ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart24f01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC148814.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0077J22, complete sequence Length = 173903 Score = 167 bits (84), Expect = 5e-38 Identities = 120/132 (90%) Strand = Plus / Minus Query: 71 cgacgacctcctgcgggaggttttcctcctcctccccaccccagccgacctcctccgcgc 130 |||||||||||| |||||||| |||||||| ||||||||| | ||||||||| ||||||| Sbjct: 124739 cgacgacctcctccgggaggtcttcctcctgctccccaccgccgccgacctcgtccgcgc 124680 Query: 131 ggcgctcgcctgcaagcccttcctccacgccgcccgcagcgcccgcttcctccgccgctt 190 | |||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| Sbjct: 124679 ctccctcgcctgcaagcccttcctccgcgccgcccgcaacgccggcttcctccgccgctt 124620 Query: 191 ccgccgccgcca 202 |||||||||||| Sbjct: 124619 ccgccgccgcca 124608 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Minus Query: 148 ccttcctccacgccgcccgcagcgcccgcttcctccgccgcttccgc 194 ||||||||| || |||||| |||| |||||||||||||||||||| Sbjct: 126996 ccttcctccgtgcggcccgcgacgccggcttcctccgccgcttccgc 126950 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 472 tcttggactgccgcaacggccgcctcct 499 ||||||||||||| ||||||||| |||| Sbjct: 124434 tcttggactgccggaacggccgcgtcct 124407
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 167 bits (84), Expect = 5e-38 Identities = 120/132 (90%) Strand = Plus / Minus Query: 71 cgacgacctcctgcgggaggttttcctcctcctccccaccccagccgacctcctccgcgc 130 |||||||||||| |||||||| |||||||| ||||||||| | ||||||||| ||||||| Sbjct: 2678219 cgacgacctcctccgggaggtcttcctcctgctccccaccgccgccgacctcgtccgcgc 2678160 Query: 131 ggcgctcgcctgcaagcccttcctccacgccgcccgcagcgcccgcttcctccgccgctt 190 | |||||||||||||||||||||| ||||||||||| |||| |||||||||||||||| Sbjct: 2678159 ctccctcgcctgcaagcccttcctccgcgccgcccgcaacgccggcttcctccgccgctt 2678100 Query: 191 ccgccgccgcca 202 |||||||||||| Sbjct: 2678099 ccgccgccgcca 2678088 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Minus Query: 148 ccttcctccacgccgcccgcagcgcccgcttcctccgccgcttccgc 194 ||||||||| || |||||| |||| |||||||||||||||||||| Sbjct: 2680476 ccttcctccgtgcggcccgcgacgccggcttcctccgccgcttccgc 2680430 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 93 ttcctcctcctccccacccca 113 ||||||||||||||||||||| Sbjct: 27332513 ttcctcctcctccccacccca 27332533 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 181 tccgccgcttccgccgccgcc 201 ||||||||||||||||||||| Sbjct: 5358757 tccgccgcttccgccgccgcc 5358777 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 24335625 tcctccgccgcctccgccgccgcc 24335648 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 472 tcttggactgccgcaacggccgcctcct 499 ||||||||||||| ||||||||| |||| Sbjct: 2677914 tcttggactgccggaacggccgcgtcct 2677887
>ref|XM_465001.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1427 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 470 ggtcttggactgccgcaacggccgcctcct 499 |||||| ||||||||||||||||||||||| Sbjct: 354 ggtcttcgactgccgcaacggccgcctcct 383
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 470 ggtcttggactgccgcaacggccgcctcct 499 |||||| ||||||||||||||||||||||| Sbjct: 10857757 ggtcttcgactgccgcaacggccgcctcct 10857728 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 85 gggaggttttcctcctcctccccacc 110 |||||||||||||||| ||||||||| Sbjct: 20183963 gggaggttttcctcctgctccccacc 20183938 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 179 cctccgccgcttccgccgccgccatccct 207 |||||||||| ||||||||||||||||| Sbjct: 32098694 cctccgccgccgccgccgccgccatccct 32098722 Score = 42.1 bits (21), Expect = 1.9 Identities = 36/41 (87%) Strand = Plus / Plus Query: 164 ccgcagcgcccgcttcctccgccgcttccgccgccgccatc 204 |||| ||| |||| |||||||||||| |||||| ||||||| Sbjct: 2861664 ccgccgcgtccgcctcctccgccgctgccgccgtcgccatc 2861704 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 35791197 tcctccgccgcctccgccgccgcc 35791220 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 cgccgcttccgccgccgcca 202 |||||||||||||||||||| Sbjct: 31583526 cgccgcttccgccgccgcca 31583507 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 13170831 tcctccgccgcctccgccgccgcc 13170808 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 gactgccgcaacggccgcctcctg 500 |||||||||||||||||| ||||| Sbjct: 10853754 gactgccgcaacggccgcgtcctg 10853777 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ccgcccgcagcgcccgcttcctcc 183 |||||||| ||||||||||||||| Sbjct: 8489990 ccgcccgccgcgcccgcttcctcc 8490013 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 tcgtcgtcctcggcgacgac 77 |||||||||||||||||||| Sbjct: 5548600 tcgtcgtcctcggcgacgac 5548619 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 tcctcctcctccccacccca 113 |||||||||||||||||||| Sbjct: 4690582 tcctcctcctccccacccca 4690601
>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1756_H07 Length = 217205 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 470 ggtcttggactgccgcaacggccgcctcct 499 |||||| ||||||||||||||||||||||| Sbjct: 63956 ggtcttcgactgccgcaacggccgcctcct 63927 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 gactgccgcaacggccgcctcctg 500 |||||||||||||||||| ||||| Sbjct: 59953 gactgccgcaacggccgcgtcctg 59976
>dbj|AK106386.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E06, full insert sequence Length = 1427 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 470 ggtcttggactgccgcaacggccgcctcct 499 |||||| ||||||||||||||||||||||| Sbjct: 354 ggtcttcgactgccgcaacggccgcctcct 383
>emb|AL954255.1| Pan troglodytes chromosome 22 clone PTB-044C19 map 22q22.3, complete sequence Length = 177268 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 |||||||| |||||||||||||||||||| Sbjct: 127616 ccgcttccgccgccgcttccgccgccgcc 127588 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgc 200 |||||||| ||||||||||||||||||| Sbjct: 127640 ccgcttccgccgccgcttccgccgccgc 127613 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgc 200 |||||||| ||||||||||||||||||| Sbjct: 127628 ccgcttccgccgccgcttccgccgccgc 127601
>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete sequence Length = 180777 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgc 200 |||||||| ||||||||||||||||||| Sbjct: 29463 ccgcttccgccgccgcttccgccgccgc 29436 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgc 200 |||||||| ||||||||||||||||||| Sbjct: 29451 ccgcttccgccgccgcttccgccgccgc 29424 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 |||||||| ||||||||||||||| |||| Sbjct: 29439 ccgcttccgccgccgcttccgccggcgcc 29411
>ref|XM_450361.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1251 Score = 46.1 bits (23), Expect = 0.12 Identities = 32/35 (91%) Strand = Plus / Plus Query: 109 ccccagccgacctcctccgcgcggcgctcgcctgc 143 |||| ||||||||||||||||| || ||||||||| Sbjct: 116 cccccgccgacctcctccgcgccgccctcgcctgc 150
