ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart18g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_483854.1| Oryza sativa (japonica cultivar-group), mRNA 212 1e-51
2dbj|AK065186.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 1e-51
3gb|AY103941.1| Zea mays PCO095480 mRNA sequence 84 6e-13
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
5dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
6gb|AF024533.1| Homo sapiens cosmid 123E15, complete sequence 42 2.1
7gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 2.1
8gb|AC005086.2| Homo sapiens BAC clone CTA-305I2 from 7, complete... 42 2.1
9gb|AC145919.3| Pan troglodytes BAC clone RP43-10A14 from 7, comp... 42 2.1
10gb|AC148297.3| Pan troglodytes BAC clone CH251-542K24 from chrom... 42 2.1
11gb|AC096679.3| Pan troglodytes clone RP43-142I13, complete sequence 42 2.1
12emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B1... 42 2.1
13gb|AC147646.2| Gallus gallus BAC clone CH261-13L1 from chromosom... 42 2.1
14gb|AC092140.4| Homo sapiens chromosome 16 clone RP11-413H22, com... 40 8.2
15emb|CR942271.10| Human DNA sequence from clone DAMC-325F20 on ch... 40 8.2
16gb|AF211176.2| Botryotinia fuckeliana cystathionine beta-lyase (... 40 8.2
17emb|AL805917.3| Human DNA sequence from clone DAQB-10J12 on chro... 40 8.2
18emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chr... 40 8.2
19emb|AL662848.6| Human DNA sequence from clone XXbac-111D4 on chr... 40 8.2
20gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 8.2
21gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 8.2
22emb|BX323006.12| Zebrafish DNA sequence from clone CH211-145H19 ... 40 8.2
23emb|CR388215.10| Human DNA sequence from clone DADB-91G1 on chro... 40 8.2
24dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113 40 8.2
25gb|AC091928.3| Homo sapiens chromosome 5 clone RP11-292F10, comp... 40 8.2
26emb|BX927194.9| Human DNA sequence from clone DAMA-342O2 on chro... 40 8.2
27gb|AC022161.8| Homo sapiens chromosome 16 clone RP11-273P11, com... 40 8.2
28emb|AL111267.1|CNS0196Z Botrytis cinerea strain T4 cDNA library 40 8.2
29gb|AC009102.10| Homo sapiens chromosome 16 clone RP11-441F2, com... 40 8.2
30gb|AC164654.3| Gallus gallus BAC clone CH261-5H7 from chromosome... 40 8.2
31dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 8.2
32dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 40 8.2
33dbj|AB164631.1| Streptomyces griseus AdBS2 gene cluster (orf6-Ad... 40 8.2
34emb|BX088547.12| Zebrafish DNA sequence from clone DKEY-238O14, ... 40 8.2
35gb|AC006167.1|AC006167 Homo sapiens clone UWGC:y67c092 from 6p21... 40 8.2
36dbj|AB023050.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 40 8.2

>ref|XM_483854.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1538

 Score =  212 bits (107), Expect = 1e-51
 Identities = 274/329 (83%), Gaps = 3/329 (0%)
 Strand = Plus / Plus

                                                                       
Query: 188 gccgccttcatcgatggcgcgtcgcaccgctacctgcgggatcagcaagac---gaccag 244
           ||||||||| |||||| |||||||| |||||||||||||||||||||| ||   ||||||
Sbjct: 309 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaacaccacgaccag 368

                                                                       
Query: 245 gccacgtccatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggctttgca 304
           ||| | || |||||||| ||  |||||||||| |||||||||||||||||||| ||||||
Sbjct: 369 gccgcttcaatgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgca 428

                                                                       
Query: 305 ccatctgccatgcttcctgcaccttcttctgcaaagttaaataagctgctactgccaaaa 364
           ||| |  ||  ||| |||||||  |||||| |||||||| | |||||| |||| || || 
Sbjct: 429 ccaccaccctcgctacctgcacaatcttcttcaaagttagacaagctgttactccctaac 488

                                                                       
Query: 365 ccatttgacaggcctcgtgctgttttcttggtgcaaattgatggatcccatgactctgtt 424
           ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| ||| |||
Sbjct: 489 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatgcctccgtt 548

