ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart22d03 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK074017.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033073D08, full insert sequence Length = 2009 Score = 89.7 bits (45), Expect = 9e-15 Identities = 177/221 (80%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 356 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 415 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 416 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 475 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||||| || || || |||||| | |||||||| || |||| Sbjct: 476 ctcagagtacggttcacgagctccgtgatgcagatctcataatccaggagagtcgttggg 535 Query: 502 ctagcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||||| || || ||||||||||| || |||||||| Sbjct: 536 ctagcctccctcctgagctcctccgcgatgtgatccggagg 576
>gb|AC105318.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1058_F05, complete sequence Length = 109126 Score = 81.8 bits (41), Expect = 2e-12 Identities = 176/221 (79%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 104846 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 104787 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 104786 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 104727 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||| Sbjct: 104726 ctcagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttggg 104667 Query: 502 ctagcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||||| || || ||||||||||| || |||||||| Sbjct: 104666 ctagcctccctcctgagctcctccgcgatgtgatccggagg 104626
>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0042J17, complete sequence Length = 124139 Score = 81.8 bits (41), Expect = 2e-12 Identities = 176/221 (79%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 35562 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 35503 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 35502 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 35443 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||| Sbjct: 35442 ctcagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttggg 35383 Query: 502 ctagcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||||| || || ||||||||||| || |||||||| Sbjct: 35382 ctagcctccctcctgagctcctccgcgatgtgatccggagg 35342
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 81.8 bits (41), Expect = 2e-12 Identities = 176/221 (79%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 21318240 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 21318181 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 21318180 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 21318121 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||| Sbjct: 21318120 ctcagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttggg 21318061 Query: 502 ctagcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||||| || || ||||||||||| || |||||||| Sbjct: 21318060 ctagcctccctcctgagctcctccgcgatgtgatccggagg 21318020 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 510 ccgccggaactcctccgcgacgtc 533 ||||||||||||||||||| |||| Sbjct: 28713826 ccgccggaactcctccgcgtcgtc 28713803
>dbj|AK103583.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133A18, full insert sequence Length = 2027 Score = 81.8 bits (41), Expect = 2e-12 Identities = 176/221 (79%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 346 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 405 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 406 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 465 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||| Sbjct: 466 ctcagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttggg 525 Query: 502 ctagcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||||| || || ||||||||||| || |||||||| Sbjct: 526 ctagcctccctcctgagctcctccgcgatgtgatccggagg 566
>ref|XM_475311.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1338 Score = 77.8 bits (39), Expect = 3e-11 Identities = 174/219 (79%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 |||||||| |||||||| ||||| ||||| ||||| || | || ||||| |||||||| Sbjct: 1 atgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggcga 60 Query: 384 agcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagcac 443 ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 61 agctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagtct 120 Query: 444 cagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctgggct 503 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||||| Sbjct: 121 cagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttgggct 180 Query: 504 agcctcccgccggaactcctccgcgacgtcgtccggagg 542 |||||||| || || ||||||||||| || |||||||| Sbjct: 181 agcctccctcctgagctcctccgcgatgtgatccggagg 219
