ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart21f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_191286.1| Oryza sativa (japonica cultivar-group), predic... 287 2e-74
2dbj|AK102373.1| Oryza sativa (japonica cultivar-group) cDNA clon... 287 2e-74
3dbj|AK060989.1| Oryza sativa (japonica cultivar-group) cDNA clon... 287 2e-74
4gb|AY108251.1| Zea mays PCO077043 mRNA sequence 252 1e-63
5gb|AY596543.1| Saccharum officinarum clone SCCCCL4007B07, comple... 248 2e-62
6ref|NM_193187.1| Oryza sativa (japonica cultivar-group), predic... 210 4e-51
7dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 137 5e-29
8dbj|AP003350.3| Oryza sativa (japonica cultivar-group) genomic D... 137 5e-29
9dbj|AP003375.2| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
10gb|AC108944.4| Mus musculus BAC clone RP23-114I22 from chromosom... 48 0.032
11gb|BC083830.1| Rattus norvegicus receptor accessory protein 6, m... 48 0.032
12gb|AC132267.3| Mus musculus BAC clone RP24-393E11 from chromosom... 48 0.032
13ref|NM_001013218.1| Rattus norvegicus receptor accessory protein... 48 0.032
14gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 46 0.13
15gb|AC099533.36| Pan troglodytes clone rp43-41g5, complete sequence 46 0.13
16dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 46 0.13
17gb|AC093571.13| Pan troglodytes clone rp43-118h18, complete sequ... 46 0.13
18gb|AC138019.26| Papio anubis clone rp41-133b2, complete sequence 46 0.13
19gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 46 0.13
20gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.13
21gb|AC012331.9| Homo sapiens chromosome 22 clone b41c4 map 22q11,... 46 0.13
22gb|AC000051.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 31f3... 46 0.13
23gb|AC002308.1| Homo sapiens Chromosome 22q11.2 BAC Clone 1000e4 ... 46 0.13
24gb|U14003.1|ECOUW93 Escherichia coli K-12 chromosomal region fro... 46 0.13
25ref|NG_000002.1| Homo sapiens immunoglobulin lambda locus (IGL@)... 46 0.13
26gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 46 0.13
27dbj|D87002.1| Homo sapiens immunoglobulin lambda gene locus DNA,... 46 0.13
28gb|AC155074.12| Mus musculus chromosome 15, clone RP24-127H11, c... 44 0.50
29ref|XM_533927.2| PREDICTED: Canis familiaris similar to Variable... 44 0.50
30ref|XM_845051.1| PREDICTED: Canis familiaris hypothetical protei... 44 0.50
31gb|BC016203.1| Mus musculus SHANK-associated RH domain interacti... 44 0.50
32gb|BC055758.1| Mus musculus SHANK-associated RH domain interacti... 44 0.50
33gb|CP000316.1| Polaromonas sp. JS666, complete genome 44 0.50
34gb|AC133198.3| Mus musculus BAC clone RP23-251I6 from chromosome... 44 0.50
35gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 44 0.50
36gb|AC093573.17| Pan troglodytes clone rp43-32j20, complete sequence 44 0.50
37dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 44 0.50
38dbj|AK165824.1| Mus musculus 11 days embryo spinal cord cDNA, RI... 44 0.50
39dbj|AK171774.1| Mus musculus activated spleen cDNA, RIKEN full-l... 44 0.50
40dbj|AK002878.1| Mus musculus adult male kidney cDNA, RIKEN full-... 44 0.50
41gb|AC008132.35| Homo sapiens chromosome 22 clone pac995o6 map 22... 44 0.50
42gb|AC023491.23| Homo sapiens chromosome 22 clone b659m11 map 22q... 44 0.50
43gb|AC008018.20| Homo sapiens chromosome 22 clone b379n11 map 22q... 44 0.50
44gb|AC023490.5| Homo sapiens chromosome 22 clone b33l19 map 22q11... 44 0.50
45gb|AC007981.47| Homo sapiens chromosome 22 clone b291 map 22q11,... 44 0.50
46gb|AC011718.2| Homo sapiens chromosome 22 clone b2280l11 map 22q... 44 0.50
47gb|AC012330.10| Homo sapiens clone b2262a2, complete sequence 44 0.50
48gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosom... 44 0.50
49dbj|AK180163.1| Mus musculus cDNA, clone:Y0G0113C14, strand:minu... 44 0.50
50dbj|AK178398.1| Mus musculus cDNA, clone:Y0G0106I18, strand:minu... 44 0.50
51emb|AL356585.7| Human DNA sequence from clone RP11-341D18 on chr... 44 0.50
52gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 m... 44 0.50
53gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 44 0.50
54emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14,... 44 0.50
55gb|AC132327.3| Mus musculus BAC clone RP24-194O6 from 3, complet... 44 0.50
56gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosom... 44 0.50
57dbj|AP000550.1| Homo sapiens genomic DNA, chromosome 22q11.2, BC... 44 0.50
58gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome ... 42 2.0
59ref|NM_171846.1| Homo sapiens lactamase, beta (LACTB), nuclear g... 42 2.0
60ref|NM_032857.2| Homo sapiens lactamase, beta (LACTB), nuclear g... 42 2.0
61gb|BC037198.1| Homo sapiens lactamase, beta, mRNA (cDNA clone MG... 42 2.0
62ref|XM_869699.1| PREDICTED: Bos taurus similar to Tumor necrosis... 42 2.0
63gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 2.0
64gb|AC107740.17| Mus musculus chromosome 9, clone RP23-340D4, com... 42 2.0
65gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome... 42 2.0
66gb|AC078834.5| Homo sapiens BAC clone RP11-69O3 from 7, complete... 42 2.0
67gb|AC139341.3| Atelerix albiventris clone LB4-464N6, complete se... 42 2.0
68gb|AC134570.5| Mus musculus BAC clone RP24-252B18 from chromosom... 42 2.0
69gb|AC107755.12| Mus musculus chromosome 9, clone RP23-225C11, co... 42 2.0
70gb|AC126255.3| Mus musculus BAC clone RP24-218F22 from chromosom... 42 2.0
71gb|AC104133.5| Homo sapiens BAC clone RP11-451N23 from 7, comple... 42 2.0
72ref|XM_860226.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
73ref|XM_535333.2| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
74ref|XM_860193.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
75ref|XM_860176.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
76ref|XM_860159.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
77ref|XM_860145.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
78ref|XM_860124.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
79ref|XM_860105.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
80ref|XM_860089.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
81ref|XM_847075.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
82ref|XM_860048.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
83ref|XM_860027.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
84ref|XM_860010.1| PREDICTED: Canis familiaris similar to pumilio ... 42 2.0
85gb|AY358709.1| Homo sapiens clone DNA76522 MRPL56 (UNQ843) mRNA,... 42 2.0
86gb|AC091507.2| Sus scrofa clone RP44-397B10, complete sequence 42 2.0
87emb|AL133466.22| Human DNA sequence from clone RP5-831C21 on chr... 42 2.0
88emb|AL645943.19| Mouse DNA sequence from clone RP23-130E22 on ch... 42 2.0
89gb|BC067288.1| Homo sapiens lactamase, beta, transcript variant ... 42 2.0
90gb|AC051635.7| Homo sapiens chromosome 18, clone RP11-540A4, com... 42 2.0
91emb|CR617302.1| full-length cDNA clone CS0DM007YF16 of Fetal liv... 42 2.0
92gb|AC096630.16| Pan troglodytes clone rp43-71g16, complete sequence 42 2.0
93emb|CR602675.1| full-length cDNA clone CS0DI074YB20 of Placenta ... 42 2.0
94dbj|AK027808.1| Homo sapiens cDNA FLJ14902 fis, clone PLACE1005467 42 2.0
95emb|CR591560.1| full-length cDNA clone CS0DJ011YB05 of T cells (... 42 2.0
96ref|XM_928119.1| PREDICTED: Homo sapiens similar to gamma-glutam... 42 2.0
97gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 42 2.0
98gb|AC159204.2| Mus musculus BAC clone RP23-229H13 from chromosom... 42 2.0
99gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.0
100gb|AC008124.8|AC008124 Homo sapiens Chromosome 12q13-62.7-72 BAC... 42 2.0
101dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
102gb|AC087612.6| Homo sapiens chromosome 15, clone RP11-69G7, comp... 42 2.0
103ref|XM_342928.2| PREDICTED: Rattus norvegicus pumilio 1 (Drosoph... 42 2.0
104dbj|AK120039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
105dbj|AK072653.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
106gb|AC132271.5| Mus musculus BAC clone RP24-338E23 from 5, comple... 42 2.0
107dbj|AK064058.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
108gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
109emb|AL831797.4|CNS08CAA Oryza sativa chromosome 12, . BAC OSJNBa... 42 2.0
110gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, comple... 42 2.0
111emb|BX004852.5| Mouse DNA sequence from clone RP23-26D22 on chro... 42 2.0
112emb|AL513468.9| Mouse DNA sequence from clone RP23-104I6 on chro... 42 2.0
113emb|AL645853.12| Mouse DNA sequence from clone RP23-329L1 on chr... 42 2.0
114gb|AY542376.1| Ambystoma mexicanum POU domain transcription fact... 40 7.9
115ref|XM_511829.1| PREDICTED: Pan troglodytes similar to KIAA0672 ... 40 7.9
116gb|AC167720.2| Mus musculus BAC clone RP24-216G15 from chromosom... 40 7.9
117ref|XM_465807.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.9
118ref|NM_001031031.1| Gallus gallus B-cell CLL/lymphoma 11A (zinc ... 40 7.9
119gb|AC153633.10| Mus musculus 6 BAC RP23-13K24 (Roswell Park Canc... 40 7.9
120gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 40 7.9
121gb|AF218784.1| Gallus gallus MHC Rfp-Y class I alpha chain (YFVI... 40 7.9
122gb|AC153878.11| Mus musculus 6 BAC RP23-229B22 (Roswell Park Can... 40 7.9
123gb|AC102856.5| Mus musculus chromosome 8, clone RP24-500H8, comp... 40 7.9
124gb|AC131976.6| Mus musculus chromosome 1, clone RP24-150D10, com... 40 7.9
125gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, com... 40 7.9
126gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 40 7.9
127gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosom... 40 7.9
128ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) ... 40 7.9
129gb|AC138682.14| Mus musculus chromosome 5, clone RP23-34L23, com... 40 7.9
130gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.9
131gb|AC138904.3| Homo sapiens chromosome 16 clone RP11-57A19, comp... 40 7.9
132emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 7.9
133gb|AC026238.2| Arabidopsis thaliana chromosome I BAC F25I16 geno... 40 7.9
134gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom... 40 7.9
135gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosom... 40 7.9
136gb|AC112791.3| Mus musculus BAC clone RP23-182O1 from 13, comple... 40 7.9
137gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complet... 40 7.9
138ref|XM_863609.1| PREDICTED: Canis familiaris hypothetical protei... 40 7.9
139gb|AC114737.3| Homo sapiens BAC clone CTD-2192D1 from 7, complet... 40 7.9
140gb|AC117600.9| Mus musculus chromosome 1, clone RP23-449C20, com... 40 7.9
141gb|DQ103310.1| Phytophthora ramorum clone F07,11A microsatellite... 40 7.9
142gb|CP000243.1| Escherichia coli UTI89, complete genome 40 7.9
143gb|BC094754.1| Homo sapiens KIAA0672 gene product, mRNA (cDNA cl... 40 7.9
144emb|AL158829.14| Human DNA sequence from clone RP11-406O23 on ch... 40 7.9
145gb|AC084794.3| Homo sapiens chromosome 16 clone CTA-154B9, compl... 40 7.9
146gb|AC026454.5| Homo sapiens chromosome 16 clone CTD-2597E15, com... 40 7.9
147ref|XM_774988.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.9
148emb|BX842580.1| Mycobacterium tuberculosis H37Rv complete genome... 40 7.9
149emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genom... 40 7.9
150gb|BC070074.1| Homo sapiens KIAA0672 gene product, mRNA (cDNA cl... 40 7.9
151emb|AL645988.6| Mouse DNA sequence from clone RP23-67J22 on chro... 40 7.9
152emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,... 40 7.9
153emb|AL096728.1|HSM800662 Homo sapiens mRNA; cDNA DKFZp434B034 (f... 40 7.9
154emb|AJ851441.1| Gallus gallus mRNA for hypothetical protein, clo... 40 7.9
155emb|AL731728.10| Mouse DNA sequence from clone RP24-531N10 on ch... 40 7.9
156ref|NM_204769.1| Gallus gallus visual system homeobox 1 homolog,... 40 7.9
157emb|BX546502.7| Zebrafish DNA sequence from clone RP71-62P22 in ... 40 7.9
158gb|AC009374.7| Drosophila melanogaster 3L BAC RP98-4J11 (Roswell... 40 7.9
159gb|AF033106.1| Grus canadensis pratensis MHC class I heavy chain... 40 7.9
160gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 7.9
161gb|AC021553.14| Homo sapiens chromosome 15, clone RP11-709B3, co... 40 7.9
162gb|AC020980.6| Homo sapiens chromosome 5 clone RPCI-1_167G20, co... 40 7.9
163gb|AC083800.13| Homo sapiens 3q BAC RP11-484M3 (Roswell Park Can... 40 7.9
164gb|AC097512.2| Homo sapiens BAC clone RP11-412P11 from 4, comple... 40 7.9
165gb|AC160395.2| Mus musculus BAC clone RP23-36C19 from chromosome... 40 7.9
166gb|AC158242.4| Pan troglodytes BAC clone CH251-354C10 from chrom... 40 7.9
167gb|AC164093.2| Mus musculus BAC clone RP23-131O16 from chromosom... 40 7.9
168gb|AC016074.6| Homo sapiens, clone RP11-697B24, complete sequence 40 7.9
169dbj|AK036393.1| Mus musculus adult male bone cDNA, RIKEN full-le... 40 7.9
170gb|AC067837.6| Homo sapiens chromosome 15, clone RP11-65B16, com... 40 7.9
171gb|AC159282.2| Mus musculus BAC clone RP23-329M17 from chromosom... 40 7.9
172gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, r... 40 7.9
173gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, r... 40 7.9
174dbj|AK053710.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 7.9
175dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
176dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
177dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
178dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
179gb|AC009725.12|AC009725 Mus musculus chromosome , clone CT7-388N... 40 7.9
180gb|AE009539.1| Brucella melitensis 16M chromosome I, section 96 ... 40 7.9
181gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.9
182dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 7.9
183ref|XM_573925.1| PREDICTED: Rattus norvegicus similar to RGD1310... 40 7.9
184gb|AC124283.11| Homo sapiens chromosome 17, clone RP13-638C3, co... 40 7.9
185gb|AC079130.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.9
186gb|AC131102.3| Mus musculus BAC clone RP23-101H16 from chromosom... 40 7.9
187gb|AC011547.4|AC011547 Homo sapiens chromosome 19 clone LLNLR-27... 40 7.9
188dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
189dbj|AP004880.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
190dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 7.9
191gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 40 7.9
192ref|NM_014859.3| Homo sapiens KIAA0672 gene product (KIAA0672), ... 40 7.9
193dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
194dbj|AP004086.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.9
195emb|AL772166.15| Mouse DNA sequence from clone RP23-413I12 on ch... 40 7.9
196dbj|AB014572.1| Homo sapiens mRNA for KIAA0672 protein, partial cds 40 7.9
197gb|AF178670.1|AF178670 Gallus gallus homeobox protein Chx10-1 (c... 40 7.9
198emb|AJ325171.1|HSA325171 Homo sapiens genomic sequence surroundi... 40 7.9
199gb|AC148872.2| Chlamydomonas reinhardtii clone cr-25P21, complet... 40 7.9
200gb|AC113288.7| Mus musculus chromosome 5, clone RP23-414I12, com... 40 7.9
201gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52... 40 7.9
202gb|AE003524.5| Drosophila melanogaster chromosome 3L, section 61... 40 7.9
203dbj|AP002342.3| Homo sapiens genomic DNA, chromosome 11q clone:C... 40 7.9
204dbj|AP003731.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 7.9
205gb|BC089954.1| Rattus norvegicus similar to 2310043K02Rik protei... 40 7.9
206gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 7.9
207ref|NM_001012352.1| Rattus norvegicus similar to 2310043K02Rik p... 40 7.9
208gb|AC005277.1|AC005277 Homo sapiens chromosome 17, clone hRPK.59... 40 7.9
209dbj|AP005626.2| Homo sapiens genomic DNA, chromosome 8q24, clone... 40 7.9
210gb|AC127309.4| Mus musculus BAC clone RP23-296L9 from 9, complet... 40 7.9
211emb|CT010498.7| Mouse DNA sequence from clone RP23-105I10 on chr... 40 7.9
212emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 40 7.9
213gb|L33930.1|HUMCD24B Homo sapiens CD24 signal transducer mRNA, c... 40 7.9
214gb|U00090.1| Rhizobium sp. NGR234 plasmid pNGR234a, complete seq... 40 7.9
215gb|U66059.1| Human germline T-cell receptor beta chain Dopamine-... 40 7.9
216emb|AL935278.7| Mouse DNA sequence from clone RP23-84E1 on chrom... 40 7.9
217gb|AC153922.6| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cance... 40 7.9
218emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chro... 40 7.9
219emb|AL645563.12| Mouse DNA sequence from clone RP23-132L14 on ch... 40 7.9
220emb|AL583893.17| Mouse DNA sequence from clone RP23-189A18 on ch... 40 7.9

