ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart18f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC113133.5| Homo sapiens chromosome 8, clone RP11-930P14, com... 42 0.20
2dbj|AK058036.1| Homo sapiens cDNA FLJ25307 fis, clone SYN00302 42 0.20
3emb|AL137850.12| Human DNA sequence from clone RP11-56P10 on chr... 38 3.1
4emb|CR861438.1| Pongo pygmaeus mRNA; cDNA DKFZp459K212 (from clo... 38 3.1
5emb|CR860731.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0327 (from cl... 38 3.1
6emb|CR860453.1| Pongo pygmaeus mRNA; cDNA DKFZp459P201 (from clo... 38 3.1
7gb|AC010051.9| Drosophila melanogaster 3L BAC RP98-3J2 (Roswell ... 38 3.1
8gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, com... 38 3.1
9gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence 38 3.1
10gb|AC153932.10| Mus musculus 10 BAC RP24-266J23 (Roswell Park Ca... 38 3.1
11gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Can... 38 3.1
12gb|AC154595.2| Mus musculus BAC clone RP23-353D15 from 13, compl... 38 3.1
13gb|AE003593.2| Drosophila melanogaster chromosome 3L, section 74... 38 3.1

>gb|AC113133.5| Homo sapiens chromosome 8, clone RP11-930P14, complete sequence
          Length = 137390

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      acctctcctctctccccatta 21
              |||||||||||||||||||||
Sbjct: 104705 acctctcctctctccccatta 104725



to top

>dbj|AK058036.1| Homo sapiens cDNA FLJ25307 fis, clone SYN00302
          Length = 2213

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 1   acctctcctctctccccatta 21
           |||||||||||||||||||||
Sbjct: 172 acctctcctctctccccatta 152



to top

>emb|AL137850.12| Human DNA sequence from clone RP11-56P10 on chromosome 9q31.3-33.3
             Contains the 3' end of the gene for a novel C2H2 type zinc
             finger protein, the AMBP gene for
             alpha-1-microglobulin/bikunin precursor, the gene for a
             novel protein similar to mouse kinesin 12 (LOC113220) and
             two CpG islands, complete sequence
          Length = 125842

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     ctctctccccattagcgtg 26
             |||||||||||||||||||
Sbjct: 22140 ctctctccccattagcgtg 22122



to top

>emb|CR861438.1| Pongo pygmaeus mRNA; cDNA DKFZp459K212 (from clone DKFZp459K212)
          Length = 4091

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2    cctctcctctctccccatt 20
            |||||||||||||||||||
Sbjct: 3250 cctctcctctctccccatt 3268



to top

>emb|CR860731.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0327 (from clone DKFZp459J0327)
          Length = 4137

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2    cctctcctctctccccatt 20
            |||||||||||||||||||
Sbjct: 3291 cctctcctctctccccatt 3309



to top

>emb|CR860453.1| Pongo pygmaeus mRNA; cDNA DKFZp459P201 (from clone DKFZp459P201)
          Length = 4094

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2    cctctcctctctccccatt 20
            |||||||||||||||||||
Sbjct: 3251 cctctcctctctccccatt 3269



to top

>gb|AC010051.9| Drosophila melanogaster 3L BAC RP98-3J2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 184424

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 47     tttggatcgccgcggatcggatt 69
              ||||||||||||||||| |||||
Sbjct: 125245 tttggatcgccgcggattggatt 125267



to top

>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence
          Length = 163533

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      cctctcctctctccccatt 20
              |||||||||||||||||||
Sbjct: 132687 cctctcctctctccccatt 132669



to top

>gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence
          Length = 158389

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     cctctcctctctccccatt 20
             |||||||||||||||||||
Sbjct: 33357 cctctcctctctccccatt 33339



to top

>gb|AC153932.10| Mus musculus 10 BAC RP24-266J23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 162628

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      cctctcctctctccccatt 20
              |||||||||||||||||||
Sbjct: 156370 cctctcctctctccccatt 156388



to top

>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 201801

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      cctctcctctctccccatt 20
              |||||||||||||||||||
Sbjct: 169668 cctctcctctctccccatt 169650



to top

>gb|AC154595.2| Mus musculus BAC clone RP23-353D15 from 13, complete sequence
          Length = 180529

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     cctctcctctctccccatt 20
             |||||||||||||||||||
Sbjct: 21823 cctctcctctctccccatt 21841



to top

>gb|AE003593.2| Drosophila melanogaster chromosome 3L, section 74 of 83 of the complete
             sequence
          Length = 313157

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    tttggatcgccgcggatcggatt 69
             ||||||||||||||||| |||||
Sbjct: 23436 tttggatcgccgcggattggatt 23414


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 617,168
Number of Sequences: 3902068
Number of extensions: 617168
Number of successful extensions: 49170
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49152
Number of HSP's gapped (non-prelim): 18
length of query: 76
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 55
effective length of database: 17,151,101,840
effective search space: 943310601200
effective search space used: 943310601200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top