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgccgccgc 200 |||||||||| |||||||||||||||| Sbjct: 1914354 cgcttcctccaccgcttccgccgccgc 1914380
>emb|BX051722.1|CNS09C2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcgcgc 345 ||||||||||||||||||||||| Sbjct: 236 cgtcgagggcggcgacttcgcgc 214
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.12 Identities = 32/35 (91%) Strand = Plus / Plus Query: 109 ccccagccgacctcctccgcgcggcgctcgcctgc 143 |||| ||||||||||||||||| || ||||||||| Sbjct: 4408286 cccccgccgacctcctccgcgccgccctcgcctgc 4408320 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tttcctcctcctccccacccc 112 ||||||||||||||||||||| Sbjct: 17958561 tttcctcctcctccccacccc 17958581 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 gcagcgcccgcttcctccgc 185 |||||||||||||||||||| Sbjct: 13487004 gcagcgcccgcttcctccgc 13487023 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 170 cgcccgcttcctccgccgcttccg 193 |||| ||||||||||||||||||| Sbjct: 9401143 cgccggcttcctccgccgcttccg 9401120
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgcc 198 ||||||||||||||||||||||| Sbjct: 22034632 cttcctccgccgcttccgccgcc 22034654 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgc 194 ||||||||||||||||||||| Sbjct: 20152215 cgcttcctccgccgcttccgc 20152235 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 9376904 gcgcccgcttcctccgccgct 9376924 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 58 tcgtcgtcctcggcgacgac 77 |||||||||||||||||||| Sbjct: 27916661 tcgtcgtcctcggcgacgac 27916642
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Plus Query: 65 cctcggcgacgacctcctgcgggaggttttcctcctcctccccaccc 111 ||||||||| |||||||||| ||| | ||||||| ||||||||||| Sbjct: 23797096 cctcggcgaggacctcctgctggacatcttcctccgcctccccaccc 23797142 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcct 496 ||||||||||||||||||||| Sbjct: 17891522 ggactgccgcaacggccgcct 17891542 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgccatcc 205 ||||||||||| ||||||||| |||||| Sbjct: 24413048 tcctccgccgcatccgccgccaccatcc 24413021 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcctcct 499 |||||||||| ||||||||||||| Sbjct: 15950709 ggactgccgccacggccgcctcct 15950732 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 ccgacctcctccgcgcggcg 134 |||||||||||||||||||| Sbjct: 9951251 ccgacctcctccgcgcggcg 9951232
>dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0681B11 Length = 144091 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Plus Query: 65 cctcggcgacgacctcctgcgggaggttttcctcctcctccccaccc 111 ||||||||| |||||||||| ||| | ||||||| ||||||||||| Sbjct: 77681 cctcggcgaggacctcctgctggacatcttcctccgcctccccaccc 77727
>dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1279D09 Length = 134793 Score = 46.1 bits (23), Expect = 0.12 Identities = 32/35 (91%) Strand = Plus / Plus Query: 109 ccccagccgacctcctccgcgcggcgctcgcctgc 143 |||| ||||||||||||||||| || ||||||||| Sbjct: 111104 cccccgccgacctcctccgcgccgccctcgcctgc 111138
>dbj|AP004261.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0013G11 Length = 151405 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgcc 198 ||||||||||||||||||||||| Sbjct: 126676 cttcctccgccgcttccgccgcc 126698
>dbj|AK106485.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-104-H02, full insert sequence Length = 1361 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Plus Query: 148 ccttcctccacgccgcccgcagcgcccgcttcctccgccgcttccgc 194 ||||||||| || |||||| |||| |||||||||||||||||||| Sbjct: 195 ccttcctccgtgcggcccgcgacgccggcttcctccgccgcttccgc 241
>dbj|AK072955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023146I19, full insert sequence Length = 1623 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgcc 198 ||||||||||||||||||||||| Sbjct: 214 cttcctccgccgcttccgccgcc 236
>gb|DQ148458.1| Phalaenopsis hybrid cultivar flavonoid 3'5'-hydroxylase mRNA, complete cds Length = 1818 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 180 ctccgccgcttccgccgccgcc 201 |||||||||||||||||||||| Sbjct: 262 ctccgccgcttccgccgccgcc 283
>gb|AC032019.7| Homo sapiens chromosome 17, clone RP11-277J6, complete sequence Length = 172709 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 94 tcctcctcctccccaccccagc 115 |||||||||||||||||||||| Sbjct: 144829 tcctcctcctccccaccccagc 144808
>gb|AC169374.2| Sorghum bicolor clone SB_BBc0019I06, complete sequence Length = 129695 Score = 44.1 bits (22), Expect = 0.48 Identities = 28/30 (93%) Strand = Plus / Minus Query: 88 aggttttcctcctcctccccaccccagccg 117 |||||||||||||||||||| |||||||| Sbjct: 44281 aggttttcctcctcctccccttcccagccg 44252
>gb|AC124804.10| Homo sapiens chromosome 17, clone RP11-449L23, complete sequence Length = 203066 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 94 tcctcctcctccccaccccagc 115 |||||||||||||||||||||| Sbjct: 7183 tcctcctcctccccaccccagc 7162
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 57 atcgtcgtcctcggcgacgacctcct 82 ||||||||||||||||||||| |||| Sbjct: 5436883 atcgtcgtcctcggcgacgacgtcct 5436908
>dbj|AP004877.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0472F10 Length = 136076 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 85 gggaggttttcctcctcctccccacc 110 |||||||||||||||| ||||||||| Sbjct: 57269 gggaggttttcctcctgctccccacc 57244
>ref|NM_115917.3| Arabidopsis thaliana transcription factor AT3G60530 mRNA, complete cds Length = 1034 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 169 cttcctccgccgcttcctccgccgc 193
>ref|XM_467922.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1615 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 179 cctccgccgcttccgccgccgccatccct 207 |||||||||| ||||||||||||||||| Sbjct: 247 cctccgccgccgccgccgccgccatccct 219
>ref|NM_193748.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2367 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcct 496 ||||||||||||||||||||| Sbjct: 324 ggactgccgcaacggccgcct 344
>ref|XM_478448.1| Oryza sativa (japonica cultivar-group), mRNA Length = 4365 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgc 194 ||||||||||||||||||||| Sbjct: 355 cgcttcctccgccgcttccgc 375
>ref|XM_472307.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 909 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 180 ctccgccgcttccgccgccgccatccctc 208 ||||||||| |||||||||||||||||| Sbjct: 285 ctccgccgccgccgccgccgccatccctc 257
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10, complete sequence Length = 153366 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 181 tccgccgcttccgccgccgcc 201 ||||||||||||||||||||| Sbjct: 45431 tccgccgcttccgccgccgcc 45451