>ref|NM_191286.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1200

 Score =  287 bits (145), Expect = 2e-74
 Identities = 317/373 (84%), Gaps = 6/373 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
           |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 23  ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 79

                                                                       
Query: 257 cctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagacagcaccgc 316
           ||||||||||| |||||||||| ||| |||||| ||||||||| || |||||||||||  
Sbjct: 80  cctcggccgctgcggtggaggatggcttgctcagcaatggtgactttgagacagcaccag 139

                                                                       
Query: 317 ctggtggtttcgtcaaatcttcttctgtttcggagggcgcagc---ggtcccaagctgga 373
           |||||||||| ||||||||| |||| ||| | || || ||| |   | ||||  ||||||
Sbjct: 140 ctggtggttttgtcaaatctgcttcagttgctgaaggtgcatcatcgatccctggctgga 199

                                                                       
Query: 374 cgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcatgatcctta 433
           |||||||||| ||||| |||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 200 cgatcaatgggacagtcgagctcatctcagcaggccagcaccagggtggcatgattctta 259

                                                                       
Query: 434 ttgttccacaaggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtgg 493
           |||||||||| ||||||||||| ||||| || || || || ||| | || ||||||||||
Sbjct: 260 ttgttccacagggggatcatgctgtacgtcttggaaacgacgcaagtatagggcaggtgg 319

                                                                       
Query: 494 tgcaggttgagaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgc 553
           ||||||||||||||||||| ||||| || ||||| |||||||| ||||| || || || |
Sbjct: 320 tgcaggttgagaagggctcagagtatgctatcacgttcagtgctgcccgaacgtgtgcac 379

                        
Query: 554 agctggagtcact 566
           |||| ||||||||
Sbjct: 380 agctagagtcact 392



to top

>dbj|AK102373.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091N05, full
           insert sequence
          Length = 1630

 Score =  287 bits (145), Expect = 2e-74
 Identities = 317/373 (84%), Gaps = 6/373 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
           |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 168 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 224

                                                                       
Query: 257 cctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagacagcaccgc 316
           ||||||||||| |||||||||| ||| |||||| ||||||||| || |||||||||||  
Sbjct: 225 cctcggccgctgcggtggaggatggcttgctcagcaatggtgactttgagacagcaccag 284

                                                                       
Query: 317 ctggtggtttcgtcaaatcttcttctgtttcggagggcgcagc---ggtcccaagctgga 373
           |||||||||| ||||||||| |||| ||| | || || ||| |   | ||||  ||||||
Sbjct: 285 ctggtggttttgtcaaatctgcttcagttgctgaaggtgcatcatcgatccctggctgga 344

                                                                       
Query: 374 cgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcatgatcctta 433
           |||||||||| ||||| |||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 345 cgatcaatgggacagtcgagctcatctcagcaggccagcaccagggtggcatgattctta 404

                                                                       
Query: 434 ttgttccacaaggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtgg 493
           |||||||||| ||||||||||| ||||| || || || || ||| | || ||||||||||
Sbjct: 405 ttgttccacagggggatcatgctgtacgtcttggaaacgacgcaagtatagggcaggtgg 464

                                                                       
Query: 494 tgcaggttgagaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgc 553
           ||||||||||||||||||| ||||| || ||||| |||||||| ||||| || || || |
Sbjct: 465 tgcaggttgagaagggctcagagtatgctatcacgttcagtgctgcccgaacgtgtgcac 524

                        
Query: 554 agctggagtcact 566
           |||| ||||||||
Sbjct: 525 agctagagtcact 537



to top

>dbj|AK060989.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C09, full
           insert sequence
          Length = 1626

 Score =  287 bits (145), Expect = 2e-74
 Identities = 317/373 (84%), Gaps = 6/373 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
           |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 169 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 225

                                                                       
Query: 257 cctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagacagcaccgc 316
           ||||||||||| |||||||||| ||| |||||| ||||||||| || |||||||||||  
Sbjct: 226 cctcggccgctgcggtggaggatggcttgctcagcaatggtgactttgagacagcaccag 285

                                                                       
Query: 317 ctggtggtttcgtcaaatcttcttctgtttcggagggcgcagc---ggtcccaagctgga 373
           |||||||||| ||||||||| |||| ||| | || || ||| |   | ||||  ||||||
Sbjct: 286 ctggtggttttgtcaaatctgcttcagttgctgaaggtgcatcatcgatccctggctgga 345

                                                                       
Query: 374 cgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcatgatcctta 433
           |||||||||| ||||| |||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 346 cgatcaatgggacagtcgagctcatctcagcaggccagcaccagggtggcatgattctta 405

                                                                       
Query: 434 ttgttccacaaggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtgg 493
           |||||||||| ||||||||||| ||||| || || || || ||| | || ||||||||||
Sbjct: 406 ttgttccacagggggatcatgctgtacgtcttggaaacgacgcaagtatagggcaggtgg 465