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 73.8 bits (37), Expect = 5e-10 Identities = 67/77 (87%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| || ||||||||||||||||||||||||||| | |||||| | || || Sbjct: 37530507 agatgtcgtttcgtagcatagttcgcgatgtccgggatggttttggaagcttgtcaagaa 37530566 Query: 382 ggagcttcgaggtgacc 398 ||||||| ||||||||| Sbjct: 37530567 ggagctttgaggtgacc 37530583 Score = 44.1 bits (22), Expect = 0.47 Identities = 34/38 (89%) Strand = Plus / Plus Query: 489 gagagccgctgggctagcctcccgccggaactcctccg 526 |||||||||||||| || || ||||| ||||||||||| Sbjct: 37530674 gagagccgctgggcaagtcttccgcccgaactcctccg 37530711
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0505D12 Length = 146951 Score = 73.8 bits (37), Expect = 5e-10 Identities = 67/77 (87%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| || ||||||||||||||||||||||||||| | |||||| | || || Sbjct: 125044 agatgtcgtttcgtagcatagttcgcgatgtccgggatggttttggaagcttgtcaagaa 125103 Query: 382 ggagcttcgaggtgacc 398 ||||||| ||||||||| Sbjct: 125104 ggagctttgaggtgacc 125120 Score = 44.1 bits (22), Expect = 0.47 Identities = 34/38 (89%) Strand = Plus / Plus Query: 489 gagagccgctgggctagcctcccgccggaactcctccg 526 |||||||||||||| || || ||||| ||||||||||| Sbjct: 125211 gagagccgctgggcaagtcttccgcccgaactcctccg 125248
>dbj|AK102221.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087L15, full insert sequence Length = 1994 Score = 73.8 bits (37), Expect = 5e-10 Identities = 67/77 (87%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| || ||||||||||||||||||||||||||| | |||||| | || || Sbjct: 369 agatgtcgtttcgtagcatagttcgcgatgtccgggatggttttggaagcttgtcaagaa 428 Query: 382 ggagcttcgaggtgacc 398 ||||||| ||||||||| Sbjct: 429 ggagctttgaggtgacc 445 Score = 44.1 bits (22), Expect = 0.47 Identities = 34/38 (89%) Strand = Plus / Plus Query: 489 gagagccgctgggctagcctcccgccggaactcctccg 526 |||||||||||||| || || ||||| ||||||||||| Sbjct: 536 gagagccgctgggcaagtcttccgcccgaactcctccg 573
>ref|NM_190757.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1347 Score = 69.9 bits (35), Expect = 8e-09 Identities = 65/75 (86%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 |||||||| || ||||||||||||||||||||||||||| | |||||| | || || || Sbjct: 1 atgtcgtttcgtagcatagttcgcgatgtccgggatggttttggaagcttgtcaagaagg 60 Query: 384 agcttcgaggtgacc 398 ||||| ||||||||| Sbjct: 61 agctttgaggtgacc 75 Score = 44.1 bits (22), Expect = 0.47 Identities = 34/38 (89%) Strand = Plus / Plus Query: 489 gagagccgctgggctagcctcccgccggaactcctccg 526 |||||||||||||| || || ||||| ||||||||||| Sbjct: 166 gagagccgctgggcaagtcttccgcccgaactcctccg 203
>dbj|AK069622.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023023F15, full insert sequence Length = 2023 Score = 65.9 bits (33), Expect = 1e-07 Identities = 150/189 (79%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggc 381 |||||||||| |||||||| ||||| ||||| ||||| || | || ||||| ||||||| Sbjct: 342 agatgtcgtttcgcagcattgttcgtgatgttagggatagttttggtagcctgtcgaggc 401 Query: 382 ggagcttcgaggtgaccatctccggcctgtccggtctcaccggccaccacaggggcaagc 441 | ||||| ||||| ||| | | || || || || || ||||||||||| || |||||| Sbjct: 402 gaagctttgaggtcaccctggctggtctatcggggcttaccggccaccatagaggcaagt 461 Query: 442 accagagcacggtgcatgagctccgcgacgccgacctcatagtgcaggagagccgctggg 501 ||||| ||||| || |||||| | || || || |||||| | |||||||| || |||| Sbjct: 462 ctcagagtacggttcacgagctctgtgatgcagatctcataatccaggagagtcgttggg 521 Query: 502 ctagcctcc 510 ||||||||| Sbjct: 522 ctagcctcc 530
>ref|NM_106341.2| Arabidopsis thaliana phosphoric diester hydrolase/ transcription factor AT1G76900 transcript variant AT1G76900.1 mRNA, complete cds Length = 1609 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 74 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 133 Query: 384 agcttcga 391 || ||||| Sbjct: 134 agtttcga 141
>ref|NM_179563.1| Arabidopsis thaliana phosphoric diester hydrolase/ transcription factor AT1G76900 transcript variant AT1G76900.2 mRNA, complete cds Length = 1708 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 173 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 232 Query: 384 agcttcga 391 || ||||| Sbjct: 233 agtttcga 240
>gb|AF487267.1| Arabidopsis thaliana tubby-like protein TULP1 (TULP1) mRNA, complete cds Length = 1368 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 1 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 60 Query: 384 agcttcga 391 || ||||| Sbjct: 61 agtttcga 68
>gb|AC002291.1| Arabidopsis thaliana chromosome I BAC F22K20 genomic sequence, complete sequence Length = 96642 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 1692 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 1751 Query: 384 agcttcga 391 || ||||| Sbjct: 1752 agtttcga 1759
>gb|AY139758.1| Arabidopsis thaliana At1g76900/F7O12_7 mRNA, complete cds Length = 1642 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 172 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 231 Query: 384 agcttcga 391 || ||||| Sbjct: 232 agtttcga 239
