ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart17h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB063117.1| Hordeum vulgare HvAPX1 mRNA for peroxisome type ... 101 1e-19
2gb|BT016732.1| Zea mays clone Contig565 mRNA sequence 78 2e-12
3gb|AY109419.1| Zea mays CL26634_1 mRNA sequence 78 2e-12
4ref|XM_483666.1| Oryza sativa (japonica cultivar-group), mRNA 70 5e-10
5ref|XM_507324.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 5e-10
6dbj|AK104490.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-10
7dbj|AK070842.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 5e-10
8gb|AF159254.1|AF159254 Zantedeschia aethiopica ascorbate peroxid... 66 8e-09
9gb|DQ078123.1| Rheum australe ascorbate peroxidase mRNA, complet... 60 5e-07
10dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 52 1e-04
11dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic D... 52 1e-04
12gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL03... 48 0.002
13emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate... 48 0.002
14dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.002
15dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic D... 48 0.002
16gb|AY104492.1| Zea mays PCO104002 mRNA sequence 48 0.002
17ref|NM_119763.2| Arabidopsis thaliana L-ascorbate peroxidase/ pe... 46 0.007
18gb|AF441714.1| Arabidopsis thaliana putative ascorbate peroxidas... 46 0.007
19gb|BT006053.1| Arabidopsis thaliana clone U51359 putative ascorb... 46 0.007
20dbj|AK119023.1| Arabidopsis thaliana At4g35970 mRNA for putative... 46 0.007
21ref|XM_479627.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.028
22ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.028
23emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate pe... 44 0.028
24dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 44 0.028
25dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.028
26dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.028
27dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.028
28dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.028
29dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA... 44 0.028
30emb|AJ843990.1| Plantago major mRNA for ascorbate peroxidase (ap... 42 0.11
31dbj|AB125635.1| Brassica oleracea BO-sAPX mRNA for stromal ascor... 42 0.11
32gb|AF139190.1|AF139190 Mesembryanthemum crystallinum cytosolic a... 42 0.11
33gb|AY382617.1| Oryza sativa (indica cultivar-group) putative per... 40 0.44
34ref|NM_119666.2| Arabidopsis thaliana APX3 (ASCORBATE PEROXIDASE... 40 0.44
35ref|XM_474945.1| Oryza sativa (japonica cultivar-group), predic... 40 0.44
36ref|XM_470658.1| Oryza sativa (japonica cultivar-group), predic... 40 0.44
37gb|BT016458.1| Zea mays clone Contig291 mRNA sequence 40 0.44
38emb|X98276.1|ATAPEXT A.thaliana mRNA for ascorbate peroxidase, e... 40 0.44
39emb|X98003.1|ATAPX A.thaliana mRNA for ascorbate peroxidase 40 0.44
40gb|AY081646.1| Arabidopsis thaliana L-ascorbate peroxidase (At4g... 40 0.44
41gb|AY065143.1| Arabidopsis thaliana L-ascorbate peroxidase (At4g... 40 0.44
42gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA... 40 0.44
43gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate pe... 40 0.44
44emb|BX828485.1|CNS0A4AX Arabidopsis thaliana Full-length cDNA Co... 40 0.44
45gb|AY086162.1| Arabidopsis thaliana clone 21896 mRNA, complete s... 40 0.44
46dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 0.44
47gb|U69138.1|ATU69138 Arabidopsis thaliana ascorbate peroxidase 3... 40 0.44
48dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds 40 0.44
49dbj|AB077953.1| Euglena gracilis apx mRNA for ascorbate peroxida... 40 0.44
50gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase... 38 1.7
51emb|AL606634.2|OSJN00066 Oryza sativa genomic DNA, chromosome 4,... 38 1.7
52gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
53gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
54gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
55gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
56gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
57gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
58gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
59gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
60dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 38 1.7
61gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate p... 38 1.7
62gb|AF079512.1|AF079512 Mesembryanthemum crystallinum clone R6-R1... 38 1.7
63emb|AL929348.9| Mouse DNA sequence from clone RP24-357K4 on chro... 38 1.7
64ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 36 6.9
65ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxida... 36 6.9
66ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxida... 36 6.9
67ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate perox... 36 6.9
68ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate perox... 36 6.9
69gb|AY789051.1| Populus tomentosa ascorbate peroxidase mRNA, comp... 36 6.9
70gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 36 6.9
71emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase 36 6.9
72emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase 36 6.9
73emb|AJ000223.1|HVJ000223 Hordeum vulgare mRNA for expressed sequ... 36 6.9
74gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 36 6.9
75gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 36 6.9
76gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, comp... 36 6.9
77dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.9
78dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.9
79emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Co... 36 6.9
80emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Co... 36 6.9
81emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Co... 36 6.9
82emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Co... 36 6.9
83emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Co... 36 6.9
84emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Co... 36 6.9
85emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Co... 36 6.9
86emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Co... 36 6.9
87emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Co... 36 6.9
88emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Co... 36 6.9
89emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Co... 36 6.9
90gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete s... 36 6.9
91gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome... 36 6.9
92dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic D... 36 6.9
93emb|X14921.1|XLIMVJ4 Xenopus laevis mRNA fragment for IgM VH-reg... 36 6.9
94gb|AC124095.7| Mus musculus chromosome 1, clone RP23-245G9, comp... 36 6.9