                                                                       
Query: 494 tgcaggttgagaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgc 553
           ||||||||||||||||||| ||||| || ||||| |||||||| ||||| || || || |
Sbjct: 466 tgcaggttgagaagggctcagagtatgctatcacgttcagtgctgcccgaacgtgtgcac 525

                        
Query: 554 agctggagtcact 566
           |||| ||||||||
Sbjct: 526 agctagagtcact 538



to top

>gb|AY108251.1| Zea mays PCO077043 mRNA sequence
          Length = 1664

 Score =  252 bits (127), Expect = 1e-63
 Identities = 276/325 (84%), Gaps = 3/325 (0%)
 Strand = Plus / Plus

                                                                       
Query: 249 ccgcctggcctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagac 308
           ||||| ||||||||| |||||||||||||| |||||||||| ||||||||| || |||||
Sbjct: 304 ccgcccggcctcggcggctccggtggaggatggcctgctcagcaatggtgactttgagac 363

                                                                       
Query: 309 agcaccgcctggtggtttcgtcaaatcttcttctgtttcggagggcgcagcgg---tccc 365
           ||||||   ||||||||| || |||||| |||||||| | ||||| ||| ||    ||||
Sbjct: 364 agcaccaagtggtggttttgtaaaatctgcttctgttgctgagggtgcatcgtcaatccc 423

                                                                       
Query: 366 aagctggacgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcat 425
             | ||||||||||| || || ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 424 tggttggacgatcaacggcacggttgaactcatttcagcaggccaacaccagggtggcat 483

                                                                       
Query: 426 gatccttattgttccacaaggggatcatgccgtacggctagggaatgatgcaggcattgg 485
           |||||| ||||||||||| ||||| ||||| ||| ||||||||||||||||  || ||||
Sbjct: 484 gatcctgattgttccacagggggaccatgcagtaaggctagggaatgatgctagcgttgg 543

                                                                       
Query: 486 gcaggtggtgcaggttgagaagggctccgagtacgcgatcacattcagtgccgcccggac 545
           |||||||||| | ||||||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 544 gcaggtggtggacgttgagaagggttcggagtatgctatcacattcagtgctgcccggac 603

                                    
Query: 546 ctgcgcgcagctggagtcactgaat 570
            || || || |||||| ||||||||
Sbjct: 604 atgtgcacaactggaggcactgaat 628



to top

>gb|AY596543.1| Saccharum officinarum clone SCCCCL4007B07, complete sequence
          Length = 1774

 Score =  248 bits (125), Expect = 2e-62
 Identities = 271/319 (84%), Gaps = 3/319 (0%)
 Strand = Plus / Plus

                                                                       
Query: 255 ggcctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagacagcacc 314
           ||||||||| |||||||||||||| |||||||||| ||||||||| || |||||||||||
Sbjct: 358 ggcctcggcggctccggtggaggatggcctgctcagcaatggtgactttgagacagcacc 417

                                                                       
Query: 315 gcctggtggtttcgtcaaatcttcttctgtttcggagggcgcagcgg---tcccaagctg 371
               |||||||| || |||||| | |||||| | ||||| ||| ||    ||||  | ||
Sbjct: 418 agtcggtggttttgtaaaatctgcgtctgttgctgagggtgcatcgtcaatccctggttg 477

                                                                       
Query: 372 gacgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcatgatcct 431
           |||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 478 gacgatcaatggcacggttgagctcatttcagcaggccagcaccagggtggcatgatcct 537

                                                                       
Query: 432 tattgttccacaaggggatcatgccgtacggctagggaatgatgcaggcattgggcaggt 491
            ||||||||||| ||||| ||||| ||| ||||||||||||||||  || ||||||||||
Sbjct: 538 gattgttccacagggggaccatgctgtaaggctagggaatgatgctagcgttgggcaggt 597

                                                                       
Query: 492 ggtgcaggttgagaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgc 551
           |||| | |||||||||||||| ||||| || ||||||||||| || ||||| || || ||
Sbjct: 598 ggtggacgttgagaagggctcagagtatgctatcacattcagcgctgcccgaacatgtgc 657

                              
Query: 552 gcagctggagtcactgaat 570
            || |||||| ||||||||
Sbjct: 658 acaactggaggcactgaat 676



to top

>ref|NM_193187.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1017

 Score =  210 bits (106), Expect = 4e-51
 Identities = 215/250 (86%), Gaps = 6/250 (2%)
 Strand = Plus / Plus

                                                                       
Query: 197 ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
           |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 23  ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 79

                                                                       
Query: 257 cctcggccgctccggtggaggacggcctgctcatcaatggtgatttcgagacagcaccgc 316
           ||||||||||| |||||||||| ||| |||||| ||||||||| || |||||||||||  
Sbjct: 80  cctcggccgctgcggtggaggatggcttgctcagcaatggtgactttgagacagcaccag 139

                                                                       
Query: 317 ctggtggtttcgtcaaatcttcttctgtttcggagggcg---cagcggtcccaagctgga 373
           |||||||||| ||||||||| |||| ||| | ||||| |   || || ||||  ||||||
Sbjct: 140 ctggtggttttgtcaaatctgcttcagttgctgagggtgcatcatcgatccctggctgga 199

                                                                       
Query: 374 cgatcaatggaacagttgagctcatttccgcaggccagcaccagggtggcatgatcctta 433
           |||||||||| ||||| |||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 200 cgatcaatgggacagtcgagctcatctcagcaggccagcaccagggtggcatgattctta 259

                     
Query: 434 ttgttccaca 443
           ||||||||||
Sbjct: 260 ttgttccaca 269



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  137 bits (69), Expect = 5e-29
 Identities = 140/163 (85%), Gaps = 3/163 (1%)
 Strand = Plus / Minus

                                                                            
Query: 284      tgctcatcaatggtgatttcgagacagcaccgcctggtggtttcgtcaaatcttcttctg 343
                |||||| ||||||||| || |||||||||||  |||||||||| ||||||||| |||| |
Sbjct: 19127698 tgctcagcaatggtgactttgagacagcaccagctggtggttttgtcaaatctgcttcag 19127639

                                                                            
Query: 344      tttcggagggcgcagc---ggtcccaagctggacgatcaatggaacagttgagctcattt 400
                || | ||||| ||| |   | ||||  |||||||||||||||| ||||| |||||||| |
Sbjct: 19127638 ttgctgagggtgcatcatcgatccctggctggacgatcaatgggacagtcgagctcatct 19127579

                                                           
Query: 401      ccgcaggccagcaccagggtggcatgatccttattgttccaca 443
                | |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 19127578 cagcaggccagcaccagggtggcatgattcttattgttccaca 19127536



 Score =  129 bits (65), Expect = 1e-26
 Identities = 139/163 (85%), Gaps = 3/163 (1%)
 Strand = Plus / Plus

                                                                            
Query: 284      tgctcatcaatggtgatttcgagacagcaccgcctggtggtttcgtcaaatcttcttctg 343
                |||||| ||||||||| || |||||||||||  |||||||||| ||||||||| |||| |
Sbjct: 31745023 tgctcagcaatggtgactttgagacagcaccagctggtggttttgtcaaatctgcttcag 31745082

                                                                            
Query: 344      tttcggagggcgcagc---ggtcccaagctggacgatcaatggaacagttgagctcattt 400
                || | || || ||| |   | ||||  |||||||||||||||| ||||| |||||||| |
Sbjct: 31745083 ttgctgaaggtgcatcatcgatccctggctggacgatcaatgggacagtcgagctcatct 31745142

                                                           
Query: 401      ccgcaggccagcaccagggtggcatgatccttattgttccaca 443
                | |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 31745143 cagcaggccagcaccagggtggcatgattcttattgttccaca 31745185



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                            
Query: 444      aggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtggtgcaggttga 503
                |||||||||||| ||||| || || || || ||| | || ||||||||||||||||||||
Sbjct: 31745282 aggggatcatgctgtacgtcttggaaacgacgcaagtatagggcaggtggtgcaggttga 31745341

                                                                            
Query: 504      gaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgcagctggagtc 563
                ||||||||| ||||| || ||||| |||||||| ||||| || || || ||||| |||||
Sbjct: 31745342 gaagggctcagagtatgctatcacgttcagtgctgcccgaacgtgtgcacagctagagtc 31745401

                   
Query: 564      act 566
                |||
Sbjct: 31745402 act 31745404



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                            
Query: 444      aggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtggtgcaggttga 503
                |||||||||||| ||||| || || || |||||| | || ||||||||||||||||||||
Sbjct: 19127439 aggggatcatgctgtacgtcttggaaacgatgcaagtatagggcaggtggtgcaggttga 19127380

                                                                            
Query: 504      gaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgcagctggagtc 563
                ||||||||| ||||| || ||||| |||||||| ||| | || || || ||||| |||||
Sbjct: 19127379 gaagggctcagagtatgctatcacgttcagtgctgcctgaacgtgtgcacagctagagtc 19127320

                   
Query: 564      act 566
                |||
Sbjct: 19127319 act 19127317



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 72/82 (87%), Gaps = 3/82 (3%)
 Strand = Plus / Plus

                                                                            
Query: 197      ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
                |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 31742718 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 31742774

                                      
Query: 257      cctcggccgctccggtggagga 278
                ||||||||||| ||||||||||
Sbjct: 31742775 cctcggccgctgcggtggagga 31742796



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 72/82 (87%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                            
Query: 197      ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
                |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 19129971 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 19129915

                                      
Query: 257      cctcggccgctccggtggagga 278
                ||||||||||| ||||||||||
Sbjct: 19129914 cctcggccgctgcggtggagga 19129893



to top

>dbj|AP003350.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0702H08
          Length = 166899

 Score =  137 bits (69), Expect = 5e-29
 Identities = 140/163 (85%), Gaps = 3/163 (1%)
 Strand = Plus / Minus

                                                                         
Query: 284   tgctcatcaatggtgatttcgagacagcaccgcctggtggtttcgtcaaatcttcttctg 343
             |||||| ||||||||| || |||||||||||  |||||||||| ||||||||| |||| |
Sbjct: 93115 tgctcagcaatggtgactttgagacagcaccagctggtggttttgtcaaatctgcttcag 93056

                                                                         
Query: 344   tttcggagggcgcagc---ggtcccaagctggacgatcaatggaacagttgagctcattt 400
             || | ||||| ||| |   | ||||  |||||||||||||||| ||||| |||||||| |
Sbjct: 93055 ttgctgagggtgcatcatcgatccctggctggacgatcaatgggacagtcgagctcatct 92996

                                                        
Query: 401   ccgcaggccagcaccagggtggcatgatccttattgttccaca 443
             | |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 92995 cagcaggccagcaccagggtggcatgattcttattgttccaca 92953



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 104/123 (84%)
 Strand = Plus / Minus

                                                                         
Query: 444   aggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtggtgcaggttga 503
             |||||||||||| ||||| || || || |||||| | || ||||||||||||||||||||
Sbjct: 92856 aggggatcatgctgtacgtcttggaaacgatgcaagtatagggcaggtggtgcaggttga 92797

                                                                         
Query: 504   gaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgcagctggagtc 563
             ||||||||| ||||| || ||||| |||||||| ||| | || || || ||||| |||||
Sbjct: 92796 gaagggctcagagtatgctatcacgttcagtgctgcctgaacgtgtgcacagctagagtc 92737

