ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart24c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016269.1| Zea mays clone Contig102 mRNA sequence 464 e-127
2gb|AY103919.1| Zea mays PCO099246 mRNA sequence 464 e-127
3gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence 458 e-126
4ref|NM_192099.1| Oryza sativa (japonica cultivar-group), predic... 454 e-124
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 454 e-124
6dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D... 454 e-124
7dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic D... 454 e-124
8dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clon... 454 e-124
9dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clon... 454 e-124
10dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clon... 454 e-124
11dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RW... 454 e-124
12dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 446 e-122
13gb|BT016705.1| Zea mays clone Contig538 mRNA sequence 379 e-102
14ref|XM_475866.1| Oryza sativa (japonica cultivar-group), predic... 353 4e-94
15gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome... 353 4e-94
16gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome... 353 4e-94
17dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 353 4e-94
18dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
19dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
20dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 4e-94
21gb|U44850.1|GMU44850 Glycine max G beta-like protein mRNA, compl... 192 8e-46
22emb|Z33643.1|BNGNRPR B.napus (Naehan) bgb1 mRNA for guanine nucl... 168 1e-38
23dbj|AK108115.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
24gb|DQ393574.1| Metarhizium anisopliae G-protein beta subunit mRN... 143 7e-31
25ref|XM_954977.1| Neurospora crassa OR74A hypothetical protein (N... 135 2e-28
26ref|XM_325664.1| Neurospora crassa OR74A hypothetical protein (N... 135 2e-28
27emb|X81875.1|NCCPC2 N.crassa cpc-2 gene 135 2e-28
28ref|XM_390046.1| Gibberella zeae PH-1 chromosome 1 GBLP_NEUCR Gu... 125 2e-25
29ref|XM_481173.1| Oryza sativa (japonica cultivar-group), mRNA 117 4e-23
30dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-23
31dbj|AP005731.3| Oryza sativa (japonica cultivar-group) genomic D... 117 4e-23
32ref|NM_101670.2| Arabidopsis thaliana ATARCA; nucleotide binding... 115 2e-22
33gb|AY063016.1| Arabidopsis thaliana putative WD-40 repeat protei... 115 2e-22
34gb|AY035007.1| Arabidopsis thaliana putative WD-40 repeat protei... 115 2e-22
35emb|BX815631.1|CNS0ABFU Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
36emb|BX816078.1|CNS0ABTL Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
37emb|BX816944.1|CNS0ABM9 Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
38emb|BX815413.1|CNS0ABK1 Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
39emb|BX815215.1|CNS0ABGT Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
40emb|BX815043.1|CNS0ABBL Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
41gb|AY088480.1| Arabidopsis thaliana clone 7026 mRNA, complete se... 115 2e-22
42gb|AC034107.5|T10F20 Sequence of BAC T10F20 from Arabidopsis tha... 115 2e-22
43gb|AC069551.4|AC069551 Genomic sequence for Arabidopsis thaliana... 115 2e-22
44gb|U77381.1|ATU77381 Arabidopsis thaliana WD-40 repeat protein (... 115 2e-22
45dbj|AB226203.1| Aspergillus oryzae cDNA, contig sequence: AoEST3062 111 2e-21
46dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 111 2e-21
47emb|BX814194.1|CNS0AC6D Arabidopsis thaliana Full-length cDNA Co... 107 4e-20
48dbj|D29704.1|RICYK16 Oryza sativa mRNA, partial homologous to G-... 107 4e-20
49dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta ... 107 4e-20
50gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 105 1e-19
51gb|AC137075.2| Genomic sequence for Oryza sativa, Nipponbare str... 105 1e-19
52dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
53ref|XM_746421.1| Aspergillus fumigatus Af293 guanine nucleotide-... 103 6e-19
54dbj|AB189027.1| Plutella xylostella mRNA for receptor for activa... 101 2e-18
55emb|BX814524.1|CNS0AC6T Arabidopsis thaliana Full-length cDNA Co... 100 9e-18
56ref|XM_362274.1| Magnaporthe grisea 70-15 hypothetical protein (... 96 1e-16
57gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like... 94 6e-16
58gb|AF548359.2| Paracoccidioides brasiliensis RACK1-like protein ... 92 2e-15
59gb|DQ186603.2| Paracoccidioides brasiliensis RACK1-like protein ... 92 2e-15
60emb|AJ298991.1|FSY298991 Fagus sylvatica partial mRNA for G prot... 88 3e-14
61gb|AY547291.1| Toxoplasma gondii receptor for activated C kinase... 86 1e-13
62gb|BT012679.1| Lycopersicon esculentum clone 113523F, mRNA sequence 84 5e-13
63gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 rec... 84 5e-13
64dbj|AB022686.1| Lycopersicon esculentum mRNA for LeArcA1 protein... 84 5e-13
65ref|XM_656675.1| Aspergillus nidulans FGSC A4 guanine nucleotide... 82 2e-12
66ref|XM_753462.1| Ustilago maydis 521 hypothetical protein (UM024... 82 2e-12
67gb|AF176775.1|AF176775 Emericella nidulans Gbeta like protein (c... 82 2e-12
68emb|Z72388.1|NPGPROTB N.plumbaginifolia mRNA for G protein beta-... 78 3e-11
69emb|Y09514.1|NPY09514 N.plumbaginifolia mRNA for G protein beta ... 76 1e-10
70emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subun... 76 1e-10
71dbj|AK113077.1| Ciona intestinalis cDNA, clone:ciad004p08, full ... 76 1e-10
72ref|XM_504171.1| Yarrowia lipolytica CLIB122, YALI0E20045g predi... 74 5e-10
73emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein bet... 74 5e-10
74gb|DQ122924.1| Chlamydomonas incerta G protein beta subunit-like... 74 5e-10
75emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 74 5e-10
76emb|AL116739.1|CNS01DEZ Botrytis cinerea strain T4 cDNA library 72 2e-09
77ref|XM_777161.1| PREDICTED: Strongylocentrotus purpuratus simila... 70 8e-09
78emb|CR938316.1| Single read from an extremity of a full-length c... 70 8e-09
79emb|CR938117.1| Single read from an extremity of a full-length c... 70 8e-09
80gb|AF368031.1|AF368031 Heliothis virescens receptor for activate... 70 8e-09
81emb|AJ004807.1|NTAJ4807 Nicotiana tabacum xanthi arcA 3 gene, pa... 68 3e-08
82gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 rec... 68 3e-08
83emb|AL116759.1|CNS01DFJ Botrytis cinerea strain T4 cDNA library 68 3e-08
84gb|AC093195.2| Drosophila melanogaster clone BACR16J09, complete... 66 1e-07
85gb|BT015249.1| Drosophila melanogaster LP17455 full insert cDNA 66 1e-07
86gb|AC008328.6| Drosophila melanogaster clone BACR09A04, complete... 66 1e-07
87gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence 66 1e-07
88gb|AY228759.1| Junonia coenia fringe mRNA, complete cds 66 1e-07
89ref|NM_057921.3| Drosophila melanogaster Receptor of activated p... 66 1e-07
90gb|AY071661.1| Drosophila melanogaster RE74715 full length cDNA 66 1e-07
91gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, r... 66 1e-07
92dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein... 66 1e-07
93gb|AY130393.1| Myxine glutinosa guanine nucleotide-binding prote... 66 1e-07
94gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28... 66 1e-07
95gb|AC004723.1|AC004723 Drosophila melanogaster, chromosome 2L, r... 66 1e-07
96gb|U96491.1|DMU96491 Drosophila melanogaster RACK1 (rack1) mRNA,... 66 1e-07
97gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like... 66 1e-07
98ref|XM_572317.1| Cryptococcus neoformans var. neoformans JEC21 c... 64 5e-07
99gb|AY431533.1| Aedes aegypti ASAP ID: 34655 Receptor for activat... 62 2e-06
100gb|DQ440042.1| Aedes aegypti clone AE-2850 activated protein kin... 62 2e-06
101emb|CR938134.1| Single read from an extremity of a full-length c... 62 2e-06
102emb|CR938087.1| Single read from an extremity of a full-length c... 62 2e-06
103emb|CR938067.1| Single read from an extremity of a full-length c... 62 2e-06
104emb|CR938027.1| Single read from an extremity of a full-length c... 62 2e-06
105ref|NM_069458.3| Caenorhabditis elegans K04D7.1 (K04D7.1) mRNA, ... 62 2e-06
106emb|Z69664.1|CEK04D7 Caenorhabditis elegans Cosmid K04D7, comple... 62 2e-06
107emb|BX013826.1|CNS08ITY Single read from an extremity of a full-... 60 8e-06
108emb|BX013825.1|CNS08ITX Single read from an extremity of a full-... 60 8e-06
109emb|BX008526.1|CNS08EQQ Single read from an extremity of a full-... 60 8e-06
110emb|BX008525.1|CNS08EQP Single read from an extremity of a full-... 60 8e-06
111emb|CR938394.1| Single read from an extremity of a full-length c... 58 3e-05
112emb|CR938393.1| Single read from an extremity of a full-length c... 58 3e-05
113dbj|AB089281.1| Mamestra brassicae mRNA for receptor for activat... 58 3e-05
114ref|XM_824109.1| Trypanosoma brucei TREU927 guanine nucleotide-b... 56 1e-04
115ref|XM_824108.1| Trypanosoma brucei TREU927 guanine nucleotide-b... 56 1e-04
116gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chr... 52 0.002
117emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-... 52 0.002
118emb|BX072072.1|CNS09RRW Single read from an extremity of a full-... 52 0.002
119emb|BX071929.1|CNS09RNX Single read from an extremity of a full-... 52 0.002
120emb|BX071928.1|CNS09RNW Single read from an extremity of a full-... 52 0.002
121emb|BX071775.1|CNS09RJN Single read from an extremity of a full-... 52 0.002
122emb|BX071585.1|CNS09RED Single read from an extremity of a full-... 52 0.002
123emb|BX071584.1|CNS09REC Single read from an extremity of a full-... 52 0.002
124emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-... 52 0.002
125emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-... 52 0.002
126emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-... 52 0.002
127emb|BX070959.1|CNS09QWZ Single read from an extremity of a full-... 52 0.002
128emb|BX070941.1|CNS09QWH Single read from an extremity of a full-... 52 0.002
129emb|BX070940.1|CNS09QWG Single read from an extremity of a full-... 52 0.002
130emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-... 52 0.002
131emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-... 52 0.002
132emb|BX069556.1|CNS09PU0 Single read from an extremity of a full-... 52 0.002
133emb|BX069191.1|CNS09PJV Single read from an extremity of a full-... 52 0.002
134emb|BX069190.1|CNS09PJU Single read from an extremity of a full-... 52 0.002
135emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-... 52 0.002
136emb|BX068249.1|CNS09OTP Single read from an extremity of a full-... 52 0.002
137emb|BX068248.1|CNS09OTO Single read from an extremity of a full-... 52 0.002
138emb|BX068227.1|CNS09OT3 Single read from an extremity of a full-... 52 0.002
139emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-... 52 0.002
140emb|BX068108.1|CNS09OPS Single read from an extremity of a full-... 52 0.002
141emb|BX068107.1|CNS09OPR Single read from an extremity of a full-... 52 0.002
142emb|BX067893.1|CNS09OJT Single read from an extremity of a full-... 52 0.002
143emb|BX067875.1|CNS09OJB Single read from an extremity of a full-... 52 0.002
144emb|BX067874.1|CNS09OJA Single read from an extremity of a full-... 52 0.002
145emb|BX067850.1|CNS09OIM Single read from an extremity of a full-... 52 0.002
146emb|BX067849.1|CNS09OIL Single read from an extremity of a full-... 52 0.002
147emb|BX067804.1|CNS09OHC Single read from an extremity of a full-... 52 0.002
148emb|BX067803.1|CNS09OHB Single read from an extremity of a full-... 52 0.002
149emb|BX067706.1|CNS09OEM Single read from an extremity of a full-... 52 0.002
150emb|BX067705.1|CNS09OEL Single read from an extremity of a full-... 52 0.002
151emb|BX067646.1|CNS09OCY Single read from an extremity of a full-... 52 0.002
152emb|BX067645.1|CNS09OCX Single read from an extremity of a full-... 52 0.002
153emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-... 52 0.002
154emb|BX067491.1|CNS09O8N Single read from an extremity of a full-... 52 0.002
155emb|BX067108.1|CNS09NY0 Single read from an extremity of a full-... 52 0.002
156emb|BX066978.1|CNS09NUE Single read from an extremity of a full-... 52 0.002
157emb|BX066941.1|CNS09NTD Single read from an extremity of a full-... 52 0.002
158emb|BX066940.1|CNS09NTC Single read from an extremity of a full-... 52 0.002
159emb|BX066785.1|CNS09NP1 Single read from an extremity of a full-... 52 0.002
160emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-... 52 0.002
161emb|BX066046.1|CNS09N4I Single read from an extremity of a full-... 52 0.002
162emb|BX065996.1|CNS09N34 Single read from an extremity of a full-... 52 0.002
163emb|BX065949.1|CNS09N1T Single read from an extremity of a full-... 52 0.002
164emb|BX065948.1|CNS09N1S Single read from an extremity of a full-... 52 0.002
165emb|BX065903.1|CNS09N0J Single read from an extremity of a full-... 52 0.002
166emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-... 52 0.002
167emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-... 52 0.002
168emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-... 52 0.002
169emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-... 52 0.002
170emb|BX065157.1|CNS09MFT Single read from an extremity of a full-... 52 0.002
171emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-... 52 0.002
172emb|BX064854.1|CNS09M7E Single read from an extremity of a full-... 52 0.002
173emb|BX064853.1|CNS09M7D Single read from an extremity of a full-... 52 0.002
174emb|BX064405.1|CNS09LUX Single read from an extremity of a full-... 52 0.002
175emb|BX064360.1|CNS09LTO Single read from an extremity of a full-... 52 0.002
176emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-... 52 0.002
177emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-... 52 0.002
178emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-... 52 0.002
179emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-... 52 0.002
180emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-... 52 0.002
181emb|BX063937.1|CNS09LHX Single read from an extremity of a full-... 52 0.002
182emb|BX063936.1|CNS09LHW Single read from an extremity of a full-... 52 0.002
183emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-... 52 0.002
184emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-... 52 0.002
185emb|BX063359.1|CNS09L1V Single read from an extremity of a full-... 52 0.002
186emb|BX063358.1|CNS09L1U Single read from an extremity of a full-... 52 0.002
187emb|BX063357.1|CNS09L1T Single read from an extremity of a full-... 52 0.002
188emb|BX063356.1|CNS09L1S Single read from an extremity of a full-... 52 0.002
189emb|BX063204.1|CNS09KXK Single read from an extremity of a full-... 52 0.002
190emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-... 52 0.002
191emb|BX063051.1|CNS09KTB Single read from an extremity of a full-... 52 0.002
192emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-... 52 0.002
193emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-... 52 0.002
194emb|BX062775.1|CNS09KLN Single read from an extremity of a full-... 52 0.002
195emb|BX062774.1|CNS09KLM Single read from an extremity of a full-... 52 0.002
196emb|BX062265.1|CNS09K7H Single read from an extremity of a full-... 52 0.002
197emb|BX062264.1|CNS09K7G Single read from an extremity of a full-... 52 0.002
198emb|BX062196.1|CNS09K5K Single read from an extremity of a full-... 52 0.002
199emb|BX062195.1|CNS09K5J Single read from an extremity of a full-... 52 0.002
200emb|BX062132.1|CNS09K3S Single read from an extremity of a full-... 52 0.002
201emb|BX062131.1|CNS09K3R Single read from an extremity of a full-... 52 0.002
202emb|BX062042.1|CNS09K1A Single read from an extremity of a full-... 52 0.002
203emb|BX062041.1|CNS09K19 Single read from an extremity of a full-... 52 0.002
204emb|BX061983.1|CNS09JZN Single read from an extremity of a full-... 52 0.002
205emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-... 52 0.002
206emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-... 52 0.002
207emb|BX061867.1|CNS09JWF Single read from an extremity of a full-... 52 0.002
208emb|BX061866.1|CNS09JWE Single read from an extremity of a full-... 52 0.002
209emb|BX061808.1|CNS09JUS Single read from an extremity of a full-... 52 0.002
210emb|BX061807.1|CNS09JUR Single read from an extremity of a full-... 52 0.002
211emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-... 52 0.002
212emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-... 52 0.002
213emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-... 52 0.002
214emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-... 52 0.002
215emb|BX061589.1|CNS09JOP Single read from an extremity of a full-... 52 0.002
216emb|BX061588.1|CNS09JOO Single read from an extremity of a full-... 52 0.002
217emb|BX061562.1|CNS09JNY Single read from an extremity of a full-... 52 0.002
218emb|BX061561.1|CNS09JNX Single read from an extremity of a full-... 52 0.002
219emb|BX060748.1|CNS09J1C Single read from an extremity of a full-... 52 0.002
220emb|BX060747.1|CNS09J1B Single read from an extremity of a full-... 52 0.002
221emb|BX060076.1|CNS09IIO Single read from an extremity of a full-... 52 0.002
222emb|BX060034.1|CNS09IHI Single read from an extremity of a full-... 52 0.002
223emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-... 52 0.002
224emb|BX059516.1|CNS09I34 Single read from an extremity of a full-... 52 0.002
225emb|BX059380.1|CNS09HZC Single read from an extremity of a full-... 52 0.002
226emb|BX059379.1|CNS09HZB Single read from an extremity of a full-... 52 0.002
227emb|BX059205.1|CNS09HUH Single read from an extremity of a full-... 52 0.002
228emb|BX059204.1|CNS09HUG Single read from an extremity of a full-... 52 0.002
229emb|BX058573.1|CNS09HCX Single read from an extremity of a full-... 52 0.002
230emb|BX058572.1|CNS09HCW Single read from an extremity of a full-... 52 0.002
231emb|BX058489.1|CNS09HAL Single read from an extremity of a full-... 52 0.002
232emb|BX058488.1|CNS09HAK Single read from an extremity of a full-... 52 0.002
233emb|BX058248.1|CNS09H3W Single read from an extremity of a full-... 52 0.002
234emb|BX058247.1|CNS09H3V Single read from an extremity of a full-... 52 0.002
235emb|BX058245.1|CNS09H3T Single read from an extremity of a full-... 52 0.002
236emb|BX058224.1|CNS09H38 Single read from an extremity of a full-... 52 0.002
237emb|BX058185.1|CNS09H25 Single read from an extremity of a full-... 52 0.002
238emb|BX056697.1|CNS09FWT Single read from an extremity of a full-... 52 0.002
239emb|BX057714.1|CNS09GP2 Single read from an extremity of a full-... 52 0.002
240emb|BX057554.1|CNS09GKM Single read from an extremity of a full-... 52 0.002
241emb|BX057393.1|CNS09GG5 Single read from an extremity of a full-... 52 0.002
242emb|BX057098.1|CNS09G7Y Single read from an extremity of a full-... 52 0.002
243emb|BX055935.1|CNS09FBN Single read from an extremity of a full-... 52 0.002
244emb|BX056059.1|CNS09FF3 Single read from an extremity of a full-... 52 0.002
245emb|BX056035.1|CNS09FEF Single read from an extremity of a full-... 52 0.002
246emb|BX056009.1|CNS09FDP Single read from an extremity of a full-... 52 0.002
247emb|BX055973.1|CNS09FCP Single read from an extremity of a full-... 52 0.002
248emb|BX055414.1|CNS09EX6 Single read from an extremity of a full-... 52 0.002
249emb|BX053270.1|CNS09D9M Single read from an extremity of a full-... 52 0.002
250emb|BX053269.1|CNS09D9L Single read from an extremity of a full-... 52 0.002
251emb|BX055020.1|CNS09EM8 Single read from an extremity of a full-... 52 0.002
252emb|BX055019.1|CNS09EM7 Single read from an extremity of a full-... 52 0.002
253emb|BX054966.1|CNS09EKQ Single read from an extremity of a full-... 52 0.002
254emb|BX054930.1|CNS09EJQ Single read from an extremity of a full-... 52 0.002