>ref|XM_581353.2| PREDICTED: Bos taurus similar to HCF-binding transcription factor Zhangfei, transcript variant 1 (LOC538594), mRNA Length = 2839 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 ||||| |||||||||| |||||||||||| Sbjct: 718 ccgctgcctccgccgcctccgccgccgcc 690
>ref|XM_876935.1| PREDICTED: Bos taurus similar to HCF-binding transcription factor Zhangfei, transcript variant 4 (LOC538594), mRNA Length = 2004 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 ||||| |||||||||| |||||||||||| Sbjct: 718 ccgctgcctccgccgcctccgccgccgcc 690
>ref|XM_876869.1| PREDICTED: Bos taurus similar to HCF-binding transcription factor Zhangfei, transcript variant 3 (LOC538594), mRNA Length = 2351 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 ||||| |||||||||| |||||||||||| Sbjct: 718 ccgctgcctccgccgcctccgccgccgcc 690
>ref|XM_865716.1| PREDICTED: Bos taurus similar to HCF-binding transcription factor Zhangfei, transcript variant 2 (LOC538594), mRNA Length = 1907 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 ||||| |||||||||| |||||||||||| Sbjct: 718 ccgctgcctccgccgcctccgccgccgcc 690
>ref|XM_416829.1| PREDICTED: Gallus gallus similar to hypothetical protein FLJ20514 (LOC418631), mRNA Length = 1805 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 gcttcctccgccgcttccgcc 195 ||||||||||||||||||||| Sbjct: 452 gcttcctccgccgcttccgcc 432
>gb|AC093956.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1263_E10, complete sequence Length = 116469 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 93 ttcctcctcctccccacccca 113 ||||||||||||||||||||| Sbjct: 44970 ttcctcctcctccccacccca 44990
>ref|XM_988604.1| PREDICTED: Mus musculus hypothetical protein LOC676263 (LOC676263), mRNA Length = 714 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 177 ttcctccgccgcttccgccgccgcc 201 ||||||||||||| ||||||||||| Sbjct: 155 ttcctccgccgctgccgccgccgcc 131
>ref|XM_985951.1| PREDICTED: Mus musculus hypothetical protein LOC671278 (LOC671278), mRNA Length = 2054 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 ttcctccgccgcttccgccgccgcc 201 ||||||||||||| ||||||||||| Sbjct: 1864 ttcctccgccgctgccgccgccgcc 1888
>ref|XM_981456.1| PREDICTED: Mus musculus hypothetical protein LOC666080 (LOC666080), mRNA Length = 2055 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 ttcctccgccgcttccgccgccgcc 201 ||||||||||||| ||||||||||| Sbjct: 1865 ttcctccgccgctgccgccgccgcc 1889
>gb|AF148779.1| Lepidobolus chaetocephalus ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast Length = 1367 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 ccgcagcgcccgcttcctccg 184 ||||||||||||||||||||| Sbjct: 136 ccgcagcgcccgcttcctccg 116
>gb|AF148778.1| Kulinia eludens ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast Length = 1369 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 ccgcagcgcccgcttcctccg 184 ||||||||||||||||||||| Sbjct: 138 ccgcagcgcccgcttcctccg 118
>gb|AF148776.1| Harperia lateriflora ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast Length = 1400 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 ccgcagcgcccgcttcctccg 184 ||||||||||||||||||||| Sbjct: 169 ccgcagcgcccgcttcctccg 149
>gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome 17, complete sequence Length = 220013 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 ttcctccgccgcttccgccgccgcc 201 ||||||||||||| ||||||||||| Sbjct: 163937 ttcctccgccgctgccgccgccgcc 163961
>gb|AC127260.3| Mus musculus BAC clone RP24-315I3 from chromosome 3, complete sequence Length = 177195 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tttcctcctcctccccacccc 112 ||||||||||||||||||||| Sbjct: 74020 tttcctcctcctccccacccc 74040
>gb|AC127268.2| Mus musculus BAC clone RP23-426K20 from chromosome 3, complete sequence Length = 182377 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 98 cctcctccccaccccagccgacctc 122 |||||||||||||||||| |||||| Sbjct: 116315 cctcctccccaccccagctgacctc 116291
>gb|AC125037.4| Mus musculus BAC clone RP23-332H20 from chromosome 3, complete sequence Length = 207842 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 92 tttcctcctcctccccacccc 112 ||||||||||||||||||||| Sbjct: 197459 tttcctcctcctccccacccc 197439
>emb|BX470209.3| Human DNA sequence from clone RP5-1050E16 on chromosome 9 Contains two novel genes and a CpG island, complete sequence Length = 85380 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 cctcctcctccccaccccagc 115 ||||||||||||||||||||| Sbjct: 69810 cctcctcctccccaccccagc 69790
>gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_A10, complete sequence Length = 102275 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 181 tccgccgcttccgccgccgcc 201 ||||||||||||||||||||| Sbjct: 44271 tccgccgcttccgccgccgcc 44291
>ref|XM_967069.1| PREDICTED: Tribolium castaneum similar to CG7826-PA, isoform A (LOC660870), mRNA Length = 6249 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 182 ccgccgcttccgccgccgcca 202 ||||||||||||||||||||| Sbjct: 4460 ccgccgcttccgccgccgcca 4440
>emb|Y13651.1|ATY13651 Arabidopsis thaliana mRNA for GATA transcription factor 4 Length = 925 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 103 cttcctccgccgcttcctccgccgc 127
>emb|AL731600.3|OSJN00243 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0055C08, complete sequence Length = 145670 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 180 ctccgccgcttccgccgccgccatccctc 208 ||||||||| |||||||||||||||||| Sbjct: 122060 ctccgccgccgccgccgccgccatccctc 122032
>emb|AL138646.2|ATT8B10 Arabidopsis thaliana DNA chromosome 3, BAC clone T8B10 Length = 103787 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 74992 cttcctccgccgcttcctccgccgc 75016
>gb|AY003872.1| Plasmodium vivax YAC 1H14, complete sequence Length = 199866 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 177704 cttcctccgccgcttcccccgccgc 177728
>gb|AY050476.1| Arabidopsis thaliana AT3g60530/T8B10_190 mRNA, complete cds Length = 723 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 98 cttcctccgccgcttcctccgccgc 122
>gb|AY039532.1| Arabidopsis thaliana AT3g60530/T8B10_190 mRNA, complete cds Length = 989 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 128 cttcctccgccgcttcctccgccgc 152
>gb|AF378881.1|AF378881 Arabidopsis thaliana AT3g60530/T8B10_190 mRNA, complete cds Length = 989 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 128 cttcctccgccgcttcctccgccgc 152
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 tccgccgcttccgccgccgcc 201 ||||||||||||||||||||| Sbjct: 1293143 tccgccgcttccgccgccgcc 1293123
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 180 ctccgccgcttccgccgccgccatccctc 208 ||||||||| |||||||||||||||||| Sbjct: 19340228 ctccgccgccgccgccgccgccatccctc 19340200 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 ccgccgcttccgccgccgcc 201 |||||||||||||||||||| Sbjct: 24216279 ccgccgcttccgccgccgcc 24216260 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 ccgccgcttccgccgccgcc 201 |||||||||||||||||||| Sbjct: 9485323 ccgccgcttccgccgccgcc 9485342