                
Query: 564   act 566
             |||
Sbjct: 92736 act 92734



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 72/82 (87%), Gaps = 3/82 (3%)
 Strand = Plus / Minus

                                                                         
Query: 197   ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
             |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 95388 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 95332

                                   
Query: 257   cctcggccgctccggtggagga 278
             ||||||||||| ||||||||||
Sbjct: 95331 cctcggccgctgcggtggagga 95310



to top

>dbj|AP003375.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1414_E05
          Length = 105222

 Score =  129 bits (65), Expect = 1e-26
 Identities = 139/163 (85%), Gaps = 3/163 (1%)
 Strand = Plus / Plus

                                                                         
Query: 284   tgctcatcaatggtgatttcgagacagcaccgcctggtggtttcgtcaaatcttcttctg 343
             |||||| ||||||||| || |||||||||||  |||||||||| ||||||||| |||| |
Sbjct: 23061 tgctcagcaatggtgactttgagacagcaccagctggtggttttgtcaaatctgcttcag 23120

                                                                         
Query: 344   tttcggagggcgcagc---ggtcccaagctggacgatcaatggaacagttgagctcattt 400
             || | || || ||| |   | ||||  |||||||||||||||| ||||| |||||||| |
Sbjct: 23121 ttgctgaaggtgcatcatcgatccctggctggacgatcaatgggacagtcgagctcatct 23180

                                                        
Query: 401   ccgcaggccagcaccagggtggcatgatccttattgttccaca 443
             | |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 23181 cagcaggccagcaccagggtggcatgattcttattgttccaca 23223



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                         
Query: 444   aggggatcatgccgtacggctagggaatgatgcaggcattgggcaggtggtgcaggttga 503
             |||||||||||| ||||| || || || || ||| | || ||||||||||||||||||||
Sbjct: 23320 aggggatcatgctgtacgtcttggaaacgacgcaagtatagggcaggtggtgcaggttga 23379

                                                                         
Query: 504   gaagggctccgagtacgcgatcacattcagtgccgcccggacctgcgcgcagctggagtc 563
             ||||||||| ||||| || ||||| |||||||| ||||| || || || ||||| |||||
Sbjct: 23380 gaagggctcagagtatgctatcacgttcagtgctgcccgaacgtgtgcacagctagagtc 23439

                
Query: 564   act 566
             |||
Sbjct: 23440 act 23442



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 72/82 (87%), Gaps = 3/82 (3%)
 Strand = Plus / Plus

                                                                         
Query: 197   ggctcgcattgctggggctggggctggcgctgcttctgctggcgccctctcgccgcctgg 256
             |||||||||||||||||||| | ||||  ||||||||||||||||||||   ||  ||||
Sbjct: 20756 ggctcgcattgctggggctgtgcctgggcctgcttctgctggcgccctc---ccatctgg 20812

                                   
Query: 257   cctcggccgctccggtggagga 278
             ||||||||||| ||||||||||
Sbjct: 20813 cctcggccgctgcggtggagga 20834



to top

>gb|AC108944.4| Mus musculus BAC clone RP23-114I22 from chromosome 9, complete sequence
          Length = 198019

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 70    cctcactcccactcccacccccca 93
             ||||||||||||||||||||||||
Sbjct: 31839 cctcactcccactcccacccccca 31816



to top

>gb|BC083830.1| Rattus norvegicus receptor accessory protein 6, mRNA (cDNA clone
            MGC:94922 IMAGE:7112359), complete cds
          Length = 2152

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 206  tgctggggctggggctggcgctgc 229
            ||||||||||||||||||||||||
Sbjct: 1388 tgctggggctggggctggcgctgc 1365



to top

>gb|AC132267.3| Mus musculus BAC clone RP24-393E11 from chromosome 9, complete sequence
          Length = 151285

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 70     cctcactcccactcccacccccca 93
              ||||||||||||||||||||||||
Sbjct: 131155 cctcactcccactcccacccccca 131132



to top

>ref|NM_001013218.1| Rattus norvegicus receptor accessory protein 6 (Reep6), mRNA
          Length = 2152

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 206  tgctggggctggggctggcgctgc 229
            ||||||||||||||||||||||||
Sbjct: 1388 tgctggggctggggctggcgctgc 1365



to top

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 472     gatgcaggcattgggcaggtggt 494
               |||||||||||||||||||||||
Sbjct: 4420587 gatgcaggcattgggcaggtggt 4420609



to top

>gb|AC099533.36| Pan troglodytes clone rp43-41g5, complete sequence
          Length = 226331

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 206    tgctggggctggggctggcgctg 228
              |||||||||||||||||||||||
Sbjct: 147427 tgctggggctggggctggcgctg 147449



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 91117 gctggggctggggctggcgctg 91138



to top

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 472     gatgcaggcattgggcaggtggt 494
               |||||||||||||||||||||||
Sbjct: 4427244 gatgcaggcattgggcaggtggt 4427266



to top

>gb|AC093571.13| Pan troglodytes clone rp43-118h18, complete sequence
          Length = 164807

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 24757 tgctggggctggggctggcgctg 24779



to top

>gb|AC138019.26| Papio anubis clone rp41-133b2, complete sequence
          Length = 204007

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 37248 tgctggggctggggctggcgctg 37226



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 213     gctggggctggcgctgcttctgctggc 239
               |||||||||||||||| ||||||||||
Sbjct: 1155382 gctggggctggcgctgattctgctggc 1155408



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 200     tcgcattgctggggctggggctg 222
               |||||||||||||||||||||||
Sbjct: 1982712 tcgcattgctggggctggggctg 1982690



to top

>gb|AC012331.9| Homo sapiens chromosome 22 clone b41c4 map 22q11, complete sequence
          Length = 143376

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 65896 tgctggggctggggctggcgctg 65874



to top

>gb|AC000051.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 31f3 In IGLC Region,
             complete sequence
          Length = 35687

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 26077 tgctggggctggggctggcgctg 26099



to top

>gb|AC002308.1| Homo sapiens Chromosome 22q11.2 BAC Clone 1000e4 In IGLC Region,
             complete sequence
          Length = 151111

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 51698 tgctggggctggggctggcgctg 51720



to top

>gb|U14003.1|ECOUW93 Escherichia coli K-12 chromosomal region from 92.8 to 00.1 minutes
          Length = 338534

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 472    gatgcaggcattgggcaggtggt 494
              |||||||||||||||||||||||
Sbjct: 113396 gatgcaggcattgggcaggtggt 113418



to top

>ref|NG_000002.1| Homo sapiens immunoglobulin lambda locus (IGL@) on chromosome 22
          Length = 909203

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 206    tgctggggctggggctggcgctg 228
              |||||||||||||||||||||||
Sbjct: 618681 tgctggggctggggctggcgctg 618703



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 472     gatgcaggcattgggcaggtggt 494
               |||||||||||||||||||||||
Sbjct: 4090144 gatgcaggcattgggcaggtggt 4090166



to top

>dbj|D87002.1| Homo sapiens immunoglobulin lambda gene locus DNA, clone:31F3
          Length = 36742

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 206   tgctggggctggggctggcgctg 228
             |||||||||||||||||||||||
Sbjct: 27129 tgctggggctggggctggcgctg 27151



to top

>gb|AC155074.12| Mus musculus chromosome 15, clone RP24-127H11, complete sequence
          Length = 184795

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 203   cattgctggggctggggctggcgctg 228
             ||||||||||||||||||||| ||||
Sbjct: 99820 cattgctggggctggggctggggctg 99795



to top

>ref|XM_533927.2| PREDICTED: Canis familiaris similar to Variable ABnormal morphology
            family member (vab-19), transcript variant 1 (LOC476723),
            mRNA
          Length = 2866

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 207  gctggggctggggctggcgctg 228
            ||||||||||||||||||||||
Sbjct: 1435 gctggggctggggctggcgctg 1414



to top

>ref|XM_845051.1| PREDICTED: Canis familiaris hypothetical protein LOC608134
           (LOC608134), mRNA
          Length = 3231

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 207 gctggggctggggctggcgctg 228
           ||||||||||||||||||||||
Sbjct: 234 gctggggctggggctggcgctg 255



to top

>gb|BC016203.1| Mus musculus SHANK-associated RH domain interacting protein, mRNA
           (cDNA clone MGC:27664 IMAGE:4527839), complete cds
          Length = 1688

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 784 cattgctggggctggggctggggctg 759



to top

>gb|BC055758.1| Mus musculus SHANK-associated RH domain interacting protein, mRNA
           (cDNA clone MGC:67162 IMAGE:6415354), complete cds
          Length = 1914

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 843 cattgctggggctggggctggggctg 818



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 213     gctggggctggcgctgcttctgctgg 238
               |||||||||||||||||| |||||||
Sbjct: 3592226 gctggggctggcgctgctgctgctgg 3592201



to top

>gb|AC133198.3| Mus musculus BAC clone RP23-251I6 from chromosome 17, complete sequence
          Length = 182898

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 82813 gctggggctggggctggcgctg 82792



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 209    tggggctggggctggcgctgct 230
              ||||||||||||||||||||||
Sbjct: 145265 tggggctggggctggcgctgct 145244



to top

>gb|AC093573.17| Pan troglodytes clone rp43-32j20, complete sequence
          Length = 170502

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 12629 gctggggctggggctggcgctg 12608



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 406     ggccagcaccagggtggcatga 427
               ||||||||||||||||||||||
Sbjct: 4269215 ggccagcaccagggtggcatga 4269194



to top

>dbj|AK165824.1| Mus musculus 11 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:G630097P18 product:similar to
           shank-interacting protein [Mus musculus], full insert
           sequence
          Length = 1660

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 623 cattgctggggctggggctggggctg 598



to top

>dbj|AK171774.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830010G21 product:similar to
            shank-interacting protein [Mus musculus], full insert
            sequence
          Length = 1906

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 203  cattgctggggctggggctggcgctg 228
            ||||||||||||||||||||| ||||
Sbjct: 1032 cattgctggggctggggctggggctg 1007



to top

>dbj|AK002878.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610041B22 product:SHARPIN homolog
           [Rattus norvegicus], full insert sequence
          Length = 1303

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 414 cattgctggggctggggctggggctg 389



to top

>gb|AC008132.35| Homo sapiens chromosome 22 clone pac995o6 map 22q11, complete sequence
          Length = 145598

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 59776 gctggggctggggctggcgctg 59755



to top

>gb|AC023491.23| Homo sapiens chromosome 22 clone b659m11 map 22q11, complete sequence
          Length = 150754

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 91272 gctggggctggggctggcgctg 91293



to top

>gb|AC008018.20| Homo sapiens chromosome 22 clone b379n11 map 22q11, complete sequence
          Length = 180884

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 122773 gctggggctggggctggcgctg 122752



to top

>gb|AC023490.5| Homo sapiens chromosome 22 clone b33l19 map 22q11, complete sequence
          Length = 176051

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 28506 gctggggctggggctggcgctg 28485



to top

>gb|AC007981.47| Homo sapiens chromosome 22 clone b291 map 22q11, complete sequence
          Length = 175358