255emb|BX054767.1|CNS09EF7 Single read from an extremity of a full-... 52 0.002
256emb|BX054766.1|CNS09EF6 Single read from an extremity of a full-... 52 0.002
257emb|BX054764.1|CNS09EF4 Single read from an extremity of a full-... 52 0.002
258emb|BX052962.1|CNS09D12 Single read from an extremity of a full-... 52 0.002
259emb|BX052918.1|CNS09CZU Single read from an extremity of a full-... 52 0.002
260emb|BX054709.1|CNS09EDL Single read from an extremity of a full-... 52 0.002
261emb|BX054708.1|CNS09EDK Single read from an extremity of a full-... 52 0.002
262emb|BX054523.1|CNS09E8F Single read from an extremity of a full-... 52 0.002
263emb|BX054522.1|CNS09E8E Single read from an extremity of a full-... 52 0.002
264emb|BX053999.1|CNS09DTV Single read from an extremity of a full-... 52 0.002
265emb|BX053571.1|CNS09DHZ Single read from an extremity of a full-... 52 0.002
266emb|BX053570.1|CNS09DHY Single read from an extremity of a full-... 52 0.002
267emb|BX053534.1|CNS09DGY Single read from an extremity of a full-... 52 0.002
268emb|BX052899.1|CNS09CZB Single read from an extremity of a full-... 52 0.002
269emb|BX052898.1|CNS09CZA Single read from an extremity of a full-... 52 0.002
270emb|BX052832.1|CNS09CXG Single read from an extremity of a full-... 52 0.002
271emb|BX052831.1|CNS09CXF Single read from an extremity of a full-... 52 0.002
272emb|BX051996.1|CNS09CA8 Single read from an extremity of a full-... 52 0.002
273emb|BX051742.1|CNS09C36 Single read from an extremity of a full-... 52 0.002
274emb|BX050240.1|CNS09AXG Single read from an extremity of a full-... 52 0.002
275emb|BX050369.1|CNS09B11 Single read from an extremity of a full-... 52 0.002
276emb|BX050368.1|CNS09B10 Single read from an extremity of a full-... 52 0.002
277emb|BX049954.1|CNS09API Single read from an extremity of a full-... 52 0.002
278emb|BX049953.1|CNS09APH Single read from an extremity of a full-... 52 0.002
279emb|BX049827.1|CNS09ALZ Single read from an extremity of a full-... 52 0.002
280emb|BX049747.1|CNS09AJR Single read from an extremity of a full-... 52 0.002
281emb|BX049746.1|CNS09AJQ Single read from an extremity of a full-... 52 0.002
282emb|BX049143.1|CNS09A2Z Single read from an extremity of a full-... 52 0.002
283emb|BX049142.1|CNS09A2Y Single read from an extremity of a full-... 52 0.002
284emb|BX049084.1|CNS09A1C Single read from an extremity of a full-... 52 0.002
285emb|BX049053.1|CNS09A0H Single read from an extremity of a full-... 52 0.002
286emb|BX049052.1|CNS09A0G Single read from an extremity of a full-... 52 0.002
287emb|BX048866.1|CNS099VA Single read from an extremity of a full-... 52 0.002
288emb|BX048716.1|CNS099R4 Single read from an extremity of a full-... 52 0.002
289emb|BX048623.1|CNS099OJ Single read from an extremity of a full-... 52 0.002
290emb|BX048011.1|CNS0997J Single read from an extremity of a full-... 52 0.002
291emb|BX048010.1|CNS0997I Single read from an extremity of a full-... 52 0.002
292emb|BX047723.1|CNS098ZJ Single read from an extremity of a full-... 52 0.002
293emb|BX047414.1|CNS098QY Single read from an extremity of a full-... 52 0.002
294emb|BX047341.1|CNS098OX Single read from an extremity of a full-... 52 0.002
295emb|BX047340.1|CNS098OW Single read from an extremity of a full-... 52 0.002
296emb|BX047228.1|CNS098LS Single read from an extremity of a full-... 52 0.002
297emb|BX046960.1|CNS098EC Single read from an extremity of a full-... 52 0.002
298emb|BX046948.1|CNS098E0 Single read from an extremity of a full-... 52 0.002
299emb|BX046837.1|CNS098AX Single read from an extremity of a full-... 52 0.002
300emb|BX046342.1|CNS097X6 Single read from an extremity of a full-... 52 0.002
301emb|BX046341.1|CNS097X5 Single read from an extremity of a full-... 52 0.002
302emb|BX046137.1|CNS097RH Single read from an extremity of a full-... 52 0.002
303emb|BX046044.1|CNS097OW Single read from an extremity of a full-... 52 0.002
304emb|BX046043.1|CNS097OV Single read from an extremity of a full-... 52 0.002
305emb|BX046040.1|CNS097OS Single read from an extremity of a full-... 52 0.002
306emb|BX046039.1|CNS097OR Single read from an extremity of a full-... 52 0.002
307emb|BX046003.1|CNS097NR Single read from an extremity of a full-... 52 0.002
308emb|BX045659.1|CNS097E7 Single read from an extremity of a full-... 52 0.002
309emb|BX045120.1|CNS096Z8 Single read from an extremity of a full-... 52 0.002
310emb|BX044960.1|CNS096US Single read from an extremity of a full-... 52 0.002
311emb|BX044959.1|CNS096UR Single read from an extremity of a full-... 52 0.002
312emb|BX044558.1|CNS096JM Single read from an extremity of a full-... 52 0.002
313emb|BX044557.1|CNS096JL Single read from an extremity of a full-... 52 0.002
314emb|BX044477.1|CNS096HD Single read from an extremity of a full-... 52 0.002
315emb|BX044333.1|CNS096DD Single read from an extremity of a full-... 52 0.002
316emb|BX043878.1|CNS0960Q Single read from an extremity of a full-... 52 0.002
317emb|BX043877.1|CNS0960P Single read from an extremity of a full-... 52 0.002
318emb|BX043353.1|CNS095M5 Single read from an extremity of a full-... 52 0.002
319emb|BX043224.1|CNS095IK Single read from an extremity of a full-... 52 0.002
320emb|BX043223.1|CNS095IJ Single read from an extremity of a full-... 52 0.002
321emb|BX043130.1|CNS095FY Single read from an extremity of a full-... 52 0.002
322emb|BX043129.1|CNS095FX Single read from an extremity of a full-... 52 0.002
323emb|BX042859.1|CNS0958F Single read from an extremity of a full-... 52 0.002
324emb|BX042858.1|CNS0958E Single read from an extremity of a full-... 52 0.002
325emb|BX042789.1|CNS0956H Single read from an extremity of a full-... 52 0.002
326emb|BX042788.1|CNS0956G Single read from an extremity of a full-... 52 0.002
327emb|BX042583.1|CNS0950R Single read from an extremity of a full-... 52 0.002
328emb|BX042320.1|CNS094TG Single read from an extremity of a full-... 52 0.002
329emb|BX042319.1|CNS094TF Single read from an extremity of a full-... 52 0.002
330emb|BX042156.1|CNS094OW Single read from an extremity of a full-... 52 0.002
331emb|BX042155.1|CNS094OV Single read from an extremity of a full-... 52 0.002
332emb|BX042051.1|CNS094LZ Single read from an extremity of a full-... 52 0.002
333emb|BX042050.1|CNS094LY Single read from an extremity of a full-... 52 0.002
334emb|BX041945.1|CNS094J1 Single read from an extremity of a full-... 52 0.002
335emb|BX041443.1|CNS09453 Single read from an extremity of a full-... 52 0.002
336emb|BX041442.1|CNS09452 Single read from an extremity of a full-... 52 0.002
337emb|BX041381.1|CNS0943D Single read from an extremity of a full-... 52 0.002
338emb|BX041149.1|CNS093WX Single read from an extremity of a full-... 52 0.002
339emb|BX041148.1|CNS093WW Single read from an extremity of a full-... 52 0.002
340emb|BX041077.1|CNS093UX Single read from an extremity of a full-... 52 0.002
341emb|BX041076.1|CNS093UW Single read from an extremity of a full-... 52 0.002
342emb|BX040686.1|CNS093K2 Single read from an extremity of a full-... 52 0.002
343emb|BX040685.1|CNS093K1 Single read from an extremity of a full-... 52 0.002
344emb|BX040670.1|CNS093JM Single read from an extremity of a full-... 52 0.002
345emb|BX039816.1|CNS092VW Single read from an extremity of a full-... 52 0.002
346emb|BX039815.1|CNS092VV Single read from an extremity of a full-... 52 0.002
347emb|BX039622.1|CNS092QI Single read from an extremity of a full-... 52 0.002
348emb|BX039621.1|CNS092QH Single read from an extremity of a full-... 52 0.002
349emb|BX038778.1|CNS09232 Single read from an extremity of a full-... 52 0.002
350emb|BX038777.1|CNS09231 Single read from an extremity of a full-... 52 0.002
351emb|BX037314.1|CNS090YE Single read from an extremity of a full-... 52 0.002
352emb|BX037214.1|CNS090VM Single read from an extremity of a full-... 52 0.002
353emb|BX036751.1|CNS090IR Single read from an extremity of a full-... 52 0.002
354emb|BX036750.1|CNS090IQ Single read from an extremity of a full-... 52 0.002
355emb|BX036560.1|CNS090DG Single read from an extremity of a full-... 52 0.002
356emb|BX036865.1|CNS090LX Single read from an extremity of a full-... 52 0.002
357emb|BX036775.1|CNS090JF Single read from an extremity of a full-... 52 0.002
358emb|BX036493.1|CNS090BL Single read from an extremity of a full-... 52 0.002
359emb|BX036135.1|CNS0901N Single read from an extremity of a full-... 52 0.002
360emb|BX036134.1|CNS0901M Single read from an extremity of a full-... 52 0.002
361emb|BX036012.1|CNS08ZY8 Single read from an extremity of a full-... 52 0.002
362emb|BX035994.1|CNS08ZXQ Single read from an extremity of a full-... 52 0.002
363emb|BX035870.1|CNS08ZUA Single read from an extremity of a full-... 52 0.002
364emb|BX035830.1|CNS08ZT6 Single read from an extremity of a full-... 52 0.002
365emb|BX035661.1|CNS08ZOH Single read from an extremity of a full-... 52 0.002
366emb|BX035508.1|CNS08ZK8 Single read from an extremity of a full-... 52 0.002
367emb|BX035507.1|CNS08ZK7 Single read from an extremity of a full-... 52 0.002
368emb|BX035504.1|CNS08ZK4 Single read from an extremity of a full-... 52 0.002
369emb|BX035503.1|CNS08ZK3 Single read from an extremity of a full-... 52 0.002
370emb|BX035221.1|CNS08ZC9 Single read from an extremity of a full-... 52 0.002
371emb|BX035158.1|CNS08ZAI Single read from an extremity of a full-... 52 0.002
372emb|BX035097.1|CNS08Z8T Single read from an extremity of a full-... 52 0.002
373emb|BX035096.1|CNS08Z8S Single read from an extremity of a full-... 52 0.002
374emb|BX034772.1|CNS08YZS Single read from an extremity of a full-... 52 0.002
375emb|BX034771.1|CNS08YZR Single read from an extremity of a full-... 52 0.002
376emb|BX034687.1|CNS08YXF Single read from an extremity of a full-... 52 0.002
377emb|BX034686.1|CNS08YXE Single read from an extremity of a full-... 52 0.002
378emb|BX034669.1|CNS08YWX Single read from an extremity of a full-... 52 0.002
379emb|BX034668.1|CNS08YWW Single read from an extremity of a full-... 52 0.002
380emb|BX034902.1|CNS08Z3E Single read from an extremity of a full-... 52 0.002
381emb|BX034612.1|CNS08YVC Single read from an extremity of a full-... 52 0.002
382emb|BX034475.1|CNS08YRJ Single read from an extremity of a full-... 52 0.002
383emb|BX034474.1|CNS08YRI Single read from an extremity of a full-... 52 0.002
384emb|BX034465.1|CNS08YR9 Single read from an extremity of a full-... 52 0.002
385emb|BX034464.1|CNS08YR8 Single read from an extremity of a full-... 52 0.002
386emb|BX034200.1|CNS08YJW Single read from an extremity of a full-... 52 0.002
387emb|BX034103.1|CNS08YH7 Single read from an extremity of a full-... 52 0.002
388emb|BX034102.1|CNS08YH6 Single read from an extremity of a full-... 52 0.002
389emb|BX033792.1|CNS08Y8K Single read from an extremity of a full-... 52 0.002
390emb|BX033662.1|CNS08Y4Y Single read from an extremity of a full-... 52 0.002
391emb|BX033661.1|CNS08Y4X Single read from an extremity of a full-... 52 0.002
392emb|BX033565.1|CNS08Y29 Single read from an extremity of a full-... 52 0.002
393emb|BX033387.1|CNS08XXB Single read from an extremity of a full-... 52 0.002
394emb|BX033386.1|CNS08XXA Single read from an extremity of a full-... 52 0.002
395emb|BX033288.1|CNS08XUK Single read from an extremity of a full-... 52 0.002
396emb|BX033287.1|CNS08XUJ Single read from an extremity of a full-... 52 0.002
397emb|BX032887.1|CNS08XJF Single read from an extremity of a full-... 52 0.002
398emb|BX032886.1|CNS08XJE Single read from an extremity of a full-... 52 0.002
399emb|BX032855.1|CNS08XIJ Single read from an extremity of a full-... 52 0.002
400emb|BX032854.1|CNS08XII Single read from an extremity of a full-... 52 0.002
401emb|BX032853.1|CNS08XIH Single read from an extremity of a full-... 52 0.002
402emb|BX032771.1|CNS08XG7 Single read from an extremity of a full-... 52 0.002
403emb|BX032770.1|CNS08XG6 Single read from an extremity of a full-... 52 0.002
404emb|BX032539.1|CNS08X9R Single read from an extremity of a full-... 52 0.002
405emb|BX032392.1|CNS08X5O Single read from an extremity of a full-... 52 0.002
406emb|BX032391.1|CNS08X5N Single read from an extremity of a full-... 52 0.002
407emb|BX032340.1|CNS08X48 Single read from an extremity of a full-... 52 0.002
408emb|BX032337.1|CNS08X45 Single read from an extremity of a full-... 52 0.002
409emb|BX032336.1|CNS08X44 Single read from an extremity of a full-... 52 0.002
410emb|BX032321.1|CNS08X3P Single read from an extremity of a full-... 52 0.002
411emb|BX032320.1|CNS08X3O Single read from an extremity of a full-... 52 0.002
412emb|BX032087.1|CNS08WX7 Single read from an extremity of a full-... 52 0.002
413emb|BX032038.1|CNS08WVU Single read from an extremity of a full-... 52 0.002
414emb|BX031734.1|CNS08WNE Single read from an extremity of a full-... 52 0.002
415emb|BX031733.1|CNS08WND Single read from an extremity of a full-... 52 0.002
416emb|BX031628.1|CNS08WKG Single read from an extremity of a full-... 52 0.002
417emb|BX031627.1|CNS08WKF Single read from an extremity of a full-... 52 0.002
418emb|BX031471.1|CNS08WG3 Single read from an extremity of a full-... 52 0.002
419emb|BX031470.1|CNS08WG2 Single read from an extremity of a full-... 52 0.002
420emb|BX031435.1|CNS08WF3 Single read from an extremity of a full-... 52 0.002
421emb|BX031434.1|CNS08WF2 Single read from an extremity of a full-... 52 0.002
422emb|BX031335.1|CNS08WCB Single read from an extremity of a full-... 52 0.002
423emb|BX030733.1|CNS08VVL Single read from an extremity of a full-... 52 0.002
424emb|BX030732.1|CNS08VVK Single read from an extremity of a full-... 52 0.002
425emb|BX031082.1|CNS08W5A Single read from an extremity of a full-... 52 0.002
426emb|BX031081.1|CNS08W59 Single read from an extremity of a full-... 52 0.002
427emb|BX030021.1|CNS08VBT Single read from an extremity of a full-... 52 0.002
428emb|BX030020.1|CNS08VBS Single read from an extremity of a full-... 52 0.002
429emb|BX029945.1|CNS08V9P Single read from an extremity of a full-... 52 0.002
430emb|BX029519.1|CNS08UXV Single read from an extremity of a full-... 52 0.002
431emb|BX029518.1|CNS08UXU Single read from an extremity of a full-... 52 0.002
432emb|BX029388.1|CNS08UU8 Single read from an extremity of a full-... 52 0.002
433emb|BX029387.1|CNS08UU7 Single read from an extremity of a full-... 52 0.002
434emb|BX029139.1|CNS08UNB Single read from an extremity of a full-... 52 0.002
435emb|BX029138.1|CNS08UNA Single read from an extremity of a full-... 52 0.002
436emb|BX029567.1|CNS08UZ7 Single read from an extremity of a full-... 52 0.002
437emb|BX029010.1|CNS08UJQ Single read from an extremity of a full-... 52 0.002
438emb|BX028870.1|CNS08UFU Single read from an extremity of a full-... 52 0.002
439emb|BX028746.1|CNS08UCE Single read from an extremity of a full-... 52 0.002
440emb|BX028745.1|CNS08UCD Single read from an extremity of a full-... 52 0.002
441emb|BX028680.1|CNS08UAK Single read from an extremity of a full-... 52 0.002
442emb|BX028679.1|CNS08UAJ Single read from an extremity of a full-... 52 0.002
443emb|BX028633.1|CNS08U99 Single read from an extremity of a full-... 52 0.002
444emb|BX028632.1|CNS08U98 Single read from an extremity of a full-... 52 0.002
445emb|BX028476.1|CNS08U4W Single read from an extremity of a full-... 52 0.002
446emb|BX022370.1|CNS08PFA Single read from an extremity of a full-... 52 0.002
447emb|BX022369.1|CNS08PF9 Single read from an extremity of a full-... 52 0.002
448emb|BX022362.1|CNS08PF2 Single read from an extremity of a full-... 52 0.002
449emb|BX022361.1|CNS08PF1 Single read from an extremity of a full-... 52 0.002
450emb|BX022296.1|CNS08PD8 Single read from an extremity of a full-... 52 0.002
451emb|BX022295.1|CNS08PD7 Single read from an extremity of a full-... 52 0.002
452emb|BX028332.1|CNS08U0W Single read from an extremity of a full-... 52 0.002
453emb|BX027959.1|CNS08TQJ Single read from an extremity of a full-... 52 0.002
454emb|BX027776.1|CNS08TLG Single read from an extremity of a full-... 52 0.002
455emb|BX027775.1|CNS08TLF Single read from an extremity of a full-... 52 0.002
456emb|BX027710.1|CNS08TJM Single read from an extremity of a full-... 52 0.002
457emb|BX027709.1|CNS08TJL Single read from an extremity of a full-... 52 0.002
458emb|BX027706.1|CNS08TJI Single read from an extremity of a full-... 52 0.002
459emb|BX027705.1|CNS08TJH Single read from an extremity of a full-... 52 0.002
460emb|BX027582.1|CNS08TG2 Single read from an extremity of a full-... 52 0.002
461emb|BX027441.1|CNS08TC5 Single read from an extremity of a full-... 52 0.002
462emb|BX026912.1|CNS08SXG Single read from an extremity of a full-... 52 0.002
463emb|BX026713.1|CNS08SRX Single read from an extremity of a full-... 52 0.002
464emb|BX026581.1|CNS08SO9 Single read from an extremity of a full-... 52 0.002
465emb|BX026476.1|CNS08SLC Single read from an extremity of a full-... 52 0.002
466emb|BX026475.1|CNS08SLB Single read from an extremity of a full-... 52 0.002
467emb|BX026473.1|CNS08SL9 Single read from an extremity of a full-... 52 0.002
468emb|BX026356.1|CNS08SI0 Single read from an extremity of a full-... 52 0.002
469emb|BX026309.1|CNS08SGP Single read from an extremity of a full-... 52 0.002
470emb|BX025966.1|CNS08S76 Single read from an extremity of a full-... 52 0.002
471emb|BX025932.1|CNS08S68 Single read from an extremity of a full-... 52 0.002
472emb|BX025668.1|CNS08RYW Single read from an extremity of a full-... 52 0.002
473emb|BX025630.1|CNS08RXU Single read from an extremity of a full-... 52 0.002
474emb|BX025629.1|CNS08RXT Single read from an extremity of a full-... 52 0.002
475emb|BX025427.1|CNS08RS7 Single read from an extremity of a full-... 52 0.002
476emb|BX025378.1|CNS08RQU Single read from an extremity of a full-... 52 0.002
477emb|BX025377.1|CNS08RQT Single read from an extremity of a full-... 52 0.002
478emb|BX025356.1|CNS08RQ8 Single read from an extremity of a full-... 52 0.002
479emb|BX025355.1|CNS08RQ7 Single read from an extremity of a full-... 52 0.002
480emb|BX024899.1|CNS08RDJ Single read from an extremity of a full-... 52 0.002
481emb|BX024898.1|CNS08RDI Single read from an extremity of a full-... 52 0.002
482emb|BX024478.1|CNS08R1U Single read from an extremity of a full-... 52 0.002
483emb|BX024477.1|CNS08R1T Single read from an extremity of a full-... 52 0.002
484emb|BX024305.1|CNS08QX1 Single read from an extremity of a full-... 52 0.002
485emb|BX024233.1|CNS08QV1 Single read from an extremity of a full-... 52 0.002
486emb|BX024132.1|CNS08QS8 Single read from an extremity of a full-... 52 0.002
487emb|BX024131.1|CNS08QS7 Single read from an extremity of a full-... 52 0.002
488emb|BX023979.1|CNS08QNZ Single read from an extremity of a full-... 52 0.002
489emb|BX023978.1|CNS08QNY Single read from an extremity of a full-... 52 0.002
490emb|BX023937.1|CNS08QMT Single read from an extremity of a full-... 52 0.002
491emb|BX023936.1|CNS08QMS Single read from an extremity of a full-... 52 0.002
492emb|BX023729.1|CNS08QH1 Single read from an extremity of a full-... 52 0.002
493emb|BX023572.1|CNS08QCO Single read from an extremity of a full-... 52 0.002
494emb|BX023551.1|CNS08QC3 Single read from an extremity of a full-... 52 0.002
495emb|BX023550.1|CNS08QC2 Single read from an extremity of a full-... 52 0.002
496emb|BX023505.1|CNS08QAT Single read from an extremity of a full-... 52 0.002
497emb|BX023504.1|CNS08QAS Single read from an extremity of a full-... 52 0.002
498emb|BX023475.1|CNS08Q9Z Single read from an extremity of a full-... 52 0.002
499emb|BX023474.1|CNS08Q9Y Single read from an extremity of a full-... 52 0.002
500emb|BX023413.1|CNS08Q89 Single read from an extremity of a full-... 52 0.002