>emb|BX814933.1|CNS0ADX5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS19ZH06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1643 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 140 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 199 Query: 384 agcttcga 391 || ||||| Sbjct: 200 agtttcga 207
>emb|BX813680.1|CNS0AAJU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1615 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 58 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 117 Query: 384 agcttcga 391 || ||||| Sbjct: 118 agtttcga 125
>gb|AC079283.4|AC079283 Arabidopsis thaliana chromosome 1 BAC F7O12 genomic sequence, complete sequence Length = 39456 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 36148 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 36207 Query: 384 agcttcga 391 || ||||| Sbjct: 36208 agtttcga 36215
>gb|BT003039.1| Arabidopsis thaliana At1g76900/F7O12_7 gene, complete cds Length = 1368 Score = 48.1 bits (24), Expect = 0.030 Identities = 57/68 (83%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatggtatcggaagcctctcgaggcgg 383 ||||||||||| ||||||||||| ||||| | ||| |||| ||||| || |||||||| Sbjct: 1 atgtcgttccgtagcatagttcgtgatgtgagagatagtataggaagtctatcgaggcgt 60 Query: 384 agcttcga 391 || ||||| Sbjct: 61 agtttcga 68
>dbj|AP004525.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT08O18, TM0052b, complete sequence Length = 86497 Score = 44.1 bits (22), Expect = 0.47 Identities = 34/38 (89%) Strand = Plus / Minus Query: 324 atgtcgttccgcagcatagttcgcgatgtccgggatgg 361 ||||| ||||||||||||||||| ||||| ||||||| Sbjct: 77292 atgtcattccgcagcatagttcgtgatgtaagggatgg 77255
>gb|AC110234.11| Mus musculus chromosome 5, clone RP23-76J15, complete sequence Length = 235276 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 483 gtgcaggagagccgctgggct 503 ||||||||||||||||||||| Sbjct: 162795 gtgcaggagagccgctgggct 162815
>gb|AC163344.2| Mus musculus BAC clone RP24-66I20 from chromosome 9, complete sequence Length = 221000 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 gtgatctgtaatccctgttcctcaa 194 ||||||| ||||||||||||||||| Sbjct: 151335 gtgatctttaatccctgttcctcaa 151359
>emb|AJ245900.1|OSA245900 Oryza sativa chromosome 4 BAC q3037-207F1 complete genome Length = 124321 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 101276 agatgtctttccgcagcatagttcg 101252
>gb|AC161419.2| Mus musculus BAC clone RP23-405I13 from chromosome 9, complete sequence Length = 213468 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 170 gtgatctgtaatccctgttcctcaa 194 ||||||| ||||||||||||||||| Sbjct: 155277 gtgatctttaatccctgttcctcaa 155253
>gb|AF497437.1| Gossypium hirsutum clone T1F08 unknown chloroplast sequence Length = 446 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Plus Query: 324 atgtcgttccgcagcatagttcgcgatgt 352 ||||||||||| ||||||||||| ||||| Sbjct: 273 atgtcgttccgtagcatagttcgtgatgt 301
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 35211774 agatgtctttccgcagcatagttcg 35211798
>dbj|AK104333.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-G06, full insert sequence Length = 1800 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 118 agatgtctttccgcagcatagttcg 142
>dbj|AK098928.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023N16, full insert sequence Length = 1826 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 154 agatgtctttccgcagcatagttcg 178
>dbj|AK066910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091C11, full insert sequence Length = 1824 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 156 agatgtctttccgcagcatagttcg 180
>dbj|AK062547.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G09, full insert sequence Length = 684 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 149 agatgtctttccgcagcatagttcg 173
>emb|AL732348.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0701F11, complete sequence Length = 82895 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 55771 agatgtctttccgcagcatagttcg 55795
>emb|AL606637.3|OSJN00076 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0039K24, complete sequence Length = 173770 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcg 346 ||||||| ||||||||||||||||| Sbjct: 7620 agatgtctttccgcagcatagttcg 7644
>gb|AC120988.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017N18, complete sequence Length = 156643 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 510 ccgccggaactcctccgcgacgtc 533 ||||||||||||||||||| |||| Sbjct: 141618 ccgccggaactcctccgcgtcgtc 141595
>gb|AC098573.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_G11, complete sequence Length = 112796 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 510 ccgccggaactcctccgcgacgtc 533 ||||||||||||||||||| |||| Sbjct: 32539 ccgccggaactcctccgcgtcgtc 32516
