ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart20d08 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1236 Score = 571 bits (288), Expect = e-160 Identities = 411/452 (90%) Strand = Plus / Plus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 ||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||| Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373 |||| |||||||||||||||||||||||| | || || || ||||||||||| ||||||| Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367 Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 433 |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 427 Query: 434 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 493 |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || |||| Sbjct: 428 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 487 Query: 494 cacctgttgatgtggtggttccccctgggcacactggtctggatccctcccagacgtcct 553 | |||||||||||||||||||||||||| |||||||||||||||| |||||||| || | Sbjct: 488 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 547 Query: 554 tcttccaggtgcttaacattcccaccaagatt 585 ||||||||||||||||||| |||||||||||| Sbjct: 548 tcttccaggtgcttaacatccccaccaagatt 579 Score = 75.8 bits (38), Expect = 1e-10 Identities = 41/42 (97%) Strand = Plus / Plus Query: 1 aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42 ||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43
>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic ribosomal protein P0, complete cds Length = 1220 Score = 571 bits (288), Expect = e-160 Identities = 411/452 (90%) Strand = Plus / Plus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 ||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| Sbjct: 110 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 169 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 170 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 229 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||| Sbjct: 230 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 289 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373 |||| |||||||||||||||||||||||| | || || || ||||||||||| ||||||| Sbjct: 290 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 349 Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 433 |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 350 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 409 Query: 434 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 493 |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || |||| Sbjct: 410 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 469 Query: 494 cacctgttgatgtggtggttccccctgggcacactggtctggatccctcccagacgtcct 553 | |||||||||||||||||||||||||| |||||||||||||||| |||||||| || | Sbjct: 470 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 529 Query: 554 tcttccaggtgcttaacattcccaccaagatt 585 ||||||||||||||||||| |||||||||||| Sbjct: 530 tcttccaggtgcttaacatccccaccaagatt 561
>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full insert sequence Length = 1236 Score = 571 bits (288), Expect = e-160 Identities = 411/452 (90%) Strand = Plus / Plus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 ||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||| Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373 |||| |||||||||||||||||||||||| | || || || ||||||||||| ||||||| Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367 Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 433 |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 427 Query: 434 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 493 |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || |||| Sbjct: 428 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 487 Query: 494 cacctgttgatgtggtggttccccctgggcacactggtctggatccctcccagacgtcct 553 | |||||||||||||||||||||||||| |||||||||||||||| |||||||| || | Sbjct: 488 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 547 Query: 554 tcttccaggtgcttaacattcccaccaagatt 585 ||||||||||||||||||| |||||||||||| Sbjct: 548 tcttccaggtgcttaacatccccaccaagatt 579 Score = 75.8 bits (38), Expect = 1e-10 Identities = 41/42 (97%) Strand = Plus / Plus Query: 1 aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42 ||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 297 bits (150), Expect = 2e-77 Identities = 222/246 (90%) Strand = Plus / Minus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 ||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| Sbjct: 1716667 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 1716608 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 1716607 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 1716548 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||| Sbjct: 1716547 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 1716488 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373 |||| |||||||||||||||||||||||| | || || || ||||||||||| ||||||| Sbjct: 1716487 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 1716428 Query: 374 agctca 379 |||||| Sbjct: 1716427 agctca 1716422 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 1715379 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 1715320 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||||||||| |||||||| || |||||||||||| Sbjct: 1715319 gcaacactggtctggatccatcccagacctctttcttccaggtg 1715276 Score = 119 bits (60), Expect = 1e-23 Identities = 66/68 (97%) Strand = Plus / Minus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 456 ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 1716313 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 1716254 Query: 457 tacaaggt 464 |||||||| Sbjct: 1716253 tacaaggt 1716246 Score = 75.8 bits (38), Expect = 1e-10 Identities = 41/42 (97%) Strand = Plus / Minus Query: 1 aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42 ||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1716793 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 1716752 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 1715190 caggtgcttaacatccccaccaagatt 1715164
>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0582D05 Length = 150483 Score = 297 bits (150), Expect = 2e-77 Identities = 222/246 (90%) Strand = Plus / Minus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 ||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| Sbjct: 116167 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 116108 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| | Sbjct: 116107 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 116048 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||| Sbjct: 116047 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 115988 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373 |||| |||||||||||||||||||||||| | || || || ||||||||||| ||||||| Sbjct: 115987 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 115928 Query: 374 agctca 379 |||||| Sbjct: 115927 agctca 115922 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 114879 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 114820 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||||||||| |||||||| || |||||||||||| Sbjct: 114819 gcaacactggtctggatccatcccagacctctttcttccaggtg 114776 Score = 119 bits (60), Expect = 1e-23 Identities = 66/68 (97%) Strand = Plus / Minus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 456 ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| Sbjct: 115813 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 115754 Query: 457 tacaaggt 464 |||||||| Sbjct: 115753 tacaaggt 115746 Score = 75.8 bits (38), Expect = 1e-10 Identities = 41/42 (97%) Strand = Plus / Minus Query: 1 aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42 ||||||||||||||||||||||||||||||||||||| |||| Sbjct: 116293 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 116252 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 114690 caggtgcttaacatccccaccaagatt 114664
>gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, complete sequence Length = 149493 Score = 278 bits (140), Expect = 2e-71 Identities = 218/244 (89%) Strand = Plus / Minus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 5848 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 5789 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 5788 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 5729 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||||||||||||| Sbjct: 5728 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 5669 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 5668 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 5609 Query: 376 ctca 379 |||| Sbjct: 5608 ctca 5605 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 4744 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 4685 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | ||||||||||||||||||||||||| || ||||| |||||| Sbjct: 4684 gaaacactggtctggatccctcccagacttctttctttcaggtg 4641 Score = 119 bits (60), Expect = 1e-23 Identities = 69/72 (95%) Strand = Plus / Minus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 456 |||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 5485 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 5426 Query: 457 tacaaggttggc 468 |||||||||||| Sbjct: 5425 tacaaggttggc 5414 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 4568 caggtgcttaacatccccaccaagatt 4542
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 278 bits (140), Expect = 2e-71 Identities = 218/244 (89%) Strand = Plus / Minus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 1650134 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1650075 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 1650074 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1650015 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||||||||||||| Sbjct: 1650014 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1649955 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 1649954 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1649895 Query: 376 ctca 379 |||| Sbjct: 1649894 ctca 1649891 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 1649030 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1648971 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | ||||||||||||||||||||||||| || ||||| |||||| Sbjct: 1648970 gaaacactggtctggatccctcccagacttctttctttcaggtg 1648927 Score = 119 bits (60), Expect = 1e-23 Identities = 69/72 (95%) Strand = Plus / Minus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 456 |||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1649771 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1649712 Query: 457 tacaaggttggc 468 |||||||||||| Sbjct: 1649711 tacaaggttggc 1649700 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 1648854 caggtgcttaacatccccaccaagatt 1648828
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 278 bits (140), Expect = 2e-71 Identities = 218/244 (89%) Strand = Plus / Minus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 1647855 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1647796 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 1647795 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1647736 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||||||||||||| Sbjct: 1647735 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1647676 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 1647675 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1647616 Query: 376 ctca 379 |||| Sbjct: 1647615 ctca 1647612 Score = 135 bits (68), Expect = 2e-28 Identities = 95/104 (91%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 1646751 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1646692 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | ||||||||||||||||||||||||| || ||||| |||||| Sbjct: 1646691 gaaacactggtctggatccctcccagacttctttctttcaggtg 1646648 Score = 119 bits (60), Expect = 1e-23 Identities = 69/72 (95%) Strand = Plus / Minus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 456 |||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||| Sbjct: 1647492 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1647433 Query: 457 tacaaggttggc 468 |||||||||||| Sbjct: 1647432 tacaaggttggc 1647421 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 1646575 caggtgcttaacatccccaccaagatt 1646549
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 270 bits (136), Expect = 5e-69 Identities = 217/244 (88%) Strand = Plus / Minus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||||| Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089 Query: 376 ctca 379 |||| Sbjct: 1603088 ctca 1603085 Score = 127 bits (64), Expect = 4e-26 Identities = 94/104 (90%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| |||||||||||||| |||||||||| Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||| |||||||||||||| || |||||||||||| Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139 Score = 125 bits (63), Expect = 2e-25 Identities = 69/71 (97%) Strand = Plus / Minus Query: 394 ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 453 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929 Query: 454 aagtacaaggt 464 ||||||||||| Sbjct: 1602928 aagtacaaggt 1602918 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 1602065 caggtgcttaacatccccaccaagatt 1602039
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 270 bits (136), Expect = 5e-69 Identities = 217/244 (88%) Strand = Plus / Minus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||||| Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089 Query: 376 ctca 379 |||| Sbjct: 1603088 ctca 1603085 Score = 127 bits (64), Expect = 4e-26 Identities = 94/104 (90%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| |||||||||||||| |||||||||| Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||| |||||||||||||| || |||||||||||| Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139 Score = 125 bits (63), Expect = 2e-25 Identities = 69/71 (97%) Strand = Plus / Minus Query: 394 ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 453 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929 Query: 454 aagtacaaggt 464 ||||||||||| Sbjct: 1602928 aagtacaaggt 1602918 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 1602065 caggtgcttaacatccccaccaagatt 1602039
>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 91883 Score = 270 bits (136), Expect = 5e-69 Identities = 217/244 (88%) Strand = Plus / Plus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 89594 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 89653 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 89654 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 89713 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||||| Sbjct: 89714 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 89773 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 89774 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 89833 Query: 376 ctca 379 |||| Sbjct: 89834 ctca 89837 Score = 127 bits (64), Expect = 4e-26 Identities = 94/104 (90%) Strand = Plus / Plus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| |||||||||||||| |||||||||| Sbjct: 90680 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 90739 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||| |||||||||||||| || |||||||||||| Sbjct: 90740 gaaacactggtctcgatccctcccagacttctttcttccaggtg 90783 Score = 125 bits (63), Expect = 2e-25 Identities = 69/71 (97%) Strand = Plus / Plus Query: 394 ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 453 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 89993 Query: 454 aagtacaaggt 464 ||||||||||| Sbjct: 89994 aagtacaaggt 90004 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 90857 caggtgcttaacatccccaccaagatt 90883