>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence
          Length = 1254

 Score =  464 bits (234), Expect = e-127
 Identities = 392/445 (88%), Gaps = 6/445 (1%)
 Strand = Plus / Plus

                                                                       
Query: 101 gatgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgccctt 160
           |||||| |||||||||| || ||| ||||| |||||||| || |||||||||||||| ||
Sbjct: 105 gatgcgcggccacaacggcgaggtgacggcgatcgcgaccccgatcgacaactcgccgtt 164

                                                                       
Query: 161 catcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccccatcca 220
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||  ||||
Sbjct: 165 catcgtctcctcctcccgcgacaagtccctgctggtgtgggacctgaccaacccggtcca 224

                                                                       
Query: 221 ggccacccagga------caccagctccgagtacggcgtccccttccgccgcctcacagg 274
             |||||| |||      | ||| | |||| |||||||||||||||||||||||||| ||
Sbjct: 225 ctccaccccggaatccggcgccaccgccgactacggcgtccccttccgccgcctcaccgg 284

                                                                       
Query: 275 ccacggccactttgtccaggacgtcgtcctcagctccgacggccagttcgcgctctccgg 334
           ||||  |||||| |||||||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 285 ccactcccacttcgtccaggacgtcgtcctcagttccgacggccagttcgccctttccgg 344

                                                                       
Query: 335 atcctgggacggcgagctccgcctctgggacctctccaccggggtcaccacccgccgctt 394
            |||||||| || |||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 345 ctcctgggatggagagctccgcctctgggacctctccaccggcctcaccacccgccgctt 404

                                                                       
Query: 395 cgtcggccacgagaaggacgtcctctccgtcgccttctctattgacaaccgacagatcgt 454
           |||||||||||||||||| ||||||||||| ||||||||  |||||||||| ||||||||
Sbjct: 405 cgtcggccacgagaaggatgtcctctccgttgccttctccgttgacaaccgccagatcgt 464

                                                                       
Query: 455 ctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacac 514
           ||||||||||||||||   ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 465 ctccgcgtcccgcgacaagaccattaagctctggaacaccctcggtgagtgcaagtacac 524

                                    
Query: 515 catcggcggtgaccttggaggcggc 539
           |||||| |||||||| || ||||||
Sbjct: 525 catcggaggtgacctcggtggcggc 549



to top

>gb|AY103919.1| Zea mays PCO099246 mRNA sequence
          Length = 1461

 Score =  464 bits (234), Expect = e-127
 Identities = 392/445 (88%), Gaps = 6/445 (1%)
 Strand = Plus / Plus

                                                                       
Query: 101 gatgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgccctt 160
           |||||| |||||||||| || ||| ||||| |||||||| || |||||||||||||| ||
Sbjct: 262 gatgcgcggccacaacggcgaggtgacggcgatcgcgaccccgatcgacaactcgccgtt 321

                                                                       
Query: 161 catcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccccatcca 220
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||  ||||
Sbjct: 322 catcgtctcctcctcccgcgacaagtccctgctggtgtgggacctgaccaacccggtcca 381

                                                                       
Query: 221 ggccacccagga------caccagctccgagtacggcgtccccttccgccgcctcacagg 274
             |||||| |||      | ||| | |||| |||||||||||||||||||||||||| ||
Sbjct: 382 ctccaccccggaatccggcgccaccgccgactacggcgtccccttccgccgcctcaccgg 441

                                                                       
Query: 275 ccacggccactttgtccaggacgtcgtcctcagctccgacggccagttcgcgctctccgg 334
           ||||  |||||| |||||||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 442 ccactcccacttcgtccaggacgtcgtcctcagttccgacggccagttcgccctttccgg 501

                                                                       
Query: 335 atcctgggacggcgagctccgcctctgggacctctccaccggggtcaccacccgccgctt 394
            |||||||| || |||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 502 ctcctgggatggagagctccgcctctgggacctctccaccggcctcaccacccgccgctt 561

                                                                       
Query: 395 cgtcggccacgagaaggacgtcctctccgtcgccttctctattgacaaccgacagatcgt 454
           |||||||||||||||||| ||||||||||| ||||||||  |||||||||| ||||||||
Sbjct: 562 cgtcggccacgagaaggatgtcctctccgttgccttctccgttgacaaccgccagatcgt 621

                                                                       
Query: 455 ctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacac 514
           ||||||||||||||||   ||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 622 ctccgcgtcccgcgacaagaccattaagctctggaacaccctcggtgagtgcaagtacac 681

                                    
Query: 515 catcggcggtgaccttggaggcggc 539
           |||||| |||||||| || ||||||
Sbjct: 682 catcggaggtgacctcggtggcggc 706



to top

>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence
          Length = 1281