>emb|BX825241.1|CNS0A7HZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL22ZC06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 97 cttcctccgccgcttcctccgccgc 121
>emb|BX825549.1|CNS0A7HL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL43ZG06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 114 cttcctccgccgcttcctccgccgc 138
>emb|BX825104.1|CNS0A65X Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH9ZG02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 176 cttcctccgccgcttccgccgccgc 200 ||||||||||||||||| ||||||| Sbjct: 169 cttcctccgccgcttcctccgccgc 193
>gb|AC155841.6| Mus musculus 6 BAC RP24-490O5 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 141583 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 93 ttcctcctcctccccacccca 113 ||||||||||||||||||||| Sbjct: 124850 ttcctcctcctccccacccca 124830
>gb|AC153842.9| Mus musculus 6 BAC RP23-348K12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 174100 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 93 ttcctcctcctccccacccca 113 ||||||||||||||||||||| Sbjct: 80301 ttcctcctcctccccacccca 80281
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 317 ccgcgtcgtcgagggcggcga 337 ||||||||||||||||||||| Sbjct: 4710376 ccgcgtcgtcgagggcggcga 4710356 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 314 gcgccgcgtcgtcgagggcggcgac 338 ||||||||||||||||| ||||||| Sbjct: 3978036 gcgccgcgtcgtcgaggtcggcgac 3978060 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 47 cgccgacaccatcgtcgtcctcggcgacg 75 ||||||||| ||||||||||||| ||||| Sbjct: 1038521 cgccgacacgatcgtcgtcctcgccgacg 1038549
>gb|AC068193.7| Homo sapiens BAC clone RP11-103P16 from 2, complete sequence Length = 170059 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 91 ttttcctcctcctccccaccc 111 ||||||||||||||||||||| Sbjct: 126975 ttttcctcctcctccccaccc 126995
>ref|XM_220269.3| PREDICTED: Rattus norvegicus cytoplasmic polyadenylation element binding protein 4 (predicted) (Cpeb4_predicted), mRNA Length = 7618 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 173 ccgcttcctccgccgcttccgccgccgcc 201 ||||| |||||||||| |||||||||||| Sbjct: 73 ccgctgcctccgccgcctccgccgccgcc 45
>gb|AC073046.7| Homo sapiens BAC clone RP11-51I5 from 2, complete sequence Length = 173658 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 98 cctcctccccaccccagccga 118 ||||||||||||||||||||| Sbjct: 126060 cctcctccccaccccagccga 126040
>gb|AY190941.1| Drosophila erecta clone DERF01_12_N08 (D1431) genomic sequence Length = 43101 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcca 202 ||||||||||| ||||||||||||| Sbjct: 28880 tcctccgccgcctccgccgccgcca 28904
>dbj|AP004304.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0483E06 Length = 159035 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 139748 gcgcccgcttcctccgccgct 139768
>dbj|AP006267.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0004F07 Length = 135890 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 47772 gcgcccgcttcctccgccgct 47792
>dbj|AP003827.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1372_D12 Length = 179898 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgc 194 ||||||||||||||||||||| Sbjct: 54603 cgcttcctccgccgcttccgc 54623
>dbj|AP003077.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0520B06 Length = 142667 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcct 496 ||||||||||||||||||||| Sbjct: 11357 ggactgccgcaacggccgcct 11377
>dbj|AP003435.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0455H03 Length = 175947 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcct 496 ||||||||||||||||||||| Sbjct: 138644 ggactgccgcaacggccgcct 138664
>dbj|AP005573.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1509_C06 Length = 113436 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tttcctcctcctccccacccc 112 ||||||||||||||||||||| Sbjct: 10215 tttcctcctcctccccacccc 10235
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0050G13 Length = 150685 Score = 42.1 bits (21), Expect = 1.9 Identities = 36/41 (87%) Strand = Plus / Plus Query: 164 ccgcagcgcccgcttcctccgccgcttccgccgccgccatc 204 |||| ||| |||| |||||||||||| |||||| ||||||| Sbjct: 129892 ccgccgcgtccgcctcctccgccgctgccgccgtcgccatc 129932
>dbj|AP003930.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1657_A07 Length = 125217 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgc 194 ||||||||||||||||||||| Sbjct: 116818 cgcttcctccgccgcttccgc 116838
>gb|AC158468.2| Postia placenta clone JGIACWS-5B5, complete sequence Length = 36622 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 318 cgcgtcgtcgagggcggcgac 338 ||||||||||||||||||||| Sbjct: 14461 cgcgtcgtcgagggcggcgac 14441
>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0486G03 Length = 146713 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 179 cctccgccgcttccgccgccgccatccct 207 |||||||||| ||||||||||||||||| Sbjct: 35350 cctccgccgccgccgccgccgccatccct 35378
>dbj|AK120494.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013119O06, full insert sequence Length = 1616 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 179 cctccgccgcttccgccgccgccatccct 207 |||||||||| ||||||||||||||||| Sbjct: 247 cctccgccgccgccgccgccgccatccct 219
>dbj|AK111419.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-182-G07, full insert sequence Length = 2382 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 67 gcgcccgcttcctccgccgct 87
>dbj|AK109797.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-E08, full insert sequence Length = 2014 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcct 496 ||||||||||||||||||||| Sbjct: 502 ggactgccgcaacggccgcct 522
>dbj|AK107969.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-135-D05, full insert sequence Length = 951 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 117 gcgcccgcttcctccgccgct 137
>dbj|AK107427.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-A03, full insert sequence Length = 1765 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 93 ttcctcctcctccccacccca 113 ||||||||||||||||||||| Sbjct: 49 ttcctcctcctccccacccca 69
>dbj|AK073038.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033000B18, full insert sequence Length = 3096 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 79 gcgcccgcttcctccgccgct 99
>dbj|AK072054.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112C01, full insert sequence Length = 3270 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 169 gcgcccgcttcctccgccgct 189 ||||||||||||||||||||| Sbjct: 55 gcgcccgcttcctccgccgct 75