>dbj|AB063117.1| Hordeum vulgare HvAPX1 mRNA for peroxisome type ascorbate
           peroxidase, complete cds
          Length = 1089

 Score =  101 bits (51), Expect = 1e-19
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                              
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 154



to top

>gb|BT016732.1| Zea mays clone Contig565 mRNA sequence
          Length = 1248

 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 42/43 (97%)
 Strand = Plus / Plus

                                                      
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctgg 43
           |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 222 gatgcgccccgatcatgctccgcctcgcatggcatgatgctgg 264



to top

>gb|AY109419.1| Zea mays CL26634_1 mRNA sequence
          Length = 1373

 Score = 77.8 bits (39), Expect = 2e-12
 Identities = 42/43 (97%)
 Strand = Plus / Minus

                                                       
Query: 1    gatgcgcccccatcatgctccgcctcgcatggcatgatgctgg 43
            |||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1187 gatgcgccccgatcatgctccgcctcgcatggcatgatgctgg 1145



to top

>ref|XM_483666.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1158

 Score = 69.9 bits (35), Expect = 5e-10
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||||| ||||||||||||||||||||||||||||| || ||||| ||||
Sbjct: 192 gatgcgcgcccatcatgctccgcctcgcatggcatgacgcgggcacttatg 242



to top

>ref|XM_507324.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1479_B11.9 mRNA
          Length = 1229

 Score = 69.9 bits (35), Expect = 5e-10
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||||| ||||||||||||||||||||||||||||| || ||||| ||||
Sbjct: 203 gatgcgcgcccatcatgctccgcctcgcatggcatgacgcgggcacttatg 253



to top

>dbj|AK104490.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B09, full
           insert sequence
          Length = 1158

 Score = 69.9 bits (35), Expect = 5e-10
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||||| ||||||||||||||||||||||||||||| || ||||| ||||
Sbjct: 192 gatgcgcgcccatcatgctccgcctcgcatggcatgacgcgggcacttatg 242



to top

>dbj|AK070842.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074O14, full
           insert sequence
          Length = 1229

 Score = 69.9 bits (35), Expect = 5e-10
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 1   gatgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||||| ||||||||||||||||||||||||||||| || ||||| ||||
Sbjct: 203 gatgcgcgcccatcatgctccgcctcgcatggcatgacgcgggcacttatg 253



to top

>gb|AF159254.1|AF159254 Zantedeschia aethiopica ascorbate peroxidase (cmApx) mRNA, complete
           cds
          Length = 1167

 Score = 65.9 bits (33), Expect = 8e-09
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||| ||| ||||||||||||| |||||||||||||||||||| ||||
Sbjct: 139 tgcgctcccgtcatgctccgcctagcatggcatgatgctggcacttatg 187



to top

>gb|DQ078123.1| Rheum australe ascorbate peroxidase mRNA, complete cds
          Length = 1192

 Score = 60.0 bits (30), Expect = 5e-07
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgc 40
           |||||||||||||||||||||||||| ||||| |||||
Sbjct: 91  tgcgcccccatcatgctccgcctcgcgtggcacgatgc 128



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 3        tgcgcccccatcatgctccgcctcgc 28
                ||||||||||||||||||||||||||
Sbjct: 20903513 tgcgcccccatcatgctccgcctcgc 20903488



 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 29       atggcatgatgctggcacctatg 51
                |||||||||||||||||| ||||
Sbjct: 20901812 atggcatgatgctggcacatatg 20901790



to top

>dbj|AP006174.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0229B10
          Length = 114509