 Score =  458 bits (231), Expect = e-126
 Identities = 386/438 (88%), Gaps = 6/438 (1%)
 Strand = Plus / Plus

                                                                       
Query: 108 ggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttcatcgtc 167
           |||||||||| || ||| ||||| |||||||| || |||||||||||||| |||||||||
Sbjct: 121 ggccacaacggcgaggtgacggcgatcgcgaccccgatcgacaactcgccgttcatcgtc 180

                                                                       
Query: 168 tcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccccatccaggccacc 227
           ||||| |||||||||||||| ||||| || |||||||| ||||||||  ||||  |||||
Sbjct: 181 tcctcctcccgcgacaagtccctgctggtgtgggacctgaccaacccggtccactccacc 240

                                                                       
Query: 228 cagga------caccagctccgagtacggcgtccccttccgccgcctcacaggccacggc 281
           | |||      | ||| | |||| |||||||||||||||||||||||||| ||||||  |
Sbjct: 241 ccggaatccggcgccaccgccgactacggcgtccccttccgccgcctcaccggccactcc 300

                                                                       
Query: 282 cactttgtccaggacgtcgtcctcagctccgacggccagttcgcgctctccggatcctgg 341
           ||||| |||||||||||||||||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 301 cacttcgtccaggacgtcgtcctcagttccgacggccagttcgccctttccggctcctgg 360

                                                                       
Query: 342 gacggcgagctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggc 401
           || || |||||||||||||||||||||||||||||  |||||||||||||||||||||||
Sbjct: 361 gatggagagctccgcctctgggacctctccaccggcctcaccacccgccgcttcgtcggc 420

                                                                       
Query: 402 cacgagaaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcg 461
           ||||||||||| ||||||||||| ||||||||  |||||||||| |||||||||||||||
Sbjct: 421 cacgagaaggatgtcctctccgttgccttctccgttgacaaccgccagatcgtctccgcg 480

                                                                       
Query: 462 tcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatcggc 521
           |||||||||   ||||| ||||| ||||||||||||||||||||||||||||||||||| 
Sbjct: 481 tcccgcgacaagaccattaagctctggaacaccctcggtgagtgcaagtacaccatcgga 540

                             
Query: 522 ggtgaccttggaggcggc 539
           |||||||| || ||||||
Sbjct: 541 ggtgacctcggtggcggc 558



to top

>ref|NM_192099.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1005

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 183 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 242

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 243 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 302

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 303 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 362

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 363 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 422

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 423 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 482

            
Query: 539 c 539
           |
Sbjct: 483 c 483



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 4   gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 63

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 64  acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 123

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 124 tcgctgctggtgtgggacctcaccaaccccgtccag 159



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                            
Query: 239      ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
                ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 28324337 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 28324396

                                                                            
Query: 299      cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
                ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 28324397 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 28324456

                                                                            
Query: 359      ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
                |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 28324457 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 28324516

                                                                            
Query: 419      ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
                |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 28324517 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 28324576

                                                                            
Query: 479      caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
                ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 28324577 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 28324636

                 
Query: 539      c 539
                |
Sbjct: 28324637 c 28324637



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                            
Query: 66       gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
                ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 28324158 gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 28324217

                                                                            
Query: 126      acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
                |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 28324218 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 28324277

                                                    
Query: 186      tcgctgctcgtctgggacctcaccaaccccatccag 221
                |||||||| || |||||||||||||||||| |||||
Sbjct: 28324278 tcgctgctggtgtgggacctcaccaaccccgtccag 28324313



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 452      cgtctccgcgtcccgcgacc 471
                ||||||||||||||||||||
Sbjct: 32357404 cgtctccgcgtcccgcgacc 32357423



to top

>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0478H03
          Length = 167560

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                          
Query: 239    ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
              ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 158844 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 158903

                                                                          
Query: 299    cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
              ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 158904 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 158963

                                                                          
Query: 359    ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
              |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 158964 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 159023

                                                                          
Query: 419    ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
              |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 159024 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 159083

                                                                          
Query: 479    caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
              ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 159084 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 159143

               
Query: 539    c 539
              |
Sbjct: 159144 c 159144



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                          
Query: 66     gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
              ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 158665 gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 158724

                                                                          
Query: 126    acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
              |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 158725 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 158784

                                                  
Query: 186    tcgctgctcgtctgggacctcaccaaccccatccag 221
              |||||||| || |||||||||||||||||| |||||
Sbjct: 158785 tcgctgctggtgtgggacctcaccaaccccgtccag 158820



to top

>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0519D04
          Length = 193068

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                         
Query: 239   ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
             ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 39437 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 39496

                                                                         
Query: 299   cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
             ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 39497 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 39556

                                                                         
Query: 359   ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
             |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 39557 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 39616

                                                                         
Query: 419   ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
             |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 39617 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 39676

                                                                         
Query: 479   caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
             ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 39677 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 39736

              
Query: 539   c 539
             |
Sbjct: 39737 c 39737



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                         
Query: 66    gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
             ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 39258 gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 39317

                                                                         
Query: 126   acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
             |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 39318 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 39377

                                                 
Query: 186   tcgctgctcgtctgggacctcaccaaccccatccag 221
             |||||||| || |||||||||||||||||| |||||
Sbjct: 39378 tcgctgctggtgtgggacctcaccaaccccgtccag 39413



to top

>dbj|AK121587.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037K24, full
           insert sequence
          Length = 1358

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 281 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 340

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 341 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 400

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 401 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 460

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 461 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 520

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 521 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 580

            
Query: 539 c 539
           |
Sbjct: 581 c 581



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 102 gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 161

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 162 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 221

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 222 tcgctgctggtgtgggacctcaccaaccccgtccag 257



to top

>dbj|AK098893.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N15, full
           insert sequence
          Length = 1256

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 252 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 311

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 312 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 371

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 372 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 431

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 432 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 491

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 492 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 551

            
Query: 539 c 539
           |
Sbjct: 552 c 552



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 73  gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 132

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 133 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 192

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 193 tcgctgctggtgtgggacctcaccaaccccgtccag 228



to top

>dbj|AK060428.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-011-A02, full
           insert sequence
          Length = 1351

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 275 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 334

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 335 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 394

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 395 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 454

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 455 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 514

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 515 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 574

            
Query: 539 c 539
           |
Sbjct: 575 c 575



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 96  gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 155

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 156 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 215

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 216 tcgctgctggtgtgggacctcaccaaccccgtccag 251



to top

>dbj|D38231.1|RICGPBSLP Oryza sativa (japonica cultivar-group) RWD mRNA for q group of
           receptor for activated C-kinase, complete cds
          Length = 1285

 Score =  454 bits (229), Expect = e-124
 Identities = 283/301 (94%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||||| |||||||||||
Sbjct: 209 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacttcgtccaggacgt 268

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 269 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 328

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 329 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 388

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 389 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 448

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 449 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 508

            
Query: 539 c 539
           |
Sbjct: 509 c 509



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 30  gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 89

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 90  acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 149

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 150 tcgctgctggtgtgggacctcaccaaccccgtccag 185



to top

>dbj|AK098877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001E12, full
           insert sequence
          Length = 1326

 Score =  446 bits (225), Expect = e-122
 Identities = 282/301 (93%)
 Strand = Plus / Plus

                                                                       
Query: 239 ctccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgt 298
           ||||||||||||||| ||||||||||||||||| ||||||  |||| | |||||||||||
Sbjct: 269 ctccgagtacggcgtgcccttccgccgcctcaccggccactcccacctcgtccaggacgt 328

                                                                       
Query: 299 cgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcct 358
           ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 329 cgtcctcagctccgacggccagttcgcgctctctggctcctgggacggcgagctccgcct 388

                                                                       
Query: 359 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcct 418
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 389 ctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgacaaagacgtcct 448

                                                                       
Query: 419 ctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccat 478
           |||||||||||||||  | |||||||| |||||||||||||| |||||||||||||||||
Sbjct: 449 ctccgtcgccttctccgtcgacaaccgccagatcgtctccgcctcccgcgaccgcaccat 508

                                                                       
Query: 479 caagctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcgg 538
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| || |||||
Sbjct: 509 caagctgtggaacaccctcggcgagtgcaagtacaccatcggcggcgacctcggcggcgg 568

            
Query: 539 c 539
           |
Sbjct: 569 c 569



 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Plus

                                                                       
Query: 66  gccggcgcgcaggagtccctcgtgtacgccggtgtgatgcgtggccacaacgacgtggtc 125
           ||||||||||||||||| || ||||  ||||| |||||||  ||||||||||||||||| 
Sbjct: 90  gccggcgcgcaggagtctctggtgttggccggcgtgatgcacggccacaacgacgtggtg 149

                                                                       
Query: 126 acggccatcgcgacacccatcgacaactcgcccttcatcgtctcctcttcccgcgacaag 185
           |||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 150 acggccatcgcgacccccatcgacaactcgccgttcatcgtctcctcctcccgcgacaag 209

                                               
Query: 186 tcgctgctcgtctgggacctcaccaaccccatccag 221
           |||||||| || |||||||||||||||||| |||||
Sbjct: 210 tcgctgctggtgtgggacctcaccaaccccgtccag 245



to top

>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence
          Length = 1265

 Score =  379 bits (191), Expect = e-102
 Identities = 272/299 (90%)
 Strand = Plus / Plus

                                                                       
Query: 241 ccgagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcg 300
           |||| |||||||||||||||||||||||||| ||||||  |||||| |||||||||||||
Sbjct: 251 ccgactacggcgtccccttccgccgcctcaccggccactcccacttcgtccaggacgtcg 310

                                                                       
Query: 301 tcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctct 360
           |||| || ||||||||||||||||| ||||| || ||||||||||||||||||||||| |
Sbjct: 311 tccttagttccgacggccagttcgcactctctggctcctgggacggcgagctccgccttt 370

                                                                       
Query: 361 gggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctct 420
           ||||||||||||||||  |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 371 gggacctctccaccggcctcaccacccgccgcttcgtcggccacgagaaggacgtcatct 430

                                                                       
Query: 421 ccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatca 480
           |||||||||||||  | |||||||| ||||||||||||||||||||||||   |||||||
Sbjct: 431 ccgtcgccttctccgtcgacaaccgccagatcgtctccgcgtcccgcgacaagaccatca 490

                                                                      
Query: 481 agctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgaccttggaggcggc 539
           |||| |||||||| ||||| ||||||||||||||||||||||| ||||| || ||||||
Sbjct: 491 agctctggaacactctcggcgagtgcaagtacaccatcggcggcgacctcggcggcggc 549



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 98/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 101 gatgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgccctt 160
           |||||| ||||| |||| || ||| ||||| |||||||| || |||||||||||||| ||
Sbjct: 105 gatgcgcggccataacggcgaggtgacggcgatcgcgaccccgatcgacaactcgccttt 164

                                                                 
Query: 161 catcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
           |||||||||||| ||||| ||||||||  |||| || |||||||| ||||||||
Sbjct: 165 catcgtctcctcctcccgggacaagtccgtgctggtgtgggacctgaccaaccc 218



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 66 gccggcgcgcaggagtccctc 86
          |||||||||||||||||||||
Sbjct: 70 gccggcgcgcaggagtccctc 90



to top

>ref|XM_475866.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1011

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Plus

                                                                       
Query: 243 gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
           |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 190 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 249

                                                                       
Query: 303 ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 250 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 309

                                                                       
Query: 363 gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
           |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 310 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 369

                                                                       
Query: 423 gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
           |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 370 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 429

                                                         
Query: 483 ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
           || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 430 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 475



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
           |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 38  tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 97

                                                               
Query: 163 tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
           |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 98  tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 149



to top

>gb|AC129717.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0079H23,
              complete sequence
          Length = 191765

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Minus

                                                                          
Query: 243    gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
              |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 116242 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 116183

                                                                          
Query: 303    ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 116182 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 116123

                                                                          
Query: 363    gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
              |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 116122 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 116063

                                                                          
Query: 423    gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
              |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 116062 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 116003

                                                            
Query: 483    ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
              || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 116002 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 115957



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                          
Query: 103    tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
              |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 116394 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 116335

                                                                  
Query: 163    tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
              |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 116334 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 116283



to top

>gb|AC135925.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0560C03,
              complete sequence
          Length = 177861

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Minus

                                                                          
Query: 243    gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
              |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 172670 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 172611

                                                                          
Query: 303    ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 172610 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 172551

                                                                          
Query: 363    gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
              |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 172550 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 172491

                                                                          
Query: 423    gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
              |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 172490 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 172431

                                                            
Query: 483    ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
              || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 172430 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 172385



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                          
Query: 103    tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
              |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 172822 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 172763

                                                                  
Query: 163    tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
              |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 172762 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 172711



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Minus

                                                                            
Query: 243      gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
                |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 27241274 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 27241215

                                                                            
Query: 303      ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 27241214 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 27241155

                                                                            
Query: 363      gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
                |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 27241154 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 27241095

                                                                            
Query: 423      gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
                |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 27241094 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 27241035

                                                              
Query: 483      ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
                || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 27241034 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 27240989



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Minus

                                                                            
Query: 103      tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
                |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 27241426 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 27241367

                                                                    
Query: 163      tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
                |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 27241366 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 27241315



to top

>dbj|AK121567.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034P13, full
           insert sequence
          Length = 1385

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Plus

                                                                       
Query: 243 gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
           |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 265 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 324

                                                                       
Query: 303 ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 325 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 384

                                                                       
Query: 363 gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
           |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 385 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 444

                                                                       
Query: 423 gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
           |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 445 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 504

                                                         
Query: 483 ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
           || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 505 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 550



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
           |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 113 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 172

                                                               
Query: 163 tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
           |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 173 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 224



to top

>dbj|AK065272.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002L07, full
           insert sequence
          Length = 1227

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Plus

                                                                       
Query: 243 gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
           |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 258 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 317

                                                                       
Query: 303 ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 318 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 377

                                                                       
Query: 363 gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
           |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 378 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 437

                                                                       
Query: 423 gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
           |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 438 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 497

                                                         
Query: 483 ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
           || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 498 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 543



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
           |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 106 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 165

                                                               
Query: 163 tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
           |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 166 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 217



to top

>dbj|AK062179.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D07, full
           insert sequence
          Length = 1412

 Score =  353 bits (178), Expect = 4e-94
 Identities = 259/286 (90%)
 Strand = Plus / Plus

                                                                       
Query: 243 gagtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtc 302
           |||||||||||| | | |||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 267 gagtacggcgtctcgtaccgccgcctcaccggccactcccacttcgtccaggacgtcgtc 326

                                                                       
Query: 303 ctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgg 362
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 327 ctcagctccgacggccagttcgcgctctcgggatcctgggacggcgagctccgcctctgg 386

                                                                       
Query: 363 gacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctcc 422
           |||||  |||||||   |||||||||||||||||||||||||   |||||||||||||||
Sbjct: 387 gacctagccaccggccgcaccacccgccgcttcgtcggccacaccaaggacgtcctctcc 446

                                                                       
Query: 423 gtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaag 482
           |||||||||||  | |||||||| ||||||||||||||| | ||||||  ||||||||||
Sbjct: 447 gtcgccttctccgtcgacaaccgccagatcgtctccgcggcgcgcgacaacaccatcaag 506

                                                         
Query: 483 ctgtggaacaccctcggtgagtgcaagtacaccatcggcggtgacc 528
           || |||||||||||||| ||||||||||||||||||||||| ||||
Sbjct: 507 ctctggaacaccctcggcgagtgcaagtacaccatcggcggcgacc 552



 Score =  127 bits (64), Expect = 4e-26
 Identities = 100/112 (89%)
 Strand = Plus / Plus

                                                                       
Query: 103 tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
           |||| |||||||||||| |||| ||||| |||||| | || || ||||||||||||||||
Sbjct: 115 tgcgcggccacaacgacatggtgacggcgatcgcggcgccgattgacaactcgcccttca 174