>emb|AJ535050.1|OSA535050 Oryza sativa (japonica cultivar-group) pdr5 gene for PDR-like ABC transporter, exons 1-19 Length = 12922 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgc 194 ||||||||||||||||||||| Sbjct: 355 cgcttcctccgccgcttccgc 375
>dbj|AB070956.1| Streptomyces avermitilis peptide-7 biosynthetic gene cluster Length = 54101 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 47 cgccgacaccatcgtcgtcctcggcgacg 75 ||||||||| ||||||||||||| ||||| Sbjct: 50353 cgccgacacgatcgtcgtcctcgccgacg 50381
>dbj|AB070950.1| Streptomyces avermitilis peptide-1 biosynthetic gene cluster Length = 21391 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 314 gcgccgcgtcgtcgagggcggcgac 338 ||||||||||||||||| ||||||| Sbjct: 18156 gcgccgcgtcgtcgaggtcggcgac 18132
>ref|XM_480382.1| Oryza sativa (japonica cultivar-group), mRNA Length = 921 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 720 tcctccgccgcctccgccgccgcc 697
>ref|NM_194831.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0030B02.5), mRNA Length = 1203 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 gcttcctccgccgcttccgc 194 |||||||||||||||||||| Sbjct: 167 gcttcctccgccgcttccgc 186
>ref|XM_468550.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1473 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 507 tcctccgccgcctccgccgccgcc 530
>ref|NM_194774.1| Oryza sativa (japonica cultivar-group) unknown protein (OSJNBa0087H07.11), mRNA Length = 393 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 gcttcctccgccgcttccgc 194 |||||||||||||||||||| Sbjct: 161 gcttcctccgccgcttccgc 180
>ref|XM_467818.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1895 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 cgccgcttccgccgccgcca 202 |||||||||||||||||||| Sbjct: 221 cgccgcttccgccgccgcca 202
>ref|XM_465294.1| Oryza sativa (japonica cultivar-group), mRNA Length = 663 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 549 tcctccgccgcctccgccgccgcc 526
>ref|XM_465000.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1236 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 gactgccgcaacggccgcctcctg 500 |||||||||||||||||| ||||| Sbjct: 304 gactgccgcaacggccgcgtcctg 327
>ref|XM_464495.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1362 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 tcgtcgtcctcggcgacgac 77 |||||||||||||||||||| Sbjct: 428 tcgtcgtcctcggcgacgac 447
>ref|XM_464355.1| Oryza sativa (japonica cultivar-group), mRNA Length = 876 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 tcctcctcctccccacccca 113 |||||||||||||||||||| Sbjct: 20 tcctcctcctccccacccca 39
>ref|XM_450512.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1272 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 cgcccgcttcctccgccgcttccg 193 |||| ||||||||||||||||||| Sbjct: 111 cgccggcttcctccgccgcttccg 134
>ref|NM_196575.1| Oryza sativa (japonica cultivar-group) putative RIM2 protein (OSJNBa0072A12.15), mRNA Length = 4317 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 179 cctccgccgcttccgccgccgcca 202 ||||||||||| |||||||||||| Sbjct: 35 cctccgccgctgccgccgccgcca 58
>ref|NM_193929.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1224 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 476 ggactgccgcaacggccgcctcct 499 |||||||||| ||||||||||||| Sbjct: 384 ggactgccgccacggccgcctcct 407
>ref|NM_192789.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1029 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgccatcc 205 ||||||||||| ||||||||| |||||| Sbjct: 506 tcctccgccgcatccgccgccaccatcc 479
>ref|XM_479421.1| Oryza sativa (japonica cultivar-group), mRNA Length = 447 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 tcgtcgtcctcggcgacgac 77 |||||||||||||||||||| Sbjct: 71 tcgtcgtcctcggcgacgac 90
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 524 gctggccgtcgccgatcctc 543 |||||||||||||||||||| Sbjct: 334733 gctggccgtcgccgatcctc 334752
>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete sequence Length = 1783081 Score = 40.1 bits (20), Expect = 7.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 95 cctcctcctccccaccccagccgacctcctcc 126 |||||||||||||||| | |||| |||||||| Sbjct: 1672777 cctcctcctccccaccgccgccgccctcctcc 1672808
>gb|AY022848.1| Oryza sativa microsatellite MRG5173 containing (CGG)X8, genomic sequence Length = 224 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 |||||| ||||||||||||||||| Sbjct: 137 tcctcctccgcttccgccgccgcc 114
>gb|AC135258.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0097K08 map C827S, complete sequence Length = 137870 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 ccgccgcttccgccgccgcc 201 |||||||||||||||||||| Sbjct: 151 ccgccgcttccgccgccgcc 132
>gb|AC147811.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0026P08 map near C827S, complete sequence Length = 148676 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 ccgccgcttccgccgccgcc 201 |||||||||||||||||||| Sbjct: 95547 ccgccgcttccgccgccgcc 95566
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 46 tcgccgacaccatcgtcgtc 65 |||||||||||||||||||| Sbjct: 1837899 tcgccgacaccatcgtcgtc 1837880
>ref|XM_414192.1| PREDICTED: Gallus gallus similar to junctophilin 3; junctophilin type 3; trinucleotide repeat containing 22 (LOC415830), mRNA Length = 2599 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 145 agcccttcctccacgccgcc 164 |||||||||||||||||||| Sbjct: 1688 agcccttcctccacgccgcc 1707
>ref|XM_422025.1| PREDICTED: Gallus gallus voltage-gated sodium channel II (LOC395945), mRNA Length = 6047 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 159 gccgcccgcagcgcccgcttcctccgcc 186 ||||| |||||||||||| ||||||||| Sbjct: 5962 gccgcgcgcagcgcccgcctcctccgcc 5935
>gb|AC116502.11| Mus musculus chromosome 13, clone RP24-300G17, complete sequence Length = 170654 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 92 tttcctcctcctccccaccc 111 |||||||||||||||||||| Sbjct: 123639 tttcctcctcctccccaccc 123620
>gb|AC140931.5| Mus musculus BAC clone RP23-3L22 from chromosome 15, complete sequence Length = 202576 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 ttcctcctcctccccacccc 112 |||||||||||||||||||| Sbjct: 161967 ttcctcctcctccccacccc 161948
>gb|AC163769.4| Pan troglodytes BAC clone CH251-59O12 from chromosome unknown, complete sequence Length = 185010 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgccgccgcc 201 |||| |||||||||| |||||||||||| Sbjct: 25651 cgctgcctccgccgcctccgccgccgcc 25678
>gb|BC073935.1| Homo sapiens cDNA clone IMAGE:5219247, partial cds Length = 719 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 346 tctccttcctgcccgaccgcggctcgtc 373 ||||||||||| ||||||||||| |||| Sbjct: 451 tctccttcctggccgaccgcggcgcgtc 424