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 3     tgcgcccccatcatgctccgcctcgc 28
             ||||||||||||||||||||||||||
Sbjct: 95739 tgcgcccccatcatgctccgcctcgc 95714



 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 29    atggcatgatgctggcacctatg 51
             |||||||||||||||||| ||||
Sbjct: 94038 atggcatgatgctggcacatatg 94016



to top

>gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL034244.2 R2R3-MYB gene
             region
          Length = 65993

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 1     gatgcgcccccatcatgctccgcctcgc 28
             ||||||| ||||||||||||||||||||
Sbjct: 56909 gatgcgcgcccatcatgctccgcctcgc 56882



to top

>emb|Z34934.1|ZMAPXG Z.mays apx gene encoding cytosolic ascorbate peroxidase
          Length = 1042

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  ||||||||||||||||||||||
Sbjct: 165 tgcgccccgctcatgctccgcctcgcatggca 196



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 1        gatgcgcccccatcatgctccgcctcgc 28
                ||||||| ||||||||||||||||||||
Sbjct: 27551869 gatgcgcgcccatcatgctccgcctcgc 27551842



to top

>dbj|AP003912.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1479_B11
          Length = 105702

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 1     gatgcgcccccatcatgctccgcctcgc 28
             ||||||| ||||||||||||||||||||
Sbjct: 34159 gatgcgcgcccatcatgctccgcctcgc 34132



to top

>gb|AY104492.1| Zea mays PCO104002 mRNA sequence
          Length = 1052

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  ||||||||||||||||||||||
Sbjct: 179 tgcgccccgctcatgctccgcctcgcatggca 210



to top

>ref|NM_119763.2| Arabidopsis thaliana L-ascorbate peroxidase/ peroxidase AT4G35970
           mRNA, complete cds
          Length = 973

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 9   cccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||| |||||||| || |||||||||||||| || |||||||
Sbjct: 136 cccattatgctccgtcttgcatggcatgatgcaggaacctatg 178



to top

>gb|AF441714.1| Arabidopsis thaliana putative ascorbate peroxidase APX5
          (AT4g35970) mRNA, partial cds
          Length = 784

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                     
Query: 9  cccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
          ||||| |||||||| || |||||||||||||| || |||||||
Sbjct: 38 cccattatgctccgtcttgcatggcatgatgcaggaacctatg 80



to top

>gb|BT006053.1| Arabidopsis thaliana clone U51359 putative ascorbate peroxidase
           (At4g35970) mRNA, complete cds
          Length = 871

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 9   cccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||| |||||||| || |||||||||||||| || |||||||
Sbjct: 91  cccattatgctccgtcttgcatggcatgatgcaggaacctatg 133



to top

>dbj|AK119023.1| Arabidopsis thaliana At4g35970 mRNA for putative ascorbate
           peroxidase, complete cds, clone: RAFL21-34-M19
          Length = 973

 Score = 46.1 bits (23), Expect = 0.007
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 9   cccatcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||| |||||||| || |||||||||||||| || |||||||
Sbjct: 136 cccattatgctccgtcttgcatggcatgatgcaggaacctatg 178



to top

>ref|XM_479627.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1110

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 173 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 218



to top

>ref|XM_506596.1| PREDICTED Oryza sativa (japonica cultivar-group), P0627E10.12 mRNA
          Length = 1392

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 169 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 214



to top

>emb|X78452.1|RSAPX R.sativus (Fakir) APX mRNA for L-ascorbate peroxidase
          Length = 753

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| ||||||||||||||||
Sbjct: 100 cccatcatggtccgcctcgcatggca 125



to top

>dbj|AB053297.1| Oryza sativa (japonica cultivar-group) APXb mRNA for L-ascorbate
           peroxidase, complete cds
          Length = 1160

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 160 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 205



to top

>dbj|AK122175.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033148L03, full
           insert sequence
          Length = 2982

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 170 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 215



to top

>dbj|AK102751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106K23, full
           insert sequence
          Length = 2215

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 173 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 218



to top

>dbj|AK068430.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156P11, full
           insert sequence
          Length = 1393

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 169 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 214



to top

>dbj|AK061715.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-H06, full
           insert sequence
          Length = 1110

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 173 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 218



to top

>dbj|AB050724.1| Oryza sativa (japonica cultivar-group) APXb mRNA for ascorbate
           peroxidase, complete cds
          Length = 1058

