ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart24f06 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_193145.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1107 Score = 125 bits (63), Expect = 2e-25 Identities = 110/123 (89%), Gaps = 2/123 (1%) Strand = Plus / Plus Query: 448 cctccttccacccggccctcgtcgccgtgcagtccaccgtgctcgaggagtacgaccccg 507 |||||||||| || ||||| |||||||| |||||||||||| | |||||||||||||| | Sbjct: 236 cctccttccagcctgcccttgtcgccgtccagtccaccgtgatggaggagtacgacccgg 295 Query: 508 ccaggcccaacgactacgaggactaccgtaaggacaaagctc-agcgggccaaggacgcc 566 |||||||||||||||||||||||||| | |||||| |||||| || |||||||||| ||| Sbjct: 296 ccaggcccaacgactacgaggactacaggaaggac-aagctcaagagggccaaggaggcc 354 Query: 567 gag 569 ||| Sbjct: 355 gag 357 Score = 107 bits (54), Expect = 4e-20 Identities = 119/140 (85%), Gaps = 3/140 (2%) Strand = Plus / Plus Query: 195 atgctgggcgggttgtacggcgacctcccgccgcccacctcggcggccggcgacgacgac 254 ||||||||||| ||||||||||||||||||||||| ||| | ||| |||||| ||| Sbjct: 1 atgctgggcggattgtacggcgacctcccgccgccg---tcgtcctccgccgacgatgac 57 Query: 255 aagccgacggcctccgtctggtcgagcgccaccaagatggcgcccccgaccctccgcaag 314 ||||| | ||| ||| |||||| |||||| |||||||||||||||| |||||||||||| Sbjct: 58 aagccctccgccgccggctggtccagcgccgccaagatggcgccccccaccctccgcaag 117 Query: 315 ccatccgcgaccttcgcccc 334 || |||| ||||||||||| Sbjct: 118 ccccccgccaccttcgcccc 137
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 125 bits (63), Expect = 2e-25 Identities = 110/123 (89%), Gaps = 2/123 (1%) Strand = Plus / Plus Query: 448 cctccttccacccggccctcgtcgccgtgcagtccaccgtgctcgaggagtacgaccccg 507 |||||||||| || ||||| |||||||| |||||||||||| | |||||||||||||| | Sbjct: 18844610 cctccttccagcctgcccttgtcgccgtccagtccaccgtgatggaggagtacgacccgg 18844669 Query: 508 ccaggcccaacgactacgaggactaccgtaaggacaaagctc-agcgggccaaggacgcc 566 |||||||||||||||||||||||||| | |||||| |||||| || |||||||||| ||| Sbjct: 18844670 ccaggcccaacgactacgaggactacaggaaggac-aagctcaagagggccaaggaggcc 18844728 Query: 567 gag 569 ||| Sbjct: 18844729 gag 18844731 Score = 117 bits (59), Expect = 4e-23 Identities = 124/145 (85%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 190 cgaagatgctgggcgggttgtacggcgacctcccgccgcccacctcggcggccggcgacg 249 |||||||||||||||| ||||||||||||||||||||||| ||| | ||| ||||| Sbjct: 18844370 cgaagatgctgggcggattgtacggcgacctcccgccgccg---tcgtcctccgccgacg 18844426 Query: 250 acgacaagccgacggcctccgtctggtcgagcgccaccaagatggcgcccccgaccctcc 309 | |||||||| | ||| ||| |||||| |||||| |||||||||||||||| ||||||| Sbjct: 18844427 atgacaagccctccgccgccggctggtccagcgccgccaagatggcgccccccaccctcc 18844486 Query: 310 gcaagccatccgcgaccttcgcccc 334 ||||||| |||| ||||||||||| Sbjct: 18844487 gcaagccccccgccaccttcgcccc 18844511 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 25 agcgagtcttcttcttcctcctcctcc 51 ||||||||||||||||||||||||||| Sbjct: 42859010 agcgagtcttcttcttcctcctcctcc 42858984 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 11232793 gtcttcttcttcctcctcctcctcc 11232817 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 26781858 tcttcttcttcctcctcctcctcc 26781835 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 241 ccggcgacgacgacaagccgacg 263 ||||||||||||||||||||||| Sbjct: 24941997 ccggcgacgacgacaagccgacg 24941975 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 421 cctccgccgccaccaccaccacc 443 ||||||||||||||||||||||| Sbjct: 11893431 cctccgccgccaccaccaccacc 11893409 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctc 53 |||||||||||||||||||||| Sbjct: 40576748 cttcttcttcctcctcctcctc 40576727 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccgt 445 |||||||||||||||||||||| Sbjct: 31426456 ccgccgccaccaccaccaccgt 31426435 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 42592934 tcttcttcctcctcctcctcc 42592954 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcct 52 ||||||||||||||||||||| Sbjct: 41702589 cttcttcttcctcctcctcct 41702569 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 39138413 ccgccgccaccaccaccaccg 39138393 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 37583768 ccgccgccaccaccaccaccg 37583748 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 35684933 ccgccgccaccaccaccaccg 35684913 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 34765393 ccgccgccaccaccaccaccg 34765373 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 31069906 ccgccgccaccaccaccaccg 31069886 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ttcttcttcctcctcctcctc 53 ||||||||||||||||||||| Sbjct: 26863074 ttcttcttcctcctcctcctc 26863054 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 11514468 ccgccgccaccaccaccaccg 11514448 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 41718521 tcttcctcttcctcctcctcctcc 41718498 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 40770600 tcttcttcctcctcctcctc 40770581 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 39051528 tcttcttcctcctcctcctc 39051547 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 34715571 ccgccgccaccaccaccacc 34715590 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 26781855 tcttcttcctcctcctcctcctcc 26781832 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||| ||||| Sbjct: 26586181 tcttcttcttcctcctccgcctcc 26586158 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 26171649 ccgccgccaccaccaccacc 26171668 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 24940551 ccgccgccaccaccaccacc 24940570 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 24356506 ccgccgccaccaccaccacc 24356487 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 22923712 tcttcttcttcctcctcctc 22923693 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 21756096 tcttcttcttcctcctcctc 21756115 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 11232797 tcttcttcctcctcctcctcctcc 11232820 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 10512629 tcttcttcttcctcctcctc 10512648 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 9596351 tcttcctcttcctcctcctcctcc 9596328 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 7516471 tcttcttcatcctcctcctcctcc 7516448 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 3323579 ccgccgccaccaccaccacc 3323560 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 2645223 tcttcttcttcctcctcctc 2645242
>dbj|AP004357.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1074C08 Length = 165701 Score = 125 bits (63), Expect = 2e-25 Identities = 110/123 (89%), Gaps = 2/123 (1%) Strand = Plus / Plus Query: 448 cctccttccacccggccctcgtcgccgtgcagtccaccgtgctcgaggagtacgaccccg 507 |||||||||| || ||||| |||||||| |||||||||||| | |||||||||||||| | Sbjct: 17000 cctccttccagcctgcccttgtcgccgtccagtccaccgtgatggaggagtacgacccgg 17059 Query: 508 ccaggcccaacgactacgaggactaccgtaaggacaaagctc-agcgggccaaggacgcc 566 |||||||||||||||||||||||||| | |||||| |||||| || |||||||||| ||| Sbjct: 17060 ccaggcccaacgactacgaggactacaggaaggac-aagctcaagagggccaaggaggcc 17118 Query: 567 gag 569 ||| Sbjct: 17119 gag 17121 Score = 117 bits (59), Expect = 4e-23 Identities = 124/145 (85%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 190 cgaagatgctgggcgggttgtacggcgacctcccgccgcccacctcggcggccggcgacg 249 |||||||||||||||| ||||||||||||||||||||||| ||| | ||| ||||| Sbjct: 16760 cgaagatgctgggcggattgtacggcgacctcccgccgccg---tcgtcctccgccgacg 16816 Query: 250 acgacaagccgacggcctccgtctggtcgagcgccaccaagatggcgcccccgaccctcc 309 | |||||||| | ||| ||| |||||| |||||| |||||||||||||||| ||||||| Sbjct: 16817 atgacaagccctccgccgccggctggtccagcgccgccaagatggcgccccccaccctcc 16876 Query: 310 gcaagccatccgcgaccttcgcccc 334 ||||||| |||| ||||||||||| Sbjct: 16877 gcaagccccccgccaccttcgcccc 16901
>dbj|AP004641.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1147B04 Length = 142956 Score = 125 bits (63), Expect = 2e-25 Identities = 110/123 (89%), Gaps = 2/123 (1%) Strand = Plus / Plus Query: 448 cctccttccacccggccctcgtcgccgtgcagtccaccgtgctcgaggagtacgaccccg 507 |||||||||| || ||||| |||||||| |||||||||||| | |||||||||||||| | Sbjct: 51621 cctccttccagcctgcccttgtcgccgtccagtccaccgtgatggaggagtacgacccgg 51680 Query: 508 ccaggcccaacgactacgaggactaccgtaaggacaaagctc-agcgggccaaggacgcc 566 |||||||||||||||||||||||||| | |||||| |||||| || |||||||||| ||| Sbjct: 51681 ccaggcccaacgactacgaggactacaggaaggac-aagctcaagagggccaaggaggcc 51739 Query: 567 gag 569 ||| Sbjct: 51740 gag 51742 Score = 117 bits (59), Expect = 4e-23 Identities = 124/145 (85%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 190 cgaagatgctgggcgggttgtacggcgacctcccgccgcccacctcggcggccggcgacg 249 |||||||||||||||| ||||||||||||||||||||||| ||| | ||| ||||| Sbjct: 51381 cgaagatgctgggcggattgtacggcgacctcccgccgccg---tcgtcctccgccgacg 51437 Query: 250 acgacaagccgacggcctccgtctggtcgagcgccaccaagatggcgcccccgaccctcc 309 | |||||||| | ||| ||| |||||| |||||| |||||||||||||||| ||||||| Sbjct: 51438 atgacaagccctccgccgccggctggtccagcgccgccaagatggcgccccccaccctcc 51497 Query: 310 gcaagccatccgcgaccttcgcccc 334 ||||||| |||| ||||||||||| Sbjct: 51498 gcaagccccccgccaccttcgcccc 51522
>gb|AY110254.1| Zea mays CL549_1 mRNA sequence Length = 1370 Score = 117 bits (59), Expect = 4e-23 Identities = 74/79 (93%) Strand = Plus / Plus Query: 466 tcgtcgccgtgcagtccaccgtgctcgaggagtacgaccccgccaggcccaacgactacg 525 ||||||| || |||||||||||||| |||||||||||||| ||||||||||||||||||| Sbjct: 308 tcgtcgctgtccagtccaccgtgctggaggagtacgaccctgccaggcccaacgactacg 367 Query: 526 aggactaccgtaaggacaa 544 |||||||||| |||||||| Sbjct: 368 aggactaccggaaggacaa 386 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 261 acggcctccgtctggtcgagcgccaccaagatggcgcccccgaccctccgcaagcc 316 ||||| ||||| ||||| |||||||||||||||||||| || |||||||||||||| Sbjct: 121 acggcttccgtttggtccagcgccaccaagatggcgcctcccaccctccgcaagcc 176
>dbj|AP006131.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT28E04, TM0229, complete sequence Length = 95108 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 477 cagtccaccgtgctcgaggagtacgaccccgccaggcccaacgactacgagga 529 |||||||| ||| | |||||||||||||| |||||||| |||||||||||||| Sbjct: 79037 cagtccacggtgatggaggagtacgacccggccaggccgaacgactacgagga 78985
>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete sequence Length = 201051 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||||||||| |||| Sbjct: 13880 tcttcttcttcctcctcctcctccctcctcc 13910 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 122790 tcttcctcttcctcctcctcctcc 122813
>emb|AL109753.9|HSJ875J14 Human DNA sequence from clone RP5-875J14 on chromosome Xq13.1-21.1 Contains the 3' end of the ATRX gene for alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae), complete sequence Length = 148423 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||||||||| |||| Sbjct: 138483 tcttcttcttcctcctcctcctccctcctcc 138453
>emb|CR376864.1| Pan troglodytes chromosome X BAC PTB-045G22, complete sequence Length = 151492 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||||||||| |||| Sbjct: 5881 tcttcttcttcctcctcctcctccctcctcc 5911
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518C01 Length = 173555 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 25 agcgagtcttcttcttcctcctcctcc 51 ||||||||||||||||||||||||||| Sbjct: 52744 agcgagtcttcttcttcctcctcctcc 52718
>gb|AC009302.2| Homo sapiens BAC clone RP11-71J24 from 2, complete sequence Length = 180970 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccct 56 ||||||||||||||||||||||||||| Sbjct: 157616 gtcttcttcttcctcctcctcctccct 157642 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 161081 cttcttcctcctcctcctcc 161062
>emb|BX324191.9| Mouse DNA sequence from clone RP23-457L22 on chromosome X, complete sequence Length = 68456 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||||||||| |||| Sbjct: 8247 tcttcttcttcctcctcctcctccctcctcc 8277 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 8244 tcttcttcttcttcctcctcctcc 8267
>gb|AC154401.2| Mus musculus BAC clone RP23-166O7 from 13, complete sequence Length = 199694 Score = 54.0 bits (27), Expect = 5e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||||||||| |||| Sbjct: 110199 tcttcttcttcctcctcctcctccctcctcc 110229 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 82742 tcttcttcttcctcctcctcctc 82720 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 82787 cttcttcctcctcctcctcc 82768 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 82745 tcttcttcttcttcctcctcctcc 82722
>gb|AC164647.3| Mus musculus BAC clone RP23-463P13 from chromosome 16, complete sequence Length = 181953 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctccctgctcc 61 ||||||||||||||||||||||||| |||| Sbjct: 49316 cttcttcttcctcctcctcctccctcctcc 49287 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcct 52 ||||||||||||||||||||| Sbjct: 49361 cttcttcttcctcctcctcct 49341
>gb|AC158954.17| Mus musculus chromosome 15, clone RP23-213P14, complete sequence Length = 188940 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 154853 tcttcttcttcctcctcctcctccct 154828
>gb|AC159425.1| Trypanosoma brucei chromosome 3 clone RPCI93-27F10, complete sequence Length = 135196 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 104835 tcttcttcttcctcctcctcctccct 104810
>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence Length = 1653225 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 180042 tcttcttcttcctcctcctcctccct 180067 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||| ||||||||||||||||||| Sbjct: 472687 tcttcctcttcctcctcctcctccc 472663
>gb|AC160136.2| Mus musculus BAC clone RP23-125E11 from chromosome 16, complete sequence Length = 192119 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 7056 tcttcttcttcctcctcctcctccct 7081 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 110466 tcttcttcctcctcctcctcc 110486 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 156041 tcttcctcttcctcctcctcctcc 156018
>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland Research Institute) complete sequence Length = 194127 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 52708 tcttcttcttcctcctcctcctccct 52683 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 52797 tcttcttcttcctcctcctc 52778
>gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, complete sequence Length = 214848 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 185027 tcttcttcttcctcctcctcctccct 185052 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 185009 tcttcttcctcctcctcctc 185028
>gb|AC148980.6| Mus musculus BAC clone RP23-230C16 from chromosome 7, complete sequence Length = 192433 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 128388 gtcttcttcttcctcctcctcctccc 128363 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 128142 gtcttcttcttcctcctcctcctccc 128117 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 127841 tcttcttcttcctcctcctcctcc 127818 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||| |||| |||| Sbjct: 128928 cttcttcttcctcctcctcccccctcctcc 128899 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 129123 cttcttcctcctcctcctcc 129104 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 127939 tcttcttcttcctcttcctcctcc 127916 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 127844 tcttcttcttcttcctcctcctcc 127821 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 127838 tcttcttcctcctcctcctcctcc 127815
