb|BX065756.1|CNS09MWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 172

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 8   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 67

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 68  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 127

                
Query: 266 aaggg 270
           |||||
Sbjct: 128 aaggg 132



to top

>emb|BX062033.1|CNS09K11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 83  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 142

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 143 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 202

                
Query: 266 aaggg 270
           |||||
Sbjct: 203 aaggg 207



to top

>emb|BX061592.1|CNS09JOS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 102 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 161

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 162 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 221

                
Query: 266 aaggg 270
           |||||
Sbjct: 222 aaggg 226



to top

>emb|BX059556.1|CNS09I48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 7   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 66

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 67  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 126

                
Query: 266 aaggg 270
           |||||
Sbjct: 127 aaggg 131



to top

>emb|BX059139.1|CNS09HSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 100 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 159

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 160 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 219

                
Query: 266 aaggg 270
           |||||
Sbjct: 220 aaggg 224



to top

>emb|BX056167.1|CNS09FI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 110 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 169

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 170 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 229

                
Query: 266 aaggg 270
           |||||
Sbjct: 230 aaggg 234



to top

>emb|BX054567.1|CNS09E9N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 862 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 803

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 802 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 743

                
Query: 266 aaggg 270
           |||||
Sbjct: 742 aaggg 738



to top

>emb|BX049132.1|CNS09A2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 104 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 163

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 164 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 223

                
Query: 266 aaggg 270
           |||||
Sbjct: 224 aaggg 228



to top

>emb|BX047370.1|CNS098PQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 71  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 130

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 131 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 190

                
Query: 266 aaggg 270
           |||||
Sbjct: 191 aaggg 195



to top

>emb|BX046671.1|CNS0986B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 52  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 111

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 112 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 171

                
Query: 266 aaggg 270
           |||||
Sbjct: 172 aaggg 176



to top

>emb|BX041377.1|CNS09439 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 4   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 63

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 64  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 123

                
Query: 266 aaggg 270
           |||||
Sbjct: 124 aaggg 128



to top

>emb|BX040698.1|CNS093KE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 603

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 89  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 148

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 149 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 208

                
Query: 266 aaggg 270
           |||||
Sbjct: 209 aaggg 213



to top

>emb|BX040183.1|CNS09363 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 448

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 57  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 116

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 117 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 176

                
Query: 266 aaggg 270
           |||||
Sbjct: 177 aaggg 181



to top

>emb|BX040080.1|CNS09338 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 98  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 157

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 158 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 217

                
Query: 266 aaggg 270
           |||||
Sbjct: 218 aaggg 222



to top

>emb|BX039936.1|CNS092Z8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 205
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 91  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 150

                                                                       
Query: 206 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 265
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 151 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 210

                
Query: 266 aaggg 270
           |||||
Sbjct: 211 aaggg 215



to top

>gb|DQ415986.1| Anopheles quadrimaculatus ribosomal protein S3 (RPS3) mRNA, partial
           cds
          Length = 336

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 186 ccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcgga 245
           |||| |||||||| |||||||| ||||  |||||||| |||||||||| |||||| || |
Sbjct: 1   ccggtgtggaggtccgcgtgaccccgacccgcacggaaatcatcatcatggccacccgca 60

                                    
Query: 246 cgcagaacgtgcttggcgagaaggg 270
           | ||||||||||| |||||||||||
Sbjct: 61  cccagaacgtgctgggcgagaaggg 85



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 331 cgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggc 387
           |||||| || || ||||||||||| | || |||||| || |||||||| ||||||||
Sbjct: 146 cgttgagctgtacgccgagaaggtggccacccgtggtctgtgcgccattgcccaggc 202



to top

>emb|BX053436.1|CNS09DE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 551

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX071837.1|CNS09RLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX071741.1|CNS09RIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX071696.1|CNS09RHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX071616.1|CNS09RF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX071485.1|CNS09RBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070633.1|CNS09QNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070555.1|CNS09QLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070506.1|CNS09QKE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070477.1|CNS09QJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070421.1|CNS09QI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX070161.1|CNS09QAT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069948.1|CNS09Q4W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069682.1|CNS09PXI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 337

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069666.1|CNS09PX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061066.1|CNS09JA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069429.1|CNS09PQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069304.1|CNS09PN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX069215.1|CNS09PKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 492

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX068963.1|CNS09PDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX068877.1|CNS09PB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX068410.1|CNS09OY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX068383.1|CNS09OXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX068027.1|CNS09ONJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX067933.1|CNS09OKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX067909.1|CNS09OK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX067157.1|CNS09NZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066852.1|CNS09NQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066794.1|CNS09NPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066745.1|CNS09NNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066721.1|CNS09NN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066470.1|CNS09NGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066232.1|CNS09N9O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX066176.1|CNS09N84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065879.1|CNS09MZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065812.1|CNS09MY0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggttcgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065503.1|CNS09MPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065323.1|CNS09MKF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065196.1|CNS09MGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX065001.1|CNS09MBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064962.1|CNS09MAE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064919.1|CNS09M97 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064727.1|CNS09M3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064562.1|CNS09LZA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 255

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064439.1|CNS09LVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064384.1|CNS09LUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064214.1|CNS09LPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064116.1|CNS09LMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX064054.1|CNS09LL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX063320.1|CNS09L0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX062932.1|CNS09KQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX062893.1|CNS09KOX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX062127.1|CNS09K3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX062120.1|CNS09K3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061743.1|CNS09JSZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061707.1|CNS09JRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061620.1|CNS09JPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061569.1|CNS09JO5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061480.1|CNS09JLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061428.1|CNS09JK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX061229.1|CNS09JEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060846.1|CNS09J42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060810.1|CNS09J32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060665.1|CNS09IZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060607.1|CNS09IXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060402.1|CNS09IRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060375.1|CNS09IQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060144.1|CNS09IKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060066.1|CNS09IIE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX060017.1|CNS09IH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX059858.1|CNS09ICM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX059821.1|CNS09IBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX059045.1|CNS09HQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX059018.1|CNS09HPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX058900.1|CNS09HM0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX058711.1|CNS09HGR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX058653.1|CNS09HF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 423

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX058108.1|CNS09H00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX058103.1|CNS09GZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056701.1|CNS09FWX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcacggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056662.1|CNS09FVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX057998.1|CNS09GWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX057677.1|CNS09GO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX057652.1|CNS09GNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX057544.1|CNS09GKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 501

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056968.1|CNS09G4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056933.1|CNS09G3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 192

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056922.1|CNS09G32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119



to top

>emb|BX056881.1|CNS09G1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 155 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 214
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 215 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 270
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,668,420
Number of Sequences: 3902068
Number of extensions: 3668420
Number of successful extensions: 57761
Number of sequences better than 10.0: 905
Number of HSP's better than 10.0 without gapping: 902
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 55827
Number of HSP's gapped (non-prelim): 1871
length of query: 514
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 491
effective length of database: 17,143,297,704
effective search space: 8417359172664
effective search space used: 8417359172664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top