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 54921 gctggggctggggctggcgctg 54900



to top

>gb|AC011718.2| Homo sapiens chromosome 22 clone b2280l11 map 22q11, complete sequence
          Length = 94384

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 11252 gctggggctggggctggcgctg 11273



to top

>gb|AC012330.10| Homo sapiens clone b2262a2, complete sequence
          Length = 105288

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 96488 gctggggctggggctggcgctg 96509



to top

>gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosome 8, complete sequence
          Length = 232127

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 70    cctcactcccactcccaccccccactcttc 99
             ||||||||||||||||| ||||| ||||||
Sbjct: 96874 cctcactcccactcccatccccctctcttc 96903



to top

>dbj|AK180163.1| Mus musculus cDNA, clone:Y0G0113C14, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023211, based on BLAT search
          Length = 458

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 57  cattgctggggctggggctggggctg 32



to top

>dbj|AK178398.1| Mus musculus cDNA, clone:Y0G0106I18, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023211, based on BLAT search
          Length = 209

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 203 cattgctggggctggggctggcgctg 228
           ||||||||||||||||||||| ||||
Sbjct: 56  cattgctggggctggggctggggctg 31



to top

>emb|AL356585.7| Human DNA sequence from clone RP11-341D18 on chromosome 22, complete
             sequence
          Length = 186858

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 207   gctggggctggggctggcgctg 228
             ||||||||||||||||||||||
Sbjct: 77787 gctggggctggggctggcgctg 77766



to top

>gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 map 3, complete sequence
          Length = 210499

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 100378 gctggggctggggctggcgctg 100357



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 431794 gctggggctggggctggcgctg 431815



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 211     gggctggggctggcgctgct 230
               ||||||||||||||||||||
Sbjct: 2501216 gggctggggctggcgctgct 2501235



to top

>emb|BX897734.11| Zebrafish DNA sequence from clone CH211-194J14, complete sequence
          Length = 151729

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 70   cctcactcccactcccaccccc 91
            ||||||||||||||||||||||
Sbjct: 9289 cctcactcccactcccaccccc 9268



to top

>gb|AC132327.3| Mus musculus BAC clone RP24-194O6 from 3, complete sequence
          Length = 174267

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 165804 gctggggctggggctggcgctg 165825



to top

>gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence
          Length = 234363

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 233770 gctggggctggggctggcgctg 233749



to top

>dbj|AP000550.1| Homo sapiens genomic DNA, chromosome 22q11.2, BCRL2 region,
              clone:KB1592A4
          Length = 150724

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 207    gctggggctggggctggcgctg 228
              ||||||||||||||||||||||
Sbjct: 104615 gctggggctggggctggcgctg 104594



to top

>gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome 8, complete sequence
          Length = 212711

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   ctggggctggggctggcgctg 228
             |||||||||||||||||||||
Sbjct: 83405 ctggggctggggctggcgctg 83425



to top

>ref|NM_171846.1| Homo sapiens lactamase, beta (LACTB), nuclear gene encoding
           mitochondrial protein, transcript variant 2, mRNA
          Length = 1388

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 174 gctggggctggggctggcgct 194



to top

>ref|NM_032857.2| Homo sapiens lactamase, beta (LACTB), nuclear gene encoding
           mitochondrial protein, transcript variant 1, mRNA
          Length = 1956

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 174 gctggggctggggctggcgct 194



to top

>gb|BC037198.1| Homo sapiens lactamase, beta, mRNA (cDNA clone MGC:24991
           IMAGE:4780106), complete cds
          Length = 1358

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 148 gctggggctggggctggcgct 168



to top

>ref|XM_869699.1| PREDICTED: Bos taurus similar to Tumor necrosis factor receptor
           superfamily member Fn14 precursor (Fibroblast growth
           factor-inducible immediate-early response protein 14)
           (FGF-inducible 14) (Tweak-receptor) (TweakR)
           (LOC617439), mRNA
          Length = 966

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 206 tgctggggctggggctggcgctgct 230
           |||||||||| ||||||||||||||
Sbjct: 56  tgctggggctcgggctggcgctgct 80



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 247     cgccgcctggcctcggccgct 267
               |||||||||||||||||||||
Sbjct: 1067495 cgccgcctggcctcggccgct 1067515



to top

>gb|AC107740.17| Mus musculus chromosome 9, clone RP23-340D4, complete sequence
          Length = 223066

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 68     cacctcactcccactcccacccccc 92
              |||||||| ||||||||||||||||
Sbjct: 210556 cacctcacccccactcccacccccc 210532



to top

>gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome 5, complete
            sequence
          Length = 198890

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  gcagctggagtcactgaatat 572
            |||||||||||||||||||||
Sbjct: 9802 gcagctggagtcactgaatat 9822



to top

>gb|AC078834.5| Homo sapiens BAC clone RP11-69O3 from 7, complete sequence
          Length = 154737

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 406    ggccagcaccagggtggcatg 426
              |||||||||||||||||||||
Sbjct: 153203 ggccagcaccagggtggcatg 153223



to top

>gb|AC139341.3| Atelerix albiventris clone LB4-464N6, complete sequence
          Length = 195266

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 77    cccactcccaccccccactct 97
             |||||||||||||||||||||
Sbjct: 50652 cccactcccaccccccactct 50672



to top

>gb|AC134570.5| Mus musculus BAC clone RP24-252B18 from chromosome 18, complete
            sequence
          Length = 183551

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 77   cccactcccaccccccactct 97
            |||||||||||||||||||||
Sbjct: 3735 cccactcccaccccccactct 3715



to top

>gb|AC107755.12| Mus musculus chromosome 9, clone RP23-225C11, complete sequence
          Length = 178844

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 68     cacctcactcccactcccacccccc 92
              |||||||| ||||||||||||||||
Sbjct: 152159 cacctcacccccactcccacccccc 152183



to top

>gb|AC126255.3| Mus musculus BAC clone RP24-218F22 from chromosome 18, complete sequence
          Length = 166367

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 77     cccactcccaccccccactct 97
              |||||||||||||||||||||
Sbjct: 136274 cccactcccaccccccactct 136254



to top

>gb|AC104133.5| Homo sapiens BAC clone RP11-451N23 from 7, complete sequence
          Length = 46877

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 406 ggccagcaccagggtggcatg 426
           |||||||||||||||||||||
Sbjct: 464 ggccagcaccagggtggcatg 484



to top

>ref|XM_860226.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 14 (LOC478158), mRNA
          Length = 5395

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2008 tgctggggctggggctggggctgct 1984



to top

>ref|XM_535333.2| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 1 (LOC478158), mRNA
          Length = 5404

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2011 tgctggggctggggctggggctgct 1987



to top

>ref|XM_860193.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 13 (LOC478158), mRNA
          Length = 5323

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1930 tgctggggctggggctggggctgct 1906



to top

>ref|XM_860176.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 12 (LOC478158), mRNA
          Length = 5416

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2029 tgctggggctggggctggggctgct 2005



to top

>ref|XM_860159.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 11 (LOC478158), mRNA
          Length = 4963

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1570 tgctggggctggggctggggctgct 1546



to top

>ref|XM_860145.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 10 (LOC478158), mRNA
          Length = 5260

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2011 tgctggggctggggctggggctgct 1987



to top

>ref|XM_860124.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 9 (LOC478158), mRNA
          Length = 5272

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2011 tgctggggctggggctggggctgct 1987



to top

>ref|XM_860105.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 8 (LOC478158), mRNA
          Length = 5116

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1723 tgctggggctggggctggggctgct 1699



to top

>ref|XM_860089.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 7 (LOC478158), mRNA
          Length = 5161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2011 tgctggggctggggctggggctgct 1987



to top

>ref|XM_847075.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 2 (LOC478158), mRNA
          Length = 5529

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2136 tgctggggctggggctggggctgct 2112



to top

>ref|XM_860048.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 6 (LOC478158), mRNA
          Length = 5298

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1905 tgctggggctggggctggggctgct 1881



to top

>ref|XM_860027.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 5 (LOC478158), mRNA
          Length = 4681

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1288 tgctggggctggggctggggctgct 1264



to top

>ref|XM_860010.1| PREDICTED: Canis familiaris similar to pumilio 1 isoform 1,
            transcript variant 4 (LOC478158), mRNA
          Length = 4678

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 1285 tgctggggctggggctggggctgct 1261



to top

>gb|AY358709.1| Homo sapiens clone DNA76522 MRPL56 (UNQ843) mRNA, complete cds
          Length = 1321

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 155 gctggggctggggctggcgct 175



to top

>gb|AC091507.2| Sus scrofa clone RP44-397B10, complete sequence
          Length = 174031

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 208   ctggggctggggctggcgctg 228
             |||||||||||||||||||||
Sbjct: 36200 ctggggctggggctggcgctg 36220



to top

>emb|AL133466.22| Human DNA sequence from clone RP5-831C21 on chromosome 20 Contains the
             GGTLA4 gene for gamma-glutamyltransferase-like activity 4,
             the 5' end of a novel protein similar to gamma-glutamyl
             transpeptidase-related protein (GGT-Rel) and the POM121L3
             gene for POM121 membrane glycoprotein-like 3 (rat),
             complete sequence
          Length = 117890

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   ctggggctggggctggcgctg 228
             |||||||||||||||||||||
Sbjct: 25452 ctggggctggggctggcgctg 25432



to top

>emb|AL645943.19| Mouse DNA sequence from clone RP23-130E22 on chromosome 11 Contains a
              prohibitin (Phb) pseudogene and a novel gene, complete
              sequence
          Length = 213383

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     actcccactcccaccccccac 94
              |||||||||||||||||||||
Sbjct: 136037 actcccactcccaccccccac 136057



to top

>gb|BC067288.1| Homo sapiens lactamase, beta, transcript variant 1, mRNA (cDNA
           clone MGC:75417 IMAGE:30366453), complete cds
          Length = 2029

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 187 gctggggctggggctggcgct 207



to top

>gb|AC051635.7| Homo sapiens chromosome 18, clone RP11-540A4, complete sequence
          Length = 158608

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tggggctggggctggcgctgc 229
             |||||||||||||||||||||
Sbjct: 19237 tggggctggggctggcgctgc 19257



to top

>emb|CR617302.1| full-length cDNA clone CS0DM007YF16 of Fetal liver of Homo sapiens
           (human)
          Length = 1921

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 186 gctggggctggggctggcgct 206



to top

>gb|AC096630.16| Pan troglodytes clone rp43-71g16, complete sequence
          Length = 160603

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   ctggggctggggctggcgctg 228
             |||||||||||||||||||||
Sbjct: 50654 ctggggctggggctggcgctg 50634



to top

>emb|CR602675.1| full-length cDNA clone CS0DI074YB20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1891

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 160 gctggggctggggctggcgct 180



to top

>dbj|AK027808.1| Homo sapiens cDNA FLJ14902 fis, clone PLACE1005467
          Length = 2025

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 175 gctggggctggggctggcgct 195



to top

>emb|CR591560.1| full-length cDNA clone CS0DJ011YB05 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1772

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 207 gctggggctggggctggcgct 227
           |||||||||||||||||||||
Sbjct: 207 gctggggctggggctggcgct 227



to top

>ref|XM_928119.1| PREDICTED: Homo sapiens similar to gamma-glutamyltransferase-like
           activity 1 (LOC645076), mRNA
          Length = 1297