>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 183385 Score = 270 bits (136), Expect = 5e-69 Identities = 217/244 (88%) Strand = Plus / Plus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| |||||| Sbjct: 22404 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 22463 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 | || || ||||||||||||||||||||||||||||||||||| || || ||||| ||| Sbjct: 22464 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 22523 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 || ||||||||||||||||| ||| | || ||||||||||| |||||||| ||||||||| Sbjct: 22524 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 22583 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375 || |||||||||||||||||||||||| | || || || ||||||||||||||||||||| Sbjct: 22584 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 22643 Query: 376 ctca 379 |||| Sbjct: 22644 ctca 22647 Score = 127 bits (64), Expect = 4e-26 Identities = 94/104 (90%) Strand = Plus / Plus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| ||||||||||||||||| || ||||| |||||||||||||| |||||||||| Sbjct: 23490 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 23549 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtg 564 | |||||||||| |||||||||||||| || |||||||||||| Sbjct: 23550 gaaacactggtctcgatccctcccagacttctttcttccaggtg 23593 Score = 125 bits (63), Expect = 2e-25 Identities = 69/71 (97%) Strand = Plus / Plus Query: 394 ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 453 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 22803 Query: 454 aagtacaaggt 464 ||||||||||| Sbjct: 22804 aagtacaaggt 22814 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 559 caggtgcttaacattcccaccaagatt 585 |||||||||||||| |||||||||||| Sbjct: 23667 caggtgcttaacatccccaccaagatt 23693
>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence Length = 1230 Score = 236 bits (119), Expect = 7e-59 Identities = 182/203 (89%) Strand = Plus / Plus Query: 383 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 442 ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |||| Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 420 Query: 443 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 502 |||||||||||||||||||||| || ||||||||||||||||| || ||||| || |||| Sbjct: 421 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 480 Query: 503 atgtggtggttccccctgggcacactggtctggatccctcccagacgtccttcttccagg 562 |||| || || |||||||| ||||||| |||||||| |||||||| || |||||||||| Sbjct: 481 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 540 Query: 563 tgcttaacattcccaccaagatt 585 |||||||||| |||||||||||| Sbjct: 541 tgcttaacatccccaccaagatt 563 Score = 194 bits (98), Expect = 2e-46 Identities = 188/218 (86%) Strand = Plus / Plus Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 |||||||||||| |||||||||| ||||||||||||||||||||| ||||||| ||| Sbjct: 114 atggcgatcaagcggaccaaggcggagaagaagatcgcgtacgacaagaagctgtgcagc 173 Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255 ||||||| |||||||||||||||||||||||| |||||||||| ||||| ||||||||| Sbjct: 174 ctgctcgatgagtacaccaaggtgctcatcgccctcgccgacaacgtcggttccaagcag 233 Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315 |||||||| |||||| ||| ||| | || ||||| | ||||||||||| |||||||| Sbjct: 234 ctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacg 293 Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagac 353 || ||| | ||||||||||||||| || | |||||||| Sbjct: 294 ctcatcaggcgctgcatcaaggtgtacgccgagaagac 331
>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 Length = 1253 Score = 236 bits (119), Expect = 7e-59 Identities = 182/203 (89%) Strand = Plus / Plus Query: 383 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 442 ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| |||| Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 439 Query: 443 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 502 |||||||||||||||||||||| || ||||||||||||||||| || ||||| || |||| Sbjct: 440 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 499 Query: 503 atgtggtggttccccctgggcacactggtctggatccctcccagacgtccttcttccagg 562 |||| || || |||||||| ||||||| |||||||| |||||||| || |||||||||| Sbjct: 500 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 559 Query: 563 tgcttaacattcccaccaagatt 585 |||||||||| |||||||||||| Sbjct: 560 tgcttaacatccccaccaagatt 582 Score = 174 bits (88), Expect = 2e-40 Identities = 187/220 (85%) Strand = Plus / Plus Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193 |||||||||||||| |||| ||||| ||||||||||||||||||||| ||||||| ||| Sbjct: 131 cgatggcgatcaagcggactaaggcggagaagaagatcgcgtacgacaagaagctgtgca 190 Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253 ||||||| |||||||||||||||||||||||| | |||||||| ||||| ||||||| Sbjct: 191 gcctgctcgatgagtacaccaaggtgctcatcgccctggccgacaacgtcggttccaagc 250 Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313 |||||||||| |||||| ||| ||| | || ||||| | ||||||||||| ||||||| Sbjct: 251 agctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaaca 310 Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagac 353 | || ||| | || |||||||||||| || | |||||||| Sbjct: 311 cgctcatcaggcgttgcatcaaggtgtacgccgagaagac 350 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 1 aggttaaagcgacgccgccgccgcaagccgtccgcct 37 ||||||||||||||||||||||||||||||||||||| Sbjct: 2 aggttaaagcgacgccgccgccgcaagccgtccgcct 38
>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds Length = 1247 Score = 147 bits (74), Expect = 5e-32 Identities = 149/174 (85%) Strand = Plus / Plus Query: 412 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 471 ||||||||||||||||| |||||||| | |||||||| || |||||||||||||| ||| Sbjct: 404 ttcaccaagggtgacctgaaggaggtcagtgaggaggttgctaagtacaaggttggagct 463 Query: 472 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacactggt 531 |||||||||||||| | ||||| || ||||||| || ||||| ||||| |||| || Sbjct: 464 cctgctcgtgttggtttggttgctccaattgatgtcgttgttcctcctggcaacacaggg 523 Query: 532 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 || |||||||| ||||| || ||||||||||||||||||||||| ||||||||| Sbjct: 524 ctcgatccctctcagacctctttcttccaggtgcttaacattcctaccaagatt 577 Score = 48.1 bits (24), Expect = 0.033 Identities = 57/68 (83%) Strand = Plus / Plus Query: 253 cagctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaac 312 ||||||||| | || ||||||||||| ||||| ||||| | || |||||||| |||||| Sbjct: 245 cagctccagaacattcgcaagggtcttcgcggcgactctgttgtcctcatggggaagaac 304 Query: 313 accctgat 320 ||| |||| Sbjct: 305 accatgat 312 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Plus Query: 150 gaccaaggccgagaagaagatcgcgtacga 179 ||||||||| |||||||||||||| ||||| Sbjct: 142 gaccaaggctgagaagaagatcgcttacga 171
