ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart23c11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF043091.1|AF043091 Hordeum vulgare dehydrin 6 (dhn6) gene, complete cds Length = 3086 Score = 1061 bits (535), Expect = 0.0 Identities = 578/591 (97%), Gaps = 1/591 (0%) Strand = Plus / Plus Query: 1 atcggcatccgcttgacattgacaatccgattcaatccacagccaagaacacacactcac 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 704 atcggcatccgcttgacattgacaatccgattcaatccacagccaagaacacacactcac 763 Query: 61 agcagcagcaagcaatccgtgaagcgaagagatggcgcatttccagggccagcagcacgg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 764 agcagcagcaagcaatccgtgaagcgaagagatggcgcatttccagggccagcagcacgg 823 Query: 121 ccacccggccacccgcgtcgacgagtacggcaaccccgtgacggccgccggccagggcgg 180 ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| Sbjct: 824 ccacccggccacccgcgtcgacgagtacggcaaccccgtgacggccggcggccacggcgg 883 Query: 181 cggcgtcaccgggaccgatggcttgggccacttccagggccagcagcacggccgcacgac 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 884 cggcgtcaccgggaccgatggcttgggccacttccagggccagcagcacggccgcacgac 943 Query: 241 gactcgcctcgacgagtacggcaacccggtgacggccggccacggcgttgggctgggatc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 944 gactcgcctcgacgagtacggcaacccggtgacggccggccacggcgttggggctggatc 1003 Query: 301 caccggcgcgggagcgcacggccctgggcacgctgggtacgggtctaccggcaccaacga 360 ||||||| ||| || |||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 1004 caccggcacggaagtgcacggtcctgggcacgctgggtacgggtctaccggcaccaacga 1063 Query: 361 cactggcggccatggccgccaggtgggttac-gtgccactggcacgggcacccacgacgc 419 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1064 cactggcggccatggccgccaggtgggttacggtgccactggcacgggcacccacgacgc 1123 Query: 420 tgggggctatggaggctctgggattgcccctcggcacggcggcgccggcactggggttca 479 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 1124 tgggggctatggaggctctgggattgcccctaggcacggcggcgccggcactggggttca 1183 Query: 480 cgacgccggtggtttggggcacacaaccgggcatggcgccaccggtacccacggaactgg 539 ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| Sbjct: 1184 cgacgccggtggtttggggcacacaaccgggcatggcgctaccagtacccacggaactgg 1243 Query: 540 gcacacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1244 gcacacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 1294 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 538 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 ||||||||||| ||||| | | ||||||||||||| || |||||||| ||||| Sbjct: 1299 gggcacacggccgggtatgacgccaccggcaccgggatcaccgggacccatgg 1351 Score = 48.1 bits (24), Expect = 0.033 Identities = 60/72 (83%) Strand = Plus / Plus Query: 519 caccggtacccacggaactgggcacacggctgggtacggctccaccggcaccggaatgac 578 |||||| ||||| || || || ||||||||||||| ||| |||||||||||| || || Sbjct: 1556 caccgggacccatggcaccggccacacggctgggttgggcggcaccggcaccgggatcac 1615 Query: 579 cgggacacatgg 590 |||||| ||||| Sbjct: 1616 cgggacccatgg 1627 Score = 48.1 bits (24), Expect = 0.033 Identities = 42/48 (87%) Strand = Plus / Plus Query: 543 cacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 |||||| ||||||||| |||||||||||| || |||||||| ||||| Sbjct: 1460 cacggccgggtacggcggcaccggcaccgggatcaccgggacccatgg 1507 Score = 48.1 bits (24), Expect = 0.033 Identities = 75/92 (81%) Strand = Plus / Plus Query: 499 cacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctgggtacggc 558 ||||| |||||| | |||| |||||| || || || || ||||||||||| ||||| | | Sbjct: 1359 cacacgaccgggtacggcggcaccgggacacatggtacagggcacacggccgggtatgac 1418 Query: 559 tccaccggcaccggaatgaccgggacacatgg 590 |||||||||| || || ||||||||||||| Sbjct: 1419 gccaccggcacagggatcgccgggacacatgg 1450 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 560 ccaccggcaccggaatgaccgggacacatgg 590 |||||||||||||||| |||||||| ||||| Sbjct: 1540 ccaccggcaccggaatcaccgggacccatgg 1570 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 ctggcggccatggccgccag 382 |||||||||||||||||||| Sbjct: 1085 ctggcggccatggccgccag 1066
>gb|AF181456.1|AF181456 Hordeum vulgare dehydrin (Dhn6) mRNA, complete cds Length = 1637 Score = 989 bits (499), Expect = 0.0 Identities = 515/519 (99%), Gaps = 1/519 (0%) Strand = Plus / Plus Query: 73 caatccgtgaagcgaagagatggcgcatttccagggccagcagcacggccacccggccac 132 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 caatccgtgaagcgaagagatggcgcatttccagggccagcagcacggccacccggccac 60 Query: 133 ccgcgtcgacgagtacggcaaccccgtgacggccgccggccagggcggcggcgtcaccgg 192 ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| Sbjct: 61 ccgcgtcgacgagtacggcaaccccgtgacggccggcggccacggcggcggcgtcaccgg 120 Query: 193 gaccgatggcttgggccacttccagggccagcagcacggccgcacgacgactcgcctcga 252 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gaccgatggcttgggccacttccagggccagcagcacggccgcacgacgactcgcctcga 180 Query: 253 cgagtacggcaacccggtgacggccggccacggcgttgggctgggatccaccggcgcggg 312 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 181 cgagtacggcaacccggtgacggccggccacggcgttgggctggggtccaccggcgcggg 240 Query: 313 agcgcacggccctgggcacgctgggtacgggtctaccggcaccaacgacactggcggcca 372 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 agcgcacggccctgggcacgctgggtacgggtctaccggcaccaacgacactggcggcca 300 Query: 373 tggccgccaggtgggttac-gtgccactggcacgggcacccacgacgctgggggctatgg 431 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 301 tggccgccaggtgggttacggtgccactggcacgggcacccacgacgctgggggctatgg 360 Query: 432 aggctctgggattgcccctcggcacggcggcgccggcactggggttcacgacgccggtgg 491 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 aggctctgggattgcccctcggcacggcggcgccggcactggggttcacgacgccggtgg 420 Query: 492 tttggggcacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctgg 551 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 tttggggcacacaaccgggcatggcgccaccggtacccacggaactgggcacacggctgg 480 Query: 552 gtacggctccaccggcaccggaatgaccgggacacatgg 590 ||||||||||||||||||||||||||||||||||||||| Sbjct: 481 gtacggctccaccggcaccggaatgaccgggacacatgg 519 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/72 (87%) Strand = Plus / Plus Query: 519 caccggtacccacggaactgggcacacggctgggtacggctccaccggcaccggaatgac 578 |||||| ||||| || || || |||||||| |||||||||||||||||||| || || || Sbjct: 562 caccgggacccatggcaccggccacacggccgggtacggctccaccggcacagggatcac 621 Query: 579 