>gb|AC117197.3| Mus musculus BAC clone RP23-127A21 from 16, complete sequence Length = 211410 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 200422 tcttcttcttcctcctcctcctccct 200447 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 ttcttcttcctcctcctcctc 53 ||||||||||||||||||||| Sbjct: 123481 ttcttcttcctcctcctcctc 123501
>gb|AC125191.4| Mus musculus BAC clone RP23-262C22 from 16, complete sequence Length = 196580 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 74171 tcttcttcttcctcctcctcctccct 74146 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 74080 tcttcttcttcctcctcctcctcc 74057 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 73992 tcttcttcttcctcctcctcctcc 73969 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 73889 tcttcttcttcctcctcctcctcc 73866 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 73810 tcttcttcttcctcctcctcctcc 73787 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||| ||||||||||||||||| Sbjct: 74077 tcttcttcctcctcctcctcctccct 74052 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 74174 tcttcttcttcttcctcctcctcc 74151 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 74083 tcttcttcttcttcctcctcctcc 74060 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 73995 tcttcttcttcttcctcctcctcc 73972 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 73989 tcttcttcctcctcctcctcctcc 73966 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 73892 tcttcttcttcttcctcctcctcc 73869 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 73886 tcttcttcctcctcctcctcctcc 73863 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 73813 tcttcttcttcttcctcctcctcc 73790 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 73807 tcttcttcctcctcctcctcctcc 73784
>gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, complete sequence Length = 171990 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 126207 tcttcttcttcctcctcctcctccct 126182 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 126225 tcttcttcctcctcctcctc 126206
>gb|AC155171.7| Mus musculus BAC clone RP23-100A10 from chromosome 7, complete sequence Length = 193027 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 171123 gtcttcttcttcctcctcctcctccc 171148 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 170877 gtcttcttcttcctcctcctcctccc 170902 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 171424 tcttcttcttcctcctcctcctcc 171447 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Plus Query: 32 cttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||| |||| |||| Sbjct: 170337 cttcttcttcctcctcctcccccctcctcc 170366 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 171427 tcttcttcctcctcctcctcctcc 171450 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 171421 tcttcttcttcttcctcctcctcc 171444 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 171326 tcttcttcttcctcttcctcctcc 171349 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 170142 cttcttcctcctcctcctcc 170161
>emb|X69816.1|RNP450AA R.norvegicus CYP17 gene Length = 7556 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 3166 tcttcttcttcctcctcctcctccct 3191 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 tcttcctcctcctcctccct 56 |||||||||||||||||||| Sbjct: 3136 tcttcctcctcctcctccct 3155
>emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chromosome 11 Contains part of the Abca13 gene for ATP-binding cassette sub-family A (ABC1) member 13, complete sequence Length = 205759 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 21 atagagcgagtcttcttcttcctcctcctcctcc 54 |||||| || |||||||||||||||||||||||| Sbjct: 185560 atagagtgactcttcttcttcctcctcctcctcc 185593
>gb|AC127352.5| Mus musculus BAC clone RP23-81P4 from chromosome 7, complete sequence Length = 196031 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 131070 gtcttcttcttcctcctcctcctccc 131095 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 130824 gtcttcttcttcctcctcctcctccc 130849 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 131371 tcttcttcttcctcctcctcctcc 131394 Score = 44.1 bits (22), Expect = 0.50 Identities = 28/30 (93%) Strand = Plus / Plus Query: 32 cttcttcttcctcctcctcctccctgctcc 61 |||||||||||||||||||| |||| |||| Sbjct: 130284 cttcttcttcctcctcctcccccctcctcc 130313 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 131374 tcttcttcctcctcctcctcctcc 131397 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 131368 tcttcttcttcttcctcctcctcc 131391 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 131273 tcttcttcttcctcttcctcctcc 131296 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 130089 cttcttcctcctcctcctcc 130108
>gb|AC099694.12| Mus musculus, clone RP23-195D9, complete sequence Length = 191204 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 27578 tcttcttcttcctcctcctcctccct 27603
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 25556077 tcttcttcttcctcctcctcctccct 25556052 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 18627196 tcttcttcttcctcctcctcctcc 18627219 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcct 52 ||||||||||||||||||||||| Sbjct: 23865869 gtcttcttcttcctcctcctcct 23865847 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 3185871 tcttcttcttcctcctcctcctc 3185849 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 24495488 tcttcttcctcctcctcctcc 24495508 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ttcttcttcctcctcctcctc 53 ||||||||||||||||||||| Sbjct: 21250348 ttcttcttcctcctcctcctc 21250328 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 19116456 tcttcttcctcctcctcctcc 19116436 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 18995919 tcttcttcttcctcctcctcc 18995939 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 10006675 tcttcttcttcctcctcctcc 10006695 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 25556080 tcttcttcttcttcctcctcctcc 25556057 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 24495488 tcttcttcctcctcctcctcctcc 24495511 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 24150446 ccgccgccaccaccaccacc 24150427 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||| ||||||||||||||||| Sbjct: 23703997 gtcttcgtcttcctcctcctcctc 23703974 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 19174058 ccgccgccaccaccaccacc 19174039 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18995916 tcttcttcttcttcctcctcctcc 18995939 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 18627199 tcttcttcctcctcctcctcctcc 18627222 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18627193 tcttcttcttcttcctcctcctcc 18627216 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5556746 cttcttcctcctcctcctcc 5556765 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5551129 cttcttcctcctcctcctcc 5551148 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 4848966 ccgccgccaccaccaccacc 4848947 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 422 ctccgccgccaccaccaccaccgt 445 |||||||||| ||||||||||||| Sbjct: 4741681 ctccgccgccgccaccaccaccgt 4741704 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 3661396 cttcttcctcctcctcctcc 3661377 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 3185874 tcttcttcttcttcctcctcctcc 3185851 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 2089647 ccgccgccaccaccaccacc 2089628
>gb|AC117735.8| Mus musculus chromosome 5, clone RP24-132L16, complete sequence Length = 183861 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 60889 tcttcttcttcctcctcctcctccct 60914 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 60886 tcttcttcttcttcctcctcctcc 60909
>gb|AC110171.29| Mus musculus chromosome 12, clone RP23-400A5, complete sequence Length = 188590 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 122355 gtcttcttcttcctcctcctcctccc 122330 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 115502 tcttcttcttcctcctcctcctc 115480 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctc 50 ||||||||||||||||||||| Sbjct: 122301 gtcttcttcttcctcctcctc 122281 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctc 50 ||||||||||||||||||||| Sbjct: 122208 gtcttcttcttcctcctcctc 122188 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctc 50 ||||||||||||||||||||| Sbjct: 122022 gtcttcttcttcctcctcctc 122002 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||| ||||||||||||||||||| Sbjct: 121946 tcttcctcttcctcctcctcctccc 121922 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 121952 tcttcttcttcctcttcctcctcc 121929 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 115541 tcttcttcttcctcctcctc 115522 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 115505 tcttcttcttcttcctcctcctcc 115482 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 115438 tcttcttcttcctcttcctcctcc 115415 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 115401 tcttcttcttcctcctcctc 115382
>gb|AC123681.12| Mus musculus chromosome 15, clone RP23-287O20, complete sequence Length = 172148 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 38939 tcttcttcttcctcctcctcctccct 38914
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 25484253 tcttcttcttcctcctcctcctccct 25484228 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 18553422 tcttcttcttcctcctcctcctcc 18553445 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcct 52 ||||||||||||||||||||||| Sbjct: 23794074 gtcttcttcttcctcctcctcct 23794052 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 3185816 tcttcttcttcctcctcctcctc 3185794 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 24423694 tcttcttcctcctcctcctcc 24423714 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ttcttcttcctcctcctcctc 53 ||||||||||||||||||||| Sbjct: 21176557 ttcttcttcctcctcctcctc 21176537 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 19042683 tcttcttcctcctcctcctcc 19042663 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 18922146 tcttcttcttcctcctcctcc 18922166 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 10006560 tcttcttcttcctcctcctcc 10006580 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 25484256 tcttcttcttcttcctcctcctcc 25484233 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 24423694 tcttcttcctcctcctcctcctcc 24423717 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 24078652 ccgccgccaccaccaccacc 24078633 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||| ||||||||||||||||| Sbjct: 23632188 gtcttcgtcttcctcctcctcctc 23632165 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 19100285 ccgccgccaccaccaccacc 19100266 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18922143 tcttcttcttcttcctcctcctcc 18922166 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 18553425 tcttcttcctcctcctcctcctcc 18553448 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18553419 tcttcttcttcttcctcctcctcc 18553442 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5556735 cttcttcctcctcctcctcc 5556754 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5551118 cttcttcctcctcctcctcc 5551137 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 4848947 ccgccgccaccaccaccacc 4848928 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 422 ctccgccgccaccaccaccaccgt 445 |||||||||| ||||||||||||| Sbjct: 4741662 ctccgccgccgccaccaccaccgt 4741685 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 3661370 cttcttcctcctcctcctcc 3661351 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 3185819 tcttcttcttcttcctcctcctcc 3185796 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 2089598 ccgccgccaccaccaccacc 2089579
>emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa0070E09 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144084 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 125459 tcttcttcttcctcctcctcctccct 125434 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 125462 tcttcttcttcttcctcctcctcc 125439
>emb|AL732537.4|CNS08C9C Oryza sativa chromosome 12, . BAC OSJNBa0036L12 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 127003 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 117641 tcttcttcttcctcctcctcctccct 117666 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 117638 tcttcttcttcttcctcctcctcc 117661
>emb|CT485796.1| Medicago truncatula chromosome 5 clone mth2-154i23, COMPLETE SEQUENCE Length = 129047 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||||| Sbjct: 93165 gtcttcttcttcctcctcctcctccc 93190
>emb|AL606509.6| Mouse DNA sequence from clone RP23-415B9 on chromosome 11, complete sequence Length = 197852 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccct 56 |||||||||||||||||||||||||| Sbjct: 193279 tcttcttcttcctcctcctcctccct 193304 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 193276 tcttcttcttcttcctcctcctcc 193299
>gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 226269 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 6111 tcttcttcttcctcctcctcctccc 6135 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 25181 tcttcttcttcctcctcctcctcc 25204 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 25060 tcttcttcttcctcctcctcctcc 25083 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 25184 tcttcttcctcctcctcctcctcc 25207 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 25063 tcttcttcctcctcctcctcctcc 25086
>gb|AC165952.4| Mus musculus BAC clone RP23-460G24 from chromosome 14, complete sequence Length = 183416 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 86638 gtcttcttcttcctcctcctcctcc 86662 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 86642 tcttcttcctcctcctcctcctcc 86665
>ref|NM_103725.2| Arabidopsis thaliana unknown protein AT1G48280 mRNA, complete cds Length = 1949 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 893 cgcctccgccgccaccaccaccacc 917
>gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, complete sequence Length = 208483 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 59792 tcttcttcttcctcctcctcctccc 59768 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 92840 tcttcttcttcctcctcctc 92821 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 92822 tcttcttcctcctcctcctc 92803 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 59795 tcttcttcttcttcctcctcctcc 59772
>ref|XM_470590.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2124 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 116 tcttcttcttcctcctcctcctccc 92 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 119 tcttcttcttcttcctcctcctcc 96
>ref|NM_189224.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 801 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 135 gtcttcttcttcctcctcctcctcc 111 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 131 tcttcttcctcctcctcctcctcc 108