>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome AT3G11250 mRNA, complete cds Length = 1239 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| || ||||| |||||||| || |||||||||| ||||| ||||||||||| Sbjct: 364 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 423 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || ||||||| ||| |||||||||| |||| ||||| ||||| Sbjct: 424 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 483 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || || || || || |||||||||||||||||||||||||| |||||| Sbjct: 484 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagatt 540
>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein (At3g11250) mRNA, complete cds Length = 1003 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| || ||||| |||||||| || |||||||||| ||||| ||||||||||| Sbjct: 271 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 330 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || ||||||| ||| |||||||||| |||| ||||| ||||| Sbjct: 331 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 390 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || || || || || |||||||||||||||||||||||||| |||||| Sbjct: 391 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagatt 447
>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein (At3g11250) mRNA, complete cds Length = 1174 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| || ||||| |||||||| || |||||||||| ||||| ||||||||||| Sbjct: 334 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 393 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || ||||||| ||| |||||||||| |||| ||||| ||||| Sbjct: 394 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 453 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || || || || || |||||||||||||||||||||||||| |||||| Sbjct: 454 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagatt 510
>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence Length = 1185 Score = 137 bits (69), Expect = 5e-29 Identities = 150/177 (84%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| || ||||| |||||||| || |||||||||| ||||| ||||||||||| Sbjct: 311 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 370 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || ||||||| ||| |||||||||| |||| ||||| ||||| Sbjct: 371 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 430 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || || || || || |||||||||||||||||||||||||| |||||| Sbjct: 431 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagatt 487
>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal protein P0, partial cds Length = 820 Score = 129 bits (65), Expect = 1e-26 Identities = 149/177 (84%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| ||||||||| | ||||||||||| || ||||| || ||||||||||| || Sbjct: 481 atcttcacaaagggtgacttgaaggaggttcgtgaagaggttgctaagtacaaggtcgga 540 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || ||||||||||| || || ||||| ||||| Sbjct: 541 gcacctgctcgtgtcggtttggtggctccagttgatgtggttgtccctcctggcaacact 600 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || || ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 601 ggtcttgacccatctcagacctctttcttccaggtgcttaacattcccaccaagatt 657 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 154 aaggccgagaagaagatcgcgtacgaccagaagctctgccag 195 ||||| || ||||||||||| ||||| ||||||||||||||| Sbjct: 226 aaggctgataagaagatcgcttacgatcagaagctctgccag 267
>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein P0, complete cds, clone: C2319 Length = 1345 Score = 123 bits (62), Expect = 7e-25 Identities = 146/174 (83%) Strand = Plus / Plus Query: 412 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 471 ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| ||| Sbjct: 433 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 492 Query: 472 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacactggt 531 |||||||||||||| | ||||| || ||||||| || || || ||||| |||| || Sbjct: 493 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 552 Query: 532 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 || || || |||||||| || |||||||||||||||||||| |||||||||||| Sbjct: 553 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagatt 606
>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein P0, complete cds, clone: C212 Length = 1326 Score = 123 bits (62), Expect = 7e-25 Identities = 146/174 (83%) Strand = Plus / Plus Query: 412 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 471 ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| ||| Sbjct: 440 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 499 Query: 472 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacactggt 531 |||||||||||||| | ||||| || ||||||| || || || ||||| |||| || Sbjct: 500 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 559 Query: 532 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 || || || |||||||| || |||||||||||||||||||| |||||||||||| Sbjct: 560 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagatt 613
>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA, complete cds Length = 1254 Score = 121 bits (61), Expect = 3e-24 Identities = 148/177 (83%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||||||||||||||||||||| || | ||||| ||||| |||||||||||||| Sbjct: 437 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 496 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || |||||||||||||| | || || || |||||||| || || || ||||| ||||| Sbjct: 497 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 556 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||| Sbjct: 557 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagatt 613
>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds Length = 1127 Score = 121 bits (61), Expect = 3e-24 Identities = 148/177 (83%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||||||||||||||| |||||||| || | || ||||| ||||||||||||||||| Sbjct: 265 atcttcaccaagggtgatctcaaggaagtcagtgaagaggttgccaagtacaaggttgga 324 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || |||||||||||||| | ||||| || |||||||||| || || ||||| |||| Sbjct: 325 gcccctgctcgtgttggtttggttgctccaattgatgtggttgtcccacctggcaacaca 384 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 || || || || |||||||| || ||||||||||| ||||||||||| ||||||||| Sbjct: 385 gggctcgacccttcccagacctctttcttccaggtccttaacattcctaccaagatt 441 Score = 42.1 bits (21), Expect = 2.0 Identities = 42/49 (85%) Strand = Plus / Plus Query: 152 ccaaggccgagaagaagatcgcgtacgaccagaagctctgccagttgct 200 ||||||| |||||||||||||| || || ||||||||||||||||| Sbjct: 8 ccaaggctgagaagaagatcgcttatgatgctaagctctgccagttgct 56
>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA, complete cds Length = 1253 Score = 121 bits (61), Expect = 3e-24 Identities = 148/177 (83%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||||||||||||||||||||| || | ||||| ||||| |||||||||||||| Sbjct: 415 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 474 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || |||||||||||||| | || || || |||||||| || || || ||||| ||||| Sbjct: 475 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 534 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||| Sbjct: 535 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagatt 591
>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1185 Score = 113 bits (57), Expect = 7e-22 Identities = 147/177 (83%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| ||| |||||||||| || |||||||||||||| Sbjct: 325 atctttaccaaaggtgacctcaaggaagttagcgaggaggttgctaagtacaaggttggt 384 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 385 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 444 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 445 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 501