cgggacacatgg 590 |||||||||||| Sbjct: 622 cgggacacatgg 633 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Plus Query: 538 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 ||||||||||| ||||| | | ||||||||||||| || |||||||| ||||| Sbjct: 524 gggcacacggccgggtatgacgccaccggcaccgggatcaccgggacccatgg 576 Score = 48.1 bits (24), Expect = 0.033 Identities = 42/48 (87%) Strand = Plus / Plus Query: 543 cacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 |||||| ||||||||| |||||||||||| || |||||||| ||||| Sbjct: 700 cacggccgggtacggcggcaccggcaccgggatcaccgggacccatgg 747 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 560 ccaccggcaccggaatgaccgggacacatgg 590 |||||||||||||||| |||||||| ||||| Sbjct: 780 ccaccggcaccggaatcaccgggacccatgg 810 Score = 42.1 bits (21), Expect = 2.0 Identities = 45/53 (84%) Strand = Plus / Plus Query: 538 gggcacacggctgggtacggctccaccggcaccggaatgaccgggacacatgg 590 ||||||||||| ||||| | | |||||||||| || || ||||||||||||| Sbjct: 638 gggcacacggccgggtatgacgccaccggcacagggatcgccgggacacatgg 690 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 ctggcggccatggccgccag 382 |||||||||||||||||||| Sbjct: 310 ctggcggccatggccgccag 291
>gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0037B06 map near 50283S, complete sequence Length = 149398 Score = 99.6 bits (50), Expect = 1e-17 Identities = 71/78 (91%) Strand = Plus / Plus Query: 90 agatggcgcatttccagggccagcagcacggccacccggccacccgcgtcgacgagtacg 149 |||||||||| |||||||| |||||||||||||||||||| | |||||||||||||||| Sbjct: 88013 agatggcgcacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacg 88072 Query: 150 gcaaccccgtgacggccg 167 ||||||| ||| |||||| Sbjct: 88073 gcaacccggtggcggccg 88090 Score = 91.7 bits (46), Expect = 2e-15 Identities = 70/78 (89%) Strand = Plus / Plus Query: 209 cacttccagggccagcagcacggccgcacgacgactcgcctcgacgagtacggcaacccg 268 ||||||||||| ||||||||||||| | || || | ||| |||||||||||||||||||| Sbjct: 88021 cacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacggcaacccg 88080 Query: 269 gtgacggccggccacggc 286 ||| |||||||||||||| Sbjct: 88081 gtggcggccggccacggc 88098 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Plus Query: 394 gccactggcacgggcacccacgacgctgggggctatgg 431 ||||| ||||| |||||||||||||| | ||||||||| Sbjct: 88222 gccaccggcaccggcacccacgacgccgcgggctatgg 88259
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 99.6 bits (50), Expect = 1e-17 Identities = 71/78 (91%) Strand = Plus / Minus Query: 90 agatggcgcatttccagggccagcagcacggccacccggccacccgcgtcgacgagtacg 149 |||||||||| |||||||| |||||||||||||||||||| | |||||||||||||||| Sbjct: 14646703 agatggcgcacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacg 14646644 Query: 150 gcaaccccgtgacggccg 167 ||||||| ||| |||||| Sbjct: 14646643 gcaacccggtggcggccg 14646626 Score = 91.7 bits (46), Expect = 2e-15 Identities = 70/78 (89%) Strand = Plus / Minus Query: 209 cacttccagggccagcagcacggccgcacgacgactcgcctcgacgagtacggcaacccg 268 ||||||||||| ||||||||||||| | || || | ||| |||||||||||||||||||| Sbjct: 14646695 cacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacggcaacccg 14646636 Query: 269 gtgacggccggccacggc 286 ||| |||||||||||||| Sbjct: 14646635 gtggcggccggccacggc 14646618 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 14767137 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 14767093 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 14767111 tcgacgagtacggcaacccggt 14767090 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 394 gccactggcacgggcacccacgacgctgggggctatgg 431 ||||| ||||| |||||||||||||| | ||||||||| Sbjct: 14646494 gccaccggcaccggcacccacgacgccgcgggctatgg 14646457 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 14760556 ccgcgtcgacgtgtacggcaaccc 14760533 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 14752113 ccgcgtcgacgtgtacggcaaccc 14752090
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 99.6 bits (50), Expect = 1e-17 Identities = 71/78 (91%) Strand = Plus / Minus Query: 90 agatggcgcatttccagggccagcagcacggccacccggccacccgcgtcgacgagtacg 149 |||||||||| |||||||| |||||||||||||||||||| | |||||||||||||||| Sbjct: 14728704 agatggcgcacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacg 14728645 Query: 150 gcaaccccgtgacggccg 167 ||||||| ||| |||||| Sbjct: 14728644 gcaacccggtggcggccg 14728627 Score = 91.7 bits (46), Expect = 2e-15 Identities = 70/78 (89%) Strand = Plus / Minus Query: 209 cacttccagggccagcagcacggccgcacgacgactcgcctcgacgagtacggcaacccg 268 ||||||||||| ||||||||||||| | || || | ||| |||||||||||||||||||| Sbjct: 14728696 cacttccagggacagcagcacggccacccggcggcgcgcgtcgacgagtacggcaacccg 14728637 Query: 269 gtgacggccggccacggc 286 ||| |||||||||||||| Sbjct: 14728636 gtggcggccggccacggc 14728619 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 14847574 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 14847530 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 14847548 tcgacgagtacggcaacccggt 14847527 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 394 gccactggcacgggcacccacgacgctgggggctatgg 431 ||||| ||||| |||||||||||||| | ||||||||| Sbjct: 14728495 gccaccggcaccggcacccacgacgccgcgggctatgg 14728458 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 14840993 ccgcgtcgacgtgtacggcaaccc 14840970 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 14832550 ccgcgtcgacgtgtacggcaaccc 14832527
>gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0034E03 map near 50283S, complete sequence Length = 134074 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 59923 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 59967 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 59949 tcgacgagtacggcaacccggt 59970 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 74947 ccgcgtcgacgtgtacggcaaccc 74970 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 66504 ccgcgtcgacgtgtacggcaaccc 66527
>gb|AY619566.1| Triticum turgidum subsp. durum dehydrin mRNA, complete cds Length = 1124 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 111 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 155 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 137 tcgacgagtacggcaacccg 156