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 208 ctggggctggggctggcgctg 228
           |||||||||||||||||||||
Sbjct: 857 ctggggctggggctggcgctg 877



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 77      cccactcccaccccccactct 97
               |||||||||||||||||||||
Sbjct: 1186060 cccactcccaccccccactct 1186080



to top

>gb|AC159204.2| Mus musculus BAC clone RP23-229H13 from chromosome 12, complete
             sequence
          Length = 211156

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    ctcactcccactcccaccccc 91
             |||||||||||||||||||||
Sbjct: 53827 ctcactcccactcccaccccc 53807



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 247    cgccgcctggcctcggccgct 267
              |||||||||||||||||||||
Sbjct: 430291 cgccgcctggcctcggccgct 430271



to top

>gb|AC008124.8|AC008124 Homo sapiens Chromosome 12q13-62.7-72 BAC RPCI11-352M15 (Roswell Park
              Cancer Institute Human BAC Library) complete sequence
          Length = 183387

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 207    gctggggctggggctggcgct 227
              |||||||||||||||||||||
Sbjct: 150479 gctggggctggggctggcgct 150459



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 36       cccccttcttctcgtcagccgcatctccc 64
                |||||||||||||||| ||| ||||||||
Sbjct: 24905617 cccccttcttctcgtctgcctcatctccc 24905589



to top

>gb|AC087612.6| Homo sapiens chromosome 15, clone RP11-69G7, complete sequence
          Length = 145405

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 207   gctggggctggggctggcgct 227
             |||||||||||||||||||||
Sbjct: 63602 gctggggctggggctggcgct 63582



to top

>ref|XM_342928.2| PREDICTED: Rattus norvegicus pumilio 1 (Drosophila) (predicted)
            (Pum1_predicted), mRNA
          Length = 4164

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 206  tgctggggctggggctggcgctgct 230
            |||||||||||||||||| ||||||
Sbjct: 2150 tgctggggctggggctggggctgct 2126



to top

>dbj|AK120039.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-E08, full
           insert sequence
          Length = 569

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 36  cccccttcttctcgtcagccgcatctccc 64
           |||||||||||||||| ||| ||||||||
Sbjct: 228 cccccttcttctcgtctgcctcatctccc 200



to top

>dbj|AK072653.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023134L04, full
           insert sequence
          Length = 1016

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 36  cccccttcttctcgtcagccgcatctccc 64
           |||||||||||||||| ||| ||||||||
Sbjct: 678 cccccttcttctcgtctgcctcatctccc 650



to top

>gb|AC132271.5| Mus musculus BAC clone RP24-338E23 from 5, complete sequence
          Length = 173029

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 552    gcagctggagtcactgaatat 572
              |||||||||||||||||||||
Sbjct: 165587 gcagctggagtcactgaatat 165607



to top

>dbj|AK064058.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-F07, full
           insert sequence
          Length = 566

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 36  cccccttcttctcgtcagccgcatctccc 64
           |||||||||||||||| ||| ||||||||
Sbjct: 228 cccccttcttctcgtctgcctcatctccc 200



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 36       cccccttcttctcgtcagccgcatctccc 64
                |||||||||||||||| ||| ||||||||
Sbjct: 24833823 cccccttcttctcgtctgcctcatctccc 24833795



to top

>emb|AL831797.4|CNS08CAA Oryza sativa chromosome 12, . BAC OSJNBa0010M16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 132741

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 36    cccccttcttctcgtcagccgcatctccc 64
             |||||||||||||||| ||| ||||||||
Sbjct: 59251 cccccttcttctcgtctgcctcatctccc 59279



to top

>gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, complete sequence
          Length = 158740

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 208    ctggggctggggctggcgctg 228
              |||||||||||||||||||||
Sbjct: 124192 ctggggctggggctggcgctg 124212



to top

>emb|BX004852.5| Mouse DNA sequence from clone RP23-26D22 on chromosome X, complete
              sequence
          Length = 165777

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 70     cctcactcccactcccaccccccactctt 98
              |||| ||||| ||||||||||||||||||
Sbjct: 113854 cctccctccctctcccaccccccactctt 113882



to top

>emb|AL513468.9| Mouse DNA sequence from clone RP23-104I6 on chromosome X, complete
              sequence
          Length = 211194

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 69     acctcactcccactcccaccc 89
              |||||||||||||||||||||
Sbjct: 124212 acctcactcccactcccaccc 124232



to top

>emb|AL645853.12| Mouse DNA sequence from clone RP23-329L1 on chromosome 11, complete
            sequence
          Length = 94538

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 207  gctggggctggggctggcgctgcttctgc 235
            ||||||||||||||||| ||||| |||||
Sbjct: 9631 gctggggctggggctggggctgcctctgc 9659



to top

>gb|AY542376.1| Ambystoma mexicanum POU domain transcription factor oct-4 mRNA,
           complete cds
          Length = 3111

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 217 gggctggcgctgcttctgctggcg 240
           |||||||||||||| |||||||||
Sbjct: 597 gggctggcgctgctgctgctggcg 574



to top

>ref|XM_511829.1| PREDICTED: Pan troglodytes similar to KIAA0672 gene product
            (LOC455062), mRNA
          Length = 4371

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  gctggggctggggctggcgc 226
            ||||||||||||||||||||
Sbjct: 3396 gctggggctggggctggcgc 3377



to top

>gb|AC167720.2| Mus musculus BAC clone RP24-216G15 from chromosome 16, complete sequence
          Length = 172721

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     ctcccactcccaccccccac 94
              ||||||||||||||||||||
Sbjct: 135098 ctcccactcccaccccccac 135079



to top

>ref|XM_465807.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 369

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ggtggtgactggtgagggag 146
           ||||||||||||||||||||
Sbjct: 175 ggtggtgactggtgagggag 156



to top

>ref|NM_001031031.1| Gallus gallus B-cell CLL/lymphoma 11A (zinc finger protein) (BCL11A),
            mRNA
          Length = 5541

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 207  gctggggctggggctggcgctgct 230
            ||||||||||||||||| ||||||
Sbjct: 3616 gctggggctggggctggggctgct 3593



to top

>gb|AC153633.10| Mus musculus 6 BAC RP23-13K24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216841

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 77     cccactcccaccccccactc 96
              ||||||||||||||||||||
Sbjct: 213661 cccactcccaccccccactc 213642



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    ggcgctgcttctgctggcgc 241
              ||||||||||||||||||||
Sbjct: 957734 ggcgctgcttctgctggcgc 957753



to top

>gb|AF218784.1| Gallus gallus MHC Rfp-Y class I alpha chain (YFVI) pseudogene,
           YFV-Y-FVw*7 allele, complete sequence
          Length = 2801

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 207 gctggggctggggctggcgctgcttctgctgg 238
           ||||||||||||||||| |||||  |||||||
Sbjct: 413 gctggggctggggctggggctgcagctgctgg 444



to top

>gb|AC153878.11| Mus musculus 6 BAC RP23-229B22 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 185647

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    cccactcccaccccccactc 96
             ||||||||||||||||||||
Sbjct: 59953 cccactcccaccccccactc 59972



to top

>gb|AC102856.5| Mus musculus chromosome 8, clone RP24-500H8, complete sequence
          Length = 195286

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 207    gctggggctggggctggcgctgct 230
              ||||||||||||||||| ||||||
Sbjct: 146454 gctggggctggggctggggctgct 146431



to top

>gb|AC131976.6| Mus musculus chromosome 1, clone RP24-150D10, complete sequence
          Length = 167470

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 73     cactcccactcccaccccccactc 96
              ||||||||||||| ||||||||||
Sbjct: 163576 cactcccactccccccccccactc 163599



to top

>gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, complete sequence
          Length = 193097

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    cccactcccaccccccactc 96
             ||||||||||||||||||||
Sbjct: 65597 cccactcccaccccccactc 65616



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 211     gggctggggctggcgctgct 230
               ||||||||||||||||||||
Sbjct: 3076189 gggctggggctggcgctgct 3076170



to top

>gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence
          Length = 179978

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 70    cctcactcccactcccacccccca 93
             |||||||||||| |||||||||||
Sbjct: 92935 cctcactcccacccccacccccca 92958



to top

>ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) on chromosome 7
          Length = 684973

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 209   tggggctggggctggcgctgcttc 232
             |||||||||||||||| |||||||
Sbjct: 41609 tggggctggggctggccctgcttc 41632



to top

>gb|AC138682.14| Mus musculus chromosome 5, clone RP23-34L23, complete sequence
          Length = 241585

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 119695 ttgctggggctggggctggggctg 119718



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 178     gaggaggagatggagcgagg 197
               ||||||||||||||||||||
Sbjct: 8331980 gaggaggagatggagcgagg 8331999



to top

>gb|AC138904.3| Homo sapiens chromosome 16 clone RP11-57A19, complete sequence
          Length = 177163

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 207    gctggggctggggctggcgctgct 230
              ||||||||||||||||| ||||||
Sbjct: 125461 gctggggctggggctggggctgct 125438



to top

>emb|BX248343.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 10/14
          Length = 307550

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    gggctggggctggcgctgct 230
              ||||||||||||||||||||
Sbjct: 220540 gggctggggctggcgctgct 220521



to top

>gb|AC026238.2| Arabidopsis thaliana chromosome I BAC F25I16 genomic sequence, complete
             sequence
          Length = 44879

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   gtagggtggtggtgactggtgagg 143
             ||||| ||||||||||||||||||
Sbjct: 22781 gtaggttggtggtgactggtgagg 22804



to top

>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence
          Length = 185902

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    ctcactcccactcccacccc 90
             ||||||||||||||||||||
Sbjct: 77717 ctcactcccactcccacccc 77698



to top

>gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosome 14, complete sequence
          Length = 197720

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     ctcccactcccaccccccac 94
              ||||||||||||||||||||
Sbjct: 174437 ctcccactcccaccccccac 174418



to top

>gb|AC112791.3| Mus musculus BAC clone RP23-182O1 from 13, complete sequence
          Length = 208443

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    tcactcccactcccaccccc 91
             ||||||||||||||||||||
Sbjct: 85704 tcactcccactcccaccccc 85723



to top

>gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complete sequence
          Length = 160295

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 328   gtcaaatcttcttctgtttc 347
             ||||||||||||||||||||
Sbjct: 18260 gtcaaatcttcttctgtttc 18241



to top

>ref|XM_863609.1| PREDICTED: Canis familiaris hypothetical protein LOC612185
           (LOC612185), mRNA
          Length = 873

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 gctggggctggggctggcgc 226
           ||||||||||||||||||||
Sbjct: 474 gctggggctggggctggcgc 455



to top

>gb|AC114737.3| Homo sapiens BAC clone CTD-2192D1 from 7, complete sequence
          Length = 99227

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   tggggctggggctggcgctg 228
             ||||||||||||||||||||
Sbjct: 79119 tggggctggggctggcgctg 79138



to top

>gb|AC117600.9| Mus musculus chromosome 1, clone RP23-449C20, complete sequence
          Length = 195848

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 73    cactcccactcccaccccccactc 96
             ||||||||||||| ||||||||||
Sbjct: 27651 cactcccactccccccccccactc 27674



to top

>gb|DQ103310.1| Phytophthora ramorum clone F07,11A microsatellite 97 sequence
          Length = 312