                                                                       
Query: 425 gatagcttcatatctgatgctggtagtgtttacaaaaccaagattgatagtgcaaaaaat 484
           || ||| ||| |||||| ||||||||  | | ||||||||  |||||| ||  ||   ||
Sbjct: 549 gaaagcatcacatctgaagctggtagcatcttcaaaaccactattgatggtctaagcgat 608

                                        
Query: 485 gctgctacagggcttacagataaggatga 513
            ||||||||||||||||||||||||||||
Sbjct: 609 tctgctacagggcttacagataaggatga 637



to top

>dbj|AK065186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002D24, full
           insert sequence
          Length = 1538

 Score =  212 bits (107), Expect = 1e-51
 Identities = 274/329 (83%), Gaps = 3/329 (0%)
 Strand = Plus / Plus

                                                                       
Query: 188 gccgccttcatcgatggcgcgtcgcaccgctacctgcgggatcagcaagac---gaccag 244
           ||||||||| |||||| |||||||| |||||||||||||||||||||| ||   ||||||
Sbjct: 309 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaacaccacgaccag 368

                                                                       
Query: 245 gccacgtccatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggctttgca 304
           ||| | || |||||||| ||  |||||||||| |||||||||||||||||||| ||||||
Sbjct: 369 gccgcttcaatgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgca 428

                                                                       
Query: 305 ccatctgccatgcttcctgcaccttcttctgcaaagttaaataagctgctactgccaaaa 364
           ||| |  ||  ||| |||||||  |||||| |||||||| | |||||| |||| || || 
Sbjct: 429 ccaccaccctcgctacctgcacaatcttcttcaaagttagacaagctgttactccctaac 488

                                                                       
Query: 365 ccatttgacaggcctcgtgctgttttcttggtgcaaattgatggatcccatgactctgtt 424
           ||||||||||| || || |||||||||||| ||||||| ||||||| ||||| ||| |||
Sbjct: 489 ccatttgacagaccacgggctgttttcttgctgcaaatcgatggattccatgcctccgtt 548

                                                                       
Query: 425 gatagcttcatatctgatgctggtagtgtttacaaaaccaagattgatagtgcaaaaaat 484
           || ||| ||| |||||| ||||||||  | | ||||||||  |||||| ||  ||   ||
Sbjct: 549 gaaagcatcacatctgaagctggtagcatcttcaaaaccactattgatggtctaagcgat 608

                                        
Query: 485 gctgctacagggcttacagataaggatga 513
            ||||||||||||||||||||||||||||
Sbjct: 609 tctgctacagggcttacagataaggatga 637



to top

>gb|AY103941.1| Zea mays PCO095480 mRNA sequence
          Length = 1596

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 101/122 (82%), Gaps = 9/122 (7%)
 Strand = Plus / Plus

                                                                       
Query: 485 gctgctacagggcttacagataaggatgaattgattgtcattcgttcagatgaatct--- 541
           |||| |||||||||||||||||||||||| || |||||||||| |||||||||||||   
Sbjct: 519 gctgatacagggcttacagataaggatgacttaattgtcattcattcagatgaatctcta 578

                                                                       
Query: 542 ------tctggatcaggtgttcttgataatgaactgaccaacttggcaacctggttggag 595
                 ||| |||||| |  |||||||||||||||  ||| |||||||| ||||||||||
Sbjct: 579 gatctctctcgatcagattatcttgataatgaactttccagcttggcaaactggttggag 638

             
Query: 596 gg 597
           ||
Sbjct: 639 gg 640



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 103/124 (83%), Gaps = 3/124 (2%)
 Strand = Plus / Plus

                                                                       
Query: 186 ccgccgccttcatcgatggcgcgtcgcaccgctacctgcgggatcagcaa---gacgacc 242
           |||||| ||||||||||| | |||||||||||||||| ||||| ||||||   ||| |||
Sbjct: 223 ccgccgtcttcatcgatgcctcgtcgcaccgctaccttcgggaccagcaagccgaccacc 282