 Score = 44.1 bits (22), Expect = 0.028
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcacct 48
           ||||||||  |||||||||||||||| |||||   |||||||||||
Sbjct: 155 tgcgccccactcatgctccgcctcgcgtggcactctgctggcacct 200



to top

>emb|AJ843990.1| Plantago major mRNA for ascorbate peroxidase (apx1 gene)
          Length = 1100

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 15  atgctccgcctcgcatggcatgatgctgg 43
           |||||||| ||||| ||||||||||||||
Sbjct: 166 atgctccgtctcgcctggcatgatgctgg 194



to top

>dbj|AB125635.1| Brassica oleracea BO-sAPX mRNA for stromal ascorbate peroxidase,
           complete cds
          Length = 1430

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 29  atggcatgatgctggcaccta 49
           |||||||||||||||||||||
Sbjct: 424 atggcatgatgctggcaccta 444



to top

>gb|AF139190.1|AF139190 Mesembryanthemum crystallinum cytosolic ascorbate peroxidase mRNA,
           complete cds
          Length = 1238

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctgg 43
           ||||| || ||||||||||||||||| ||||| || |||||
Sbjct: 201 tgcgctcctatcatgctccgcctcgcgtggcacgacgctgg 241



to top

>gb|AY382617.1| Oryza sativa (indica cultivar-group) putative peroxisome-bound
           ascorbate peroxidase (APx3) mRNA, complete cds
          Length = 1060

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||| ||||||||||||||||| || |||||
Sbjct: 130 tgcgctcccatcatgctccgcctggcgtggca 161



to top

>ref|NM_119666.2| Arabidopsis thaliana APX3 (ASCORBATE PEROXIDASE 3); L-ascorbate
           peroxidase AT4G35000 (APX3) mRNA, complete cds
          Length = 1213

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 261 atcatgctccgattggcatggcacgatgctggaacctatg 300



to top

>ref|XM_474945.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 876

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||| ||||||||||||||||| || |||||
Sbjct: 91  tgcgctcccatcatgctccgcctggcgtggca 122



to top

>ref|XM_470658.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  |||||||||||||||| |||||
Sbjct: 94  tgcgcccctctcatgctccgcctcgcgtggca 125



to top

>gb|BT016458.1| Zea mays clone Contig291 mRNA sequence
          Length = 1269

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||| ||| |||||||||||||||| |||||
Sbjct: 185 tgcgcgcccctcatgctccgcctcgcgtggca 216



to top

>emb|X98276.1|ATAPEXT A.thaliana mRNA for ascorbate peroxidase, extraplastidal (membrane
           bound) (APX3)
          Length = 1045

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 103 atcatgctccgattggcatggcacgatgctggaacctatg 142



to top

>emb|X98003.1|ATAPX A.thaliana mRNA for ascorbate peroxidase
          Length = 1127

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 167 atcatgctccgattggcatggcacgatgctggaacctatg 206



to top

>gb|AY081646.1| Arabidopsis thaliana L-ascorbate peroxidase (At4g35000) mRNA,
           complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 97  atcatgctccgattggcatggcacgatgctggaacctatg 136



to top

>gb|AY065143.1| Arabidopsis thaliana L-ascorbate peroxidase (At4g35000; M4E13.60)
           mRNA, complete cds
          Length = 1121

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 185 atcatgctccgattggcatggcacgatgctggaacctatg 224



to top

>gb|AF411228.1|AF411228 Hordeum vulgare ascorbate peroxidase mRNA, complete cds
          Length = 1138

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||| ||| |||||||||||||||| |||||
Sbjct: 174 tgcgcgcccctcatgctccgcctcgcgtggca 205



to top

>gb|AY254495.1| Oryza sativa (indica cultivar-group) ascorbate peroxidase mRNA,
           complete cds
          Length = 806

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  |||||||||||||||| |||||
Sbjct: 107 tgcgcccctctcatgctccgcctcgcgtggca 138



to top

>emb|BX828485.1|CNS0A4AX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH94ZG04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2260

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 159 atcatgctccgattggcatggcacgatgctggaacctatg 198



to top

>gb|AY086162.1| Arabidopsis thaliana clone 21896 mRNA, complete sequence
          Length = 1160

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 211 atcatgctccgattggcatggcacgatgctggaacctatg 250



to top

>dbj|AK061841.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E04, full
           insert sequence
          Length = 1070