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 206 tgctggggctggggctggcgctgcttctgctg 237
           |||||| ||||| |||||||||||| ||||||
Sbjct: 103 tgctggcgctggcgctggcgctgctactgctg 134



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 475     gcaggcattgggcaggtggt 494
               ||||||||||||||||||||
Sbjct: 4694290 gcaggcattgggcaggtggt 4694309



to top

>gb|BC094754.1| Homo sapiens KIAA0672 gene product, mRNA (cDNA clone IMAGE:30337933)
          Length = 3965

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  gctggggctggggctggcgc 226
            ||||||||||||||||||||
Sbjct: 1868 gctggggctggggctggcgc 1849



to top

>emb|AL158829.14| Human DNA sequence from clone RP11-406O23 on chromosome 9 Contains
            part of the AKAP2 (PALM2) gene for A kinase (PRKA) anchor
            protein 2 (paralemmin 2), a novel gene and a CpG island,
            complete sequence
          Length = 136723

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 67   tcacctcactcccactccca 86
            ||||||||||||||||||||
Sbjct: 2136 tcacctcactcccactccca 2117



to top

>gb|AC084794.3| Homo sapiens chromosome 16 clone CTA-154B9, complete sequence
          Length = 230510

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 207   gctggggctggggctggcgctgct 230
             ||||||||||||||||| ||||||
Sbjct: 87274 gctggggctggggctggggctgct 87297



to top

>gb|AC026454.5| Homo sapiens chromosome 16 clone CTD-2597E15, complete sequence
          Length = 136331

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 207   gctggggctggggctggcgctgct 230
             ||||||||||||||||| ||||||
Sbjct: 21902 gctggggctggggctggggctgct 21879



to top

>ref|XM_774988.1| PREDICTED: Strongylocentrotus purpuratus similar to KIAA0261
            (LOC574639), mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 170  gccagtcggaggaggagatg 189
            ||||||||||||||||||||
Sbjct: 1397 gccagtcggaggaggagatg 1416



to top

>emb|BX842580.1| Mycobacterium tuberculosis H37Rv complete genome; segment 9/13
          Length = 346051

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    gggctggggctggcgctgct 230
              ||||||||||||||||||||
Sbjct: 308430 gggctggggctggcgctgct 308411



to top

>emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genome; segment 11/16
          Length = 349635

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 207   gctggggctggggctggcgctgcttctgctgg 238
             ||||| |||||||||||||||| ||| |||||
Sbjct: 57775 gctggtgctggggctggcgctgtttccgctgg 57744



to top

>gb|BC070074.1| Homo sapiens KIAA0672 gene product, mRNA (cDNA clone IMAGE:30338180)
          Length = 3965

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  gctggggctggggctggcgc 226
            ||||||||||||||||||||
Sbjct: 1868 gctggggctggggctggcgc 1849



to top

>emb|AL645988.6| Mouse DNA sequence from clone RP23-67J22 on chromosome 11 Contains four
              novel genes (9130409J20Rik, A530088H08Rik), two genes for a
              novel proteins (2310004I24Rik, A730055C05Rik, LOC193004),
              the Sco1 gene for SCO cytochrome oxidase deficient homolog
              1 (yeast), the 5' end of the Myh3 gene for skeletal muscle
              embryonic myosin heavy polypeptide 3 and a CpG island,
              complete sequence
          Length = 217003

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 77     cccactcccaccccccactc 96
              ||||||||||||||||||||
Sbjct: 191496 cccactcccaccccccactc 191477



to top

>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04,
            complete sequence
          Length = 143301

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  ctgccagtcggaggaggaga 187
            ||||||||||||||||||||
Sbjct: 4459 ctgccagtcggaggaggaga 4478



to top

>emb|AL096728.1|HSM800662 Homo sapiens mRNA; cDNA DKFZp434B034 (from clone DKFZp434B034)
          Length = 2951

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 gctggggctggggctggcgc 226
           ||||||||||||||||||||
Sbjct: 818 gctggggctggggctggcgc 799



to top

>emb|AJ851441.1| Gallus gallus mRNA for hypothetical protein, clone 3a6
          Length = 5541

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 207  gctggggctggggctggcgctgct 230
            ||||||||||||||||| ||||||
Sbjct: 3616 gctggggctggggctggggctgct 3593



to top

>emb|AL731728.10| Mouse DNA sequence from clone RP24-531N10 on chromosome 11 Contains
             part of the Car10 gene for carbonic anhydrase 10, complete
             sequence
          Length = 146735

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 554   agctggagtcactgaatatc 573
             ||||||||||||||||||||
Sbjct: 89372 agctggagtcactgaatatc 89391



to top

>ref|NM_204769.1| Gallus gallus visual system homeobox 1 homolog, CHX10-like
           (zebrafish) (VSX1), mRNA
          Length = 1996

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 207 gctggggctggggctggcgctgct 230
           ||||||||||||||||| ||||||
Sbjct: 286 gctggggctggggctggggctgct 309



to top

>emb|BX546502.7| Zebrafish DNA sequence from clone RP71-62P22 in linkage group 25,
             complete sequence
          Length = 169168

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   gggctggggctggcgctgct 230
             ||||||||||||||||||||
Sbjct: 89149 gggctggggctggcgctgct 89130



to top

>gb|AC009374.7| Drosophila melanogaster 3L BAC RP98-4J11 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 164719

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 73    cactcccactcccaccccccactc 96
             |||||||||| |||||||||||||
Sbjct: 12382 cactcccactgccaccccccactc 12405



to top

>gb|AF033106.1| Grus canadensis pratensis MHC class I heavy chain (f51) mRNA,
           complete cds
          Length = 1675

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 207 gctggggctggggctggcgctgct 230
           ||||||||||||||||| ||||||
Sbjct: 55  gctggggctggggctggggctgct 78



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 207     gctggggctggggctggcgctgct 230
               ||||||||||||| ||||||||||
Sbjct: 2869306 gctggggctgggggtggcgctgct 2869283



to top

>gb|AC021553.14| Homo sapiens chromosome 15, clone RP11-709B3, complete sequence
          Length = 185596

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   gctggggctggggctggcgc 226
             ||||||||||||||||||||
Sbjct: 83799 gctggggctggggctggcgc 83780



to top

>gb|AC020980.6| Homo sapiens chromosome 5 clone RPCI-1_167G20, complete sequence
          Length = 175177

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 127189 ttgctggggctggggctggggctg 127166



to top

>gb|AC083800.13| Homo sapiens 3q BAC RP11-484M3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181395

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 123256 ttgctggggctggggctggggctg 123233



to top

>gb|AC097512.2| Homo sapiens BAC clone RP11-412P11 from 4, complete sequence
          Length = 149282

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    ctcactcccactcccacccc 90
             ||||||||||||||||||||
Sbjct: 72488 ctcactcccactcccacccc 72507



to top

>gb|AC160395.2| Mus musculus BAC clone RP23-36C19 from chromosome 12, complete sequence
          Length = 207840

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 70    cctcactcccactcccacccccca 93
             |||||||||||| |||||||||||
Sbjct: 45342 cctcactcccacccccacccccca 45365



to top

>gb|AC158242.4| Pan troglodytes BAC clone CH251-354C10 from chromosome unknown, complete
              sequence
          Length = 182200

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 153323 ttgctggggctggggctggggctg 153346



to top

>gb|AC164093.2| Mus musculus BAC clone RP23-131O16 from chromosome 16, complete sequence
          Length = 229443

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 139993 ttgctggggctggggctggggctg 140016



to top

>gb|AC016074.6| Homo sapiens, clone RP11-697B24, complete sequence
          Length = 164239

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 66     ctcacctcactcccactcccaccc 89
              |||||| |||||||||||||||||
Sbjct: 147562 ctcaccccactcccactcccaccc 147539



to top

>dbj|AK036393.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
            library, clone:9830004K05 product:thiosulfate
            sulfurtransferase, mitochondrial, full insert sequence
          Length = 2631

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 74   actcccactcccacccccca 93
            ||||||||||||||||||||
Sbjct: 2562 actcccactcccacccccca 2543



to top

>gb|AC067837.6| Homo sapiens chromosome 15, clone RP11-65B16, complete sequence
          Length = 173919

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   gctggggctggggctggcgc 226
             ||||||||||||||||||||
Sbjct: 10719 gctggggctggggctggcgc 10738



to top

>gb|AC159282.2| Mus musculus BAC clone RP23-329M17 from chromosome 12, complete sequence
          Length = 210571

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 70     cctcactcccactcccacccccca 93
              |||||||||||| |||||||||||
Sbjct: 202410 cctcactcccacccccacccccca 202433



to top

>gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
             BACR37K07, complete sequence
          Length = 157722

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    cttcttctcgtcagccgcat 59
             ||||||||||||||||||||
Sbjct: 47649 cttcttctcgtcagccgcat 47630



to top

>gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone
            BACR20P10, complete sequence
          Length = 157482

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 40   cttcttctcgtcagccgcat 59
            ||||||||||||||||||||
Sbjct: 4498 cttcttctcgtcagccgcat 4517



to top

>dbj|AK053710.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130220E24 product:synbindin, full insert
           sequence
          Length = 1340

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ctcactcccactcccacccc 90
           ||||||||||||||||||||
Sbjct: 306 ctcactcccactcccacccc 287



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 168      ctgccagtcggaggaggaga 187
                ||||||||||||||||||||
Sbjct: 20273826 ctgccagtcggaggaggaga 20273845



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 177      ggaggaggagatggagcgag 196
                ||||||||||||||||||||
Sbjct: 18197746 ggaggaggagatggagcgag 18197765



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 178     gaggaggagatggagcgagg 197
               ||||||||||||||||||||
Sbjct: 8329815 gaggaggagatggagcgagg 8329834



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 124      ggtggtggtgactggtgagg 143
                ||||||||||||||||||||
Sbjct: 30784761 ggtggtggtgactggtgagg 30784780



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 127      ggtggtgactggtgagggag 146
                ||||||||||||||||||||
Sbjct: 17565340 ggtggtgactggtgagggag 17565359



to top

>gb|AC009725.12|AC009725 Mus musculus chromosome , clone CT7-388N17, complete sequence
          Length = 145152

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 75     ctcccactcccaccccccac 94
              ||||||||||||||||||||
Sbjct: 114733 ctcccactcccaccccccac 114714



to top

>gb|AE009539.1| Brucella melitensis 16M chromosome I, section 96 of 195 of the
            complete sequence
          Length = 10029

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 222  ggcgctgcttctgctggcgc 241
            ||||||||||||||||||||
Sbjct: 5704 ggcgctgcttctgctggcgc 5685



to top

>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   gaggaggagatggagcgagg 197
             ||||||||||||||||||||
Sbjct: 69236 gaggaggagatggagcgagg 69255



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 206     tgctggggctggggctggcg 225
               ||||||||||||||||||||
Sbjct: 6194479 tgctggggctggggctggcg 6194460



to top

>ref|XM_573925.1| PREDICTED: Rattus norvegicus similar to RGD1310090_predicted
           protein (LOC498643), mRNA
          Length = 968