                                                               
Query: 163 tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaaccc 214
           |||||||||| |||||||||||||||||||| || |||||| ||||||||||
Sbjct: 175 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaaccc 226



to top

>gb|U44850.1|GMU44850 Glycine max G beta-like protein mRNA, complete cds
          Length = 988

 Score =  192 bits (97), Expect = 8e-46
 Identities = 226/269 (84%)
 Strand = Plus / Plus

                                                                       
Query: 246 tacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcctc 305
           ||||| ||||||  |||||||||||| || ||    ||||| ||||||||||||||||||
Sbjct: 158 tacggtgtcccccgccgccgcctcaccggacattctcacttcgtccaggacgtcgtcctc 217

                                                                       
Query: 306 agctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctgggac 365
              |||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 218 tcatccgacggtcagttcgccctctccggctcctgggacggcgagctccgcctctgggac 277

                                                                       
Query: 366 ctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggacgtcctctccgtc 425
           ||| |  | ||   | |  ||||||||||||| ||||||   |||||||| |||||||| 
Sbjct: 278 ctcgcggctggcacctctgcccgccgcttcgttggccacaccaaggacgtgctctccgtg 337

                                                                       
Query: 426 gccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctg 485
           || ||||| || |||||||| |||||||| || || || || |||||||| |||||||||
Sbjct: 338 gcgttctccatcgacaaccgtcagatcgtgtcggcctctcgtgaccgcacgatcaagctg 397

                                        
Query: 486 tggaacaccctcggtgagtgcaagtacac 514
           ||||||||||| |||||||||||||||||
Sbjct: 398 tggaacaccctgggtgagtgcaagtacac 426



to top

>emb|Z33643.1|BNGNRPR B.napus (Naehan) bgb1 mRNA for guanine nucleotide regulatory
           protein
          Length = 1196

 Score =  168 bits (85), Expect = 1e-38
 Identities = 187/221 (84%)
 Strand = Plus / Plus

                                                                       
Query: 294 gacgtcgtcctcagctccgacggccagttcgcgctctccggatcctgggacggcgagctc 353
           ||||||||||||  |||||||||||| |||||||| |||||   ||||||||||||||| 
Sbjct: 225 gacgtcgtcctctcctccgacggccaattcgcgctttccggcagctgggacggcgagctt 284

                                                                       
Query: 354 cgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaaggac 413
           ||||||||||||||| || |||| ||| | || ||| | |||||||| |||   || |||
Sbjct: 285 cgcctctgggacctcgccgccggcgtctcgactcgcagattcgtcggacacaccaaagac 344

                                                                       
Query: 414 gtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgc 473
           ||||||||||| ||||||||  | |||||||| ||||||||||| || ||||| ||||||
Sbjct: 345 gtcctctccgtggccttctcgctcgacaaccgtcagatcgtctcggcctcccgtgaccgc 404

                                                    
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacac 514
           || |||||||| |||||||| || || ||||||||||||||
Sbjct: 405 acgatcaagctctggaacactctgggggagtgcaagtacac 445



to top

>dbj|AK108115.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C04, full
           insert sequence
          Length = 1123

 Score =  159 bits (80), Expect = 1e-35
 Identities = 146/168 (86%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           |||||||||||||| |||||||||||    ||||||||| | |||||||||||| | || 
Sbjct: 302 ctccgcctctgggagctctccaccggccagaccacccgcggtttcgtcggccacaacaac 361

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           |||||||| ||||||  ||||||    |||||||| |||||||||||||  ||||| |||
Sbjct: 362 gacgtcctttccgtcagcttctccgccgacaaccgtcagatcgtctccggttcccgtgac 421

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 422 cgcaccatcaagctgtggaacaccctcggtgactgcaagtacaccatc 469



to top

>gb|DQ393574.1| Metarhizium anisopliae G-protein beta subunit mRNA, complete cds
          Length = 1165

 Score =  143 bits (72), Expect = 7e-31
 Identities = 144/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           |||||||| ||||| ||| |||||||   |||||| || || ||||||||||||   || 
Sbjct: 346 ctccgcctgtgggagctcgccaccggcaccaccactcgacgattcgtcggccacaccaac 405

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||||||||||||| ||||||||   |||||||| ||||||||||| |  |||||||||
Sbjct: 406 gacgtcctctccgtctccttctctgccgacaaccgtcagatcgtctctggttcccgcgac 465

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           || ||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 466 cgaaccatcaagctgtggaacaccctcggtgaatgcaagttcaccatc 513



to top

>ref|XM_954977.1| Neurospora crassa OR74A hypothetical protein (NCU05810.1) partial
           mRNA
          Length = 951

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           ||||| |||||||| || ||||||||   |||||||||||| ||||||||||||   || 
Sbjct: 259 ctccgtctctgggagctttccaccggcaccaccacccgccgtttcgtcggccacaccaac 318

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||| ||||||||| | |||||    |||||||| |||||||||||||  |||||||| 
Sbjct: 319 gacgttctctccgtctctttctccgccgacaaccgccagatcgtctccggttcccgcgat 378

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||| |||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 379 cgctccatcaagctgtggaacaccctcggtgactgcaagttcaccatc 426



to top

>ref|XM_325664.1| Neurospora crassa OR74A hypothetical protein (NCU05810.1) partial
           mRNA
          Length = 951

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           ||||| |||||||| || ||||||||   |||||||||||| ||||||||||||   || 
Sbjct: 259 ctccgtctctgggagctttccaccggcaccaccacccgccgtttcgtcggccacaccaac 318

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||| ||||||||| | |||||    |||||||| |||||||||||||  |||||||| 
Sbjct: 319 gacgttctctccgtctctttctccgccgacaaccgccagatcgtctccggttcccgcgat 378

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||| |||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 379 cgctccatcaagctgtggaacaccctcggtgactgcaagttcaccatc 426



to top

>emb|X81875.1|NCCPC2 N.crassa cpc-2 gene
          Length = 4269

 Score =  135 bits (68), Expect = 2e-28
 Identities = 143/168 (85%)
 Strand = Plus / Plus

                                                                        
Query: 351  ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
            ||||| |||||||| || ||||||||   |||||||||||| ||||||||||||   || 
Sbjct: 2366 ctccgtctctgggagctttccaccggcaccaccacccgccgtttcgtcggccacaccaac 2425

                                                                        
Query: 411  gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
            ||||| ||||||||| | |||||    |||||||| |||||||||||||  |||||||| 
Sbjct: 2426 gacgttctctccgtctctttctccgccgacaaccgccagatcgtctccggttcccgcgat 2485

                                                            
Query: 471  cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
            || ||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 2486 cgtaccatcaagctgtggaacaccctcggtgactgcaagttcaccatc 2533



to top

>ref|XM_390046.1| Gibberella zeae PH-1 chromosome 1 GBLP_NEUCR Guanine
           nucleotide-binding protein beta subunit-like protein
           (Cross-pathway control WD-repeat protein cpc-2)
           (FG09870.1) partial mRNA
          Length = 951

 Score =  125 bits (63), Expect = 2e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                       
Query: 380 caccacccgccgcttcgtcggccacgagaaggacgtcctctccgtcgccttctctattga 439
           |||||| || || ||||||||||||   || |||||||||||||||  |||||||   ||
Sbjct: 288 caccactcgacgattcgtcggccacactaacgacgtcctctccgtcagcttctctgccga 347

                                                                       
Query: 440 caaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcgg 499
           ||||||||||||||| ||||  || |||||||| ||||||||||| ||||||||||||||
Sbjct: 348 caaccgacagatcgtttccggttctcgcgaccgaaccatcaagctctggaacaccctcgg 407

                              
Query: 500 tgagtgcaagtacaccatc 518
           ||| |||||||||||||||
Sbjct: 408 tgactgcaagtacaccatc 426



to top

>ref|XM_481173.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 552

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Plus

                                                                       
Query: 103 tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
           |||| |||||||||||| |||||| ||| |||||| | || ||||||| ||||||| |||
Sbjct: 14  tgcgcggccacaacgacatggtcatggcaatcgcggcgccgatcgacatctcgcccctca 73

                                                              
Query: 163 tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaacc 213
           |||||||||| |||||||||||||||||||| || |||||| |||||||||
Sbjct: 74  tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaacc 124



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                            
Query: 103      tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
                |||| |||||||||||| |||||| ||| |||||| | || ||||||| ||||||| |||
Sbjct: 10365583 tgcgcggccacaacgacatggtcatggcaatcgcggcgccgatcgacatctcgcccctca 10365524

                                                                   
Query: 163      tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaacc 213
                |||||||||| |||||||||||||||||||| || |||||| |||||||||
Sbjct: 10365523 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaacc 10365473



to top

>dbj|AP005731.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OSJNBa0091D16
          Length = 174222

 Score =  117 bits (59), Expect = 4e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                         
Query: 103   tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
             |||| |||||||||||| |||||| ||| |||||| | || ||||||| ||||||| |||
Sbjct: 66541 tgcgcggccacaacgacatggtcatggcaatcgcggcgccgatcgacatctcgcccctca 66482

                                                                
Query: 163   tcgtctcctcttcccgcgacaagtcgctgctcgtctgggacctcaccaacc 213
             |||||||||| |||||||||||||||||||| || |||||| |||||||||
Sbjct: 66481 tcgtctcctcctcccgcgacaagtcgctgctggtgtgggacatcaccaacc 66431



to top

>ref|NM_101670.2| Arabidopsis thaliana ATARCA; nucleotide binding AT1G18080 (ATARCA)
           mRNA, complete cds
          Length = 1358

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 440 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 499

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 500 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 549



to top

>gb|AY063016.1| Arabidopsis thaliana putative WD-40 repeat protein (At1g18080)
           mRNA, complete cds
          Length = 1015

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 316 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 375

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 376 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 425



to top

>gb|AY035007.1| Arabidopsis thaliana putative WD-40 repeat protein (At1g18080)
           mRNA, complete cds
          Length = 1259

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 385 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 444

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 445 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 494



to top

>emb|BX815631.1|CNS0ABFU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS79ZB07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1146

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 357 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 416

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 417 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 466



to top

>emb|BX816078.1|CNS0ABTL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH26ZH09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1236

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 388 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 447

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 448 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 497



to top

>emb|BX816944.1|CNS0ABM9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH78ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1238

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 362 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 421

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 422 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 471



to top

>emb|BX815413.1|CNS0ABK1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS59ZB04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1131

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 365 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 424

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 425 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 474



to top

>emb|BX815215.1|CNS0ABGT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS42ZD07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1253

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 363 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 422

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 423 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 472



to top

>emb|BX815043.1|CNS0ABBL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS27ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1198

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 362 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 421

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 422 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 471



to top

>gb|AY088480.1| Arabidopsis thaliana clone 7026 mRNA, complete sequence
          Length = 1234

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 440 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 499

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 500 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 549



to top

>gb|AC034107.5|T10F20 Sequence of BAC T10F20 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 81129

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                         
Query: 408   aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
             |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 28718 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 28777

                                                               
Query: 468   gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
             ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 28778 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 28827



to top

>gb|AC069551.4|AC069551 Genomic sequence for Arabidopsis thaliana BAC T10O22 from chromosome I,
             complete sequence
          Length = 92948

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                         
Query: 408   aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
             |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 14022 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 14081

                                                               
Query: 468   gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
             ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 14082 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 14131



to top

>gb|U77381.1|ATU77381 Arabidopsis thaliana WD-40 repeat protein (AtArcA) mRNA, complete
           cds
          Length = 984

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 316 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 375

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 376 gaccgtacgatcaagctgtggaacactcttggtgagtgcaagtacaccat 425



to top

>dbj|AB226203.1| Aspergillus oryzae cDNA, contig sequence: AoEST3062
          Length = 1325

 Score =  111 bits (56), Expect = 2e-21
 Identities = 140/168 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           |||||||||||||| ||| | ||||| |  ||||||||   |||||| ||||||   || 
Sbjct: 352 ctccgcctctgggagctcgctaccggcgagaccacccgtaccttcgttggccacaccaac 411

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||||||||||||| |||||||    |||||||| ||||| |||||||| || || |||
Sbjct: 412 gacgtcctctccgtctccttctccgccgacaaccgccagattgtctccgcttctcgtgac 471

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||| ||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 472 cgcagcatcaagctctggaacaccctcggtgactgcaagttcaccatc 519



to top

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score =  111 bits (56), Expect = 2e-21
 Identities = 140/168 (83%)
 Strand = Plus / Plus

                                                                          
Query: 351    ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
              |||||||||||||| ||| | ||||| |  ||||||||   |||||| ||||||   || 
Sbjct: 703140 ctccgcctctgggagctcgctaccggcgagaccacccgtaccttcgttggccacaccaac 703199

                                                                          
Query: 411    gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
              ||||||||||||||| |||||||    |||||||| ||||| |||||||| || || |||
Sbjct: 703200 gacgtcctctccgtctccttctccgccgacaaccgccagattgtctccgcttctcgtgac 703259

                                                              
Query: 471    cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
              |||| ||||||||| ||||||||||||||||| ||||||| |||||||
Sbjct: 703260 cgcagcatcaagctctggaacaccctcggtgactgcaagttcaccatc 703307



to top

>emb|BX814194.1|CNS0AC6D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1110

 Score =  107 bits (54), Expect = 4e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| ||||||||||| || || || 
Sbjct: 355 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctctgcatctcgt 414

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || |||||||||| |||||||||
Sbjct: 415 gaccgtacgatcaagctgtggaacactcttggtgagtgcacgtacaccat 464



to top

>dbj|D29704.1|RICYK16 Oryza sativa mRNA, partial homologous to G-protein
           beta-subunit-like polypeptide gene
          Length = 175

 Score =  107 bits (54), Expect = 4e-20
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 agtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcc 303
           ||||||||||| | | ||| ||||| || ||||||  |||||| ||||||||||||||||
Sbjct: 69  agtacggcgtctcgtaccgncgccttaccggccactcccacttcgtccaggacgtcgtcc 128

                                                          
Query: 304 tcagctccgacggccagttcgcgctctccggatcctgggacggcgag 350
           |||||||||||||||| |||| | |||| |||| |||||||||||||
Sbjct: 129 tcagctccgacggccaattcgagntctcgggatnctgggacggcgag 175



to top

>dbj|AB180244.1| Fusarium oxysporum fgb2 gene for G-protein beta like WD repeat
           protein, complete cds
          Length = 1796

 Score =  107 bits (54), Expect = 4e-20
 Identities = 108/126 (85%)
 Strand = Plus / Plus

                                                                       
Query: 393 ttcgtcggccacgagaaggacgtcctctccgtcgccttctctattgacaaccgacagatc 452
           ||||||||||||   || |||||||| ||||||  |||||||   |||||||| ||||||
Sbjct: 687 ttcgtcggccacaccaacgacgtcctttccgtcagcttctctgccgacaaccgccagatc 746

                                                                       
Query: 453 gtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtac 512
           |||||||  || |||||||| ||||||||||| |||||||| |||||||| |||||||||
Sbjct: 747 gtctccggttctcgcgaccgaaccatcaagctctggaacactctcggtgactgcaagtac 806

                 
Query: 513 accatc 518
           ||||||
Sbjct: 807 accatc 812



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  105 bits (53), Expect = 1e-19
 Identities = 99/113 (87%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                            
Query: 103      tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
                |||| |||| ||| ||| |||| ||||| |||||| | || |||||||||||||||||||
Sbjct: 10003429 tgcgcggccgcaatgacatggtgacggcgatcgcggcgccgatcgacaactcgcccttca 10003488

                                                                     
Query: 163      tcgtctcctcttccc-gcgacaagtcgctgctcgtctgggacctcaccaaccc 214
                |||||||||| |||| |||||||||||||||| || |||||| ||||||||||
Sbjct: 10003489 tcgtctcctcctccctgcgacaagtcgctgctggtgtgggacatcaccaaccc 10003541



to top

>gb|AC137075.2| Genomic sequence for Oryza sativa, Nipponbare striain, clone
             OSJNBb0027B12, from chromosome 3, complete sequence
          Length = 127426