>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete sequence Length = 206281 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 55318 tcttcttcttcctcctcctcctccc 55342 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 55348 tcttcttcttcctcctcctcctcc 55371 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 ttcttcttcctcctcctcctcc 54 |||||||||||||||||||||| Sbjct: 55466 ttcttcttcctcctcctcctcc 55487 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 33 ttcttcttcctcctcctcctcc 54 |||||||||||||||||||||| Sbjct: 51429 ttcttcttcctcctcctcctcc 51450 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 |||||||| |||||||||||||||| Sbjct: 55351 tcttcttcctcctcctcctcctccc 55375 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 55467 tcttcttcctcctcctcctcctcc 55490 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 55345 tcttcttcttcttcctcctcctcc 55368 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 55315 tcttcttcttcttcctcctcctcc 55338
>gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosome 19, complete sequence Length = 188848 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 103418 tcttcttcttcctcctcctcctccc 103394 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 103421 tcttcttcttcttcctcctcctcc 103398
>gb|AC107754.9| Mus musculus chromosome 7, clone RP23-231J2, complete sequence Length = 171637 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 144194 tcttcttcttcctcctcctcctccc 144218 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 144013 tcttcttcttcctcctcctcctcc 144036 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 144016 tcttcttcctcctcctcctcctcc 144039
>gb|AC158358.5| Mus musculus BAC clone RP23-429K3 from chromosome 14, complete sequence Length = 198706 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 50445 gtcttcttcttcctcctcctcctcc 50421 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 50441 tcttcttcctcctcctcctcctcc 50418
>gb|AC139062.10| Mus musculus chromosome 17, clone RP23-69L11, complete sequence Length = 136224 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 14665 tcttcttcttcctcctcctcctccc 14641 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 35772 tcttcctcttcctcctcctcctcc 35795 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 14668 tcttcttcttcttcctcctcctcc 14645
>gb|AC125688.6| Rattus norvegicus 20 BAC CH230-186I2 (Children's Hospital Oakland Research Institute) complete sequence Length = 209618 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 72822 tcttcttcttcctcctcctcctccc 72846 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 62809 tcttcttcttcctcttcctcctcc 62786 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 62803 tcttcctcttcctcctcctcctcc 62780
>gb|AC140845.2| Mus musculus BAC clone RP24-386C13 from chromosome 8, complete sequence Length = 153426 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 104134 tcttcttcttcctcctcctcctccc 104110 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 100411 tcttcttcctcctcctcctcc 100431 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 104137 tcttcttcttcttcctcctcctcc 104114
>gb|AC102312.11| Mus musculus chromosome 10, clone RP24-428L4, complete sequence Length = 182940 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 19252 tcttcttcttcctcctcctcctccc 19276 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 19249 tcttcttcttcttcctcctcctcc 19272
>gb|AC131912.6| Mus musculus chromosome 9, clone RP24-164A20, complete sequence Length = 204724 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 77846 gtcttcttcttcctcctcctcctcc 77870 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 114740 tcttcctcttcctcctcctcctcc 114717 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 77850 tcttcttcctcctcctcctcctcc 77873
>gb|AC159209.2| Mus musculus BAC clone RP23-100C6 from chromosome 13, complete sequence Length = 212761 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 32 cttcttcttcctcctcctcctccct 56 ||||||||||||||||||||||||| Sbjct: 2790 cttcttcttcctcctcctcctccct 2814 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 14595 tcttcttcttcctcctcctcctcc 14618 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 14687 tcttcctcttcctcctcctcctcc 14710 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 14681 tcttcttcttcctcttcctcctcc 14704 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 14598 tcttcttcctcctcctcctcctcc 14621 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 14592 tcttcttcttcttcctcctcctcc 14615
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 5609689 tcttcttcttcctcctcctcctccc 5609665 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 22235264 tcttcttcttcctcctcctcctcc 22235287 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 427 ccgccaccaccaccaccgtacc 448 |||||||||||||||||||||| Sbjct: 34831584 ccgccaccaccaccaccgtacc 34831605 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccaccg 444 |||| ||||||||||||||||||||| Sbjct: 33931163 cgccgccgccgccaccaccaccaccg 33931188 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 22089742 tcttcttcttcctcctcctcct 22089721 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 16568342 tcttcttcttcctcctcctcct 16568363 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 35215341 tcttcttcttcctcctcctcc 35215361 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 34896260 ccgccgccaccaccaccaccg 34896280 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 421 cctccgccgccaccaccaccaccgt 445 ||||||||||| ||||||||||||| Sbjct: 22436753 cctccgccgccgccaccaccaccgt 22436777 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 18268192 tcttcttcctcctcctcctcc 18268212 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 12485050 tcttcttcttcctcctcctcc 12485070 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 |||| |||||||||||||||||||| Sbjct: 9041136 cgccgccgccgccaccaccaccacc 9041112 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccctg 57 |||| |||| |||||||||||||||||| Sbjct: 30033098 gtctccttcgtcctcctcctcctccctg 30033071 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 27150427 cttcttcctcctcctcctcc 27150408 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 cctcctcctcctccctgctc 60 |||||||||||||||||||| Sbjct: 24652150 cctcctcctcctccctgctc 24652169 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 417 ctcgcctccgccgccaccaccaccaccg 444 |||||| |||||||||||| |||||||| Sbjct: 23280331 ctcgccgccgccgccaccagcaccaccg 23280358 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 22554866 ccgccgccaccaccaccacc 22554885 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 22235267 tcttcttcctcctcctcctcctcc 22235290 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 22235261 tcttcttcttcttcctcctcctcc 22235284 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 18268192 tcttcttcctcctcctcctcctcc 18268215 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccac 442 |||||||||||||| ||||||||| Sbjct: 17350897 cgcctccgccgccatcaccaccac 17350920 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 16568339 tcttcttcttcttcctcctcctcc 16568362 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 15483811 tcttcttcttcctcctcctc 15483830 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 12536708 tcttcttcctcctcctcctc 12536727 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 12328277 cttcttcctcctcctcctcc 12328296 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 10120531 tcttcctcttcctcctcctcctcc 10120508 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5689360 cttcttcctcctcctcctcc 5689379 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 5609692 tcttcttcttcttcctcctcctcc 5609669 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 4185271 cttcttcctcctcctcctcc 4185252 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 636064 cttcttcctcctcctcctcc 636045 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 417 ctcgcctccgccgccaccaccacc 440 ||||||||| |||||||||||||| Sbjct: 45242 ctcgcctcctccgccaccaccacc 45265
>gb|AC007096.3| Homo sapiens BAC clone RP11-306F13 from 7, complete sequence Length = 35036 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 5535 tcttcttcttcctcctcctcctccc 5559 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 5532 tcttcttcttcttcctcctcctcc 5555
>gb|AC113125.8| Mus musculus chromosome 14, clone RP23-350B18, complete sequence Length = 220629 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 201569 gtcttcttcttcctcctcctcctcc 201545 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 201565 tcttcttcctcctcctcctcctcc 201542
>ref|XM_895645.2| PREDICTED: Mus musculus hypothetical LOC620139 (LOC620139), mRNA Length = 264 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 135 gtcttcttcttcctcctcctcctcc 111 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 131 tcttcttcctcctcctcctcctcc 108
>gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome 19, complete sequence Length = 247655 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 162201 tcttcttcttcctcctcctcctccc 162177 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 162204 tcttcttcttcttcctcctcctcc 162181
>gb|AC132957.3| Mus musculus BAC clone RP23-149E9 from chromosome 19, complete sequence Length = 246177 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 222405 tcttcttcttcctcctcctcctccc 222381 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 222408 tcttcttcttcttcctcctcctcc 222385
>gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosome 16, complete sequence Length = 196519 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 88225 tcttcttcttcctcctcctcctccc 88201 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 88228 tcttcttcttcttcctcctcctcc 88205
>gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosome 17, complete sequence Length = 147557 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 140694 tcttcttcttcctcctcctcctccc 140718
>gb|AC132118.3| Mus musculus BAC clone RP23-467C14 from chromosome 5, complete sequence Length = 175070 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 160484 tcttcttcttcctcctcctcctccc 160460 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 160487 tcttcttcttcttcctcctcctcc 160464 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 96460 tcttcctcttcctcctcctcctcc 96437
>gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosome 15, complete sequence Length = 205859 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 60514 gtcttcttcttcctcctcctcctcc 60490 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 60411 tcttcttcttcctcctcctcctcc 60388 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||| |||||||||||||||| Sbjct: 74912 tcttctttttcctcctcctcctcc 74935 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 60510 tcttcttcctcctcctcctcctcc 60487 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 60414 tcttcttcttcttcctcctcctcc 60391 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 60408 tcttcttcctcctcctcctcctcc 60385 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 9151 tcttcttcttcctcctcctc 9170
>gb|AC124376.4| Mus musculus BAC clone RP24-573J18 from chromosome 15, complete sequence Length = 139636 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 139040 gtcttcttcttcctcctcctcctcc 139016 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 138937 tcttcttcttcctcctcctcctcc 138914 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 139036 tcttcttcctcctcctcctcctcc 139013 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 138940 tcttcttcttcttcctcctcctcc 138917 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 138934 tcttcttcctcctcctcctcctcc 138911 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 87698 tcttcttcttcctcctcctc 87717
>gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosome 18, complete sequence Length = 212786 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 21346 tcttcttcttcctcctcctcctccc 21370 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 21343 tcttcttcttcttcctcctcctcc 21366
>gb|AC127358.3| Mus musculus BAC clone RP23-109B9 from chromosome 18, complete sequence Length = 162003 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 149698 gtcttcttcttcctcctcctcctcc 149674 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 149599 gtcttcttcttcctcctcctcctcc 149575 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||| ||||||||||| Sbjct: 149671 gtcttcttcttcttcctcctcctc 149648 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||| ||||||||||| Sbjct: 149572 gtcttcttcttcttcctcctcctc 149549
>gb|AC127678.9| Mus musculus BAC clone RP24-233M12 from chromosome 18, complete sequence Length = 157430 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 144443 gtcttcttcttcctcctcctcctcc 144467 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 144344 gtcttcttcttcctcctcctcctcc 144368 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 64557 tcttcttcttcctcctcctcct 64536 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 144474 tcttcttcttcctcctcctc 144493 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||| ||||||||||| Sbjct: 144470 gtcttcttcttcttcctcctcctc 144493 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 144375 tcttcttcttcctcctcctc 144394 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||| ||||||||||| Sbjct: 144371 gtcttcttcttcttcctcctcctc 144394 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 64560 tcttcttcttcttcctcctcctcc 64537
>gb|AC125524.4| Mus musculus BAC clone RP24-378N16 from chromosome 6, complete sequence Length = 175917 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 45127 tcttcttcttcctcctcctcctccc 45103
>gb|AC125198.4| Mus musculus BAC clone RP23-254B9 from 14, complete sequence Length = 205392 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 190716 gtcttcttcttcctcctcctcctcc 190740 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 |||||| |||||||||||||||||| Sbjct: 12521 gtcttcctcttcctcctcctcctcc 12545 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 190720 tcttcttcctcctcctcctcctcc 190743
>ref|XM_662605.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.60020) partial mRNA Length = 2340 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 156 gtcttcttcttcctcctcctcctcc 132
>gb|AC162802.4| Mus musculus BAC clone RP23-363M4 from chromosome 5, complete sequence Length = 234206 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 97071 tcttcttcttcctcctcctcctccc 97047 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 97074 tcttcttcttcttcctcctcctcc 97051 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 33047 tcttcctcttcctcctcctcctcc 33024
>emb|CR407583.5| Zebrafish DNA sequence from clone DKEY-151C12 in linkage group 7, complete sequence Length = 104674 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 56954 gtcttcttcttcctcctcctcctcc 56978 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 56958 tcttcttcctcctcctcctcctcc 56981
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3' end of the KCNN3 gene for potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, a novel gene and the 5' end of the ADAR gene for adenosine deaminase, RNA-specific, complete sequence Length = 173014 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 169173 tcttcttcttcctcctcctcctccc 169149 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 169714 tcttcttcttcctcctcctc 169695 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 169672 tcttcctcttcctcctcctcctcc 169649 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 169424 tcttcctcttcctcctcctcctcc 169401