                                                                       
Query: 243 aggccacgtccatgtcacttgatgaagtttctgcagctgtttctgtcttgcttggctttg 302
           ||| | | || |||||  |  ||||||||||||| | |||||||||||||||||| || |
Sbjct: 283 aggacgcttcaatgtcgttaaatgaagtttctgcggttgtttctgtcttgcttggtttcg 342

               
Query: 303 cacc 306
           ||||
Sbjct: 343 cacc 346



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 365 ccatttgacaggcctcgtgctgttttcttggtgcaaattgatgg 408
           |||||||| || || |||||||||||| | ||||||||||||||
Sbjct: 405 ccatttgatagaccgcgtgctgttttcctcgtgcaaattgatgg 448



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                                
Query: 188      gccgccttcatcgatggcgcgtcgcaccgctacctgcgggatcagcaa 235
                ||||||||| |||||| |||||||| ||||||||||||||||||||||
Sbjct: 28387126 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaa 28387173



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                      
Query: 254      atgtcacttgatgaagtttctgcagctgtttctgtcttgcttggctttgcacca 307
                |||||||| ||  |||||||||| |||||||||||||||||||| |||||||||
Sbjct: 28387363 atgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgcacca 28387416



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                            
Query: 347      aagctgctactgccaaaaccatttgacaggcctcgtgctgttttcttggtgcaaattgat 406
                |||||| |||| || || ||||||||||| || || |||||||||||| ||||||| |||
Sbjct: 28387540 aagctgttactccctaacccatttgacagaccacgggctgttttcttgctgcaaatcgat 28387599

                          
Query: 407      ggatcccatg 416
                |||| |||||
Sbjct: 28387600 ggattccatg 28387609



to top

>dbj|AP005411.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0044E16
          Length = 153296

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                              
Query: 188    gccgccttcatcgatggcgcgtcgcaccgctacctgcgggatcagcaa 235
              ||||||||| |||||| |||||||| ||||||||||||||||||||||
Sbjct: 115932 gccgccttcgtcgatgccgcgtcgcgccgctacctgcgggatcagcaa 115979



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                    
Query: 254    atgtcacttgatgaagtttctgcagctgtttctgtcttgcttggctttgcacca 307
              |||||||| ||  |||||||||| |||||||||||||||||||| |||||||||
Sbjct: 116169 atgtcactagaccaagtttctgcggctgtttctgtcttgcttggttttgcacca 116222



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                          
Query: 347    aagctgctactgccaaaaccatttgacaggcctcgtgctgttttcttggtgcaaattgat 406
              |||||| |||| || || ||||||||||| || || |||||||||||| ||||||| |||
Sbjct: 116346 aagctgttactccctaacccatttgacagaccacgggctgttttcttgctgcaaatcgat 116405

                        
Query: 407    ggatcccatg 416
              |||| |||||
Sbjct: 116406 ggattccatg 116415



to top

>gb|AF024533.1| Homo sapiens cosmid 123E15, complete sequence
          Length = 84912

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 387   ttttcttggtgcaaattgatg 407
             |||||||||||||||||||||
Sbjct: 51894 ttttcttggtgcaaattgatg 51914



to top

>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete
             sequence
          Length = 214292

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 489   ctacagggcttacagataagg 509
             |||||||||||||||||||||
Sbjct: 83347 ctacagggcttacagataagg 83367



to top

>gb|AC005086.2| Homo sapiens BAC clone CTA-305I2 from 7, complete sequence
          Length = 129586

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 387    ttttcttggtgcaaattgatg 407
              |||||||||||||||||||||
Sbjct: 122763 ttttcttggtgcaaattgatg 122743



to top

>gb|AC145919.3| Pan troglodytes BAC clone RP43-10A14 from 7, complete sequence
          Length = 174235

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 387   ttttcttggtgcaaattgatg 407
             |||||||||||||||||||||
Sbjct: 75729 ttttcttggtgcaaattgatg 75709



to top

>gb|AC148297.3| Pan troglodytes BAC clone CH251-542K24 from chromosome 7, complete
             sequence
          Length = 192516