>gb|AY349271.1| Hordeum vulgare subsp. spontaneum NPGS PI 559559 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349270.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349269.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349268.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349267.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349266.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 dehydrin 9 (Dhn9) gene, complete cds Length = 992 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 452 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 496 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 478 tcgacgagtacggcaacccg 497
>gb|AY349265.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 dehydrin 9 (Dhn9) gene, complete cds Length = 994 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 454 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 498 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 480 tcgacgagtacggcaacccg 499
>gb|AY349264.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349263.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349262.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 dehydrin 9 (Dhn9) gene, complete cds Length = 1000 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 460 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 504 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 486 tcgacgagtacggcaacccg 505
>gb|AY349261.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 dehydrin 9 (Dhn9) gene, complete cds Length = 1005 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349260.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349259.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349258.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349257.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349256.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349255.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349254.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349253.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349252.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349251.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 dehydrin 9 (Dhn9) gene, complete cds Length = 1004 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 464 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 508 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 490 tcgacgagtacggcaacccg 509
>gb|AY349250.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349249.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>gb|AY349248.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 dehydrin 9 (Dhn9) gene, complete cds Length = 1001 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 461 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 505 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 487 tcgacgagtacggcaacccg 506
>gb|AY349247.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 dehydrin 9 (Dhn9) gene, complete cds Length = 1007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 465 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 509 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 491 tcgacgagtacggcaacccg 510
>dbj|AK121952.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K14, full insert sequence Length = 709 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 107 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 151 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 133 tcgacgagtacggcaacccggt 154
>emb|Y00842.1|OSRAB21 Rice rab21 gene for water-stress inducible protein RAB21 Length = 2537 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 1613 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 1657 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 1639 tcgacgagtacggcaacccggt 1660
>emb|X78431.1|TDDEH27 T.durum Desf. (Siliana) Dehydrin mRNA, clone pTd27e Length = 751 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 67 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 111 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 93 tcgacgagtacggcaacccg 112
>emb|X59133.1|TARAB T.aestivum L. mRNA for an ABA responsive gene, rab Length = 781 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 39 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 83 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 65 tcgacgagtacggcaacccg 84
>gb|U60097.2|OSU60097 Oryza sativa dehydrin mRNA, complete cds Length = 864 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 99 gcagcacggccacgtgaccagccgcgtcgacgagtacggcaaccc 143 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 125 tcgacgagtacggcaacccggt 146
>gb|AF181459.1|AF181459 Hordeum vulgare dehydrin (Dhn9) gene, complete cds Length = 1791 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 632 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 676 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 658 tcgacgagtacggcaacccg 677
>gb|AF043094.1|AF043094 Hordeum vulgare dehydrin 9 (dhn9) gene, complete cds Length = 1630 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 112 gcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||| | |||| |||| |||||||||||||||||||||||| Sbjct: 690 gcagcacgacaaccccgccaaccgcgtcgacgagtacggcaaccc 734 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccg 268 |||||||||||||||||||| Sbjct: 716 tcgacgagtacggcaacccg 735
>emb|X15286.1|HVDHN17 Barley mRNA for dehydrin (dhn17) Length = 812 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 114 agcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 64 agcacggccacgcgaccaaccgcgtcgacgagtacggtaaccc 106
>gb|AF181453.1|AF181453 Hordeum vulgare dehydrin (Dhn3) gene, complete cds Length = 1575 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 114 agcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 784 agcacggccacgcgaccaaccgcgtcgacgagtacggtaaccc 826
>gb|AY895929.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531957 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 177 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 223
