Clone Name | bart25a12 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009387.1| Triticum aestivum clone wlm96.pk035.d7:fis, full insert mRNA sequence Length = 1805 Score = 71.9 bits (36), Expect = 2e-10 Identities = 42/44 (95%) Strand = Plus / Plus Query: 22 caagctatctagcaaagatggccatggctaggagctccagccta 65 ||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 14 caagctagctagcaaagatggccatggccaggagctccagccta 57
>gb|AC103624.9| Mus musculus chromosome 5, clone RP24-258B22, complete sequence Length = 172330 Score = 40.1 bits (20), Expect = 0.64 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 agatggccatggctaggagc 56 |||||||||||||||||||| Sbjct: 8795 agatggccatggctaggagc 8814
>gb|AC016580.7|AC016580 Homo sapiens chromosome 5 clone CTD-2509J24, complete sequence Length = 184118 Score = 40.1 bits (20), Expect = 0.64 Identities = 23/24 (95%) Strand = Plus / Plus Query: 34 caaagatggccatggctaggagct 57 ||||||||||||||||||| |||| Sbjct: 87366 caaagatggccatggctagcagct 87389
>gb|AC034246.4|AC034246 Homo sapiens chromosome 5 clone RP11-160F8, complete sequence Length = 155025 Score = 40.1 bits (20), Expect = 0.64 Identities = 23/24 (95%) Strand = Plus / Plus Query: 34 caaagatggccatggctaggagct 57 ||||||||||||||||||| |||| Sbjct: 141167 caaagatggccatggctagcagct 141190
>gb|AC008960.6|AC008960 Homo sapiens chromosome 5 clone CTD-2354D24, complete sequence Length = 74999 Score = 40.1 bits (20), Expect = 0.64 Identities = 23/24 (95%) Strand = Plus / Minus Query: 34 caaagatggccatggctaggagct 57 ||||||||||||||||||| |||| Sbjct: 21778 caaagatggccatggctagcagct 21755
>gb|AC104742.9| Mus musculus chromosome 5, clone RP24-334A12, complete sequence Length = 117378 Score = 40.1 bits (20), Expect = 0.64 Identities = 20/20 (100%) Strand = Plus / Minus Query: 37 agatggccatggctaggagc 56 |||||||||||||||||||| Sbjct: 2850 agatggccatggctaggagc 2831
>emb|AL929082.7| Zebrafish DNA sequence from clone CH211-113P18, complete sequence Length = 195316 Score = 40.1 bits (20), Expect = 0.64 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 ctgcagcgtacaacaagcta 28 |||||||||||||||||||| Sbjct: 145111 ctgcagcgtacaacaagcta 145092
>emb|AL772268.6| Mouse DNA sequence from clone RP23-465I4 on chromosome 11 Contains the 5' end of the gene for the ortholog of human and rat FAT tumor suppressor homolog 2 (Drosophila) FAT2, a novel pseudogene and the 3' end of the Sparc gene for secreted acidic cysteine rich glycoprotein, complete sequence Length = 86314 Score = 38.2 bits (19), Expect = 2.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 atctagcaaagatggccat 46 ||||||||||||||||||| Sbjct: 55414 atctagcaaagatggccat 55396
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence Length = 6365727 Score = 36.2 bits (18), Expect = 9.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 16 gtacaacaagctatctagcaaa 37 ||||||||||||||| |||||| Sbjct: 6116230 gtacaacaagctatcgagcaaa 6116209
>ref|XM_742907.1| Aspergillus fumigatus Af293 PHD transcription factor Rum1 (Afu5g03430) partial mRNA Length = 5247 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 gcaacactgcagcgtaca 20 |||||||||||||||||| Sbjct: 4684 gcaacactgcagcgtaca 4701
>ref|XM_383901.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03725.1) partial mRNA Length = 1809 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 32 agcaaagatggccatggc 49 |||||||||||||||||| Sbjct: 594 agcaaagatggccatggc 577
>gb|AC067982.6| Homo sapiens chromosome 8, clone RP11-125E23, complete sequence Length = 147875 Score = 36.2 bits (18), Expect = 9.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 39 atggccatggctaggagctcca 60 ||||||||||||| |||||||| Sbjct: 120514 atggccatggctacgagctcca 120493
>gb|AC156021.2| Mus musculus BAC clone RP23-256A5 from chromosome 5, complete sequence Length = 217987 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 41 ggccatggctaggagctc 58 |||||||||||||||||| Sbjct: 81353 ggccatggctaggagctc 81336
>gb|AC157353.2| Mus musculus BAC clone RP24-236H23 from chromosome 12, complete sequence Length = 188463 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Minus Query: 47 ggctaggagctccagcct 64 |||||||||||||||||| Sbjct: 147729 ggctaggagctccagcct 147712
>dbj|AK040956.1| Mus musculus adult male aorta and vein cDNA, RIKEN full-length enriched library, clone:A530051G23 product:unclassifiable, full insert sequence Length = 4354 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 41 ggccatggctaggagctc 58 |||||||||||||||||| Sbjct: 1531 ggccatggctaggagctc 1548
>gb|AC025828.3|AC025828 Homo sapiens, clone RP11-13I24, complete sequence Length = 152843 Score = 36.2 bits (18), Expect = 9.9 Identities = 21/22 (95%) Strand = Plus / Minus Query: 39 atggccatggctaggagctcca 60 ||||||||||||| |||||||| Sbjct: 21509 atggccatggctacgagctcca 21488
>gb|AC154845.2| Mus musculus BAC clone RP23-48E18 from chromosome 14, complete sequence Length = 211129 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 30 ctagcaaagatggccatg 47 |||||||||||||||||| Sbjct: 177837 ctagcaaagatggccatg 177854
>gb|AC009223.2| Homo sapiens BAC clone RP11-24K2 from 2, complete sequence Length = 182144 Score = 36.2 bits (18), Expect = 9.9 Identities = 18/18 (100%) Strand = Plus / Plus Query: 45 atggctaggagctccagc 62 |||||||||||||||||| Sbjct: 6578 atggctaggagctccagc 6595 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 409,218 Number of Sequences: 3902068 Number of extensions: 409218 Number of successful extensions: 25962 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 25940 Number of HSP's gapped (non-prelim): 22 length of query: 66 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 45 effective length of database: 17,151,101,840 effective search space: 771799582800 effective search space used: 771799582800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)