>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome AT3G09200 mRNA, complete cds Length = 1307 Score = 105 bits (53), Expect = 2e-19 Identities = 146/177 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 517
>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0 (At3g09200) mRNA, complete cds Length = 994 Score = 105 bits (53), Expect = 2e-19 Identities = 146/177 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 271 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 330 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 331 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 390 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 391 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 447
>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0 (At3g09200) mRNA, complete cds Length = 1160 Score = 105 bits (53), Expect = 2e-19 Identities = 146/177 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 517
>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZG11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1136 Score = 105 bits (53), Expect = 2e-19 Identities = 146/177 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||||| Sbjct: 308 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 367 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 368 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 427 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 428 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 484
>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein Length = 1332 Score = 99.6 bits (50), Expect = 1e-17 Identities = 113/134 (84%) Strand = Plus / Plus Query: 452 ccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtgg 511 |||||||||||||||| |||||||||||| |||| | |||||||| ||||||| || | Sbjct: 556 ccaagtacaaggttggagctcctgctcgttttggtttggttgcaccaattgatgttgttg 615 Query: 512 ttccccctgggcacactggtctggatccctcccagacgtccttcttccaggtgcttaaca 571 | || || || |||||||||| || ||||||||||| || ||||||||||| ||||||| Sbjct: 616 tcccaccaggcaacactggtcttgacccctcccagacatctttcttccaggttcttaaca 675 Query: 572 ttcccaccaagatt 585 | ||||| |||||| Sbjct: 676 tccccactaagatt 689 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 151 accaaggccgagaagaagatcgcgtacgaccagaagctctgcca 194 |||||||| |||||||||||||| ||||| |||||||| ||||| Sbjct: 255 accaaggctgagaagaagatcgcatacgatcagaagctatgcca 298
>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome AT2G40010 mRNA, complete cds Length = 1153 Score = 97.6 bits (49), Expect = 4e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| ||||||||| | ||||| || | || ||||| || |||||||||||||| Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || |||| || || |||||||||| || | || || ||||| Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaa 581 ||||| || || || ||||| |||||||||||||||||||||||||| ||||| Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaa 446
>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence Length = 1373 Score = 97.6 bits (49), Expect = 4e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| ||||||||| | ||||| || | || ||||| || |||||||||||||| Sbjct: 478 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 537 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || |||| || || |||||||||| || | || || ||||| Sbjct: 538 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 597 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaa 581 ||||| || || || ||||| |||||||||||||||||||||||||| ||||| Sbjct: 598 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaa 650
>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB74ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 97.6 bits (49), Expect = 4e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| ||||||||| | ||||| || | || ||||| || |||||||||||||| Sbjct: 130 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 189 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || |||| || || |||||||||| || | || || ||||| Sbjct: 190 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 249 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaa 581 ||||| || || || ||||| |||||||||||||||||||||||||| ||||| Sbjct: 250 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaa 302
>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence Length = 1199 Score = 97.6 bits (49), Expect = 4e-17 Identities = 145/177 (81%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 ||||| ||||| |||||||||||||| || |||||||||| || ||||||||||| || Sbjct: 339 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtcggt 398 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 || ||||||||||| || | || || || |||||||||| || | ||||| ||||| Sbjct: 399 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 458 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagatt 585 ||||| || || ||||| || || |||||||||||||||||||| || ||||||||| Sbjct: 459 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagatt 515
>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal protein P0 (At2g40010) mRNA, complete cds Length = 985 Score = 97.6 bits (49), Expect = 4e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 468 |||||||| ||||||||| | ||||| || | || ||||| || |||||||||||||| Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333 Query: 469 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctgggcacact 528 |||||||||||||| || |||| || || |||||||||| || | || || ||||| Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393 Query: 529 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaa 581 ||||| || || || ||||| |||||||||||||||||||||||||| ||||| Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaa 446
>emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein Length = 1393 Score = 87.7 bits (44), Expect = 4e-14 Identities = 128/156 (82%) Strand = Plus / Plus Query: 430 aaggaggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggcta 489 ||||||||| ||||||| || || ||||||||||| || |||||||| ||||||| | Sbjct: 451 aaggaggttagcgaggaagttgctaagtacaaggtcggagctcctgcctgtgttggtttg 510 Query: 490 gttgcacctgttgatgtggtggttccccctgggcacactggtctggatccctcccagacg 549 ||||| || ||||||| || || || || || ||||||| || ||||| || ||||| Sbjct: 511 gttgctccaattgatgttgttgtccctccaggcaacactgggctcgatccatctcagacc 570 Query: 550 tccttcttccaggtgcttaacattcccaccaagatt 585 || |||||||||||||| |||||||||||||||||| Sbjct: 571 tctttcttccaggtgctcaacattcccaccaagatt 606 Score = 40.1 bits (20), Expect = 8.0 Identities = 47/56 (83%) Strand = Plus / Plus Query: 235 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactc 290 |||||||| || || |||||||||||| | || ||| ||||||| || |||||||| Sbjct: 256 gacaatgttggttcaaagcagctccagaacattcgccagggtctacgtggtgactc 311
>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete sequence Length = 108847 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| |||||||||||||| || |||| || || |||||||||| || | || | Sbjct: 77949 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 77890 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 580 | |||||||||| || || || ||||| |||||||||||||||||||||||||| |||| Sbjct: 77889 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 77830 Query: 581 a 581 | Sbjct: 77829 a 77829
>emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH39ZH02 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1296 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| |||||||||||||| || |||| || || |||||||||| || | || | Sbjct: 1148 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 1089 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 580 | |||||||||| || || || ||||| |||||||||||||||||||||||||| |||| Sbjct: 1088 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 1029 Query: 581 a 581 | Sbjct: 1028 a 1028
>gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence Length = 820 Score = 63.9 bits (32), Expect = 5e-07 Identities = 64/72 (88%), Gaps = 2/72 (2%) Strand = Plus / Plus Query: 514 ccccctgggcacactggtctggatccctcccagacgtccttcttccaggtgcttaacatt 573 |||||||| ||||||| ||||||||||||||||| || ||||| ||||||| |||||| Sbjct: 14 ccccctggcaacactgggctggatccctcccagacctctttctt-caggtgc-taacatc 71 Query: 574 cccaccaagatt 585 |||||||||||| Sbjct: 72 cccaccaagatt 83
>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete sequence Length = 103517 Score = 61.9 bits (31), Expect = 2e-06 Identities = 85/103 (82%) Strand = Plus / Plus Query: 461 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 520 ||||||| |||||||||||||| || ||||||| ||| |||||||||| |||| |||| Sbjct: 59147 aggttggtgctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctg 59206 Query: 521 ggcacactggtctggatccctcccagacgtccttcttccaggt 563 | |||||||||| || || || || || || ||||||||||| Sbjct: 59207 gcaacactggtcttgacccatctcaaacatcgttcttccaggt 59249 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Plus Query: 560 aggtgcttaacattcccaccaagatt 585 ||||||||||||||||||| |||||| Sbjct: 59343 aggtgcttaacattcccactaagatt 59368
>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence, complete sequence Length = 106688 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 465 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||| Sbjct: 21237 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 21181
>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete sequence Length = 85561 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 409 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 465 ||||| ||||| |||||||||||||| || |||||||||| || |||||||||||| Sbjct: 85560 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 85504
>gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds Length = 1118 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 235 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 294 |||||||| |||||||||||| | ||| ||||||||| | ||||||||| | || | Sbjct: 147 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 206 Query: 295 gtgctcatgggcaagaacaccctgat 320 ||||| ||||||||||||||| |||| Sbjct: 207 gtgctgatgggcaagaacaccatgat 232
>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein (rpp0 gene) Length = 608 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 292 atcgtgctcatgggcaagaacaccctgat 320 |||||||||||||||||||||||| |||| Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182
>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds Length = 1081 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 292 atcgtgctcatgggcaagaacaccctgat 320 |||||||||||||||||||||||| |||| Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255
>dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I antigen, partial cds and promoter region Length = 3861 Score = 50.1 bits (25), Expect = 0.008 Identities = 34/37 (91%) Strand = Plus / Plus Query: 235 gacaatgtcggctccaagcagctccaggagatccgca 271 |||||||| |||||||||||| | ||||||||||||| Sbjct: 1649 gacaatgtgggctccaagcagatgcaggagatccgca 1685
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 580972 cccagacgtccttcttccaggcgctgaacatt 581003 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 578573 cccagacgtccttcttccaggcgctgaacatt 578604
>gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ribosomal protein mRNA, partial cds Length = 1147 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 397 cccagacgtccttcttccaggcgctgaacatt 428
>ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit protein (LMJ_0399) partial mRNA Length = 972 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 419 cccagacgtccttcttccaggcgctgaacatt 450
>ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit protein (LMJ_0400) partial mRNA Length = 972 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 419 cccagacgtccttcttccaggcgctgaacatt 450
>ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic ribosomal phosphoprotein P0 (LOC587264), mRNA Length = 533 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 293 tcgtgctcatgggcaagaacaccctgatccgc 324 |||| |||||||||||||||||| |||||||| Sbjct: 196 tcgtcctcatgggcaagaacaccatgatccgc 227 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 235 gacaatgtcggctccaagcag 255 ||||||||||||||||||||| Sbjct: 138 gacaatgtcggctccaagcag 158
>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320 ||||||||| | |||||||||| ||||||||||||||| |||| Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 48.1 bits (24), Expect = 0.033 Identities = 33/36 (91%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgatccgcc 325 |||||||||| ||||||||||||||| |||| |||| Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271
>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 941 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320 ||||||||| | |||||||||| ||||||||||||||| |||| Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 598 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320 ||||||||| | |||||||||| ||||||||||||||| |||| Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320 ||||||||| | |||||||||| ||||||||||||||| |||| Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243
>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320 ||||||||| | |||||||||| ||||||||||||||| |||| Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257
>ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic ribosomal phosphoprotein P0 (LOC590099), mRNA Length = 198 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 293 tcgtgctcatgggcaagaacaccctgatccgc 324 |||| |||||||||||||||||| |||||||| Sbjct: 119 tcgtcctcatgggcaagaacaccatgatccgc 150 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 235 gacaatgtcggctccaagcag 255 ||||||||||||||||||||| Sbjct: 61 gacaatgtcggctccaagcag 81
>emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene Length = 3790 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 3032 cccagacgtccttcttccaggcgctgaacatt 3063 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 663 cccagacgtccttcttccaggcgctgaacatt 694
>gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRNA, complete sequence Length = 1664 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 452 cccagacgtccttcttccaggcgctgaacatt 483
>gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal protein P0 gene, complete cds Length = 1373 Score = 48.1 bits (24), Expect = 0.033 Identities = 30/32 (93%) Strand = Plus / Plus Query: 542 cccagacgtccttcttccaggtgcttaacatt 573 ||||||||||||||||||||| ||| |||||| Sbjct: 496 cccagacgtccttcttccaggcgctgaacatt 527
>ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosomal protein P0 (AN2734.2), mRNA Length = 939 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Plus Query: 397 aacgttggcctcatcttcaccaagggtgacctcaaggag 435 |||||||| ||||||||||||| || |||||||||||| Sbjct: 247 aacgttggtttcatcttcaccaacggcgacctcaaggag 285
>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 812 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204
>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266
>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 784 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241
>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276
>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1068 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263
>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 290 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 91 ccatcgtgctgatgggcaagaacaccatgat 121