>gb|AY895928.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 7 (Dhn7) gene, complete cds Length = 1332 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895925.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895923.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895922.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 7 (Dhn7) gene, complete cds Length = 1364 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895921.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 7 (Dhn7) gene, complete cds Length = 1373 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895920.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 170 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 216
>gb|AY895919.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895915.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895914.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 7 (Dhn7) gene, complete cds Length = 1366 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 219
>gb|AY895910.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 170 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 216
>gb|AY895905.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 7 (Dhn7) gene, complete cds Length = 1363 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 170 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 216
>gb|AF043092.1|AF043092 Hordeum vulgare dehydrin 7 (dhn7) gene, complete cds Length = 2127 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 540 cagcagcacggccaggcgaccaaccgcgtcgacgagtacggtaaccc 586
>gb|AF043089.1|AF043089 Hordeum vulgare dehydrin 3 (dhn3) gene, complete cds Length = 1560 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 114 agcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 ||||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 747 agcacggccacgcgaccaaccgcgtcgacgagtacggtaaccc 789
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 102 tccagggccagcagcacggccaccc 126 ||||||||||||||||||||||||| Sbjct: 939187 tccagggccagcagcacggccaccc 939163 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 213 tccagggccagcagcacggcc 233 ||||||||||||||||||||| Sbjct: 939187 tccagggccagcagcacggcc 939167
>emb|Y10778.1|SSY10778 S.stapfianus pSD.8a mRNA Length = 310 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 106 ccgcgtcgacgagtacggcaaccc 129
>emb|X72748.1|HVDEHYD H.vulgare mRNA for dehydrin Length = 1016 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 114 ccgcgtcgacgagtacggcaaccc 137
>emb|X15287.1|HVDHN18 Barley mRNA for dehydrin (dhn18) Length = 1049 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 101 ccgcgtcgacgagtacggcaaccc 124
>emb|X62476.1|TARAB15B T.aestivum rab15B mRNA Length = 1068 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 99 ccgcgtcgacgagtacggcaaccc 122 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggtg 271 ||||||||||||||||||||||| Sbjct: 104 tcgacgagtacggcaacccggtg 126
>gb|AF181454.1|AF181454 Hordeum vulgare dehydrin (Dhn4) gene, complete cds Length = 2440 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 872 ccgcgtcgacgagtacggcaaccc 895
>gb|AY895904.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895903.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895901.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531853 dehydrin 4 (Dhn4) gene, complete cds Length = 920 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895900.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 4 (Dhn4) gene, complete cds Length = 924 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895899.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895898.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420916 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895897.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 4 (Dhn4) gene, complete cds Length = 919 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895896.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420911 dehydrin 4 (Dhn4) gene, complete cds Length = 910 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895895.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 406276 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895894.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401371 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895892.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895891.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895890.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895889.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293409 dehydrin 4 (Dhn4) gene, complete cds Length = 921 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895888.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293402 dehydrin 4 (Dhn4) gene, complete cds Length = 980 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895887.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895886.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 4 (Dhn4) gene, complete cds Length = 904 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895885.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 253933 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895884.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 4 (Dhn4) gene, complete cds Length = 916 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 33 ccgcgtcgacgagtacggcaaccc 56
>gb|AY895883.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 4 (Dhn4) gene, complete cds Length = 906 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895882.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 4 (Dhn4) gene, complete cds Length = 908 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895881.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 4 (Dhn4) gene, complete cds Length = 907 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AY895880.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212305 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 39 ccgcgtcgacgagtacggcaaccc 62
>gb|AF043090.1|AF043090 Hordeum vulgare dehydrin 4 (dhn4) gene, complete cds Length = 2790 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||||||||| Sbjct: 1402 ccgcgtcgacgagtacggcaaccc 1425