 Score =  105 bits (53), Expect = 1e-19
 Identities = 99/113 (87%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                         
Query: 103   tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
             |||| |||| ||| ||| |||| ||||| |||||| | || |||||||||||||||||||
Sbjct: 53345 tgcgcggccgcaatgacatggtgacggcgatcgcggcgccgatcgacaactcgcccttca 53404

                                                                  
Query: 163   tcgtctcctcttccc-gcgacaagtcgctgctcgtctgggacctcaccaaccc 214
             |||||||||| |||| |||||||||||||||| || |||||| ||||||||||
Sbjct: 53405 tcgtctcctcctccctgcgacaagtcgctgctggtgtgggacatcaccaaccc 53457



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  105 bits (53), Expect = 1e-19
 Identities = 99/113 (87%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                            
Query: 103      tgcgtggccacaacgacgtggtcacggccatcgcgacacccatcgacaactcgcccttca 162
                |||| |||| ||| ||| |||| ||||| |||||| | || |||||||||||||||||||
Sbjct: 10001550 tgcgcggccgcaatgacatggtgacggcgatcgcggcgccgatcgacaactcgcccttca 10001609

                                                                     
Query: 163      tcgtctcctcttccc-gcgacaagtcgctgctcgtctgggacctcaccaaccc 214
                |||||||||| |||| |||||||||||||||| || |||||| ||||||||||
Sbjct: 10001610 tcgtctcctcctccctgcgacaagtcgctgctggtgtgggacatcaccaaccc 10001662



to top

>ref|XM_746421.1| Aspergillus fumigatus Af293 guanine nucleotide-binding protein
           subunit (Afu4g13170) partial mRNA
          Length = 951

 Score =  103 bits (52), Expect = 6e-19
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||||||||||||| |||||||    |||||||| |||||||||||||  || || |||
Sbjct: 319 gacgtcctctccgtctccttctccgccgacaaccgccagatcgtctccggttctcgtgac 378

                                                   
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagt 510
           ||||||||||||||||||||||||||||| || |||||||
Sbjct: 379 cgcaccatcaagctgtggaacaccctcggcgactgcaagt 418



to top

>dbj|AB189027.1| Plutella xylostella mRNA for receptor for activated protein kinase
           C homolog, complete cds
          Length = 1132

 Score =  101 bits (51), Expect = 2e-18
 Identities = 96/111 (86%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||||||||||||||||||| |||||||||| || ||||| || |  ||||| 
Sbjct: 376 aaggatgtcctctccgtcgccttctctgttgacaaccgtcaaatcgtgtctggatcccga 435

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 436 gacaagaccatcaagctgtggaacacccttgccgagtgcaagtacaccatc 486



to top

>emb|BX814524.1|CNS0AC6T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZH04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1223

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           |||||||| |||||||||||||||||  | |||||||| |||||||||||  | || || 
Sbjct: 355 aaggacgtgctctccgtcgccttctcactcgacaaccgtcagatcgtctcttcatctcgt 414

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||| || ||||||||||||||||| || ||||||| ||||||||||||
Sbjct: 415 gaccgtacgatcaagctgtggaacactcttggtgagttcaagtacaccat 464



to top

>ref|XM_362274.1| Magnaporthe grisea 70-15 hypothetical protein (MG04719.4) partial
           cds
          Length = 951

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 138/168 (82%)
 Strand = Plus / Plus

                                                                       
Query: 351 ctccgcctctgggacctctccaccggggtcaccacccgccgcttcgtcggccacgagaag 410
           |||||||| ||||| ||| |||| ||   |||||||||||||||||||||||||   || 
Sbjct: 259 ctccgcctttgggagctcgccactggcaccaccacccgccgcttcgtcggccacaccaac 318

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||| || |||||| | ||||||   |||||| | ||||| || ||||  || || |||
Sbjct: 319 gacgttctgtccgtctctttctctgccgacaacaggcagattgtttccggctcgcgtgac 378

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||| |||||||||||||||||||||| || || |||||||||||||||
Sbjct: 379 cgctccatcaagctgtggaacaccctgggcgactgcaagtacaccatc 426



to top

>gb|DQ122897.1| Chlamydomonas incerta G protein beta subunit-like polypeptide
           (cblP) mRNA, partial cds
          Length = 843

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 380 caccacccgccgcttcgtcggccacgagaaggacgtcctctccgtcgccttctctattga 439
           |||||||||||||||||| ||||||   ||||| || || ||||| || |||||  | ||
Sbjct: 300 caccacccgccgcttcgtgggccacaccaaggatgtgctgtccgtggctttctcggtgga 359

                                                                       
Query: 440 caaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcgg 499
           |||||| |||||||| || |  || ||||||   ||||||||||||||||||||||| ||
Sbjct: 360 caaccgccagatcgtgtcgggctcgcgcgacaagaccatcaagctgtggaacaccctggg 419

                                  
Query: 500 tgagtgcaagtacaccatcggcg 522
            ||||||||||||||||| ||||
Sbjct: 420 cgagtgcaagtacaccattggcg 442



to top

>gb|AF548359.2| Paracoccidioides brasiliensis RACK1-like protein mRNA, complete cds
          Length = 1409

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                       
Query: 441 aaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggt 500
           ||||| |||||||||||||  ||||||||||| ||||||||||||||||||||||| |||
Sbjct: 453 aaccgccagatcgtctccggctcccgcgaccggaccatcaagctgtggaacaccctgggt 512

                             
Query: 501 gagtgcaagtacaccatc 518
           || ||||| | |||||||
Sbjct: 513 gactgcaaattcaccatc 530



to top

>gb|DQ186603.2| Paracoccidioides brasiliensis RACK1-like protein gene, complete cds
          Length = 1804

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                       
Query: 441 aaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggt 500
           ||||| |||||||||||||  ||||||||||| ||||||||||||||||||||||| |||
Sbjct: 632 aaccgccagatcgtctccggctcccgcgaccggaccatcaagctgtggaacaccctgggt 691

                             
Query: 501 gagtgcaagtacaccatc 518
           || ||||| | |||||||
Sbjct: 692 gactgcaaattcaccatc 709



to top

>emb|AJ298991.1|FSY298991 Fagus sylvatica partial mRNA for G protein-like gbf1 protein, clone
           FsGBf1
          Length = 801

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                       
Query: 414 gtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgc 473
           ||||| |||||||  ||||| || |||||||| ||||||||||| || || || ||||||
Sbjct: 163 gtcctttccgtcgttttctcaatcgacaaccgtcagatcgtctctgcttcacgtgaccgc 222

                                                       
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           || |||||| | |||||||| |||||||||||||||| ||||||
Sbjct: 223 acgatcaagttttggaacacactcggtgagtgcaagttcaccat 266



to top

>gb|AY547291.1| Toxoplasma gondii receptor for activated C kinase 1 (RACK1) mRNA,
           complete cds
          Length = 966

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 70/79 (88%)
 Strand = Plus / Plus

                                                                       
Query: 441 aaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggt 500
           ||||| ||||||||||| | |||||| ||| | ||||||||||||||||||||||| |  
Sbjct: 364 aaccgccagatcgtctctgggtcccgtgacagaaccatcaagctgtggaacacccttgcg 423

                              
Query: 501 gagtgcaagtacaccatcg 519
           |||||||||||||||||||
Sbjct: 424 gagtgcaagtacaccatcg 442



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 291 caggacgtcgtcctcagctccgacggccagttcgcgctctccggatcctgggac 344
           |||||||||||  ||| |  ||||||||||||||| |||||||||  |||||||
Sbjct: 214 caggacgtcgtgatcaacagcgacggccagttcgcactctccggaagctgggac 267



to top

>gb|BT012679.1| Lycopersicon esculentum clone 113523F, mRNA sequence
          Length = 1247

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 429 ttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtgg 488
           |||||| |||||||||| ||||| ||||| || ||||| |||   ||||||||||| |||
Sbjct: 420 ttctctgttgacaaccgtcagattgtctctgcttcccgtgacaagaccatcaagctatgg 479

                                     
Query: 489 aacaccctcggtgagtgcaagtacac 514
           ||||| ||||||||||||||||||||
Sbjct: 480 aacacactcggtgagtgcaagtacac 505



to top

>gb|DQ073456.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1) gene,
            complete cds
          Length = 2925

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 93/110 (84%)
 Strand = Plus / Plus

                                                                        
Query: 409  aggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcg 468
            |||| ||||||||||| ||||||||| | |||||| ||||||| ||||| |  || ||||
Sbjct: 1184 aggatgtcctctccgtggccttctctgtggacaacagacagattgtctctggttctcgcg 1243

                                                              
Query: 469  accgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
            ||   ||||||||| ||||||||||||| | ||| |||||||||||||||
Sbjct: 1244 acaagaccatcaagttgtggaacacccttgctgaatgcaagtacaccatc 1293



to top

>dbj|AB022686.1| Lycopersicon esculentum mRNA for LeArcA1 protein, complete cds
          Length = 1197

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 429 ttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtgg 488
           |||||| |||||||||| ||||| ||||| || ||||| |||   ||||||||||| |||
Sbjct: 385 ttctctgttgacaaccgtcagattgtctctgcttcccgtgacaagaccatcaagctatgg 444

                                     
Query: 489 aacaccctcggtgagtgcaagtacac 514
           ||||| ||||||||||||||||||||
Sbjct: 445 aacacactcggtgagtgcaagtacac 470



to top

>ref|XM_656675.1| Aspergillus nidulans FGSC A4 guanine nucleotide-binding protein
           subunit beta-like protein (Cross-pathway control
           WD-repeat protein cpc-2) (AN4163.2), mRNA
          Length = 951

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                       
Query: 438 gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
           |||||||| |||||||| ||||  ||||| ||||||||||||||||| |||||||| || 
Sbjct: 346 gacaaccgccagatcgtttccggctcccgtgaccgcaccatcaagctctggaacactctt 405

                                
Query: 498 ggtgagtgcaagtacaccatc 518
           || || |||||||||||||||
Sbjct: 406 ggagactgcaagtacaccatc 426



to top

>ref|XM_753462.1| Ustilago maydis 521 hypothetical protein (UM02408.1) partial mRNA
          Length = 1281

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 438 gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
           |||||||| ||||||||||| |  || || ||||||||||||||||| ||||||||||||
Sbjct: 442 gacaaccgtcagatcgtctctggttcgcgtgaccgcaccatcaagctctggaacaccctc 501

                        
Query: 498 ggtgagtgcaagt 510
           || ||||||||||
Sbjct: 502 ggcgagtgcaagt 514



to top

>gb|AF176775.1|AF176775 Emericella nidulans Gbeta like protein (cpcB) gene, complete cds
          Length = 4505

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Plus

                                                                        
Query: 438  gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
            |||||||| |||||||| ||||  ||||| ||||||||||||||||| |||||||| || 
Sbjct: 2171 gacaaccgccagatcgtttccggctcccgtgaccgcaccatcaagctctggaacactctt 2230

                                 
Query: 498  ggtgagtgcaagtacaccatc 518
            || || |||||||||||||||
Sbjct: 2231 ggagactgcaagtacaccatc 2251



to top

>emb|Z72388.1|NPGPROTB N.plumbaginifolia mRNA for G protein beta-subunit-like protein
          Length = 1261

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 246 tacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcctc 305
           ||||| ||||||  |||||| ||||| |||||||||||||| |||||||| |||||||| 
Sbjct: 230 tacggtgtcccccgccgccgtctcactggccacggccacttcgtccaggatgtcgtcctt 289

                                                                      
Query: 306 agctccgacggccagttcgcgctctccggatcctgggacggcgagctccgcctctggga 364
             |||||||||   ||| || ||||| || ||||||||||| ||||| ||||| |||||
Sbjct: 290 tcctccgacggtatgtttgctctctctgggtcctgggacggtgagcttcgcctttggga 348



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 438 gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
           |||||||| |||||||| ||||| ||||| |||    ||||||||||||||||||| |||
Sbjct: 422 gacaaccgtcagatcgtttccgcttcccgtgacaaatccatcaagctgtggaacactctc 481

                               
Query: 498 ggtgagtgcaagtacaccat 517
           ||||| ||||| || |||||
Sbjct: 482 ggtgaatgcaaatataccat 501



to top

>emb|Y09514.1|NPY09514 N.plumbaginifolia mRNA for G protein beta subunit-like protein
          Length = 1280

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 246 tacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcctc 305
           ||||||||||||  |||||||||||||||||| || ||||| || || ||||| ||||| 
Sbjct: 176 tacggcgtcccccgccgccgcctcacaggccatggacacttcgttcaagacgttgtcctt 235

                                                             
Query: 306 agctccgacggccagttcgcgctctccggatcctgggacggcgagctccg 355
              |||||||||  |||||| || |||||||| |||||||| ||||||||
Sbjct: 236 tcatccgacggcatgttcgctctttccggatcttgggacggtgagctccg 285



to top

>emb|Y08678.1|MSGB1 Medicago sativa mRNA for G protein beta subunit-like protein (gbl
           gene)
          Length = 1259

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 417 ctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgaccgcacc 476
           ||||||||||| ||||| || || ||||| |||||||| || || || || |||||||| 
Sbjct: 368 ctctccgtcgctttctccatcgataaccgtcagatcgtgtctgcttctcgtgaccgcacg 427

                                                 
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacac 514
           || ||||| |||||||| || |||||||||||||||||
Sbjct: 428 attaagctctggaacactcttggtgagtgcaagtacac 465



to top

>dbj|AK113077.1| Ciona intestinalis cDNA, clone:ciad004p08, full insert sequence
          Length = 1095

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 437 tgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccct 496
           |||||||||||||||| ||||||| ||||| ||| | ||||||||| |||||||||||||
Sbjct: 405 tgacaaccgacagatcatctccgcttcccgtgacggaaccatcaagttgtggaacaccct 464

                                 
Query: 497 cggtgagtgcaagtacaccatc 518
            ||| | ||||| || ||||||
Sbjct: 465 tggtcaatgcaaatataccatc 486



to top

>ref|XM_504171.1| Yarrowia lipolytica CLIB122, YALI0E20045g predicted mRNA
          Length = 702

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 438 gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
           |||||||||||||| ||||| ||   ||| ||||| ||||||||| | ||||||||| ||
Sbjct: 373 gacaaccgacagattgtctctgccggccgagaccgaaccatcaagatctggaacaccatc 432

                                
Query: 498 ggtgagtgcaagtacaccatc 518
           || ||||||||||||||||||
Sbjct: 433 ggcgagtgcaagtacaccatc 453



to top

>emb|X53574.1|CRGPLP C. reinhardtii Cblp gene for a G protein beta subunit-like
            polypeptide
          Length = 2314

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                             
Query: 474  accatcaagctgtggaacaccctcggtgagtgcaagtacaccatcggcg 522
            ||||||||||||||||||||||| || ||||||||||||||||| ||||
Sbjct: 1087 accatcaagctgtggaacaccctgggcgagtgcaagtacaccattggcg 1135



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 380 caccacccgccgcttcgtcggccac 404
           |||||||||||||||||| ||||||
Sbjct: 758 caccacccgccgcttcgtgggccac 782



to top

>gb|DQ122924.1| Chlamydomonas incerta G protein beta subunit-like polypeptide
           (cblP) gene, partial cds
          Length = 1471

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatcggcg 522
           ||||||||||||||||||||||| || ||||||||||||||||| ||||
Sbjct: 885 accatcaagctgtggaacaccctgggcgagtgcaagtacaccattggcg 933



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 380 caccacccgccgcttcgtcggccac 404
           |||||||||||||||||| ||||||
Sbjct: 525 caccacccgccgcttcgtgggccac 549



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                           
Query: 438     gacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctc 497
               |||||||||||||| ||||| ||   ||| ||||| ||||||||| | ||||||||| ||
Sbjct: 2382756 gacaaccgacagattgtctctgccggccgagaccgaaccatcaagatctggaacaccatc 2382697