>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241
>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1033 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267
>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 809 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236
>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 515 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1029 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1014 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263
>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 55 ccatcgtgctgatgggcaagaacaccatgat 85
>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255
>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 837 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132
>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245
>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260
>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260
>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 775 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250
>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260
>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1063 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277
>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 377 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249
>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271
>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 455 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263
>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1037 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283
>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264
>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 753 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275
>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1059 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261
>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51DB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 374 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 52 ccatcgtgctgatgggcaagaacaccatgat 82
>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 690 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 335 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236
>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1021 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264
>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1014 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263
>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 340 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179
>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 722 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 642 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234
>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1054 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270
>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 349 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233
>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 731 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252
>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268
>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 999 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236
>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 540 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248
>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237
>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820
>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231
>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 500 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250
>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 693 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201
>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134
>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1057 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1009 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741
>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341
>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1073 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 304 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1031 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255
>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 467 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 380 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277
>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261
>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760
>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1029 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277
>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1059 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 439 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 92 ccatcgtgctgatgggcaagaacaccatgat 122
>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854
>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 198 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 881 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264
>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229
>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1039 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246
>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133
>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204
>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206
>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253
>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1052 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255
>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 689 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244
>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235
>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239
>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755
>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202
>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 997 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248
>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756
>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1032 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356
>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1047 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX060185.1|CNS09ILP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1050 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246
>emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX059866.1|CNS09ICU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245
>emb|BX059758.1|CNS09I9U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX059741.1|CNS09I9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269
>emb|BX059642.1|CNS09I6M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 430 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232
>emb|BX059587.1|CNS09I53 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267
>emb|BX059585.1|CNS09I51 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 152 ccatcgtgctgatgggcaagaacaccatgat 182
>emb|BX059469.1|CNS09I1T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268
>emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 108 ccatcgtgctgatgggcaagaacaccatgat 138