>ref|XM_959532.1| Neurospora crassa OR74A hypothetical protein (NCU07438.1) partial mRNA Length = 1911 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgccatcc 205 ||||||||||| ||||||||||||||| Sbjct: 753 tcctccgccgccgccgccgccgccatcc 780
>gb|BC044942.1| Homo sapiens olfactory receptor, family 7, subfamily E, member 140 pseudogene, mRNA (cDNA clone IMAGE:5214442), partial cds Length = 2245 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 346 tctccttcctgcccgaccgcggctcgtc 373 ||||||||||| ||||||||||| |||| Sbjct: 351 tctccttcctggccgaccgcggcgcgtc 324
>ref|XM_327723.1| Neurospora crassa OR74A hypothetical protein (NCU07438.1) partial mRNA Length = 1911 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgccatcc 205 ||||||||||| ||||||||||||||| Sbjct: 753 tcctccgccgccgccgccgccgccatcc 780
>gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0010D04, complete sequence Length = 122599 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 21415 tcctccgccgcctccgccgccgcc 21438
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 gcgccgcgtcgtcgagggcggcga 337 |||||||||||||||| ||||||| Sbjct: 167603 gcgccgcgtcgtcgagcgcggcga 167626
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 tcctccgccgcttccgccgccgcc 201 |||||| ||||||||||||||||| Sbjct: 7738230 tcctcctccgcttccgccgccgcc 7738253
>gb|AY350753.1| Parascaris univalens chromosomal breakage region 1 Length = 14872 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 90 gttttcctcctcctccccacccca 113 |||||||||||||||||| ||||| Sbjct: 2469 gttttcctcctcctcccctcccca 2492
>ref|XM_845030.1| PREDICTED: Canis familiaris similar to nucleosome assembly protein 1-like 5 (LOC607931), mRNA Length = 537 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 ||||||||||| |||||||||||| Sbjct: 65 tcctccgccgcctccgccgccgcc 42
>gb|AC132342.3| Mus musculus BAC clone RP24-168N15 from chromosome 12, complete sequence Length = 165700 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 ttcctcctcctccccacccc 112 |||||||||||||||||||| Sbjct: 81383 ttcctcctcctccccacccc 81364
>ref|XM_842943.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0339) partial mRNA Length = 9831 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 524 gctggccgtcgccgatcctc 543 |||||||||||||||||||| Sbjct: 9757 gctggccgtcgccgatcctc 9776
>ref|XM_570656.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CND06070) partial mRNA Length = 1412 Score = 40.1 bits (20), Expect = 7.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 95 cctcctcctccccaccccagccgacctcctcc 126 |||||||||||||||| | |||| |||||||| Sbjct: 69 cctcctcctccccaccgccgccgccctcctcc 100
>ref|NM_001025300.1| Homo sapiens RAB12, member RAS oncogene family (RAB12), mRNA Length = 5087 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 tcctccgccgcttccgccgccgcc 201 |||||||||||| ||||||||||| Sbjct: 78 tcctccgccgctgccgccgccgcc 55
>gb|BC038446.1| Homo sapiens splicing factor 1, mRNA (cDNA clone MGC:45254 IMAGE:5493676), complete cds Length = 2989 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 174 cgcttcctccgccgcttccgccgccgcc 201 |||| |||||||||| |||||||||||| Sbjct: 297 cgctgcctccgccgcctccgccgccgcc 324
>emb|AL121827.34|HSA261N11 Human DNA sequence from clone RP11-261N11 on chromosome 20, complete sequence Length = 184223 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 ctcctcctccccaccccagc 115 |||||||||||||||||||| Sbjct: 74836 ctcctcctccccaccccagc 74817
>emb|AL121936.17|HSBK14H9 Human DNA sequence from clone CTA-14H9 on chromosome 6 Contains the 3' end of the BTN2A1 gene encoding butyrophilin 2A, the BTN1A1 gene encoding butyrophilin 1A, part of a novel gene, the HMG17L3 gene encoding two variants of the high-mobility group (nonhistone chromosomal) protein 17-like 3, 2 CpG islands, ESTs, STSs and GSSs, complete sequence Length = 122979 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 tcctcctcctccccacccca 113 |||||||||||||||||||| Sbjct: 63187 tcctcctcctccccacccca 63168
>emb|BX053396.1|CNS09DD4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 678 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 255 cgtcgagggcggcgacttcg 236
>emb|BX053380.1|CNS09DCO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 597 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 39 cgtcgagggcggcgacttcg 20
>emb|BX053379.1|CNS09DCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 797 cgtcgagggcggcgacttcg 816
>emb|BX072064.1|CNS09RRO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 770 cgtcgagggcggcgacttcg 789
>emb|BX071791.1|CNS09RK3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 249 cgtcgagggcggcgacttcg 230
>emb|BX071790.1|CNS09RK2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 782 cgtcgagggcggcgacttcg 801
>emb|BX071653.1|CNS09RG9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 808 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 246 cgtcgagggcggcgacttcg 227
>emb|BX071652.1|CNS09RG8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 757 cgtcgagggcggcgacttcg 776
>emb|BX071452.1|CNS09RAO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 237 cgtcgagggcggcgacttcg 218
>emb|BX071451.1|CNS09RAN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 719 cgtcgagggcggcgacttcg 738
>emb|BX071396.1|CNS09R94 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 776 cgtcgagggcggcgacttcg 795
>emb|BX071298.1|CNS09R6E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 671 cgtcgagggcggcgacttcg 690
>emb|BX071259.1|CNS09R5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 349 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 251 cgtcgagggcggcgacttcg 232
>emb|BX071258.1|CNS09R5A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 777 cgtcgagggcggcgacttcg 796
>emb|BX071034.1|CNS09QZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 229 cgtcgagggcggcgacttcg 210
>emb|BX071033.1|CNS09QZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 794 cgtcgagggcggcgacttcg 813
>emb|BX070988.1|CNS09QXS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 714 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 267 cgtcgagggcggcgacttcg 248
>emb|BX070987.1|CNS09QXR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 692 cgtcgagggcggcgacttcg 711
>emb|BX070913.1|CNS09QVP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 253 cgtcgagggcggcgacttcg 234
>emb|BX070912.1|CNS09QVO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 795 cgtcgagggcggcgacttcg 814
>emb|BX070805.1|CNS09QSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 499 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 215 cgtcgagggcggcgacttcg 196