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 387   ttttcttggtgcaaattgatg 407
             |||||||||||||||||||||
Sbjct: 42538 ttttcttggtgcaaattgatg 42518



to top

>gb|AC096679.3| Pan troglodytes clone RP43-142I13, complete sequence
          Length = 194020

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 387    ttttcttggtgcaaattgatg 407
              |||||||||||||||||||||
Sbjct: 110447 ttttcttggtgcaaattgatg 110427



to top

>emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B10, complete sequence
          Length = 182378

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 333    ctgcaaagttaaataagctgc 353
              |||||||||||||||||||||
Sbjct: 139516 ctgcaaagttaaataagctgc 139496



to top

>gb|AC147646.2| Gallus gallus BAC clone CH261-13L1 from chromosome unknown, complete
              sequence
          Length = 238934

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 285    ctgtcttgcttggctttgcaccatc 309
              ||||||| |||||||||||||||||
Sbjct: 143501 ctgtcttacttggctttgcaccatc 143525



to top

>gb|AC092140.4| Homo sapiens chromosome 16 clone RP11-413H22, complete sequence
          Length = 193188

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 439  tgatgctggtagtgtttaca 458
            ||||||||||||||||||||
Sbjct: 5464 tgatgctggtagtgtttaca 5445



to top

>emb|CR942271.10| Human DNA sequence from clone DAMC-325F20 on chromosome 6, complete
            sequence
          Length = 52666

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 553  tgttcttgataatgaactga 572
            ||||||||||||||||||||
Sbjct: 2300 tgttcttgataatgaactga 2281



to top

>gb|AF211176.2| Botryotinia fuckeliana cystathionine beta-lyase (metC) gene,
           complete cds
          Length = 2921

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 261 ttgatgaagtttctgcagct 280
           ||||||||||||||||||||
Sbjct: 397 ttgatgaagtttctgcagct 378



to top

>emb|AL805917.3| Human DNA sequence from clone DAQB-10J12 on chromosome 6 Contains the
             TIGD1L gene for tigger transposable element derived
             1-like, the 5' end of the C6orf214 gene for chromosome 6
             open reading frame 214, the 5' end of the DDR1 gene for
             discoidin domain receptor family, member 1, and 1 CpG
             island, complete sequence
          Length = 65373

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 553   tgttcttgataatgaactga 572
             ||||||||||||||||||||
Sbjct: 22037 tgttcttgataatgaactga 22018



to top

>emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chromosome 6 contains the 3'
              end of a putative novel transcript, the NRM gene for nurim
              (nuclear envelope membrane protein), a ribosomal protein L7
              (RPL7) pseudogene, the gene for KIAA0170 protein, the TUBB
              gene for tubulin, beta polypeptide, the FLOT1 gene for
              flotillin 1, the IER3 gene for immediate early response 3,
              a putative novel transcript and five CpG islands, complete
              sequence
          Length = 171627

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 553    tgttcttgataatgaactga 572
              ||||||||||||||||||||
Sbjct: 164878 tgttcttgataatgaactga 164859



to top

>emb|AL662848.6| Human DNA sequence from clone XXbac-111D4 on chromosome 6 contains a
              ribosomal protein L7 (RPL7) pseudogene, the gene for
              KIAA0170 protein, the TUBB gene for tubulin, beta
              polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene
              for immediate early response 3 , two putative novel
              transcripts and three CpG islands, complete sequence
          Length = 185617

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 553    tgttcttgataatgaactga 572
              ||||||||||||||||||||
Sbjct: 149973 tgttcttgataatgaactga 149954



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    atgccgccgccttcatcgat 202
              ||||||||||||||||||||
Sbjct: 751815 atgccgccgccttcatcgat 751796



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 189     ccgccttcatcgatggcgcgtcgc 212
               ||||||||||| ||||||||||||
Sbjct: 1759053 ccgccttcatccatggcgcgtcgc 1759030



to top

>emb|BX323006.12| Zebrafish DNA sequence from clone CH211-145H19 in linkage group 15,
              complete sequence
          Length = 161776