>gb|AC094014.3| Papio anubis clone RP41-371B12, complete sequence Length = 161946 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 142139 tcttcttcttcctcctcctcctccc 142115 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 142142 tcttcttcttcttcctcctcctcc 142119
>emb|BX538350.1| Cryptosporidium parvum chromosome 6, complete sequence; segment 1/4 Length = 287050 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 23084 gtcttcttcttcctcctcctcctcc 23108
>gb|AC152396.4| Mus musculus chromosome 18, clone RP23-175I15, complete sequence Length = 185947 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 49645 tcttcttcttcctcctcctcctccc 49621
>gb|AC101690.7| Mus musculus chromosome 7, clone RP23-218E6, complete sequence Length = 229964 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 32 cttcttcttcctcctcctcctccct 56 ||||||||||||||||||||||||| Sbjct: 58382 cttcttcttcctcctcctcctccct 58406
>gb|AC141420.11| Pan troglodytes clone rp43-149n17, complete sequence Length = 167816 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 98105 gtcttcttcttcctcctcctcctcc 98081
>gb|AC138065.25| Pan troglodytes clone rp43-11g4, complete sequence Length = 173247 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 172602 gtcttcttcttcctcctcctcctcc 172626
>gb|DP000056.1| Pan troglodytes chromosome Y chry_random_3 genomic scaffold Length = 331329 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 317151 gtcttcttcttcctcctcctcctcc 317175
>ref|NM_132778.1| Drosophila melanogaster CG9095-RA (CG9095), mRNA Length = 4796 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 3416 cgcctccgccgccaccaccaccacc 3392
>gb|AC090489.8| Genomic sequence for Mus musculus, clone RP23-104O10, complete sequence Length = 207424 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 123395 tcttcttcttcctcctcctcctccc 123419
>gb|AC172372.2| Pan troglodytes BAC clone CH251-1067L6 from chromosome y, complete sequence Length = 192570 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 102260 gtcttcttcttcctcctcctcctcc 102236 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 7743 gtcttcttcttcctcctcctcctcc 7767 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 102256 tcttcttcctcctcctcctcctcc 102233 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 7747 tcttcttcctcctcctcctcctcc 7770
>gb|AC024996.6| Homo sapiens chromosome 8, clone RP11-697C18, complete sequence Length = 177864 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 122362 tcttcttcttcctcctcctcctccc 122386 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 122359 tcttcttcttcttcctcctcctcc 122382
>gb|AC134860.4| Mus musculus BAC clone RP23-388A16 from chromosome 13, complete sequence Length = 206634 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 32 cttcttcttcctcctcctcctccct 56 ||||||||||||||||||||||||| Sbjct: 172167 cttcttcttcctcctcctcctccct 172191 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 183972 tcttcttcttcctcctcctcctcc 183995 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 184064 tcttcctcttcctcctcctcctcc 184087 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 184058 tcttcttcttcctcttcctcctcc 184081 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 183975 tcttcttcctcctcctcctcctcc 183998 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 183969 tcttcttcttcttcctcctcctcc 183992
>gb|AC159246.2| Mus musculus BAC clone RP24-266N21 from chromosome 9, complete sequence Length = 147269 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 71106 cgcctccgccgccaccaccaccacc 71082
>gb|AY056802.1| Arabidopsis thaliana At1g48280/F11A17_25 mRNA, complete cds Length = 1433 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 376 cgcctccgccgccaccaccaccacc 400
>emb|CR406996.1| Gallus gallus finished cDNA, clone ChEST1004j2 Length = 1641 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 671 tcttcttcttcctcctcctcctccc 695
>ref|XM_625349.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd6_90), partial mRNA Length = 2340 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 156 gtcttcttcttcctcctcctcctcc 132
>gb|S65290.1|S65279S06 drebrin {clone eDcg5} [chickens, Genomic, 1001 nt, segment 6 of 10] Length = 1001 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 379 tcttcttcttcctcctcctcctccc 403
>gb|S65267.1| Gallus gallus drebrin A mRNA, alternatively spliced, partial cds Length = 1919 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 597 tcttcttcttcctcctcctcctccc 621
>gb|AF336797.2|AF336797 Homo sapiens small-conductance calcium-activated potassium channel (KCNN3) gene, complete cds Length = 163217 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 115307 tcttcttcttcctcctcctcctccc 115331 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 114941 tcttcttcttcctcctcctcctccc 114965 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 114690 tcttcctcttcctcctcctcctcc 114713 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 114442 tcttcctcttcctcctcctcctcc 114465 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 114400 tcttcttcttcctcctcctc 114419
>gb|AC113955.20| Mus musculus chromosome 7, clone RP23-402K24, complete sequence Length = 196206 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 106196 gtcttcttcttcctcctcctcctcc 106220 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 106200 tcttcttcctcctcctcctcctcc 106223
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 4903916 tcttcttcttcctcctcctcctccc 4903940 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 9373800 tcttcttcttcctcctcctcctcc 9373823 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||||||||||||||| Sbjct: 2714073 gtcttcttcttcctcctcctcctc 2714096 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctccc 55 |||||||||||||||||||||| Sbjct: 24658625 tcttcttcctcctcctcctccc 24658604 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 9300157 tcttcttcttcctcctcctcct 9300178 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 29662008 tcttcttcctcctcctcctcc 29661988 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctc 50 ||||||||||||||||||||| Sbjct: 27854625 gtcttcttcttcctcctcctc 27854605 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccacc 443 |||| |||||||||||||||||||| Sbjct: 24637467 cgccaccgccgccaccaccaccacc 24637491 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 24323340 ccgccgccaccaccaccaccg 24323360 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 23796686 tcttcttcctcctcctcctcc 23796706 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccaccgtaccctcc 452 |||||||| ||||| |||||||||||||| Sbjct: 20660009 ccgccgccgccaccgccaccgtaccctcc 20660037 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 17807026 tcttcttcttcctcctcctcc 17807006 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 421 cctccgccgccaccaccaccaccgt 445 |||||||| |||||||||||||||| Sbjct: 11918150 cctccgccaccaccaccaccaccgt 11918174 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 10525470 tcttcttcctcctcctcctcc 10525450 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 10523052 tcttcttcctcctcctcctcc 10523032 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 228 cccacctcggcggccggcgacgacgacaa 256 |||||||| || ||||||||||||||||| Sbjct: 7834512 cccacctccgccgccggcgacgacgacaa 7834484 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 |||||||||||| |||||||||||| Sbjct: 4903912 gtcttcttcttcttcctcctcctcc 4903936 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctc 50 ||||||||||||||||||||| Sbjct: 1413312 gtcttcttcttcctcctcctc 1413332 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 1387279 ccgccgccaccaccaccaccg 1387259 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 1387213 ccgccgccaccaccaccaccg 1387193 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 29662008 tcttcttcctcctcctcctcctcc 29661985 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 29376980 tcttcttcttcctcctcctc 29376961 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 29370180 cttcttcctcctcctcctcc 29370161 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 28167872 cttcttcctcctcctcctcc 28167891 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 23796624 tcttcttcctcctcctcctc 23796643 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 23426823 ccgccgccaccaccaccacc 23426804 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 23426796 ccgccgccaccaccaccacc 23426777 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 23398674 tcttcttcttcctcctcctc 23398655 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 21989150 tcttcttcttcctcctcctc 21989131 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 20668160 ccgccgccaccaccaccacc 20668179 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 423 tccgccgccaccaccaccaccgta 446 |||||| ||||||||||||||||| Sbjct: 12141558 tccgccaccaccaccaccaccgta 12141535 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 10761280 ccgccgccaccaccaccacc 10761261 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 10091786 cttcttcctcctcctcctcc 10091805 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 10091742 cttcttcctcctcctcctcc 10091761 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 7926770 ccgccgccaccaccaccacc 7926789 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 6070221 ccgccgccaccaccaccacc 6070202
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 5608902 tcttcttcttcctcctcctcctccc 5608878 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 22228293 tcttcttcttcctcctcctcctcc 22228316 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 427 ccgccaccaccaccaccgtacc 448 |||||||||||||||||||||| Sbjct: 34921656 ccgccaccaccaccaccgtacc 34921677 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccaccg 444 |||| ||||||||||||||||||||| Sbjct: 34021635 cgccgccgccgccaccaccaccaccg 34021660 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 22082771 tcttcttcttcctcctcctcct 22082750 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 16561975 tcttcttcttcctcctcctcct 16561996 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 35305413 tcttcttcttcctcctcctcc 35305433 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccaccg 444 ||||||||||||||||||||| Sbjct: 34986332 ccgccgccaccaccaccaccg 34986352 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 421 cctccgccgccaccaccaccaccgt 445 ||||||||||| ||||||||||||| Sbjct: 22429782 cctccgccgccgccaccaccaccgt 22429806 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 18261733 tcttcttcctcctcctcctcc 18261753 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 12481813 tcttcttcttcctcctcctcc 12481833 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 |||| |||||||||||||||||||| Sbjct: 9038969 cgccgccgccgccaccaccaccacc 9038945 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccctg 57 |||| |||| |||||||||||||||||| Sbjct: 30124520 gtctccttcgtcctcctcctcctccctg 30124493 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 27241750 cttcttcctcctcctcctcc 27241731 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 cctcctcctcctccctgctc 60 |||||||||||||||||||| Sbjct: 24569619 cctcctcctcctccctgctc 24569638 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 417 ctcgcctccgccgccaccaccaccaccg 444 |||||| |||||||||||| |||||||| Sbjct: 23273359 ctcgccgccgccgccaccagcaccaccg 23273386 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 ccgccgccaccaccaccacc 443 |||||||||||||||||||| Sbjct: 22547895 ccgccgccaccaccaccacc 22547914 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 22228296 tcttcttcctcctcctcctcctcc 22228319 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 22228290 tcttcttcttcttcctcctcctcc 22228313 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 18261733 tcttcttcctcctcctcctcctcc 18261756 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccac 442 |||||||||||||| ||||||||| Sbjct: 17344438 cgcctccgccgccatcaccaccac 17344461 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 16561972 tcttcttcttcttcctcctcctcc 16561995 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 15478345 tcttcttcttcctcctcctc 15478364 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 12533471 tcttcttcctcctcctcctc 12533490 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 12325040 cttcttcctcctcctcctcc 12325059 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 10118652 tcttcctcttcctcctcctcctcc 10118629 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 5688573 cttcttcctcctcctcctcc 5688592 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 5608905 tcttcttcttcttcctcctcctcc 5608882 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 4185380 cttcttcctcctcctcctcc 4185361 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 636062 cttcttcctcctcctcctcc 636043 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 417 ctcgcctccgccgccaccaccacc 440 ||||||||| |||||||||||||| Sbjct: 45242 ctcgcctcctccgccaccaccacc 45265
>gb|AC018488.7|AC018488 Drosophila melanogaster, chromosome X, region 13A-13B, BAC clone BACR09F03, complete sequence Length = 165118 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 77107 cgcctccgccgccaccaccaccacc 77131
>gb|AC175060.2| Pan troglodytes BAC clone CH251-724O9 from chromosome y, complete sequence Length = 196548 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 174258 gtcttcttcttcctcctcctcctcc 174282 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 174262 tcttcttcctcctcctcctcctcc 174285
>gb|AC154685.2| Mus musculus BAC clone RP24-321G16 from chromosome 17, complete sequence Length = 162362 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 19073 tcttcttcttcctcctcctcctccc 19097 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 19070 tcttcttcttcttcctcctcctcc 19093
>gb|AC140263.3| Mus musculus BAC clone RP24-299F13 from chromosome 17, complete sequence Length = 158695 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 50047 tcttcttcttcctcctcctcctccc 50071
>gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, complete sequence Length = 158242 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 80210 tcttcttcttcctcctcctcctccc 80234 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctccc 55 |||||||||||||||||||||| Sbjct: 80101 tcttcttcctcctcctcctccc 80122 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 79961 tcttcttcttcctcctcctcct 79982 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 80207 tcttcttcttcttcctcctcctcc 80230 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 79803 tcttcttcttcctcctcctc 79822
>gb|BT004847.1| Drosophila melanogaster RE70412 full insert cDNA Length = 4601 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 3214 cgcctccgccgccaccaccaccacc 3190