>gb|AF453444.1|AF453444 Triticum aestivum dehydrin WZY1-1 mRNA, complete cds Length = 483 Score = 46.1 bits (23), Expect = 0.13 Identities = 38/43 (88%) Strand = Plus / Plus Query: 114 agcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||| || ||| |||||||||||||||||| ||||| Sbjct: 5 agcacggccaggcgaccatccgcgtcgacgagtacggtaaccc 47
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 169 cggccagggcggcggcgtcaccg 191 ||||||||||||||||||||||| Sbjct: 6380260 cggccagggcggcggcgtcaccg 6380282
>gb|AF181461.1|AF181461 Hordeum vulgare dehydrin (Dhn11) gene, complete cds Length = 2009 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggtg 271 ||||||||||||||||||||||| Sbjct: 879 tcgacgagtacggcaacccggtg 901 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 134 cgcgtcgacgagtacggcaaccc 156 ||||||||||||||||||||||| Sbjct: 875 cgcgtcgacgagtacggcaaccc 897
>gb|AF181457.1|AF181457 Hordeum vulgare dehydrin (Dhn7) mRNA, complete cds Length = 654 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| ||||||||| |||||||| ||||| Sbjct: 30 cagcagcacggccaggcgaccaaccgcgtcgatgagtacggtaaccc 76
>gb|AY895931.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 560559 dehydrin 7 (Dhn7) gene, complete cds Length = 1371 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || || |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccgaccgcgtcgacgagtacggtaaccc 219
>gb|AY895930.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 559556 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| ||||||||| |||||||| ||||| Sbjct: 177 cagcagcacggccaggcgaccaaccgcgtcgatgagtacggtaaccc 223
>gb|AY895927.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 531851 dehydrin 7 (Dhn7) gene, complete cds Length = 1357 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || || |||||||||||||||||| ||||| Sbjct: 188 cagcagcacggccaggcgaccgaccgcgtcgacgagtacggtaaccc 234
>gb|AY895926.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 466460 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| ||||||||| |||||||| ||||| Sbjct: 177 cagcagcacggccaggcgaccaaccgcgtcgatgagtacggtaaccc 223
>gb|AY895924.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 420913 dehydrin 7 (Dhn7) gene, complete cds Length = 1375 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || || |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccgaccgcgtcgacgagtacggtaaccc 219
>gb|AY895917.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 296926 dehydrin 7 (Dhn7) gene, complete cds Length = 1370 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| ||||||||| |||||||| ||||| Sbjct: 177 cagcagcacggccaggcgaccaaccgcgtcgatgagtacggtaaccc 223
>gb|AY895909.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 236388 dehydrin 7 (Dhn7) gene, complete cds Length = 1369 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || ||| ||||||||| |||||||| ||||| Sbjct: 177 cagcagcacggccaggcgaccaaccgcgtcgatgagtacggtaaccc 223
>gb|AY895907.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 219796 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 46.1 bits (23), Expect = 0.13 Identities = 41/47 (87%) Strand = Plus / Plus Query: 110 cagcagcacggccacccggccacccgcgtcgacgagtacggcaaccc 156 |||||||||||||| || || |||||||||||||||||| ||||| Sbjct: 173 cagcagcacggccaggcgaccgaccgcgtcgacgagtacggtaaccc 219
>gb|AY895893.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 401370 dehydrin 4 (Dhn4) gene, complete cds Length = 922 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 134 cgcgtcgacgagtacggcaaccc 156 ||||||||||||||||||||||| Sbjct: 40 cgcgtcgacgagtacggcaaccc 62
>gb|AF043086.1|AF043086 Hordeum vulgare dehydrin 11 (dhn11) gene, complete cds Length = 2420 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggtg 271 ||||||||||||||||||||||| Sbjct: 887 tcgacgagtacggcaacccggtg 909 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 134 cgcgtcgacgagtacggcaaccc 156 ||||||||||||||||||||||| Sbjct: 883 cgcgtcgacgagtacggcaaccc 905
>gb|AC166079.2| Mus musculus BAC clone RP23-51L15 from chromosome 7, complete sequence Length = 193749 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Minus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 184260 ccacttccagggccagcagcac 184239
>ref|XR_003856.1| PREDICTED: Mus musculus similar to signal-induced proliferation-associated 1 like 3 (LOC672426), mRNA Length = 7714 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 578 ccacttccagggccagcagcac 599
>ref|XM_001003324.1| PREDICTED: Mus musculus RIKEN cDNA 2610511M17 gene, transcript variant 3 (2610511M17Rik), mRNA Length = 7713 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 578 ccacttccagggccagcagcac 599
>ref|XM_923293.2| PREDICTED: Mus musculus RIKEN cDNA 2610511M17 gene, transcript variant 13 (2610511M17Rik), mRNA Length = 2774 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 505 ccacttccagggccagcagcac 526
>ref|XM_914459.2| PREDICTED: Mus musculus RIKEN cDNA 2610511M17 gene, transcript variant 6 (2610511M17Rik), mRNA Length = 7713 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 578 ccacttccagggccagcagcac 599
>emb|AJ704824.1| Glycine max partial lea10 gene for putative dehydrin Length = 641 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggt 270 |||||||||||||||||||||| Sbjct: 2 tcgacgagtacggcaacccggt 23 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 gtcgacgagtacggcaaccc 156 |||||||||||||||||||| Sbjct: 1 gtcgacgagtacggcaaccc 20
>dbj|AK154121.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630003D01 product:weakly similar to High-RISK human PAPILLOMA VIRUSES E6 ONCOPROTEINS TARGETED protein E6TP1 alpha homolog [Mus musculus], full insert sequence Length = 4371 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 579 ccacttccagggccagcagcac 600
>dbj|AK171182.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630301L12 product:hypothetical protein, full insert sequence Length = 2771 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 ccacttccagggccagcagcac 229 |||||||||||||||||||||| Sbjct: 507 ccacttccagggccagcagcac 528
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 458 gcggcgccggcactggggttca 479 |||||||||||||||||||||| Sbjct: 1325152 gcggcgccggcactggggttca 1325173
>ref|NM_031216.3| Homo sapiens SEH1-like (S. cerevisiae) (SEH1L), transcript variant 2, mRNA Length = 3513 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 2434 cactcacagcagcagcaagca 2414