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 405 aggccagcaccagggtggca 424
           ||||||||||||||||||||
Sbjct: 828 aggccagcaccagggtggca 809



to top

>gb|AC124283.11| Homo sapiens chromosome 17, clone RP13-638C3, complete sequence
          Length = 143744

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 205   ttgctggggctggggctggcgctg 228
             ||||||||||||||||||| ||||
Sbjct: 46954 ttgctggggctggggctggggctg 46977



to top

>gb|AC079130.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-446E21, complete
              sequence
          Length = 190587

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 83     cccaccccccactcttctac 102
              ||||||||||||||||||||
Sbjct: 166441 cccaccccccactcttctac 166422



to top

>gb|AC131102.3| Mus musculus BAC clone RP23-101H16 from chromosome 5, complete sequence
          Length = 208536

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 205    ttgctggggctggggctggcgctg 228
              ||||||||||||||||||| ||||
Sbjct: 141367 ttgctggggctggggctggggctg 141390



to top

>gb|AC011547.4|AC011547 Homo sapiens chromosome 19 clone LLNLR-272C5, complete sequence
          Length = 41174

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 207   gctggggctggggctggcgctgct 230
             ||||||||||||||||| ||||||
Sbjct: 23495 gctggggctggggctggggctgct 23518



to top

>dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0477A12
          Length = 138141

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    ggaggaggagatggagcgag 196
              ||||||||||||||||||||
Sbjct: 133052 ggaggaggagatggagcgag 133071



to top

>dbj|AP004880.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0487D09
          Length = 161531

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    ggtggtggtgactggtgagg 143
              ||||||||||||||||||||
Sbjct: 124908 ggtggtggtgactggtgagg 124927



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 478     ggcattgggcaggtggtgca 497
               ||||||||||||||||||||
Sbjct: 2718223 ggcattgggcaggtggtgca 2718242



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    ggcgctgcttctgctggcgc 241
              ||||||||||||||||||||
Sbjct: 976734 ggcgctgcttctgctggcgc 976753



to top

>ref|NM_014859.3| Homo sapiens KIAA0672 gene product (KIAA0672), mRNA
          Length = 4227

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  gctggggctggggctggcgc 226
            ||||||||||||||||||||
Sbjct: 2199 gctggggctggggctggcgc 2180



to top

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1218_C12
          Length = 105861

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 177  ggaggaggagatggagcgag 196
            ||||||||||||||||||||
Sbjct: 989  ggaggaggagatggagcgag 1008



to top

>dbj|AP004086.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1288_D09
          Length = 124026

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   ggtggtgactggtgagggag 146
             ||||||||||||||||||||
Sbjct: 35258 ggtggtgactggtgagggag 35277



to top

>emb|AL772166.15| Mouse DNA sequence from clone RP23-413I12 on chromosome 2, complete
           sequence
          Length = 184547

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 68  cacctcactcccactcccaccccc 91
           |||||||| |||||||||||||||
Sbjct: 621 cacctcacccccactcccaccccc 644



to top

>dbj|AB014572.1| Homo sapiens mRNA for KIAA0672 protein, partial cds
          Length = 4227

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 207  gctggggctggggctggcgc 226
            ||||||||||||||||||||
Sbjct: 2199 gctggggctggggctggcgc 2180



to top

>gb|AF178670.1|AF178670 Gallus gallus homeobox protein Chx10-1 (chx10-1) mRNA, complete cds
          Length = 1996

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 207 gctggggctggggctggcgctgct 230
           ||||||||||||||||| ||||||
Sbjct: 286 gctggggctggggctggggctgct 309



to top

>emb|AJ325171.1|HSA325171 Homo sapiens genomic sequence surrounding NotI site, clone
           NL1-CF22C
          Length = 533

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 207 gctggggctggggctggcgctgct 230
           ||||||||||||||||| ||||||
Sbjct: 58  gctggggctggggctggggctgct 81



to top

>gb|AC148872.2| Chlamydomonas reinhardtii clone cr-25P21, complete sequence
          Length = 45702

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 207   gctggggctggggctggcgctgct 230
             |||||||||||||||| |||||||
Sbjct: 13384 gctggggctggggctgccgctgct 13361



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 207   gctggggctggggctggcgctgcttctgctgg 238
             ||||||||||||||||| |||||  |||||||
Sbjct: 13390 gctggggctggggctggggctgccgctgctgg 13359



to top

>gb|AC113288.7| Mus musculus chromosome 5, clone RP23-414I12, complete sequence
          Length = 185599

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 328  gtcaaatcttcttctgtttc 347
            ||||||||||||||||||||
Sbjct: 9642 gtcaaatcttcttctgtttc 9661



to top

>gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52 of 83 of the complete
             sequence
          Length = 236144

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    cttcttctcgtcagccgcat 59
             ||||||||||||||||||||
Sbjct: 54992 cttcttctcgtcagccgcat 54973



to top

>gb|AE003524.5| Drosophila melanogaster chromosome 3L, section 61 of 83 of the complete
              sequence
          Length = 425677

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 73     cactcccactcccaccccccactc 96
              |||||||||| |||||||||||||
Sbjct: 256801 cactcccactgccaccccccactc 256778



to top

>dbj|AP002342.3| Homo sapiens genomic DNA, chromosome 11q clone:CTD-2258N2, complete
             sequences
          Length = 174548

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 70    cctcactcccactcccacccccca 93
             |||||||||||||||||| |||||
Sbjct: 11585 cctcactcccactcccactcccca 11608



to top

>dbj|AP003731.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-677N11, complete
             sequence
          Length = 33560

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 70    cctcactcccactcccacccccca 93
             |||||||||||||||||| |||||
Sbjct: 21649 cctcactcccactcccactcccca 21672



to top

>gb|BC089954.1| Rattus norvegicus similar to 2310043K02Rik protein, mRNA (cDNA
           clone MGC:109288 IMAGE:7312637), complete cds
          Length = 1630

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 405 aggccagcaccagggtggca 424
           ||||||||||||||||||||
Sbjct: 829 aggccagcaccagggtggca 810



to top

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    gggctggcgctgcttctgct 236
              ||||||||||||||||||||
Sbjct: 178373 gggctggcgctgcttctgct 178354



to top

>ref|NM_001012352.1| Rattus norvegicus similar to 2310043K02Rik protein (RGD1310090),
           mRNA
          Length = 1630

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 405 aggccagcaccagggtggca 424
           ||||||||||||||||||||
Sbjct: 829 aggccagcaccagggtggca 810



to top

>gb|AC005277.1|AC005277 Homo sapiens chromosome 17, clone hRPK.597_M_12, complete sequence
          Length = 118788

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    gctggggctggggctggcgc 226
              ||||||||||||||||||||
Sbjct: 116316 gctggggctggggctggcgc 116335



to top

>dbj|AP005626.2| Homo sapiens genomic DNA, chromosome 8q24, clone: KB51H10, complete
             sequence
          Length = 74057

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 66    ctcacctcactcccactcccaccc 89
             |||||| |||||||||||||||||
Sbjct: 18903 ctcaccccactcccactcccaccc 18880



to top

>gb|AC127309.4| Mus musculus BAC clone RP23-296L9 from 9, complete sequence
          Length = 188083

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 83     cccaccccccactcttctac 102
              ||||||||||||||||||||
Sbjct: 163191 cccaccccccactcttctac 163172



to top

>emb|CT010498.7| Mouse DNA sequence from clone RP23-105I10 on chromosome 13, complete
             sequence
          Length = 207035

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 75    ctcccactcccaccccccactctt 98
             ||||||| ||||||||||||||||
Sbjct: 48637 ctcccacccccaccccccactctt 48660



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    ggcgctgcttctgctggcgc 241
              ||||||||||||||||||||
Sbjct: 973854 ggcgctgcttctgctggcgc 973873



to top

>gb|L33930.1|HUMCD24B Homo sapiens CD24 signal transducer mRNA, complete cds and 3'
           region
          Length = 2116

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 212 ggctggggctggcgctgcttctgctggc 239
           |||||||||||| |||||| ||||||||
Sbjct: 79  ggctggggctggggctgctgctgctggc 106



to top

>gb|U00090.1| Rhizobium sp. NGR234 plasmid pNGR234a, complete sequence
          Length = 536165

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 468    gaatgatgcaggcattgggc 487
              ||||||||||||||||||||
Sbjct: 405677 gaatgatgcaggcattgggc 405696



to top

>gb|U66059.1| Human germline T-cell receptor beta chain
             Dopamine-beta-hydroxylase-like, TRY1, TRY2, TRY3,
             TCRBV27S1P, TCRBV22S1A2N1T, TCRBV9S1A1T, TCRBV7S1A1N2T,
             TCRBV5S1A1T, TCRBV13S3, TCRBV6S7P, TCRBV7S3A2T,
             TCRBV13S2A1T, TCRBV9S2A2PT, TCRBV7S2A1N4T,
             TCRBV13S9/13S2A1T, TCRBV6S5A1N1, TCRBV30S1P, TCRBV31S1,
             TCRBV13S5, TCRBV6S1A1N1, TCRBV32S1P, TCRBV5S5P,
             TCRBV1S1A1N1, TCRBV12S2A1T, TCRBV21S1, TCRBV8S4P,
             TCRBV12S3, TCRBV21S3A2N2T, TCRBV8S5P, TCRBV13S1 genes from
             bases 1 to 267156 (section 1 of 3)
          Length = 267156

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 209   tggggctggggctggcgctgcttc 232
             |||||||||||||||| |||||||
Sbjct: 41609 tggggctggggctggccctgcttc 41632



to top

>emb|AL935278.7| Mouse DNA sequence from clone RP23-84E1 on chromosome 2, complete
              sequence
          Length = 183353

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 386    cagttgagctcatttccgcaggcc 409
              |||||||||||||| |||||||||
Sbjct: 135317 cagttgagctcattgccgcaggcc 135340



to top

>gb|AC153922.6| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 234722

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     cccactcccaccccccactc 96
              ||||||||||||||||||||
Sbjct: 146941 cccactcccaccccccactc 146960



to top

>emb|AL772282.9| Mouse DNA sequence from clone RP23-328F3 on chromosome 2, complete
              sequence
          Length = 188624

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 68     cacctcactcccactcccaccccc 91
              |||||||| |||||||||||||||
Sbjct: 187245 cacctcacccccactcccaccccc 187268



to top

>emb|AL645563.12| Mouse DNA sequence from clone RP23-132L14 on chromosome 4, complete
              sequence
          Length = 214456

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    tggggctggggctggcgctg 228
              ||||||||||||||||||||
Sbjct: 173307 tggggctggggctggcgctg 173326



to top

>emb|AL583893.17| Mouse DNA sequence from clone RP23-189A18 on chromosome 15, complete
              sequence
          Length = 184558

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 74     actcccactcccacccccca 93
              ||||||||||||||||||||
Sbjct: 174416 actcccactcccacccccca 174435


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,914,304
Number of Sequences: 3902068
Number of extensions: 4914304
Number of successful extensions: 130137
Number of sequences better than 10.0: 220
Number of HSP's better than 10.0 without gapping: 222
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127731
Number of HSP's gapped (non-prelim): 2365
length of query: 580
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 557
effective length of database: 17,143,297,704
effective search space: 9548816821128
effective search space used: 9548816821128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top