>gb|AC172373.3| Pan troglodytes BAC clone CH251-1081D19 from chromosome y, complete sequence Length = 194913 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 46223 gtcttcttcttcctcctcctcctcc 46199 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 46219 tcttcttcctcctcctcctcctcc 46196
>gb|AC092431.7| Homo sapiens BAC clone RP11-77O7 from 2, complete sequence Length = 192725 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 129114 gtcttcttcttcctcctcctcctcc 129138 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 129118 tcttcttcctcctcctcctcctcc 129141
>gb|AC163726.3| Pan troglodytes BAC clone CH251-653B19 from chromosome y, complete sequence Length = 207364 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 193188 gtcttcttcttcctcctcctcctcc 193212
>gb|AC098807.3| Papio anubis clone RP41-157N15, complete sequence Length = 212643 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 74163 tcttcttcttcctcctcctcctccc 74187 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 |||||||||||| |||||||||||| Sbjct: 74159 gtcttcttcttcttcctcctcctcc 74183
>gb|AC105928.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0014O06, complete sequence Length = 168031 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 73388 tcttcttcttcctcctcctcctccc 73364 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 153059 cttcttcctcctcctcctcc 153078 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 73391 tcttcttcttcttcctcctcctcc 73368
>gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109972 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 57555 gtcttcttcttcctcctcctcctcc 57531 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 57551 tcttcttcctcctcctcctcctcc 57528
>gb|AC007932.3|F11A17 Arabidopsis thaliana chromosome 1 BAC F11A17 sequence, complete sequence Length = 102078 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 67954 cgcctccgccgccaccaccaccacc 67930
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 163 ccgccgccggtgccgctcccgcttt 187 ||||||||||||||||||||||||| Sbjct: 2406955 ccgccgccggtgccgctcccgcttt 2406979
>dbj|AP003206.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1146F03 Length = 137047 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 124586 gtcttcttcttcctcctcctcctcc 124610 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 124590 tcttcttcctcctcctcctcctcc 124613
>dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0475H04 Length = 143337 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 20198 gtcttcttcttcctcctcctcctcc 20222 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 20202 tcttcttcctcctcctcctcctcc 20225
>dbj|AP003510.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0528E04 Length = 170701 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 91399 tcttcttcttcctcctcctcctccc 91423 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 |||||||||||| |||||||||||| Sbjct: 91395 gtcttcttcttcttcctcctcctcc 91419
>emb|BX000488.8| Zebrafish DNA sequence from clone CH211-286F18 in linkage group 14, complete sequence Length = 97160 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 234 gtcttcttcttcctcctcctcctcc 258 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 238 tcttcttcctcctcctcctcctcc 261
>emb|AL713977.13| Mouse DNA sequence from clone RP23-303A21 on chromosome X, complete sequence Length = 159014 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 13715 tcttcttcttcctcctcctcctccc 13739
>gb|AC116730.7| Mus musculus chromosome 1, clone RP23-346J11, complete sequence Length = 208503 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 202563 gtcttcttcttcctcctcctcctcc 202539 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 197282 tcttcttcttcctcctcctcctc 197304 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctccc 55 |||||||||||||||||||||| Sbjct: 37544 tcttcttcctcctcctcctccc 37565 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 |||||||| |||||||||||||||| Sbjct: 202559 tcttcttcctcctcctcctcctccc 202535 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 197243 tcttcctcttcctcctcctcctcc 197266
>dbj|AK099496.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013027L08, full insert sequence Length = 912 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 95 gtcttcttcttcctcctcctcctcc 71 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 91 tcttcttcctcctcctcctcctcc 68
>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete sequence Length = 168760 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 142745 gtcttcttcttcctcctcctcctcc 142769 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 142749 tcttcttcctcctcctcctcctcc 142772
>gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232977 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 173495 tcttcttcttcctcctcctcctccc 173471 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 5190 tcttcttcctcctcctcctcc 5170
>gb|AC175059.2| Pan troglodytes BAC clone CH251-777D16 from chromosome y, complete sequence Length = 166448 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 49256 gtcttcttcttcctcctcctcctcc 49232
>gb|AC158127.3| Mus musculus chromosome 19, clone RP23-135N12, complete sequence Length = 217544 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 25071 tcttcttcttcctcctcctcctccc 25095 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 25068 tcttcttcttcttcctcctcctcc 25091
>emb|AL157957.4|CNS01RGF Human chromosome 14 DNA sequence BAC R-969O13 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 202212 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 29 agtcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||||| Sbjct: 92229 agtcttcttcttcctcctcctcctc 92253
>emb|AL358293.4|CNS05TE0 Human chromosome 14 DNA sequence BAC R-398E10 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 197927 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 101285 tcttcttcttcctcctcctcctccc 101261 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 101288 tcttcttcttcttcctcctcctcc 101265
>gb|AE003498.5| Drosophila melanogaster chromosome X, section 50 of 74 of the complete sequence Length = 341520 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 419 cgcctccgccgccaccaccaccacc 443 ||||||||||||||||||||||||| Sbjct: 77862 cgcctccgccgccaccaccaccacc 77886
>gb|AC118684.9| Mus musculus chromosome 17, clone RP23-414B17, complete sequence Length = 202561 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 58980 tcttcttcttcctcctcctcctccc 58956 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 59090 tcttcttcttcctcctcctcctcc 59067 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 59093 tcttcttcttcttcctcctcctcc 59070 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 59087 tcttcttcctcctcctcctcctcc 59064
>gb|AC102173.15| Mus musculus chromosome 18, clone RP23-472D7, complete sequence Length = 185768 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 183942 tcttcttcttcctcctcctcctccc 183918
>emb|AL591936.12| Mouse DNA sequence from clone RP23-28B10 on chromosome 2, complete sequence Length = 147431 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 20437 gtcttcttcttcctcctcctcctcc 20413 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||| ||||||| Sbjct: 20506 tcttcttcttcctccttctcctcc 20483
>gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosome 19, complete sequence Length = 148454 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 41191 tcttcttcttcctcctcctcctccc 41167 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 41194 tcttcttcttcttcctcctcctcc 41171
>gb|AC141878.4| Mus musculus BAC clone RP24-257N14 from 14, complete sequence Length = 192097 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 36123 gtcttcttcttcctcctcctcctcc 36099 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 36119 tcttcttcctcctcctcctcctcc 36096
>emb|AJ811963.1| Linum album mRNA for cinnamyl-alcohol dehydrogenase (cad gene) Length = 1291 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 12 gtcttcttcttcctcctcctcctcc 36 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 16 tcttcttcctcctcctcctcctcc 39
>emb|AL772342.12| Mouse DNA sequence from clone RP23-105D19 on chromosome 2, complete sequence Length = 206806 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 59043 tcttcttcttcctcctcctcctccc 59019 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 59046 tcttcttcttcttcctcctcctcc 59023
>gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome 17, complete sequence Length = 219548 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 155127 tcttcttcttcctcctcctcctccc 155151 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 155124 tcttcttcttcttcctcctcctcc 155147 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 133968 tcttcctcttcctcctcctcctcc 133945
>emb|AL928719.6| Mouse DNA sequence from clone RP23-419G21 on chromosome 2, complete sequence Length = 197909 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 37 tcttcctcctcctcctccctgctcc 61 ||||||||||||||||||||||||| Sbjct: 150511 tcttcctcctcctcctccctgctcc 150535
>gb|AC136457.3| Mus musculus BAC clone RP23-76G19 from chromosome 13, complete sequence Length = 204369 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 168078 gtcttcttcttcctcctcctcctcc 168054 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctc 53 |||||||||||||||||||||||| Sbjct: 171350 gtcttcttcttcctcctcctcctc 171327 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 168074 tcttcttcctcctcctcctcctcc 168051
>gb|AC168071.4| Mus musculus BAC clone RP23-97D14 from chromosome 14, complete sequence Length = 270731 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 50449 gtcttcttcttcctcctcctcctcc 50425 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 50445 tcttcttcctcctcctcctcctcc 50422
>gb|AC101992.11| Mus musculus chromosome 3, clone RP24-377J3, complete sequence Length = 191967 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 105109 tcttcttcttcctcctcctcctccc 105085 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 105112 tcttcttcttcttcctcctcctcc 105089
>gb|AC108836.23| Mus musculus chromosome 19, clone RP23-276L15, complete sequence Length = 196065 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 135631 tcttcttcttcctcctcctcctccc 135655 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 135628 tcttcttcttcttcctcctcctcc 135651
>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete sequence Length = 239244 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 181250 tcttcttcttcctcctcctcctccc 181226 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcc 51 |||||||||||||||||||||| Sbjct: 158382 gtcttcttcttcctcctcctcc 158361
>gb|AC164875.14| Mus musculus chromosome 1, clone RP23-59P14, complete sequence Length = 250957 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 ||||||||||||||||||||||||| Sbjct: 26044 gtcttcttcttcctcctcctcctcc 26020 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 20755 tcttcttcttcctcctcctcctc 20777 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 |||||||| |||||||||||||||| Sbjct: 26040 tcttcttcctcctcctcctcctccc 26016 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 20716 tcttcctcttcctcctcctcctcc 20739
>gb|AC170752.2| Mus musculus BAC clone RP23-116B8 from chromosome 10, complete sequence Length = 194054 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 30279 tcttcttcttcctcctcctcctccc 30303
>gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 231740 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||||||||||||| Sbjct: 45950 tcttcttcttcctcctcctcctccc 45926 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 45953 tcttcttcttcttcctcctcctcc 45930
>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence Length = 214638 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 23655 tcttcttcttcctcctcctcctcc 23632 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 18238 tcttcttcttcctcctcctcctcc 18215 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 18436 tcttcttcttcctcctcctcctc 18414 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 18325 tcttcttcttcctcctcctcctc 18303 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||||||| |||||| Sbjct: 23619 tcttcttcttcctcctcttcctcc 23596 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||| ||||||||||||| Sbjct: 18472 tcttcttctttctcctcctcctcc 18449 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18439 tcttcttcttcttcctcctcctcc 18416 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||| ||||||||||||| Sbjct: 18361 tcttcttctttctcctcctcctcc 18338 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18328 tcttcttcttcttcctcctcctcc 18305 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 18241 tcttcttcttcttcctcctcctcc 18218
>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence Length = 180227 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 135748 tcttcttcttcctcctcctcctcc 135771 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 135751 tcttcttcctcctcctcctcctcc 135774 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 135745 tcttcttcttcttcctcctcctcc 135768
>gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, complete sequence Length = 168316 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 148026 tcttcttcttcctcctcctcctcc 148003 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 148029 tcttcttcttcttcctcctcctcc 148006 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 148023 tcttcttcctcctcctcctcctcc 148000
>gb|AC117825.9| Mus musculus chromosome 18, clone RP24-80J4, complete sequence Length = 198559 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 21402 tcttcttcttcctcctcctcctcc 21425 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 21405 tcttcttcctcctcctcctcctcc 21428
>gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, complete sequence Length = 207103 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 196849 tcttcttcttcctcctcctcctcc 196872 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 196852 tcttcttcctcctcctcctcctcc 196875
>gb|AC116759.13| Mus musculus chromosome 18, clone RP23-383E12, complete sequence Length = 203049 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 139531 tcttcttcttcctcctcctcctcc 139508 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 139534 tcttcttcttcttcctcctcctcc 139511
>gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, complete sequence Length = 212156 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 83719 tcttcttcttcctcctcctcctcc 83742 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 83722 tcttcttcctcctcctcctcctcc 83745 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 83716 tcttcttcttcttcctcctcctcc 83739
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 64215 tcttcttcttcctcctcctcctcc 64192 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 64218 tcttcttcttcttcctcctcctcc 64195
>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence Length = 190298 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 8385 tcttcttcttcctcctcctcctcc 8408 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 8388 tcttcttcctcctcctcctcctcc 8411 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 8382 tcttcttcttcttcctcctcctcc 8405
>gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, complete sequence Length = 185846 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 122460 tcttcttcttcctcctcctcctcc 122437 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 122463 tcttcttcttcttcctcctcctcc 122440 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 122457 tcttcttcctcctcctcctcctcc 122434
>gb|AC116696.20| Mus musculus chromosome 3, clone RP24-425N23, complete sequence Length = 168053 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 122567 tcttcttcttcctcctcctcctcc 122590 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 122728 cttcttcctcctcctcctcc 122747 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 122570 tcttcttcctcctcctcctcctcc 122593 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 122564 tcttcttcttcttcctcctcctcc 122587
>gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, complete sequence Length = 144502 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 38723 tcttcttcttcctcctcctcctcc 38746 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 38726 tcttcttcctcctcctcctcctcc 38749 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 38720 tcttcttcttcttcctcctcctcc 38743
>gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, complete sequence Length = 169136 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 30405 tcttcttcttcctcctcctcctcc 30428 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cttcttcctcctcctcctcc 54 |||||||||||||||||||| Sbjct: 137214 cttcttcctcctcctcctcc 137195 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 30408 tcttcttcctcctcctcctcctcc 30431 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 30402 tcttcttcttcttcctcctcctcc 30425
>gb|AC118200.8| Mus musculus chromosome 5, clone RP23-330E5, complete sequence Length = 208710 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 144395 tcttcttcttcctcctcctcctcc 144372 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 144398 tcttcttcttcttcctcctcctcc 144375
>gb|BC109074.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126246 IMAGE:40034219), complete cds Length = 2388 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 1454 tcttcttcttcctcctcctcctcc 1431
>gb|BC109073.1| Homo sapiens death-associated protein 6, mRNA (cDNA clone MGC:126245 IMAGE:40034214), complete cds Length = 2388 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 1454 tcttcttcttcctcctcctcctcc 1431
>gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, complete sequence Length = 184794 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 153575 tcttcttcttcctcctcctcctcc 153552 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 153578 tcttcttcttcttcctcctcctcc 153555 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 153572 tcttcttcctcctcctcctcctcc 153549
>gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, complete sequence Length = 212494 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 86145 tcttcttcttcctcctcctcctcc 86122 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 18890 tcttcttcctcctcctcctcc 18910 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 86148 tcttcttcttcttcctcctcctcc 86125 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 86142 tcttcttcctcctcctcctcctcc 86119 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||| ||||||||||||||||||| Sbjct: 25567 tcttgttcttcctcctcctcctcc 25590 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 18890 tcttcttcctcctcctcctcctcc 18913
>ref|NM_120448.2| Arabidopsis thaliana unknown protein AT5G03670 mRNA, complete cds Length = 1989 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 1340 tcttcttcttcctcctcctcctcc 1317 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 1337 tcttcttcctcctcctcctcctcc 1314
>gb|AC152947.1| Mus musculus 10 BAC RP23-12H20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 222139 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 209917 tcttcttcttcctcctcctcctcc 209894 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 189136 tcttcttcttcctcctcctcctcc 189113 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 209920 tcttcttcttcttcctcctcctcc 209897 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 209914 tcttcttcctcctcctcctcctcc 209891 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 189139 tcttcttcttcttcctcctcctcc 189116 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 189133 tcttcttcctcctcctcctcctcc 189110
>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence Length = 186266 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 58143 tcttcttcttcctcctcctcctcc 58166 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 57976 tcttcttcttcctcctcctcctcc 57999 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 58146 tcttcttcctcctcctcctcctcc 58169 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 58140 tcttcttcttcttcctcctcctcc 58163 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 58092 tcttcctcttcctcctcctcctcc 58115 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 ttcttcttcctcctcctcct 52 |||||||||||||||||||| Sbjct: 58035 ttcttcttcctcctcctcct 58054 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 57979 tcttcttcctcctcctcctcctcc 58002 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 57973 tcttcttcttcttcctcctcctcc 57996 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 57854 tcttcttcttcctcctcctc 57873
>gb|AC161271.2| Mus musculus BAC clone RP23-59D8 from chromosome 14, complete sequence Length = 206083 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 148259 tcttcttcttcctcctcctcctcc 148282 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 121866 tcttcttcttcctcctcctcctcc 121843 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 99843 tcttcttcctcctcctcctcc 99823 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 148262 tcttcttcctcctcctcctcctcc 148285 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 148256 tcttcttcttcttcctcctcctcc 148279 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 121869 tcttcttcttcttcctcctcctcc 121846 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 121863 tcttcttcctcctcctcctcctcc 121840
>gb|AC161810.10| Mus musculus chromosome 3, clone RP24-363L5, complete sequence Length = 151433 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 44261 tcttcttcttcctcctcctcctcc 44238 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctc 53 |||||||||||||||||||||| Sbjct: 69738 cttcttcttcctcctcctcctc 69717 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 69700 tcttcatcttcctcctcctcctcc 69677 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 44264 tcttcttcttcttcctcctcctcc 44241
>ref|NM_016374.4| Homo sapiens AT rich interactive domain 4B (RBP1- like) (ARID4B), transcript variant 1, mRNA Length = 6065 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 2121 tcttcttcttcctcctcctcctcc 2098 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 2124 tcttcttcttcttcctcctcctcc 2101
>gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, complete sequence Length = 161054 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 74221 tcttcttcttcctcctcctcctcc 74198 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 3 ccatacaagagaaagaagata 23 ||||||||||||||||||||| Sbjct: 74669 ccatacaagagaaagaagata 74649 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 74224 tcttcttcttcttcctcctcctcc 74201
>gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, complete sequence Length = 215135 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 92857 tcttcttcttcctcctcctcctcc 92880 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 92860 tcttcttcctcctcctcctcctcc 92883
>gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, complete sequence Length = 181842 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 174125 tcttcttcttcctcctcctcctcc 174102 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 173999 tcttcttcttcctcctcctcctcc 173976 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 173939 tcttcttcttcctcctcctcctcc 173916 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 174128 tcttcttcttcttcctcctcctcc 174105 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 174122 tcttcttcctcctcctcctcctcc 174099 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 174002 tcttcttcttcttcctcctcctcc 173979 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 173996 tcttcttcctcctcctcctcctcc 173973 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 173942 tcttcttcttcttcctcctcctcc 173919 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 173936 tcttcttcctcctcctcctcctcc 173913
>gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, complete sequence Length = 152264 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 46711 tcttcttcttcctcctcctcctcc 46734 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 46714 tcttcttcctcctcctcctcctcc 46737 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 46708 tcttcttcttcttcctcctcctcc 46731
>gb|AC153727.6| Mus musculus BAC clone RP23-354L15 from chromosome 12, complete sequence Length = 202733 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 61248 tcttcttcttcctcctcctcctcc 61271 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 61215 tcttcttcttcctcctcctcctcc 61238 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 61251 tcttcttcctcctcctcctcctcc 61274 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 61218 tcttcttcctcctcctcctcctcc 61241 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 61182 tcttcctcttcctcctcctcctcc 61205
>gb|AC163390.2| Mus musculus chromosome 1, clone RP24-300C19, complete sequence Length = 180465 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 134713 tcttcttcttcctcctcctcctcc 134736 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 134716 tcttcttcctcctcctcctcctcc 134739 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 134710 tcttcttcttcttcctcctcctcc 134733
>gb|AC101706.9| Mus musculus chromosome 15, clone RP23-256L18, complete sequence Length = 170006 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 12070 tcttcttcttcctcctcctcctcc 12047 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 12073 tcttcttcttcttcctcctcctcc 12050 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 12067 tcttcttcctcctcctcctcctcc 12044
>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence Length = 171409 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 50569 tcttcttcttcctcctcctcctcc 50546 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 50572 tcttcttcttcttcctcctcctcc 50549 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 50566 tcttcttcctcctcctcctcctcc 50543 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 50524 tcttcctcttcctcctcctcctcc 50501
>gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome 1, complete sequence Length = 185692 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 179549 tcttcttcttcctcctcctcctcc 179526 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 179552 tcttcttcttcttcctcctcctcc 179529
>gb|AC161120.5| Mus musculus BAC clone RP23-84A2 from chromosome 10, complete sequence Length = 214638 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 55212 tcttcttcttcctcctcctcctcc 55235 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 31064 tcttcttcctcctcctcctcc 31084 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 55215 tcttcttcctcctcctcctcctcc 55238 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 55209 tcttcttcttcttcctcctcctcc 55232
>gb|AC154375.2| Mus musculus BAC clone RP23-69H21 from chromosome 12, complete sequence Length = 169125 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 114270 tcttcttcttcctcctcctcctcc 114247 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 114273 tcttcttcttcttcctcctcctcc 114250 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 114267 tcttcttcctcctcctcctcctcc 114244 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||| |||||||||| Sbjct: 75152 tcttcttcttccttctcctcctcc 75129 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||| ||||||||||||| Sbjct: 75121 tcttcttctttctcctcctcctcc 75098
>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence Length = 175318 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 46916 tcttcttcttcctcctcctcctcc 46939 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 46913 tcttcttcttcttcctcctcctcc 46936 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctc 53 |||||||||||||||||||| Sbjct: 30681 tcttcttcctcctcctcctc 30662
>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence Length = 174746 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 151731 tcttcttcttcctcctcctcctcc 151754 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 151734 tcttcttcctcctcctcctcctcc 151757 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 151728 tcttcttcttcttcctcctcctcc 151751
>gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, complete sequence Length = 180366 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 46916 tcttcttcttcctcctcctcctcc 46939 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 46919 tcttcttcctcctcctcctcctcc 46942 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 46913 tcttcttcttcttcctcctcctcc 46936
>gb|AC153494.25| Mus musculus 10 BAC RP23-345J24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 231991 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 145026 tcttcttcttcctcctcctcctcc 145049 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 145029 tcttcttcctcctcctcctcctcc 145052 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 110728 tcttcctcttcctcctcctcctcc 110705
>gb|AC160027.16| Mus musculus 10 BAC RP23-192N23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207847 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 33941 tcttcttcttcctcctcctcctcc 33918 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 33938 tcttcttcctcctcctcctcctcc 33915
>gb|AC115691.8| Mus musculus chromosome 18, clone RP24-286B14, complete sequence Length = 175016 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 121537 tcttcttcttcctcctcctcctcc 121514 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 155980 tcttcttcctcctcctcctcc 155960 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 |||||||| |||||||||||||||| Sbjct: 121534 tcttcttcctcctcctcctcctccc 121510 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 155980 tcttcttcctcctcctcctcctcc 155957 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||||||| |||||| Sbjct: 74933 tcttcttcttcctcctcttcctcc 74956
>gb|AC111028.10| Mus musculus chromosome 8, clone RP23-221P20, complete sequence Length = 193256 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 22575 tcttcttcttcctcctcctcctcc 22552 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 22578 tcttcttcttcttcctcctcctcc 22555 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 6160 tcttcctcttcctcctcctcctcc 6137
>gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, complete sequence Length = 194425 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 160251 tcttcttcttcctcctcctcctcc 160228 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 160254 tcttcttcttcttcctcctcctcc 160231 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 160248 tcttcttcctcctcctcctcctcc 160225
>ref|XM_641716.1| Dictyostelium discoideum nucleomorphin (DDB0231257), partial mRNA Length = 1023 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 452 tcttcttcttcctcctcctcctcc 429 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 449 tcttcttcctcctcctcctcctcc 426
>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence Length = 172348 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 21416 tcttcttcttcctcctcctcctcc 21439 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 21308 tcttcttcttcctcctcctcct 21329 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 21419 tcttcttcctcctcctcctcctcc 21442 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 21413 tcttcttcttcttcctcctcctcc 21436
>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence Length = 156107 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 154741 tcttcttcttcctcctcctcctcc 154718 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 154744 tcttcttcttcttcctcctcctcc 154721 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 154738 tcttcttcctcctcctcctcctcc 154715
>gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, complete sequence Length = 218246 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 3194 tcttcttcttcctcctcctcctcc 3217 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 3419 tcttcctcttcctcctcctcctcc 3442 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 3413 tcttcttcttcctcttcctcctcc 3436 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 3197 tcttcttcctcctcctcctcctcc 3220 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 3191 tcttcttcttcttcctcctcctcc 3214
>ref|XM_630260.1| Dictyostelium discoideum hypothetical protein (DDB0219987), partial mRNA Length = 1860 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 851 tcttcttcttcctcctcctcctcc 828 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 848 tcttcttcctcctcctcctcctcc 825
>ref|XM_635272.1| Dictyostelium discoideum hypothetical protein (DDB0205144), partial mRNA Length = 7872 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 1597 tcttcttcttcctcctcctcctcc 1620 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 1600 tcttcttcctcctcctcctcctcc 1623 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 1594 tcttcttcttcttcctcctcctcc 1617
>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence Length = 219218 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 114306 tcttcttcttcctcctcctcctcc 114283 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 114309 tcttcttcttcttcctcctcctcc 114286 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 114303 tcttcttcctcctcctcctcctcc 114280 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 114249 tcttcctcttcctcctcctcctcc 114226
>gb|AC159008.2| Mus musculus BAC clone RP23-14E14 from chromosome 7, complete sequence Length = 239149 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 46843 tcttcttcttcctcctcctcctcc 46820
>gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome 10, complete sequence Length = 252639 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 110195 tcttcttcttcctcctcctcctcc 110172 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 134344 tcttcttcctcctcctcctcc 134324 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 110198 tcttcttcttcttcctcctcctcc 110175 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 110192 tcttcttcctcctcctcctcctcc 110169
>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence Length = 206735 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 159153 tcttcttcttcctcctcctcctcc 159176 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 159210 tcttcctcttcctcctcctcctcc 159233 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 159156 tcttcttcctcctcctcctcctcc 159179 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 159150 tcttcttcttcttcctcctcctcc 159173
>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete sequence Length = 186202 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 51557 tcttcttcttcctcctcctcctcc 51534 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 51560 tcttcttcttcttcctcctcctcc 51537 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 51554 tcttcttcctcctcctcctcctcc 51531
>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence Length = 229027 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 191441 tcttcttcttcctcctcctcctcc 191418 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 40 tcctcctcctcctccctgctcc 61 |||||||||||||||||||||| Sbjct: 54062 tcctcctcctcctccctgctcc 54083 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 191444 tcttcttcttcttcctcctcctcc 191421 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 191438 tcttcttcctcctcctcctcctcc 191415
>gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome 5, complete sequence Length = 233082 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 212811 tcttcttcttcctcctcctcctcc 212788 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 |||||||| |||||||||||||||| Sbjct: 212808 tcttcttcctcctcctcctcctccc 212784 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 212814 tcttcttcttcttcctcctcctcc 212791
>gb|AC159286.3| Mus musculus BAC clone RP23-314E22 from chromosome 14, complete sequence Length = 210984 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 174265 tcttcttcttcctcctcctcctcc 174288 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 174295 tcttcctcttcctcctcctcctcc 174318 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 174268 tcttcttcctcctcctcctcctcc 174291 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 174262 tcttcttcttcttcctcctcctcc 174285
>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete sequence Length = 162597 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 25129 tcttcttcttcctcctcctcctcc 25152 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 28409 tcttcctcttcctcctcctcctcc 28432 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 28403 tcttcttcttcctcttcctcctcc 28426 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 28316 tcttcctcttcctcctcctcctcc 28339 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 25132 tcttcttcctcctcctcctcctcc 25155 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 25126 tcttcttcttcttcctcctcctcc 25149 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 8327 tcttcctcttcctcctcctcctcc 8350 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 7745 tcttcttcttcctcctcctc 7764 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 7628 tcttcctcttcctcctcctcctcc 7651
>gb|AC155304.4| Mus musculus BAC clone RP24-212I6 from chromosome 8, complete sequence Length = 165128 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 85419 tcttcttcttcctcctcctcctcc 85442 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 85422 tcttcttcctcctcctcctcctcc 85445 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 85416 tcttcttcttcttcctcctcctcc 85439
>gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome 18, complete sequence Length = 193523 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 167525 tcttcttcttcctcctcctcctcc 167548 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 167528 tcttcttcctcctcctcctcctcc 167551 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 167522 tcttcttcttcttcctcctcctcc 167545
>gb|AC163660.4| Mus musculus BAC clone RP23-283J16 from chromosome 13, complete sequence Length = 198752 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 116151 tcttcttcttcctcctcctcctcc 116128 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 72310 tcttcttcttcctcctcctcctcc 72333 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 116154 tcttcttcttcttcctcctcctcc 116131 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 116148 tcttcttcctcctcctcctcctcc 116125 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 88435 tcttcttcttcctcttcctcctcc 88412 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 88429 tcttcctcttcctcctcctcctcc 88406 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 72313 tcttcttcctcctcctcctcctcc 72336 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 72307 tcttcttcttcttcctcctcctcc 72330
>gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosome 3, complete sequence Length = 177586 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 176392 tcttcttcttcctcctcctcctcc 176415 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 98539 tcttcttcttcctcctcctcctc 98561 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 98512 tcttcttcctcctcctcctcc 98532 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 176395 tcttcttcctcctcctcctcctcc 176418 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 176389 tcttcttcttcttcctcctcctcc 176412 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 98721 tcttcctcttcctcctcctcctcc 98744 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 98715 tcttcttcttcctcttcctcctcc 98738 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 98536 tcttcttcttcttcctcctcctcc 98559
>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence Length = 196951 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 11013 tcttcttcttcctcctcctcctcc 10990 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 153502 tcttcttcttcctcctcctcct 153481 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 33 ttcttcttcctcctcctcctcc 54 |||||||||||||||||||||| Sbjct: 10981 ttcttcttcctcctcctcctcc 10960 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctcc 54 ||||||||||||||||||||| Sbjct: 164429 tcttcttcctcctcctcctcc 164449 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctcc 54 |||||||||||| |||||||||||| Sbjct: 153506 gtcttcttcttcttcctcctcctcc 153482 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 164429 tcttcttcctcctcctcctcctcc 164452 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 11016 tcttcttcttcttcctcctcctcc 10993 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 11010 tcttcttcctcctcctcctcctcc 10987 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 10980 tcttcttcctcctcctcctcctcc 10957
>gb|AC165948.2| Mus musculus BAC clone RP24-430M9 from chromosome 17, complete sequence Length = 176267 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 102320 tcttcttcttcctcctcctcctcc 102343 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 80269 tcttcttcttcctcctcctcctcc 80292 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 102323 tcttcttcctcctcctcctcctcc 102346 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 102317 tcttcttcttcttcctcctcctcc 102340 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 80272 tcttcttcctcctcctcctcctcc 80295
>gb|AC163349.3| Mus musculus BAC clone RP23-188F5 from chromosome 3, complete sequence Length = 226848 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 173828 tcttcttcttcctcctcctcctcc 173851 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 173831 tcttcttcctcctcctcctcctcc 173854
>gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, complete sequence Length = 202146 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 173434 tcttcttcttcctcctcctcctcc 173411 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 77088 tcttcttcttcctcctcctcctcc 77065 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 173520 tcttcctcttcctcctcctcctcc 173497 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||| |||||||||| Sbjct: 173474 tcttcttcttcctgctcctcctcc 173451 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 173431 tcttcttcctcctcctcctcctcc 173408 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 77091 tcttcttcttcttcctcctcctcc 77068 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 77085 tcttcttcctcctcctcctcctcc 77062
>gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, complete sequence Length = 156900 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 91745 tcttcttcttcctcctcctcctcc 91768 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 152996 tcttcttcttcctcctcctcct 153017 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 ttcttcttcctcctcctcct 52 |||||||||||||||||||| Sbjct: 152874 ttcttcttcctcctcctcct 152893 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 91748 tcttcttcctcctcctcctcctcc 91771 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 91742 tcttcttcttcttcctcctcctcc 91765
>gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180936 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 50868 tcttcttcttcctcctcctcctcc 50845 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcct 52 |||||||||||||||||||||| Sbjct: 32355 tcttcttcttcctcctcctcct 32334 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 50871 tcttcttcttcttcctcctcctcc 50848 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 50865 tcttcttcctcctcctcctcctcc 50842 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 32454 tcttcctcttcctcctcctcctcc 32431
>gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210923 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 16714 tcttcttcttcctcctcctcctcc 16691 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 16717 tcttcttcttcttcctcctcctcc 16694 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 16711 tcttcttcctcctcctcctcctcc 16688 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 8990 tcttcttcttcctcttcctcctcc 8967
>gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, complete sequence Length = 181980 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 102444 tcttcttcttcctcctcctcctcc 102467 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 102447 tcttcttcctcctcctcctcctcc 102470 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 102441 tcttcttcttcttcctcctcctcc 102464 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 84540 tcttcctcttcctcctcctcctcc 84563
>gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, complete sequence Length = 142975 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 75074 tcttcttcttcctcctcctcctcc 75051 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 75239 tcttcttcttcctcctcctcctc 75217 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 75242 tcttcttcttcttcctcctcctcc 75219 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 75184 tcttcttcttcctcctcctc 75165 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 75077 tcttcttcttcttcctcctcctcc 75054 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 48857 tcttcctcttcctcctcctcctcc 48880
>ref|XM_474931.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2298 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 809 tcttcttcttcctcctcctcctcc 786 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 812 tcttcttcttcttcctcctcctcc 789 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 806 tcttcttcctcctcctcctcctcc 783