>ref|XM_416750.1| PREDICTED: Gallus gallus similar to Homeobox protein PKNOX1 (PBX/knotted homeobox 1) (Homeobox protein PREP-1) (LOC418542), mRNA Length = 3317 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 105 agggccagcagcacggccacc 125 ||||||||||||||||||||| Sbjct: 121 agggccagcagcacggccacc 101
>gb|BC012430.1| Homo sapiens SEH1-like (S. cerevisiae), mRNA (cDNA clone MGC:21489 IMAGE:3865994), complete cds Length = 3497 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 2388 cactcacagcagcagcaagca 2368
>emb|AJ249273.1|HAN249273 Helianthus annuus partial dhn1wt1 gene for putative dehydrin, exons 1-2 Length = 1002 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>gb|AE005791.1| Caulobacter crescentus CB15 section 117 of 359 of the complete genome Length = 10822 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 165 ccgccggccagggcggcggcg 185 ||||||||||||||||||||| Sbjct: 7090 ccgccggccagggcggcggcg 7110
>gb|AF255625.1| Homo sapiens putative nucleoporin protein SEH1A (SEH1) mRNA, complete cds Length = 3431 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 2338 cactcacagcagcagcaagca 2318
>gb|AF136976.1|AF136976 Homo sapiens sec13-like protein mRNA, complete cds Length = 3492 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 2411 cactcacagcagcagcaagca 2391
>gb|AC122218.4| Mus musculus BAC clone RP23-118J7 from chromosome 16, complete sequence Length = 196599 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 31 ttcaatccacagccaagaacacaca 55 ||||||||||||||||||| ||||| Sbjct: 10909 ttcaatccacagccaagaagacaca 10933
>emb|AJ438980.1|HAN438980 Helianthus annuus partial dhn1f gene for putative dehydrin, exons 1-2 Length = 1081 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ438979.1|HAN438979 Helianthus annuus partial dhn1wt7 gene for putative dehydrin, exons 1-2 Length = 1081 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 169 cggccagggcggcggcgtcac 189 ||||||||||||||||||||| Sbjct: 1012840 cggccagggcggcggcgtcac 1012820 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 167 gccggccagggcggcggcgt 186 |||||||||||||||||||| Sbjct: 4849251 gccggccagggcggcggcgt 4849232
>emb|AJ250228.1|HAN250228 Helianthus annuus partial dhn1wt6 gene for putative dehydrin, exons 1-2 Length = 1065 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ250227.1|HAN250227 Helianthus annuus partial dhn1wt5 gene for putative dehydrin, exons 1-2 Length = 1068 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ250226.1|HAN250226 Helianthus annuus partial dhn1wt4 gene for putative dehydrin, exons 1-2 Length = 1076 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ250225.1|HAN250225 Helianthus annuus partial dhn1wt3 gene for putative dehydrin, exons 1-2 Length = 1028 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ250224.1|HAN250224 Helianthus annuus partial dhn1wt2 gene for putative dehydrin, exons 1-2 Length = 1086 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|X92647.1|HADEHY H.annuus mRNA for homologous dehydrin Length = 1043 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 207 cgacgagtacggcaacccggt 227 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 168 cgacgagtacggcaacccggt 188
>emb|AJ250147.1|HNI250147 Helianthus niveus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1030 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>emb|AJ250127.1|TRO250127 Tithonia rotundifolia partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1119 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 114 cgacgagtacggcaacccggt 134
>emb|AJ249272.1|HAN249272 Helianthus annuus partial dhn1e gene for putative dehydrin, exons 1-2 Length = 1039 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 130 cgacgagtacggcaacccggt 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>emb|AJ249271.1|HAN249271 Helianthus annuus partial dhn1d gene for putative dehydrin, exons 1-2 Length = 1039 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 130 cgacgagtacggcaacccggt 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>emb|AJ249270.1|HAN249270 Helianthus annuus partial dhn1c gene for putative dehydrin, exons 1-2 Length = 1042 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 130 cgacgagtacggcaacccggt 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>emb|AJ249269.1|HAN249269 Helianthus annuus partial dhn1b gene for putative dehydrin, exons 1-2 Length = 1042 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 130 cgacgagtacggcaacccggt 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>emb|AJ010944.1|HAN010944 Helianthus annuus mRNA for dehydrin-like protein, partial Length = 892 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 130 cgacgagtacggcaacccggt 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 91 cgacgagtacggcaacccggt 111
>emb|AJ002741.1|HAAJ2741 Helianthus annuus gene encoding dehydrin-like protein, partial Length = 1081 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 150 cgacgagtacggcaacccggt 170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 250 cgacgagtacggcaacccggt 270 ||||||||||||||||||||| Sbjct: 111 cgacgagtacggcaacccggt 131
>dbj|AP001357.5| Homo sapiens genomic DNA, chromosome 18 clone:RP11-807E13, complete sequence Length = 182382 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 2143 cactcacagcagcagcaagca 2123
>dbj|AP002449.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-773H22, complete sequence Length = 184000 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 134894 cactcacagcagcagcaagca 134874
>emb|BX538037.1|HSM806205 Homo sapiens mRNA; cDNA DKFZp686H12115 (from clone DKFZp686H12115) Length = 5325 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 cactcacagcagcagcaagca 74 ||||||||||||||||||||| Sbjct: 4143 cactcacagcagcagcaagca 4123
>gb|U20824.1|EHVU20824 Equine herpesvirus 2, complete genome Length = 184427 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 213 tccagggccagcagcacggcc 233 ||||||||||||||||||||| Sbjct: 60208 tccagggccagcagcacggcc 60228 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 102 tccagggccagcagcacggcc 122 ||||||||||||||||||||| Sbjct: 60208 tccagggccagcagcacggcc 60228