>emb|BX059220.1|CNS09HUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1011 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254
>emb|BX059184.1|CNS09HTW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1045 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248
>emb|BX059095.1|CNS09HRF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 678 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235
>emb|BX058839.1|CNS09HKB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1035 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1026 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236
>emb|BX058740.1|CNS09HHK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244
>emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237
>emb|BX058315.1|CNS09H5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 557 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247
>emb|BX058203.1|CNS09H2N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX056754.1|CNS09FYE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201
>emb|BX057924.1|CNS09GUW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1054 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269
>emb|BX057796.1|CNS09GRC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 541 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256
>emb|BX057631.1|CNS09GMR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 415 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 88 ccatcgtgctgatgggcaagaacaccatgat 118
>emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 480 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 159 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 87 ccatcgtgctgatgggcaagaacaccatgat 117
>emb|BX057218.1|CNS09GBA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 826 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273
>emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 455 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX057133.1|CNS09G8X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 780 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264
>emb|BX057094.1|CNS09G7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 287 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261
>emb|BX057074.1|CNS09G7A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 457 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232
>emb|BX056996.1|CNS09G54 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265
>emb|BX056958.1|CNS09G42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX056914.1|CNS09G2U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 609 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266
>emb|BX056483.1|CNS09FQV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 671 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 162 ccatcgtgctgatgggcaagaacaccatgat 192
>emb|BX055960.1|CNS09FCC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 496 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX055808.1|CNS09F84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1041 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276
>emb|BX056320.1|CNS09FMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239
>emb|BX056288.1|CNS09FLG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 889 ccatcgtgctgatgggcaagaacaccatgat 859
>emb|BX056287.1|CNS09FLF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267
>emb|BX056283.1|CNS09FLB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 856 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 98 ccatcgtgctgatgggcaagaacaccatgat 128
>emb|BX055999.1|CNS09FDF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 771 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 190 ccatcgtgctgatgggcaagaacaccatgat 220
>emb|BX055725.1|CNS09F5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255
>emb|BX055721.1|CNS09F5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272
>emb|BX055621.1|CNS09F2X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 450 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255
>emb|BX055603.1|CNS09F2F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 599 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271
>emb|BX055567.1|CNS09F1F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272
>emb|BX053214.1|CNS09D82 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX053185.1|CNS09D79 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 362 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX053146.1|CNS09D66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 761 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX052948.1|CNS09D0O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240
>emb|BX052946.1|CNS09D0M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259
>emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246
>emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX054345.1|CNS09E3H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 776 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 188 ccatcgtgctgatgggcaagaacaccatgat 218
>emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273
>emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 969 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266
>emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260
>emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268
>emb|BX053890.1|CNS09DQU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 800 ccatcgtgctgatgggcaagaacaccatgat 770
>emb|BX053889.1|CNS09DQT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 282 ccatcgtgctgatgggcaagaacaccatgat 312
>emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 881 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 248 ccatcgtgctgatgggcaagaacaccatgat 278
>emb|BX053704.1|CNS09DLO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271
>emb|BX053693.1|CNS09DLD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273
>emb|BX053532.1|CNS09DGW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 761 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244
>emb|BX052874.1|CNS09CYM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257
>emb|BX052836.1|CNS09CXK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 310 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 209
>emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 772 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 86 ccatcgtgctgatgggcaagaacaccatgat 116
>emb|BX052777.1|CNS09CVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 912 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234
>emb|BX052724.1|CNS09CUG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258
>emb|BX052368.1|CNS09CKK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 939 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251
>emb|BX052263.1|CNS09CHN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320 |||||||||| ||||||||||||||| |||| Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,323,676 Number of Sequences: 3902068 Number of extensions: 4323676 Number of successful extensions: 96436 Number of sequences better than 10.0: 1070 Number of HSP's better than 10.0 without gapping: 1070 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92791 Number of HSP's gapped (non-prelim): 3619 length of query: 585 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 562 effective length of database: 17,143,297,704 effective search space: 9634533309648 effective search space used: 9634533309648 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