                                    
Query: 498     ggtgagtgcaagtacaccatc 518
               || ||||||||||||||||||
Sbjct: 2382696 ggcgagtgcaagtacaccatc 2382676



to top

>emb|AL116739.1|CNS01DEZ Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||| ||||||||  ||||||||   || ||| |||| || |||||||  |||||||||
Sbjct: 2   gacgttctctccgtttccttctctgccgataacagacaaattgtctccggatcccgcgac 61

                                                           
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           || || |||||| |||||||||| |||||||| ||||||| |||||||
Sbjct: 62  cgtacaatcaagttgtggaacactctcggtgactgcaagttcaccatc 109



to top

>ref|XM_777161.1| PREDICTED: Strongylocentrotus purpuratus similar to guanine
           nucleotide binding protein (G protein), beta polypeptide
           2-like 1 (LOC576894), mRNA
          Length = 611

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 101/123 (82%)
 Strand = Plus / Plus

                                                                       
Query: 396 gtcggccacgagaaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtc 455
           ||||| ||| ||||||| ||||||   || |||||||||  ||||||||| |||||||| 
Sbjct: 377 gtcggtcacaagaaggatgtcctcagtgttgccttctctgctgacaaccgtcagatcgta 436

                                                                       
Query: 456 tccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacacc 515
           || |  ||  | |||||||| |||||||| ||||||||||| || | |||||||||||||
Sbjct: 437 tctggctcaagggaccgcactatcaagctctggaacacccttggagtgtgcaagtacacc 496

              
Query: 516 atc 518
           |||
Sbjct: 497 atc 499



to top

>emb|CR938316.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YD09AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 803

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 409 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 468

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 469 gacaagaccatcaagctgtggaacaccctggccgagtgcaagtacaccatc 519



to top

>emb|CR938117.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 856

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 409 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 468

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 469 gacaagaccatcaagctgtggaacaccctggccgagtgcaagtacaccatc 519



to top

>gb|AF368031.1|AF368031 Heliothis virescens receptor for activated protein kinase C RACK1
           mRNA, complete cds
          Length = 1071

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||||||||| || |||||  |||||||||| ||||| || || |  || || 
Sbjct: 316 aaggatgtcctctccgtggcgttctcagttgacaaccgtcagattgtgtctggctctcgg 375

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   |||||||||||||||||||| || | |||||||||||||||||||
Sbjct: 376 gacaagaccatcaagctgtggaacacactggctgagtgcaagtacaccatc 426



to top

>emb|AJ004807.1|NTAJ4807 Nicotiana tabacum xanthi arcA 3 gene, partial
          Length = 1076

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcctc 305
           ||||||||||||  ||||||||| || ||||||||||| || ||||| ||||||||||| 
Sbjct: 52  tacggcgtcccccgccgccgccttactggccacggccatttcgtccaagacgtcgtcctt 111

                                                             
Query: 306 agctccgacggccagttcgcgctctccggatcctgggacggcgagctccg 355
              || ||||||  ||| || |||||||| || |||||||| ||||||||
Sbjct: 112 tcatctgacggcatgtttgcactctccggttcatgggacggtgagctccg 161



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacac 514
           |||||||| |||||||| ||||||||||||||||||||
Sbjct: 283 atcaagctttggaacacgctcggtgagtgcaagtacac 320



to top

>gb|DQ073455.1| Choristoneura fumiferana activated C kinase 1 receptor (RACK1)
           mRNA, complete cds
          Length = 1427

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| ||||| ||||||||| | |||||| ||||||| ||||| |  || |||
Sbjct: 405 aaggatgtcctatccgtggccttctctgtggacaacagacagattgtctctggttctcgc 464

                                                             
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           |||   ||||||||| ||||||||||||| |  || ||||||||||||||
Sbjct: 465 gacaagaccatcaagttgtggaacacccttgccgaatgcaagtacaccat 514



to top

>emb|AL116759.1|CNS01DFJ Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 453 gtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtac 512
           |||||||  ||||||||||| || |||||| |||||||||| |||||||| ||||||| |
Sbjct: 40  gtctccggatcccgcgaccgtacaatcaagttgtggaacactctcggtgactgcaagttc 99

                 
Query: 513 accatc 518
           ||||||
Sbjct: 100 accatc 105



to top

>gb|AC093195.2| Drosophila melanogaster clone BACR16J09, complete sequence
          Length = 178863

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                           
Query: 474    accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
              ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 175750 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 175706



to top

>gb|BT015249.1| Drosophila melanogaster LP17455 full insert cDNA
          Length = 4775

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 222 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 178



to top

>gb|AC008328.6| Drosophila melanogaster clone BACR09A04, complete sequence
          Length = 166722

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                           
Query: 474    accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
              ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 133997 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 133953



to top

>gb|BT012967.1| Lycopersicon esculentum clone 114159R, mRNA sequence
          Length = 1324

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 agtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcc 303
           ||||||| ||||||  |||||| ||||||||||||||||||||||| ||||| || || |
Sbjct: 233 agtacggtgtcccccgccgccgtctcacaggccacggccactttgttcaggatgttgttc 292

                        
Query: 304 tcagctccgacgg 316
           ||  |||||||||
Sbjct: 293 tctcctccgacgg 305



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           |||||| |||||||||| ||||||||||| || ||||||||
Sbjct: 466 atcaagttgtggaacactctcggtgagtgtaaatacaccat 506



to top

>gb|AY228759.1| Junonia coenia fringe mRNA, complete cds
          Length = 2398

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 375 accatcaagctgtggaacacccttgccgagtgcaagtacaccatc 331



to top

>ref|NM_057921.3| Drosophila melanogaster Receptor of activated protein kinase C 1
           CG7111-RA (Rack1), mRNA
          Length = 1115

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 468 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 512



to top

>gb|AY071661.1| Drosophila melanogaster RE74715 full length cDNA
          Length = 1155

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 495 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 539



to top

>gb|AC008329.3|AC008329 Drosophila melanogaster, chromosome 2L, region 28C-28D, BAC clone
             BACR31D05, complete sequence
          Length = 172633

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                          
Query: 474   accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
             ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 34754 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 34710



to top

>dbj|AB022687.1| Lycopersicon esculentum mRNA for LeArcA2 protein, complete cds
          Length = 1115

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 agtacggcgtccccttccgccgcctcacaggccacggccactttgtccaggacgtcgtcc 303
           ||||||| ||||||  |||||| ||||||||||||||||||||||| ||||| || || |
Sbjct: 198 agtacggtgtcccccgccgccgtctcacaggccacggccactttgttcaggatgttgttc 257

                        
Query: 304 tcagctccgacgg 316
           ||  |||||||||
Sbjct: 258 tctcctccgacgg 270



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           |||||| |||||||||| ||||||||||| || ||||||||
Sbjct: 431 atcaagttgtggaacactctcggtgagtgtaaatacaccat 471



to top

>gb|AY130393.1| Myxine glutinosa guanine nucleotide-binding protein mRNA, partial
           cds
          Length = 901

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacac 514
           |||||||||||||||||||||||||||| || |||||||||
Sbjct: 356 accatcaagctgtggaacaccctcggtgtgtacaagtacac 396



to top

>gb|AE003619.3| Drosophila melanogaster chromosome 2L, section 28 of 83 of the
            complete sequence
          Length = 289516

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 474  accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
            ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 5144 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 5100



to top

>gb|AC004723.1|AC004723 Drosophila melanogaster, chromosome 2L, region 28C4-28D2, P1 clone
           DS00289, complete sequence
          Length = 52277

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 656 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 612



to top

>gb|U96491.1|DMU96491 Drosophila melanogaster RACK1 (rack1) mRNA, complete cds
          Length = 1130

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||||| | ||||||||||| |||||||
Sbjct: 451 accatcaagctgtggaacaccctggctgagtgcaagttcaccatc 495



to top

>gb|DQ284489.1| Solanum tuberosum clone 042G03 ArcA2 protein-like mRNA, complete
           cds
          Length = 1098

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccat 517
           ||||||||||||||||| ||||||||||| |||||||||||
Sbjct: 464 atcaagctgtggaacactctcggtgagtgtaagtacaccat 504



to top

>ref|XM_572317.1| Cryptococcus neoformans var. neoformans JEC21 cytoplasm protein
           (CNH01270) partial mRNA
          Length = 1088

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                       
Query: 411 gacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgcgac 470
           ||||| ||||||||| | ||||||  ||||||||| || || || || || ||||| |||
Sbjct: 349 gacgttctctccgtctctttctctgctgacaaccgtcaaattgtttctgcctcccgagac 408

                                                   
Query: 471 cgcaccatcaagctgtggaacaccctcggtgagtgcaagt 510
           ||  |||||||||| ||||||||||| || ||||||||||
Sbjct: 409 cgatccatcaagctctggaacacccttggagagtgcaagt 448



to top

>gb|AY431533.1| Aedes aegypti ASAP ID: 34655 Receptor for activated protein kinase
           C (RACK) mRNA sequence
          Length = 1066

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 329 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 388

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 389 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 439



to top

>gb|DQ440042.1| Aedes aegypti clone AE-2850 activated protein kinase C receptor
           mRNA, complete cds
          Length = 936

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 316 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 375

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 376 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 426



to top

>emb|CR938134.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ08AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 821

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 400 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 459

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 460 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 510



to top

>emb|CR938087.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 829

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 405 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 464

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 465 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 515



to top

>emb|CR938067.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YL12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 775

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 414 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 473

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 474 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 524



to top

>emb|CR938027.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YM22AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 830

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| ||||| || || ||||||||  | |||||||| || ||||| ||||  ||||| 
Sbjct: 409 aaggatgtcctgtcggtggccttctccgtcgacaaccgtcaaatcgtgtccggatcccgt 468

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||   ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 469 gacaagaccatcaagctgtggaacaccttggccgagtgcaagtacaccatc 519



to top

>ref|NM_069458.3| Caenorhabditis elegans K04D7.1 (K04D7.1) mRNA, complete cds
          Length = 1040

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
           ||||| || ||||| || |||||||||  ||||||| |||| |||||||| |  ||||||
Sbjct: 365 aaggatgttctctctgttgccttctctgctgacaacagacaaatcgtctctggatcccgc 424

                                                              
Query: 468 gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||    ||||||||||||||||||| || |   |||||||||||||||||
Sbjct: 425 gacaagtccatcaagctgtggaacactcttgcccagtgcaagtacaccatc 475



to top

>emb|Z69664.1|CEK04D7 Caenorhabditis elegans Cosmid K04D7, complete sequence
          Length = 38799

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                        
Query: 408  aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccgcgtcccgc 467
            ||||| || ||||| || |||||||||  ||||||| |||| |||||||| |  ||||||
Sbjct: 8375 aaggatgttctctctgttgccttctctgctgacaacagacaaatcgtctctggatcccgc 8434

                                                               
Query: 468  gaccgcaccatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
            |||    ||||||||||||||||||| || |   |||||||||||||||||
Sbjct: 8435 gacaagtccatcaagctgtggaacactcttgcccagtgcaagtacaccatc 8485



to top

>emb|BX013826.1|CNS08ITY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 655 atcaagctgtggaacaccctggccgagtgcaagtacaccatc 614



to top

>emb|BX013825.1|CNS08ITX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 777

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 472 atcaagctgtggaacaccctggccgagtgcaagtacaccatc 513



to top

>emb|BX008526.1|CNS08EQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 647 atcaagctgtggaacaccctggccgagtgcaagtacaccatc 606



to top

>emb|BX008525.1|CNS08EQP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           |||||||||||||||||||| |  ||||||||||||||||||
Sbjct: 396 atcaagctgtggaacaccctggccgagtgcaagtacaccatc 437



to top

>emb|CR938394.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YA14AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 776

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 473 accatcaagctgtggaacaccttggccgagtgcaagtacaccatc 517



to top

>emb|CR938393.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YA14BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 789

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||||||| | |  ||||||||||||||||||
Sbjct: 652 accatcaagctgtggaacaccttggccgagtgcaagtacaccatc 608



to top

>dbj|AB089281.1| Mamestra brassicae mRNA for receptor for activated protein kinase C
           homolog, complete cds
          Length = 1108

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 474 accatcaagctgtggaacaccctcggtgagtgcaagtacac 514
           |||||||||||||||||||| || | |||||||||||||||
Sbjct: 418 accatcaagctgtggaacacacttgctgagtgcaagtacac 458



to top

>ref|XM_824109.1| Trypanosoma brucei TREU927 guanine nucleotide-binding protein
           subunit beta-like protein (Tb11.01.3180) partial mRNA
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccg 459
           |||||||| |||||||| |||||||||   |||||||||||||| |||||||
Sbjct: 328 aaggacgtactctccgtggccttctctcccgacaaccgacagattgtctccg 379



to top

>ref|XM_824108.1| Trypanosoma brucei TREU927 guanine nucleotide-binding protein
           subunit beta - like protein (Tb11.01.3170) partial mRNA
          Length = 957

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 408 aaggacgtcctctccgtcgccttctctattgacaaccgacagatcgtctccg 459
           |||||||| |||||||| |||||||||   |||||||||||||| |||||||
Sbjct: 328 aaggacgtactctccgtggccttctctcccgacaaccgacagattgtctccg 379



to top

>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete
              sequence
          Length = 1194300

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                          
Query: 437    tgacaaccgacagatcgtctccgcgtcccgcgaccgcaccatcaagctgtggaacaccct 496
              ||||||||| || || || || || ||||| |||||  |||||||||| |||||||||||
Sbjct: 821850 tgacaaccgtcaaattgtttctgcctcccgagaccgatccatcaagctctggaacaccct 821909

                            
Query: 497    cggtgagtgcaagt 510
               || ||||||||||
Sbjct: 821910 tggagagtgcaagt 821923



to top

>emb|BX025426.1|CNS08RS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX072072.1|CNS09RRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 472 atcaagctgtggaacactctggccgagtgcaagtacaccatc 513



to top

>emb|BX071929.1|CNS09RNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 662 atcaagctgtggaacactctggccgagtgcaagtacaccatc 621



to top

>emb|BX071928.1|CNS09RNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1065

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 480 atcaagctgtggaacactctggccgagtgcaagtacaccatc 521



to top

>emb|BX071775.1|CNS09RJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 662 atcaagctgtggaacactctggccgagtgcaagtacaccatc 621



to top

>emb|BX071585.1|CNS09RED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 671 atcaagctgtggaacactctggccgagtgcaagtacaccatc 630



to top

>emb|BX071584.1|CNS09REC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 492 atcaagctgtggaacactctggccgagtgcaagtacaccatc 533



to top

>emb|BX071503.1|CNS09RC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 650 atcaagctgtggaacactctggccgagtgcaagtacaccatc 609



to top

>emb|BX071502.1|CNS09RC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 477 atcaagctgtggaacactctggccgagtgcaagtacaccatc 518



to top

>emb|BX070960.1|CNS09QX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 666 atcaagctgtggaacactctggccgagtgcaagtacaccatc 625



to top

>emb|BX070959.1|CNS09QWZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 495 atcaagctgtggaacactctggccgagtgcaagtacaccatc 536



to top

>emb|BX070941.1|CNS09QWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 659 atcaagctgtggaacactctggccgagtgcaagtacaccatc 618



to top

>emb|BX070940.1|CNS09QWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 475 atcaagctgtggaacactctggccgagtgcaagtacaccatc 516



to top

>emb|BX069856.1|CNS09Q2C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 653 atcaagctgtggaacactctggccgagtgcaagtacaccatc 612



to top

>emb|BX069855.1|CNS09Q2B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 476 atcaagctgtggaacactctggccgagtgcaagtacaccatc 517



to top

>emb|BX069556.1|CNS09PU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 428 atcaagctgtggaacactctggccgagtgcaagtacaccatc 469



to top

>emb|BX069191.1|CNS09PJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 649 atcaagctgtggaacactctggccgagtgcaagtacaccatc 608



to top

>emb|BX069190.1|CNS09PJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 443 atcaagctgtggaacactctggccgagtgcaagtacaccatc 484



to top

>emb|BX068439.1|CNS09OYZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 488 atcaagctgtggaacactctggccgagtgcaagtacaccatc 529



to top

>emb|BX068249.1|CNS09OTP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 713