>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis gene cluster, partial sequence Length = 103450 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 ccacccgaggcggcggcacggccg 53 ||||||||||| |||||||||||| Sbjct: 81358 ccacccgaggcagcggcacggccg 81381
>emb|AL050316.15|HSDJ911I5 Human DNA sequence from clone RP5-911I5 on chromosome 20q13.11-13.2 Contains ESTs, STSs and GSSs, complete sequence Length = 72289 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 ttgcttgttcacctcgccac 284 |||||||||||||||||||| Sbjct: 10227 ttgcttgttcacctcgccac 10208
>gb|AF312913.1|AF312913 Homo sapiens chromosome 20 clone h119, complete sequence Length = 122951 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 ttgcttgttcacctcgccac 284 |||||||||||||||||||| Sbjct: 77580 ttgcttgttcacctcgccac 77599
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 7.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcga 349 ||||||||||||||||||| || ||||| Sbjct: 3216491 agatgtcgttccgcagcattgtccgcga 3216464
>gb|AC160949.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0006E22, complete sequence Length = 128256 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 caatccttgccctgttaccg 170 |||||||||||||||||||| Sbjct: 36083 caatccttgccctgttaccg 36064
>dbj|BA000004.3| Bacillus halodurans C-125 DNA, complete genome Length = 4202352 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 116 gttgattattgcttccgtctagaa 139 ||||||| |||||||||||||||| Sbjct: 2291160 gttgattgttgcttccgtctagaa 2291183
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 388 tcgaggtgaccatctccggc 407 |||||||||||||||||||| Sbjct: 147443 tcgaggtgaccatctccggc 147462
>dbj|AK110257.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-A09, full insert sequence Length = 1164 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 ccgccggaactcctccgcgacgtc 533 ||||||||||||||||||| |||| Sbjct: 200 ccgccggaactcctccgcgtcgtc 223
>dbj|AK108181.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-140-A12, full insert sequence Length = 1297 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 510 ccgccggaactcctccgcgacgtc 533 ||||||||||||||||||| |||| Sbjct: 843 ccgccggaactcctccgcgtcgtc 820
>dbj|AK102298.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033089L13, full insert sequence Length = 1941 Score = 40.1 bits (20), Expect = 7.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcga 349 ||||||||||||||||||| || ||||| Sbjct: 173 agatgtcgttccgcagcattgtccgcga 200
>emb|AL049839.3|CNS0000J Human chromosome 14 DNA sequence BAC R-986E7 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 214527 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 ttcttccagctttgcttgtt 273 |||||||||||||||||||| Sbjct: 81925 ttcttccagctttgcttgtt 81906
>gb|AC006199.1|AC006199 Homo sapiens, clone hRPK.13_A_1, complete sequence Length = 164682 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 tgtacaagttgattattgct 128 |||||||||||||||||||| Sbjct: 2795 tgtacaagttgattattgct 2776
>emb|AJ628018.2| Streptomyces sp. SCC 2136 deoxysugar biosynthetic gene cluster Length = 77550 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 cgaggcggcggcacggccgc 54 |||||||||||||||||||| Sbjct: 61373 cgaggcggcggcacggccgc 61354
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 7.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcga 349 ||||||||||||||||||| || ||||| Sbjct: 3216436 agatgtcgttccgcagcattgtccgcga 3216409
>emb|AL713936.4|CNS07YPH Oryza sativa chromosome 12, . BAC OJ1057_G11 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 109081 Score = 40.1 bits (20), Expect = 7.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 322 agatgtcgttccgcagcatagttcgcga 349 ||||||||||||||||||| || ||||| Sbjct: 6877 agatgtcgttccgcagcattgtccgcga 6850
>emb|AL713906.3|CNS07YQ6 Oryza sativa chromosome 12, . BAC OJ1587_D05 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 90756 Score = 40.1 bits (20), Expect = 7.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 322 agatgtcgttccgcagcatagttcgcga 349 ||||||||||||||||||| || ||||| Sbjct: 1173 agatgtcgttccgcagcattgtccgcga 1200
>emb|AL627186.13| Mouse DNA sequence from clone RP23-413I9 on chromosome 4, complete sequence Length = 180246 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 142 actccagagcaatccttgcc 161 |||||||||||||||||||| Sbjct: 62075 actccagagcaatccttgcc 62094 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,004,426 Number of Sequences: 3902068 Number of extensions: 3004426 Number of successful extensions: 53685 Number of sequences better than 10.0: 52 Number of HSP's better than 10.0 without gapping: 53 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 53396 Number of HSP's gapped (non-prelim): 289 length of query: 546 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 523 effective length of database: 17,143,297,704 effective search space: 8965944699192 effective search space used: 8965944699192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