>ref|XM_467070.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2388 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 1412 tcttcttcttcctcctcctcctcc 1389 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctc 53 ||||||||||||||||||||||| Sbjct: 1106 tcttcttcttcctcctcctcctc 1084 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 1409 tcttcttcctcctcctcctcctcc 1386
>ref|XM_519642.1| PREDICTED: Pan troglodytes similar to nucleoplasmin 2 (LOC464038), mRNA Length = 1244 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||| Sbjct: 793 cttcttcttcctcctcctcctccc 770
>ref|XM_465895.1| Oryza sativa (japonica cultivar-group), mRNA Length = 711 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 334 tcttcttcttcctcctcctcctcc 311 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 337 tcttcttcttcttcctcctcctcc 314 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 331 tcttcttcctcctcctcctcctcc 308
>gb|AC163020.9| Mus musculus chromosome 7, clone RP23-36L11, complete sequence Length = 215384 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 205904 tcttcttcttcctcctcctcctcc 205881 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 205907 tcttcttcttcttcctcctcctcc 205884 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 205901 tcttcttcctcctcctcctcctcc 205878
>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence Length = 190857 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 55284 tcttcttcttcctcctcctcctcc 55261 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 55287 tcttcttcttcttcctcctcctcc 55264 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 55281 tcttcttcctcctcctcctcctcc 55258
>ref|NM_184850.1| Oryza sativa (japonica cultivar-group), mRNA Length = 417 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 62 tcttcttcttcctcctcctcctcc 85 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 65 tcttcttcctcctcctcctcctcc 88 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 59 tcttcttcttcttcctcctcctcc 82
>gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosome 16, complete sequence Length = 211870 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 4079 tcttcttcttcctcctcctcctcc 4056 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 4082 tcttcttcttcttcctcctcctcc 4059 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 4076 tcttcttcctcctcctcctcctcc 4053
>gb|AC159891.2| Mus musculus BAC clone RP23-394E10 from chromosome 9, complete sequence Length = 178766 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 153082 tcttcttcttcctcctcctcctcc 153059 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 153085 tcttcttcttcttcctcctcctcc 153062 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 153079 tcttcttcctcctcctcctcctcc 153056
>ref|NM_196734.1| Oryza sativa (japonica cultivar-group) unknown protein (OSJNBa0094K20.9), mRNA Length = 759 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Minus Query: 30 gtcttcttcttcctcctcctcctccctg 57 ||||||||| |||||||||||||||||| Sbjct: 345 gtcttcttcctcctcctcctcctccctg 318
>gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, complete sequence Length = 177754 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 79278 tcttcttcttcctcctcctcctcc 79301 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 79281 tcttcttcctcctcctcctcctcc 79304 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 79275 tcttcttcttcttcctcctcctcc 79298 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 5301 tcttcctcttcctcctcctcctcc 5278
>gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome 16, complete sequence Length = 177446 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 57131 tcttcttcttcctcctcctcctcc 57154 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 34 tcttcttcctcctcctcctccctgctcc 61 ||||| ||||||||||||||||| |||| Sbjct: 57155 tcttcctcctcctcctcctccctcctcc 57182 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 57128 tcttcttcttcttcctcctcctcc 57151
>gb|AC167138.6| Mus musculus chromosome 15, clone RP24-358O3, complete sequence Length = 190097 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 169300 tcttcttcttcctcctcctcctcc 169277 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 169303 tcttcttcttcttcctcctcctcc 169280 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 169297 tcttcttcctcctcctcctcctcc 169274
>ref|XM_517538.1| PREDICTED: Pan troglodytes similar to high-mobility group box 2; high-mobility group (nonhistone chromosomal) protein 2 (LOC461606), mRNA Length = 968 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 697 tcttcttcttcctcctcctcctcc 674
>gb|AC110509.21| Mus musculus chromosome 8, clone RP24-423G4, complete sequence Length = 190160 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 141223 tcttcttcttcctcctcctcctcc 141246 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||||||||||||| ||||||||| Sbjct: 126565 tcttcttcttcctccccctcctccc 126589 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 141226 tcttcttcctcctcctcctcctcc 141249
>gb|AC166984.7| Mus musculus chromosome 15, clone RP24-359A11, complete sequence Length = 167492 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 43628 tcttcttcttcctcctcctcctcc 43605 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 43631 tcttcttcttcttcctcctcctcc 43608 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 43625 tcttcttcctcctcctcctcctcc 43602
>ref|XM_517262.1| PREDICTED: Pan troglodytes similar to Putative splicing factor YT521 (LOC461291), mRNA Length = 1812 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 941 tcttcttcttcctcctcctcctcc 918 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 938 tcttcttcctcctcctcctcctcc 915
>gb|AC100043.9| Mus musculus chromosome 3, clone RP23-32D13, complete sequence Length = 234931 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 196543 tcttcttcttcctcctcctcctcc 196566 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 196546 tcttcttcctcctcctcctcctcc 196569 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 196540 tcttcttcttcttcctcctcctcc 196563 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 196428 tcttcctcttcctcctcctcctcc 196451 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 196422 tcttcttcttcctcttcctcctcc 196445 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 6806 tcttcctcttcctcctcctcctcc 6829
>gb|AC104932.22| Mus musculus chromosome 3, clone RP24-337A16, complete sequence Length = 184718 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 52055 tcttcttcttcctcctcctcctcc 52032 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 52058 tcttcttcttcttcctcctcctcc 52035 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 52052 tcttcttcctcctcctcctcctcc 52029
>ref|NM_192452.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 249 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 125 tcttcttcttcctcctcctcctcc 102 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 122 tcttcttcctcctcctcctcctcc 99
>gb|AC163325.7| Mus musculus chromosome 1, clone RP23-76L21, complete sequence Length = 253153 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 131985 tcttcttcttcctcctcctcctcc 131962 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctccc 55 ||||| ||||||||||||||||||| Sbjct: 218340 tcttcctcttcctcctcctcctccc 218316 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcc 51 ||||||||||||||||||||| Sbjct: 177624 tcttcttcttcctcctcctcc 177604 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 131982 tcttcttcctcctcctcctcctcc 131959
>gb|AC161218.10| Mus musculus chromosome 7, clone RP24-161J8, complete sequence Length = 181156 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 3560 tcttcttcttcctcctcctcctcc 3537 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 37 tcttcctcctcctcctccct 56 |||||||||||||||||||| Sbjct: 64577 tcttcctcctcctcctccct 64558 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 3557 tcttcttcctcctcctcctcctcc 3534
>gb|AC161212.9| Mus musculus chromosome 3, clone RP24-267M11, complete sequence Length = 147921 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 118991 tcttcttcttcctcctcctcctcc 118968 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 118988 tcttcttcctcctcctcctcctcc 118965
>gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, complete sequence Length = 196756 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 115997 tcttcttcttcctcctcctcctcc 115974
>gb|AC166332.7| Mus musculus chromosome 1, clone RP24-266F18, complete sequence Length = 167566 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 128235 tcttcttcttcctcctcctcctcc 128258 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 128103 tcttcttcttcctcctcctcctcc 128126 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 128238 tcttcttcctcctcctcctcctcc 128261 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 128232 tcttcttcttcttcctcctcctcc 128255 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 128106 tcttcttcctcctcctcctcctcc 128129 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 128100 tcttcttcttcttcctcctcctcc 128123
>ref|NM_182795.1| Homo sapiens nucleophosmin/nucleoplasmin, 2 (NPM2), mRNA Length = 1118 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 32 cttcttcttcctcctcctcctccc 55 |||||||||||||||||||||||| Sbjct: 646 cttcttcttcctcctcctcctccc 623
>gb|AC107838.16| Mus musculus chromosome 1, clone RP23-274N9, complete sequence Length = 160232 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 56165 tcttcttcttcctcctcctcctcc 56188 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 38 cttcctcctcctcctccctgctcc 61 ||||||||||||||||||| |||| Sbjct: 56293 cttcctcctcctcctccctcctcc 56316 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 56168 tcttcttcctcctcctcctcctcc 56191
>gb|AC131065.16| Mus musculus chromosome 18, clone RP23-21J21, complete sequence Length = 208270 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 126718 tcttcttcttcctcctcctcctcc 126695 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||| |||||||||||||||| Sbjct: 137052 tcttctttttcctcctcctcctcc 137075 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 126721 tcttcttcttcttcctcctcctcc 126698 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 126715 tcttcttcctcctcctcctcctcc 126692
>gb|AC121311.16| Mus musculus chromosome 3, clone RP24-317L5, complete sequence Length = 221261 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 15940 tcttcttcttcctcctcctcctcc 15963
>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence Length = 176864 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 67103 tcttcttcttcctcctcctcctcc 67126 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 67106 tcttcttcctcctcctcctcctcc 67129 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 67100 tcttcttcttcttcctcctcctcc 67123 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctc 50 |||||||||||||||||||| Sbjct: 66941 tcttcttcttcctcctcctc 66960
>gb|AC153544.4| Mus musculus 10 BAC RP23-326C6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 215036 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 15582 tcttcttcttcctcctcctcctcc 15605
>gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188027 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 21903 tcttcttcttcctcctcctcctcc 21880 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 21900 tcttcttcctcctcctcctcctcc 21877
>gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, complete sequence Length = 166975 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 58093 tcttcttcttcctcctcctcctcc 58116 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 57632 tcttcttcttcctcctcctcctcc 57655 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 58212 tcttcctcttcctcctcctcctcc 58235 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||| ||||||||| Sbjct: 58206 tcttcttcttcctcttcctcctcc 58229 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 58096 tcttcttcctcctcctcctcctcc 58119 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 58090 tcttcttcttcttcctcctcctcc 58113 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||||||||| |||| Sbjct: 57980 tcttcttcttcctcctccttctcc 58003 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||| ||||||| Sbjct: 57868 tcttcttcttcctccttctcctcc 57891 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||||||| |||||| Sbjct: 57779 tcttcttcttcctcctcttcctcc 57802 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||||||||| |||||| Sbjct: 57698 tcttcttcttcctcctcttcctcc 57721 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 57635 tcttcttcctcctcctcctcctcc 57658 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 57629 tcttcttcttcttcctcctcctcc 57652
>gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence Length = 225524 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 158669 tcttcttcttcctcctcctcctcc 158646 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 158672 tcttcttcttcttcctcctcctcc 158649 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 158666 tcttcttcctcctcctcctcctcc 158643
>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence Length = 176668 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 90644 tcttcttcttcctcctcctcctcc 90621 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 90641 tcttcttcctcctcctcctcctcc 90618
>gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, complete sequence Length = 191225 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 65422 tcttcttcttcctcctcctcctcc 65399 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 65425 tcttcttcttcttcctcctcctcc 65402 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 65419 tcttcttcctcctcctcctcctcc 65396 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||| |||||||||||||||||| Sbjct: 19345 tcttcctcttcctcctcctcctcc 19368
>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07, complete sequence Length = 164477 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 62934 tcttcttcttcctcctcctcctcc 62957
>gb|AC118932.7| Mus musculus chromosome 5, clone RP24-147H20, complete sequence Length = 168156 Score = 48.1 bits (24), Expect = 0.032 Identities = 24/24 (100%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||||||||||||||||||| Sbjct: 138130 tcttcttcttcctcctcctcctcc 138153 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 |||||||| ||||||||||||||| Sbjct: 138133 tcttcttcctcctcctcctcctcc 138156 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tcttcttcttcctcctcctcctcc 54 ||||||||||| |||||||||||| Sbjct: 138127 tcttcttcttcttcctcctcctcc 138150 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,154,929 Number of Sequences: 3902068 Number of extensions: 6154929 Number of successful extensions: 815869 Number of sequences better than 10.0: 10315 Number of HSP's better than 10.0 without gapping: 10396 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 572001 Number of HSP's gapped (non-prelim): 239960 length of query: 570 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 547 effective length of database: 17,143,297,704 effective search space: 9377383844088 effective search space used: 9377383844088 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