>emb|BX070804.1|CNS09QSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 745 cgtcgagggcggcgacttcg 764
>emb|BX070631.1|CNS09QNV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 550 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 257 cgtcgagggcggcgacttcg 238
>emb|BX070630.1|CNS09QNU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 765 cgtcgagggcggcgacttcg 784
>emb|BX070560.1|CNS09QLW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 363 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 240 cgtcgagggcggcgacttcg 221
>emb|BX070559.1|CNS09QLV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 772 cgtcgagggcggcgacttcg 791
>emb|BX070494.1|CNS09QK2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 841 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 236 cgtcgagggcggcgacttcg 217
>emb|BX070493.1|CNS09QK1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 699 cgtcgagggcggcgacttcg 718
>emb|BX070258.1|CNS09QDI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 455 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 269 cgtcgagggcggcgacttcg 250
>emb|BX070053.1|CNS09Q7T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 301 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 261 cgtcgagggcggcgacttcg 242
>emb|BX070052.1|CNS09Q7S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 796 cgtcgagggcggcgacttcg 815
>emb|BX070015.1|CNS09Q6R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 546 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 258 cgtcgagggcggcgacttcg 239
>emb|BX070014.1|CNS09Q6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 788 cgtcgagggcggcgacttcg 807
>emb|BX069981.1|CNS09Q5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 781 cgtcgagggcggcgacttcg 800
>emb|BX069946.1|CNS09Q4U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 879 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 791 cgtcgagggcggcgacttcg 810
>emb|BX069852.1|CNS09Q28 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 809 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 252 cgtcgagggcggcgacttcg 233
>emb|BX069851.1|CNS09Q27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 853 cgtcgagggcggcgacttcg 872
>emb|BX069725.1|CNS09PYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 254 cgtcgagggcggcgacttcg 235
>emb|BX069724.1|CNS09PYO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 787 cgtcgagggcggcgacttcg 806
>emb|BX069627.1|CNS09PVZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 760 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 250 cgtcgagggcggcgacttcg 231
>emb|BX069626.1|CNS09PVY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 782 cgtcgagggcggcgacttcg 801
>emb|BX069444.1|CNS09PQW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 245 cgtcgagggcggcgacttcg 226
>emb|BX069443.1|CNS09PQV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 779 cgtcgagggcggcgacttcg 798
>emb|BX069442.1|CNS09PQU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 262 cgtcgagggcggcgacttcg 243
>emb|BX069441.1|CNS09PQT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 777 cgtcgagggcggcgacttcg 796
>emb|BX069361.1|CNS09POL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 785 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 253 cgtcgagggcggcgacttcg 234
>emb|BX069360.1|CNS09POK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 903 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 796 cgtcgagggcggcgacttcg 815
>emb|BX069131.1|CNS09PI7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 251 cgtcgagggcggcgacttcg 232
>emb|BX069130.1|CNS09PI6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1050 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 801 cgtcgagggcggcgacttcg 820
>emb|BX069121.1|CNS09PHX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 273 cgtcgagggcggcgacttcg 254
>emb|BX069120.1|CNS09PHW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 777 cgtcgagggcggcgacttcg 796
>emb|BX069029.1|CNS09PFD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 321 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 290 cgtcgagggcggcgacttcg 271
>emb|BX069028.1|CNS09PFC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 827 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 735 cgtcgagggcggcgacttcg 754
>emb|BX068969.1|CNS09PDP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 477 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 275 cgtcgagggcggcgacttcg 256
>emb|BX068968.1|CNS09PDO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 757 cgtcgagggcggcgacttcg 776
>emb|BX068914.1|CNS09PC6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 268 cgtcgagggcggcgacttcg 249
>emb|BX068913.1|CNS09PC5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1021 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 800 cgtcgagggcggcgacttcg 819
>emb|BX068797.1|CNS09P8X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 531 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 31 cgtcgagggcggcgacttcg 12
>emb|BX068796.1|CNS09P8W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 878 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 679 cgtcgagggcggcgacttcg 698
>emb|BX068679.1|CNS09P5N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 255 cgtcgagggcggcgacttcg 236
>emb|BX068678.1|CNS09P5M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1045 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 795 cgtcgagggcggcgacttcg 814
>emb|BX068669.1|CNS09P5D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 502 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 243 cgtcgagggcggcgacttcg 224
>emb|BX068455.1|CNS09OZF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 804 cgtcgagggcggcgacttcg 823
>emb|BX068360.1|CNS09OWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 372 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 37 cgtcgagggcggcgacttcg 18
>emb|BX068359.1|CNS09OWR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 792 cgtcgagggcggcgacttcg 811
>emb|BX068150.1|CNS09OQY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 784 cgtcgagggcggcgacttcg 803
>emb|BX068136.1|CNS09OQK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 257 cgtcgagggcggcgacttcg 238
>emb|BX068135.1|CNS09OQJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 796 cgtcgagggcggcgacttcg 815
>emb|BX067770.1|CNS09OGE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 242 cgtcgagggcggcgacttcg 223
>emb|BX067769.1|CNS09OGD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 771 cgtcgagggcggcgacttcg 790
>emb|BX067575.1|CNS09OAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 254 cgtcgagggcggcgacttcg 235
>emb|BX067574.1|CNS09OAY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 758 cgtcgagggcggcgacttcg 777