>gb|AC087840.16| Mus musculus strain C57BL/6J chromosome 16 clone rp23-240k10, complete sequence Length = 190761 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 31 ttcaatccacagccaagaacacaca 55 ||||||||||||||||||| ||||| Sbjct: 141113 ttcaatccacagccaagaagacaca 141137
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 cgccggccagggcggcggcg 185 |||||||||||||||||||| Sbjct: 212673 cgccggccagggcggcggcg 212692
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 gccgccggccagggcggcggcgtc 187 |||||||||||||||| ||||||| Sbjct: 460910 gccgccggccagggcgtcggcgtc 460887
>gb|AE017286.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough plasmid pDV, complete sequence Length = 202301 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cggcacggcggcgccggcactggg 474 ||||||||||||| |||||||||| Sbjct: 195574 cggcacggcggcgtcggcactggg 195597
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 544 acggctgggtacggctccaccggcaccg 571 ||||||||||||||| ||||||||||| Sbjct: 1853413 acggctgggtacggcagcaccggcaccg 1853440
>gb|BC046014.1| Danio rerio wu:fb33b12, mRNA (cDNA clone IMAGE:5601434), partial cds Length = 1382 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 49 acacacactcacagcagcagcaag 72 |||||||| ||||||||||||||| Sbjct: 633 acacacacacacagcagcagcaag 656
>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence Length = 2580084 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 cagggcggcggcgtcaccgg 192 |||||||||||||||||||| Sbjct: 1137896 cagggcggcggcgtcaccgg 1137877
>emb|AJ704826.1| Lactuca sativa partial lea1 gene for putative dehydrin Length = 338 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 gtcgacgagtacggcaaccc 156 |||||||||||||||||||| Sbjct: 1 gtcgacgagtacggcaaccc 20
>emb|AJ704825.1| Glycine max partial lea8 gene for putative dehydrin Length = 591 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 gtcgacgagtacggcaaccc 156 |||||||||||||||||||| Sbjct: 1 gtcgacgagtacggcaaccc 20
>gb|AC117465.13| Homo sapiens 3 BAC RP11-706D8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 195231 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 49 acacacactcacagcagcagcaag 72 |||||||| ||||||||||||||| Sbjct: 111944 acacacacacacagcagcagcaag 111921
>emb|X79560.1|HSCDCH H.salinarium (R1M1) cdcH gene Length = 3000 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 gccacccgcgtcgacgagta 147 |||||||||||||||||||| Sbjct: 2603 gccacccgcgtcgacgagta 2584
>emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete genome; segment 8/29 Length = 321250 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 cgccggccagggcggcggcg 185 |||||||||||||||||||| Sbjct: 89795 cgccggccagggcggcggcg 89814
>emb|AJ439060.1|AGA439060 Anopheles gambiae DNA from 2R chromosome, clone 11N17 Length = 147295 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 tcggcacggcggcgccggca 469 |||||||||||||||||||| Sbjct: 30391 tcggcacggcggcgccggca 30372
>gb|DQ397867.1| Cenarchaeum symbiosum clone C12D02, complete sequence Length = 38715 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 acggccgccggccagggcggcggc 184 |||||||||||||||| ||||||| Sbjct: 20495 acggccgccggccaggccggcggc 20518
>gb|DQ397609.1| Cenarchaeum symbiosum clone C13F02, complete sequence Length = 43826 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 acggccgccggccagggcggcggc 184 |||||||||||||||| ||||||| Sbjct: 29212 acggccgccggccaggccggcggc 29189
>gb|DQ397605.2| Cenarchaeum symbiosum clone C09D08, complete sequence Length = 35950 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 acggccgccggccagggcggcggc 184 |||||||||||||||| ||||||| Sbjct: 14411 acggccgccggccaggccggcggc 14434
>gb|DQ397566.1| Cenarchaeum symbiosum clone C06D08, complete sequence Length = 38715 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 acggccgccggccagggcggcggc 184 |||||||||||||||| ||||||| Sbjct: 21118 acggccgccggccaggccggcggc 21095
>dbj|AK128954.1| Mus musculus cDNA fis, clone TRACH3010757, highly similar to Interferon-gamma inducible protein MG11 Length = 3753 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 100 tttccagggccagcagcacggcca 123 |||||||||||||||||| ||||| Sbjct: 2445 tttccagggccagcagcagggcca 2468
>gb|AE005913.1| Caulobacter crescentus CB15 section 239 of 359 of the complete genome Length = 13785 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 gggccagcagcacggccacc 125 |||||||||||||||||||| Sbjct: 9889 gggccagcagcacggccacc 9870
>gb|AC087069.3| Homo sapiens chromosome 7 clone RP11-7P19, complete sequence Length = 159620 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 49 acacacactcacagcagcagcaagcaat 76 |||||||| |||||||||||||| |||| Sbjct: 81842 acacacacacacagcagcagcaatcaat 81869
>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome Length = 2628784 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 gccgccggccagggcggcgg 183 |||||||||||||||||||| Sbjct: 450356 gccgccggccagggcggcgg 450337
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 ccgccggccagggcggcggc 184 |||||||||||||||||||| Sbjct: 2813210 ccgccggccagggcggcggc 2813229 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 ccgccggccagggcggcggc 184 |||||||||||||||||||| Sbjct: 143097 ccgccggccagggcggcggc 143116
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 249 tcgacgagtacggcaacccggtga 272 |||||||| ||||||||||||||| Sbjct: 906360 tcgacgaggacggcaacccggtga 906383
>gb|AC158680.4| Mus musculus 6 BAC RP23-112F6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206705 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 acacacactcacagcagcag 68 |||||||||||||||||||| Sbjct: 45054 acacacactcacagcagcag 45035
>dbj|AB179766.1| Alternaria alternata AF-toxin biosynthesis gene cluster (Aft9-1, Aft10-1, Aft11-1, Aft12-1, AftR-2, Aft3-2), complete cds Length = 37168 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 513 tggcgccaccggtacccacg 532 |||||||||||||||||||| Sbjct: 25289 tggcgccaccggtacccacg 25270
>gb|AF031248.1|AF031248 Lophopyrum elongatum dehydrin-/LEA group 2-like protein (ESI18-3) mRNA, complete cds Length = 793 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 57 ccgcgtcgacgagtacggtaaccc 80
