ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart21h11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_675650.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 0.92
2gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 38 3.6
3ref|XM_366446.1| Magnaporthe grisea 70-15 hypothetical protein (... 38 3.6
4gb|CP000243.1| Escherichia coli UTI89, complete genome 38 3.6
5gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 38 3.6
6dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 38 3.6
7gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 38 3.6
8gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 38 3.6
9dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 38 3.6
10gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 38 3.6
11gb|U28377.1|ECU28377 Escherichia coli K-12 genome; approximately... 38 3.6
12gb|CP000036.1| Shigella boydii Sb227, complete genome 38 3.6
13gb|CP000038.1| Shigella sonnei Ss046, complete genome 38 3.6

>ref|XM_675650.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7473.2), mRNA
          Length = 2427

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 51   tctgcccaccccggacgttg 70
            ||||||||||||||||||||
Sbjct: 1137 tctgcccaccccggacgttg 1156



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3153400 gatcatgccgatgccgttg 3153418



to top

>ref|XM_366446.1| Magnaporthe grisea 70-15 hypothetical protein (MG10664.4) partial
           mRNA
          Length = 2865

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  atgccgatgccgttgctga 35
           |||||||||||||||||||
Sbjct: 145 atgccgatgccgttgctga 127



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3368552 gatcatgccgatgccgttg 3368570



to top

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3155981 gatcatgccgatgccgttg 3155999



to top

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3156615 gatcatgccgatgccgttg 3156633



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3142063 gatcatgccgatgccgttg 3142081



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3965626 gatcatgccgatgccgttg 3965644



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3898312 gatcatgccgatgccgttg 3898330



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 2988070 gatcatgccgatgccgttg 2988052



to top

>gb|U28377.1|ECU28377 Escherichia coli K-12 genome; approximately 65 to 68 minutes
          Length = 141744

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     gatcatgccgatgccgttg 31
              |||||||||||||||||||
Sbjct: 112344 gatcatgccgatgccgttg 112362



to top

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3008921 gatcatgccgatgccgttg 3008939



to top

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 13      gatcatgccgatgccgttg 31
               |||||||||||||||||||
Sbjct: 3314286 gatcatgccgatgccgttg 3314304


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 572,745
Number of Sequences: 3902068
Number of extensions: 572745
Number of successful extensions: 35685
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35323
Number of HSP's gapped (non-prelim): 362
length of query: 86
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 65
effective length of database: 17,151,101,840
effective search space: 1114821619600
effective search space used: 1114821619600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top