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ttctgcagctgtttctgtct 290
              ||||||||||||||||||||
Sbjct: 129193 ttctgcagctgtttctgtct 129212



to top

>emb|CR388215.10| Human DNA sequence from clone DADB-91G1 on chromosome 6, complete
             sequence
          Length = 112744

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 553   tgttcttgataatgaactga 572
             ||||||||||||||||||||
Sbjct: 99088 tgttcttgataatgaactga 99069



to top

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 579    tggcaacctggttggagggt 598
              ||||||||||||||||||||
Sbjct: 529182 tggcaacctggttggagggt 529163



to top

>gb|AC091928.3| Homo sapiens chromosome 5 clone RP11-292F10, complete sequence
          Length = 200923

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 529   ttcagatgaatcttctggatcagg 552
             ||||||||||||||||| ||||||
Sbjct: 45425 ttcagatgaatcttctgaatcagg 45448



to top

>emb|BX927194.9| Human DNA sequence from clone DAMA-342O2 on chromosome 6, complete
             sequence
          Length = 110208

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 553   tgttcttgataatgaactga 572
             ||||||||||||||||||||
Sbjct: 15652 tgttcttgataatgaactga 15633



to top

>gb|AC022161.8| Homo sapiens chromosome 16 clone RP11-273P11, complete sequence
          Length = 181541

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 439    tgatgctggtagtgtttaca 458
              ||||||||||||||||||||
Sbjct: 116441 tgatgctggtagtgtttaca 116422



to top

>emb|AL111267.1|CNS0196Z Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 261 ttgatgaagtttctgcagct 280
           ||||||||||||||||||||
Sbjct: 261 ttgatgaagtttctgcagct 280



to top

>gb|AC009102.10| Homo sapiens chromosome 16 clone RP11-441F2, complete sequence
          Length = 183394

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 439   tgatgctggtagtgtttaca 458
             ||||||||||||||||||||
Sbjct: 85557 tgatgctggtagtgtttaca 85576



to top

>gb|AC164654.3| Gallus gallus BAC clone CH261-5H7 from chromosome unknown, complete
              sequence
          Length = 250515

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 435    tatctgatgctggtagtgtt 454
              ||||||||||||||||||||
Sbjct: 139940 tatctgatgctggtagtgtt 139959



to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 553     tgttcttgataatgaactga 572
               ||||||||||||||||||||
Sbjct: 1100372 tgttcttgataatgaactga 1100391



to top

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 553    tgttcttgataatgaactga 572
              ||||||||||||||||||||
Sbjct: 674493 tgttcttgataatgaactga 674512



to top

>dbj|AB164631.1| Streptomyces griseus AdBS2 gene cluster (orf6-AdBS2, orf5-AdBS2,
            orf1-AdBS2, orf2-AdBS2, orf3-AdBS2, orf4-AdBS2), complete
            and partial cds
          Length = 6620

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 538  atcttctggatcaggtgttc 557
            ||||||||||||||||||||
Sbjct: 3431 atcttctggatcaggtgttc 3412



to top

>emb|BX088547.12| Zebrafish DNA sequence from clone DKEY-238O14, complete sequence
          Length = 256446

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttctgcagctgtttctgtct 290
              ||||||||||||||||||||
Sbjct: 249740 ttctgcagctgtttctgtct 249721



to top

>gb|AC006167.1|AC006167 Homo sapiens clone UWGC:y67c092 from 6p21, complete sequence
          Length = 42883

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 553   tgttcttgataatgaactga 572
             ||||||||||||||||||||
Sbjct: 35104 tgttcttgataatgaactga 35123



to top

>dbj|AB023050.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
             clone:832F2, complete sequence
          Length = 112018

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 553   tgttcttgataatgaactga 572
             ||||||||||||||||||||
Sbjct: 75402 tgttcttgataatgaactga 75421


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,157,800
Number of Sequences: 3902068
Number of extensions: 5157800
Number of successful extensions: 103949
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103713
Number of HSP's gapped (non-prelim): 232
length of query: 600
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 577
effective length of database: 17,143,297,704
effective search space: 9891682775208
effective search space used: 9891682775208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top