>emb|BX067534.1|CNS09O9U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 289 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 113 cgtcgagggcggcgacttcg 94
>emb|BX067533.1|CNS09O9T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 771 cgtcgagggcggcgacttcg 790
>emb|BX067446.1|CNS09O7E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 574 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 244 cgtcgagggcggcgacttcg 225
>emb|BX067445.1|CNS09O7D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 747 cgtcgagggcggcgacttcg 766
>emb|BX067333.1|CNS09O49 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 767 cgtcgagggcggcgacttcg 786
>emb|BX067064.1|CNS09NWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 264 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 233 cgtcgagggcggcgacttcg 214
>emb|BX067063.1|CNS09NWR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1041 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 743 cgtcgagggcggcgacttcg 762
>emb|BX067001.1|CNS09NV1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 431 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 265 cgtcgagggcggcgacttcg 246
>emb|BX067000.1|CNS09NV0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 710 cgtcgagggcggcgacttcg 729
>emb|BX067241.1|CNS09O1P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 246 cgtcgagggcggcgacttcg 227
>emb|BX067240.1|CNS09O1O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 869 cgtcgagggcggcgacttcg 888
>emb|BX067178.1|CNS09NZY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 245 cgtcgagggcggcgacttcg 226
>emb|BX067177.1|CNS09NZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 693 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 555 cgtcgagggcggcgacttcg 574
>emb|BX067146.1|CNS09NZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 272 cgtcgagggcggcgacttcg 253
>emb|BX067145.1|CNS09NZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 797 cgtcgagggcggcgacttcg 816
>emb|BX066849.1|CNS09NQT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 256 cgtcgagggcggcgacttcg 237
>emb|BX066848.1|CNS09NQS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 786 cgtcgagggcggcgacttcg 805
>emb|BX066768.1|CNS09NOK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 593 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 251 cgtcgagggcggcgacttcg 232
>emb|BX066767.1|CNS09NOJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 765 cgtcgagggcggcgacttcg 784
>emb|BX066726.1|CNS09NNE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 239 cgtcgagggcggcgacttcg 220
>emb|BX066725.1|CNS09NND Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 780 cgtcgagggcggcgacttcg 799
>emb|BX066633.1|CNS09NKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 791 cgtcgagggcggcgacttcg 810
>emb|BX066558.1|CNS09NIQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 679 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 113 cgtcgagggcggcgacttcg 94
>emb|BX066557.1|CNS09NIP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 778 cgtcgagggcggcgacttcg 797
>emb|BX066512.1|CNS09NHG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 248 cgtcgagggcggcgacttcg 229
>emb|BX066511.1|CNS09NHF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1033 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 778 cgtcgagggcggcgacttcg 797
>emb|BX066367.1|CNS09NDF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 537 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 238 cgtcgagggcggcgacttcg 219
>emb|BX066366.1|CNS09NDE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 587 cgtcgagggcggcgacttcg 606
>emb|BX066303.1|CNS09NBN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 245 cgtcgagggcggcgacttcg 226
>emb|BX066302.1|CNS09NBM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 782 cgtcgagggcggcgacttcg 801
>emb|BX066297.1|CNS09NBH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 223 cgtcgagggcggcgacttcg 204
>emb|BX066296.1|CNS09NBG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 767 cgtcgagggcggcgacttcg 786
>emb|BX066130.1|CNS09N6U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 247 cgtcgagggcggcgacttcg 228
>emb|BX066129.1|CNS09N6T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 868 cgtcgagggcggcgacttcg 887
>emb|BX065912.1|CNS09N0S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 700 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 243 cgtcgagggcggcgacttcg 224
>emb|BX065603.1|CNS09MS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 224 cgtcgagggcggcgacttcg 205
>emb|BX065559.1|CNS09MQZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 236 cgtcgagggcggcgacttcg 217
>emb|BX065558.1|CNS09MQY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 774 cgtcgagggcggcgacttcg 793
>emb|BX065427.1|CNS09MNB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 197 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 162 cgtcgagggcggcgacttcg 143
>emb|BX065426.1|CNS09MNA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 755 cgtcgagggcggcgacttcg 774
>emb|BX065421.1|CNS09MN5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 214 cgtcgagggcggcgacttcg 195
>emb|BX065420.1|CNS09MN4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 796 cgtcgagggcggcgacttcg 815
>emb|BX065376.1|CNS09MLW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 233 cgtcgagggcggcgacttcg 214
>emb|BX065375.1|CNS09MLV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 768 cgtcgagggcggcgacttcg 787
>emb|BX065329.1|CNS09MKL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 467 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 245 cgtcgagggcggcgacttcg 226
>emb|BX065312.1|CNS09MK4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 781 cgtcgagggcggcgacttcg 800
>emb|BX065118.1|CNS09MEQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 790 cgtcgagggcggcgacttcg 809
>emb|BX065105.1|CNS09MED Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 323 cgtcgagggcggcgacttcg 342 |||||||||||||||||||| Sbjct: 749 cgtcgagggcggcgacttcg 768 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,089,048 Number of Sequences: 3902068 Number of extensions: 5089048 Number of successful extensions: 151244 Number of sequences better than 10.0: 942 Number of HSP's better than 10.0 without gapping: 963 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 142952 Number of HSP's gapped (non-prelim): 8286 length of query: 550 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 527 effective length of database: 17,143,297,704 effective search space: 9034517890008 effective search space used: 9034517890008 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