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 598 atcaagctgtggaacactctggccgagtgcaagtacaccatc 557



to top

>emb|BX068248.1|CNS09OTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 429 atcaagctgtggaacactctggccgagtgcaagtacaccatc 470



to top

>emb|BX068227.1|CNS09OT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 478 atcaagctgtggaacactctggccgagtgcaagtacaccatc 519



to top

>emb|BX068197.1|CNS09OS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 480 atcaagctgtggaacactctggccgagtgcaagtacaccatc 521



to top

>emb|BX068108.1|CNS09OPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 659 atcaagctgtggaacactctggccgagtgcaagtacaccatc 618



to top

>emb|BX068107.1|CNS09OPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX067893.1|CNS09OJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 471 atcaagctgtggaacactctggccgagtgcaagtacaccatc 512



to top

>emb|BX067875.1|CNS09OJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 645 atcaagctgtggaacactctggccgagtgcaagtacaccatc 604



to top

>emb|BX067874.1|CNS09OJA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 376 atcaagctgtggaacactctggccgagtgcaagtacaccatc 417



to top

>emb|BX067850.1|CNS09OIM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 655 atcaagctgtggaacactctggccgagtgcaagtacaccatc 614



to top

>emb|BX067849.1|CNS09OIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 478 atcaagctgtggaacactctggccgagtgcaagtacaccatc 519



to top

>emb|BX067804.1|CNS09OHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 656 atcaagctgtggaacactctggccgagtgcaagtacaccatc 615



to top

>emb|BX067803.1|CNS09OHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 484 atcaagctgtggaacactctggccgagtgcaagtacaccatc 525



to top

>emb|BX067706.1|CNS09OEM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 665 atcaagctgtggaacactctggccgagtgcaagtacaccatc 624



to top

>emb|BX067705.1|CNS09OEL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX067646.1|CNS09OCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 659 atcaagctgtggaacactctggccgagtgcaagtacaccatc 618



to top

>emb|BX067645.1|CNS09OCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 475 atcaagctgtggaacactctggccgagtgcaagtacaccatc 516



to top

>emb|BX067584.1|CNS09OB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 541 atcaagctgtggaacactctggccgagtgcaagtacaccatc 582



to top

>emb|BX067491.1|CNS09O8N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 473 atcaagctgtggaacactctggccgagtgcaagtacaccatc 514



to top

>emb|BX067108.1|CNS09NY0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 605 atcaagctgtggaacactctggccgagtgcaagtacaccatc 564



to top

>emb|BX066978.1|CNS09NUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 444 atcaagctgtggaacactctggccgagtgcaagtacaccatc 485



to top

>emb|BX066941.1|CNS09NTD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 669 atcaagctgtggaacactctggccgagtgcaagtacaccatc 628



to top

>emb|BX066940.1|CNS09NTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 188 atcaagctgtggaacactctggccgagtgcaagtacaccatc 229



to top

>emb|BX066785.1|CNS09NP1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 682 atcaagctgtggaacactctggccgagtgcaagtacaccatc 641



to top

>emb|BX066784.1|CNS09NP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 489 atcaagctgtggaacactctggccgagtgcaagtacaccatc 530



to top

>emb|BX066046.1|CNS09N4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 470 atcaagctgtggaacactctggccgagtgcaagtacaccatc 511



to top

>emb|BX065996.1|CNS09N34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 190 atcaagctgtggaacactctggccgagtgcaagtacaccatc 231



to top

>emb|BX065949.1|CNS09N1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 658 atcaagctgtggaacactctggccgagtgcaagtacaccatc 617



to top

>emb|BX065948.1|CNS09N1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 541 atcaagctgtggaacactctggccgagtgcaagtacaccatc 582



to top

>emb|BX065903.1|CNS09N0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX065710.1|CNS09MV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 475 atcaagctgtggaacactctggccgagtgcaagtacaccatc 516



to top

>emb|BX065387.1|CNS09MM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 658 atcaagctgtggaacactctggccgagtgcaagtacaccatc 617



to top

>emb|BX065386.1|CNS09MM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 479 atcaagctgtggaacactctggccgagtgcaagtacaccatc 520



to top

>emb|BX065352.1|CNS09ML8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 479 atcaagctgtggaacactctggccgagtgcaagtacaccatc 520



to top

>emb|BX065157.1|CNS09MFT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 185 atcaagctgtggaacactctggccgagtgcaagtacaccatc 226



to top

>emb|BX065022.1|CNS09MC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 447 atcaagctgtggaacactctggccgagtgcaagtacaccatc 488



to top

>emb|BX064854.1|CNS09M7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 562 atcaagctgtggaacactctggccgagtgcaagtacaccatc 521



to top

>emb|BX064853.1|CNS09M7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 383 atcaagctgtggaacactctggccgagtgcaagtacaccatc 424



to top

>emb|BX064405.1|CNS09LUX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 684 atcaagctgtggaacactctggccgagtgcaagtacaccatc 643



to top

>emb|BX064360.1|CNS09LTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 495 atcaagctgtggaacactctggccgagtgcaagtacaccatc 536



to top

>emb|BX064271.1|CNS09LR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 662 atcaagctgtggaacactctggccgagtgcaagtacaccatc 621



to top

>emb|BX064270.1|CNS09LR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 470 atcaagctgtggaacactctggccgagtgcaagtacaccatc 511



to top

>emb|BX064196.1|CNS09LP4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 477 atcaagctgtggaacactctggccgagtgcaagtacaccatc 518



to top

>emb|BX064129.1|CNS09LN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 645 atcaagctgtggaacactctggccgagtgcaagtacaccatc 604



to top

>emb|BX064128.1|CNS09LN8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 470 atcaagctgtggaacactctggccgagtgcaagtacaccatc 511



to top

>emb|BX063937.1|CNS09LHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 656 atcaagctgtggaacactctggccgagtgcaagtacaccatc 615



to top

>emb|BX063936.1|CNS09LHW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 476 atcaagctgtggaacactctggccgagtgcaagtacaccatc 517



to top

>emb|BX063471.1|CNS09L4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 664 atcaagctgtggaacactctggccgagtgcaagtacaccatc 623



to top

>emb|BX063470.1|CNS09L4Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 488 atcaagctgtggaacactctggccgagtgcaagtacaccatc 529



to top

>emb|BX063359.1|CNS09L1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 648 atcaagctgtggaacactctggccgagtgcaagtacaccatc 607



to top

>emb|BX063358.1|CNS09L1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 452 atcaagctgtggaacactctggccgagtgcaagtacaccatc 493



to top

>emb|BX063357.1|CNS09L1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 637 atcaagctgtggaacactctggccgagtgcaagtacaccatc 596



to top

>emb|BX063356.1|CNS09L1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 456 atcaagctgtggaacactctggccgagtgcaagtacaccatc 497



to top

>emb|BX063204.1|CNS09KXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 665 atcaagctgtggaacactctggccgagtgcaagtacaccatc 624



to top

>emb|BX063203.1|CNS09KXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX063051.1|CNS09KTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 411 atcaagctgtggaacactctggccgagtgcaagtacaccatc 452



to top

>emb|BX062794.1|CNS09KM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 652 atcaagctgtggaacactctggccgagtgcaagtacaccatc 611



to top

>emb|BX062793.1|CNS09KM5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 467 atcaagctgtggaacactctggccgagtgcaagtacaccatc 508



to top

>emb|BX062775.1|CNS09KLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 654 atcaagctgtggaacactctggccgagtgcaagtacaccatc 613



to top

>emb|BX062774.1|CNS09KLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 477 atcaagctgtggaacactctggccgagtgcaagtacaccatc 518



to top

>emb|BX062265.1|CNS09K7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 654 atcaagctgtggaacactctggccgagtgcaagtacaccatc 613



to top

>emb|BX062264.1|CNS09K7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 438 atcaagctgtggaacactctggccgagtgcaagtacaccatc 479



to top

>emb|BX062196.1|CNS09K5K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 652 atcaagctgtggaacactctggccgagtgcaagtacaccatc 611



to top

>emb|BX062195.1|CNS09K5J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1076

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 474 atcaagctgtggaacactctggccgagtgcaagtacaccatc 515



to top

>emb|BX062132.1|CNS09K3S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 663 atcaagctgtggaacactctggccgagtgcaagtacaccatc 622



to top

>emb|BX062131.1|CNS09K3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1080

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 472 atcaagctgtggaacactctggccgagtgcaagtacaccatc 513



to top

>emb|BX062042.1|CNS09K1A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 650 atcaagctgtggaacactctggccgagtgcaagtacaccatc 609



to top

>emb|BX062041.1|CNS09K19 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 466 atcaagctgtggaacactctggccgagtgcaagtacaccatc 507



to top

>emb|BX061983.1|CNS09JZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 478 atcaagctgtggaacactctggccgagtgcaagtacaccatc 519



to top

>emb|BX061891.1|CNS09JX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 651 atcaagctgtggaacactctggccgagtgcaagtacaccatc 610



to top

>emb|BX061890.1|CNS09JX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 471 atcaagctgtggaacactctggccgagtgcaagtacaccatc 512



to top

>emb|BX061867.1|CNS09JWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 660 atcaagctgtggaacactctggccgagtgcaagtacaccatc 619



to top

>emb|BX061866.1|CNS09JWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 471 atcaagctgtggaacactctggccgagtgcaagtacaccatc 512



to top

>emb|BX061808.1|CNS09JUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 646 atcaagctgtggaacactctggccgagtgcaagtacaccatc 605



to top

>emb|BX061807.1|CNS09JUR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 469 atcaagctgtggaacactctggccgagtgcaagtacaccatc 510



to top

>emb|BX061784.1|CNS09JU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 653 atcaagctgtggaacactctggccgagtgcaagtacaccatc 612



to top

>emb|BX061783.1|CNS09JU3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 469 atcaagctgtggaacactctggccgagtgcaagtacaccatc 510



to top

>emb|BX061677.1|CNS09JR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 659 atcaagctgtggaacactctggccgagtgcaagtacaccatc 618



to top

>emb|BX061676.1|CNS09JR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 498 atcaagctgtggaacactctggccgagtgcaagtacaccatc 539



to top

>emb|BX061589.1|CNS09JOP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 661 atcaagctgtggaacactctggccgagtgcaagtacaccatc 620



to top

>emb|BX061588.1|CNS09JOO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 474 atcaagctgtggaacactctggccgagtgcaagtacaccatc 515



to top

>emb|BX061562.1|CNS09JNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 664 atcaagctgtggaacactctggccgagtgcaagtacaccatc 623



to top

>emb|BX061561.1|CNS09JNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX060748.1|CNS09J1C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 640 atcaagctgtggaacactctggccgagtgcaagtacaccatc 599



to top

>emb|BX060747.1|CNS09J1B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 455 atcaagctgtggaacactctggccgagtgcaagtacaccatc 496



to top

>emb|BX060076.1|CNS09IIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 394 atcaagctgtggaacactctggccgagtgcaagtacaccatc 435



to top

>emb|BX060034.1|CNS09IHI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 473 atcaagctgtggaacactctggccgagtgcaagtacaccatc 514



to top

>emb|BX059646.1|CNS09I6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 452 atcaagctgtggaacactctggccgagtgcaagtacaccatc 493



to top

>emb|BX059516.1|CNS09I34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 437 atcaagctgtggaacactctggccgagtgcaagtacaccatc 478



to top

>emb|BX059380.1|CNS09HZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 671 atcaagctgtggaacactctggccgagtgcaagtacaccatc 630



to top

>emb|BX059379.1|CNS09HZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 479 atcaagctgtggaacactctggccgagtgcaagtacaccatc 520



to top

>emb|BX059205.1|CNS09HUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 648 atcaagctgtggaacactctggccgagtgcaagtacaccatc 607



to top

>emb|BX059204.1|CNS09HUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 475 atcaagctgtggaacactctggccgagtgcaagtacaccatc 516



to top

>emb|BX058573.1|CNS09HCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 697

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 619 atcaagctgtggaacactctggccgagtgcaagtacaccatc 578



to top

>emb|BX058572.1|CNS09HCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 240

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 190 atcaagctgtggaacactctggccgagtgcaagtacaccatc 231



to top

>emb|BX058489.1|CNS09HAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 662 atcaagctgtggaacactctggccgagtgcaagtacaccatc 621



to top

>emb|BX058488.1|CNS09HAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 497 atcaagctgtggaacactctggccgagtgcaagtacaccatc 538



to top

>emb|BX058248.1|CNS09H3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 662 atcaagctgtggaacactctggccgagtgcaagtacaccatc 621



to top

>emb|BX058247.1|CNS09H3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 486 atcaagctgtggaacactctggccgagtgcaagtacaccatc 527



to top

>emb|BX058245.1|CNS09H3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 433 atcaagctgtggaacactctggccgagtgcaagtacaccatc 474



to top

>emb|BX058224.1|CNS09H38 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 678 atcaagctgtggaacactctggccgagtgcaagtacaccatc 637



to top

>emb|BX058185.1|CNS09H25 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1060

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 482 atcaagctgtggaacactctggccgagtgcaagtacaccatc 523



to top

>emb|BX056697.1|CNS09FWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 474 atcaagctgtggaacactctggccgagtgcaagtacaccatc 515



to top

>emb|BX057714.1|CNS09GP2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 493 atcaagctgtggaacactctggccgagtgcaagtacaccatc 534



to top

>emb|BX057554.1|CNS09GKM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 641

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 476 atcaagctgtggaacactctggccgagtgcaagtacaccatc 517



to top

>emb|BX057393.1|CNS09GG5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 472 atcaagctgtggaacactctggccgagtgcaagtacaccatc 513



to top

>emb|BX057098.1|CNS09G7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 647

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 405 atcaagctgtggaacactctggccgagtgcaagtacaccatc 446



to top

>emb|BX055935.1|CNS09FBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 469 atcaagctgtggaacactctggccgagtgcaagtacaccatc 510



to top

>emb|BX056059.1|CNS09FF3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 443 atcaagctgtggaacactctggccgagtgcaagtacaccatc 484



to top

>emb|BX056035.1|CNS09FEF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 687

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 474 atcaagctgtggaacactctggccgagtgcaagtacaccatc 515



to top

>emb|BX056009.1|CNS09FDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 483 atcaagctgtggaacactctggccgagtgcaagtacaccatc 524



to top

>emb|BX055973.1|CNS09FCP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 548

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 464 atcaagctgtggaacactctggccgagtgcaagtacaccatc 505



to top

>emb|BX055414.1|CNS09EX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 477 atcaagctgtggaacactctggccgagtgcaagtacaccatc 518



to top

>emb|BX053270.1|CNS09D9M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 667 atcaagctgtggaacactctggccgagtgcaagtacaccatc 626



to top

>emb|BX053269.1|CNS09D9L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 477 atcaagctgtggaacaccctcggtgagtgcaagtacaccatc 518
           ||||||||||||||||| || |  ||||||||||||||||||
Sbjct: 490 atcaagctgtggaacactctggccgagtgcaagtacaccatc 531


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,255,230
Number of Sequences: 3902068
Number of extensions: 3255230
Number of successful extensions: 90154
Number of sequences better than 10.0: 1736
Number of HSP's better than 10.0 without gapping: 1719
Number of HSP's successfully gapped in prelim test: 18
Number of HSP's that attempted gapping in prelim test: 86422
Number of HSP's gapped (non-prelim): 3718
length of query: 539
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 516
effective length of database: 17,143,297,704
effective search space: 8845941615264
effective search space used: 8845941615264
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top