>dbj|AB158495.1| Octopus vulgaris CTR2 gene for cephalotocin receptor 2, exon 2-3, partial cds Length = 4086 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 388 ttacgtgccactggcacggg 407 |||||||||||||||||||| Sbjct: 2022 ttacgtgccactggcacggg 2041
>gb|AE004611.1| Pseudomonas aeruginosa PAO1, section 172 of 529 of the complete genome Length = 10365 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 ggccgccggccagggcggcg 182 |||||||||||||||||||| Sbjct: 6965 ggccgccggccagggcggcg 6984
>gb|AE004569.1| Pseudomonas aeruginosa PAO1, section 130 of 529 of the complete genome Length = 10245 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 206 ggccacttccagggccagcagcac 229 ||||||||||||||||| |||||| Sbjct: 6477 ggccacttccagggccaccagcac 6454
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 gccagggcggcggcgtcacc 190 |||||||||||||||||||| Sbjct: 17325 gccagggcggcggcgtcacc 17344
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 ctcggcacggcggcgccggc 468 |||||||||||||||||||| Sbjct: 5780068 ctcggcacggcggcgccggc 5780049
>gb|AE005076.1| Halobacterium sp. NRC-1 section 107 of 170 of the complete genome Length = 12928 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 gccacccgcgtcgacgagta 147 |||||||||||||||||||| Sbjct: 93 gccacccgcgtcgacgagta 74
>emb|AJ250153.1|HPR250153 Helianthus praecox partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1032 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 112 gacgagtacggcaacccggt 131
>emb|AJ250148.1|HTU250148 Helianthus tuberosus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 998 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 112 gacgagtacggcaacccggt 131
>emb|AJ250145.1|HHI250145 Helianthus hirsutus partial dhn1 gene for putative dehydrin, exons 1-2 Length = 998 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 112 gacgagtacggcaacccggt 131
>emb|AJ250125.1|HPR250125 Helianthus praecox partial dhn1 gene for putative dehydrin, exons 1-2 Length = 1027 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 112 gacgagtacggcaacccggt 131
>emb|AJ249708.1|HDE249708 Helianthus debilis partial cDhn1 gene for putative dehydrin, exons 1-2 subsp. cucumerifolius Length = 1017 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 112 gacgagtacggcaacccggt 131
>ref|XM_321528.2| Anopheles gambiae str. PEST ENSANGP00000017400 (ENSANGG00000014911), partial mRNA Length = 4938 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 450 tcggcacggcggcgccggca 469 |||||||||||||||||||| Sbjct: 3892 tcggcacggcggcgccggca 3873
>emb|X52422.1|OSRAB16B O.sativa DNA for rab 16B gene Length = 2890 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 1434 ccgcgtcgacgtgtacggcaaccc 1457
>emb|AJ297737.1|HCI297737 Helianthus ciliaris partial dhn1 gene for putative dehydrin, exons 1-2 Length = 931 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 gacgagtacggcaacccggt 270 |||||||||||||||||||| Sbjct: 92 gacgagtacggcaacccggt 111
>dbj|AK071366.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096D05, full insert sequence Length = 795 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 117 ccgcgtcgacgtgtacggcaaccc 140
>dbj|AK063517.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H03, full insert sequence Length = 872 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 ||||||||||| |||||||||||| Sbjct: 174 ccgcgtcgacgtgtacggcaaccc 197
>gb|AY895918.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 366446 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AY895916.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 293411 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AY895913.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1344 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AY895912.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 268242 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AY895911.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 254894 dehydrin 7 (Dhn7) gene, complete cds Length = 1343 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AY895908.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 220523 dehydrin 7 (Dhn7) gene, complete cds Length = 1337 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 200 ccgcgtcgacgagtacggtaaccc 223
>gb|AY895906.1| Hordeum vulgare subsp. spontaneum voucher NPGS PI 212306 dehydrin 7 (Dhn7) gene, complete cds Length = 1342 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 133 ccgcgtcgacgagtacggcaaccc 156 |||||||||||||||||| ||||| Sbjct: 196 ccgcgtcgacgagtacggtaaccc 219
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 cgccggccagggcggcggcg 185 |||||||||||||||||||| Sbjct: 1736083 cgccggccagggcggcggcg 1736064
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 85 cgaagagatggcgcatttccagggccag 112 ||||| |||| ||||||||||||||||| Sbjct: 1799822 cgaagtgatgccgcatttccagggccag 1799849 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 296 ggatccaccggcgcgggagcgcac 319 |||||| ||||||||||||||||| Sbjct: 1406657 ggatccgccggcgcgggagcgcac 1406680
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 455 acggcggcgccggcactggggttc 478 |||||||||| ||||||||||||| Sbjct: 1236487 acggcggcgcaggcactggggttc 1236464
>gb|AC153803.1| Mus musculus 6 BAC RP24-276E19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 155295 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 acacacactcacagcagcag 68 |||||||||||||||||||| Sbjct: 24499 acacacactcacagcagcag 24518
>emb|AL669828.13| Mouse DNA sequence from clone RP23-163J20 on chromosome 2, complete sequence Length = 248940 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 100 tttccagggccagcagcacggcca 123 |||||||||||||||||| ||||| Sbjct: 19048 tttccagggccagcagcagggcca 19025 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,120,059 Number of Sequences: 3902068 Number of extensions: 4120059 Number of successful extensions: 98100 Number of sequences better than 10.0: 191 Number of HSP's better than 10.0 without gapping: 191 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94970 Number of HSP's gapped (non-prelim): 3119 length of query: 590 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 567 effective length of database: 17,143,297,704 effective search space: 9720249798168 effective search space used: 9720249798168 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