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  |||||||||||||||| |||||
Sbjct: 159 tgcgcccctctcatgctccgcctcgcgtggca 190



to top

>gb|U69138.1|ATU69138 Arabidopsis thaliana ascorbate peroxidase 3 (APX3) mRNA, complete
           cds
          Length = 1177

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 12  atcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||||  | |||||||| |||||||| |||||||
Sbjct: 223 atcatgctccgattggcatggcacgatgctggaacctatg 262



to top

>dbj|D45423.1| Rice mRNA for ascorbate peroxidase, complete cds
          Length = 983

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 3   tgcgcccccatcatgctccgcctcgcatggca 34
           ||||||||  |||||||||||||||| |||||
Sbjct: 133 tgcgcccctctcatgctccgcctcgcgtggca 164



to top

>dbj|AB077953.1| Euglena gracilis apx mRNA for ascorbate peroxidase, partial cds
          Length = 1326

 Score = 40.1 bits (20), Expect = 0.44
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgctggcac 46
           |||||||||||| || ||||||| || ||||| || ||||||||
Sbjct: 157 tgcgcccccatcctgatccgcctggcgtggcacgacgctggcac 200



to top

>gb|AF540556.1| Brassica juncea clone APX 8A ascorbate peroxidase mRNA, complete
           cds
          Length = 987

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 12  atcatgctccgcctcgcatggca 34
           |||||| ||||||||||||||||
Sbjct: 172 atcatggtccgcctcgcatggca 194



to top

>emb|AL606634.2|OSJN00066 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0072N21,
             complete sequence
          Length = 130433

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 3     tgcgcccccatcatgctccgcct 25
             ||||| |||||||||||||||||
Sbjct: 11106 tgcgctcccatcatgctccgcct 11084



to top

>gb|AF039953.1|AF039953 Fragaria x ananassa cytosolic ascorbate peroxidase (ApxSC) mRNA,
           complete cds
          Length = 1040

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 175 tcatgctccgtctcgcatggcactctgctggaacctatg 213



to top

>gb|AF159633.1|AF159633 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX26 allele, complete cds
          Length = 1035

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 163 tcatgctccgtctcgcatggcactctgctggaacctatg 201



to top

>gb|AF159632.1|AF159632 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX22 allele, complete cds
          Length = 1065

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 176 tcatgctccgtctcgcatggcactctgctggaacctatg 214



to top

>gb|AF159631.1|AF159631 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX19 allele, complete cds
          Length = 1051

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 163 tcatgctccgtctcgcatggcactctgctggaacctatg 201



to top

>gb|AF159630.1|AF159630 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX42 allele, complete cds
          Length = 1035

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 176 tcatgctccgtctcgcatggcactctgctggaacctatg 214



to top

>gb|AF159629.1|AF159629 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX27 allele, complete cds
          Length = 1030

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 171 tcatgctccgtctcgcatggcactctgctggaacctatg 209



to top

>gb|AF159628.1|AF159628 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX44 allele, complete cds
          Length = 1040

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 176 tcatgctccgtctcgcatggcactctgctggaacctatg 214



to top

>gb|AF159627.1|AF159627 Fragaria x ananassa cytosolic ascorbate peroxidase (APX) mRNA,
           APX18 allele, complete cds
          Length = 1012

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 148 tcatgctccgtctcgcatggcactctgctggaacctatg 186



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 3       tgcgcccccatcatgctccgcct 25
               ||||| |||||||||||||||||
Sbjct: 8200593 tgcgctcccatcatgctccgcct 8200571



to top

>gb|AF022213.1|AF022213 Fragaria x ananassa cytosolic ascorbate peroxidase (APX-c) mRNA,
           complete cds
          Length = 1044

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           |||||||||| |||||||||||   |||||| |||||||
Sbjct: 167 tcatgctccgtctcgcatggcactctgctggaacctatg 205



to top

>gb|AF079512.1|AF079512 Mesembryanthemum crystallinum clone R6-R11 ascorbate peroxidase
           mRNA, complete cds
          Length = 1022

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 13  tcatgctccgcctcgcatggcatgatgctggcacctatg 51
           ||||||| |||||| |||  ||||||||||| |||||||
Sbjct: 146 tcatgcttcgcctctcattccatgatgctggtacctatg 184



to top

>emb|AL929348.9| Mouse DNA sequence from clone RP24-357K4 on chromosome 2, complete
             sequence
          Length = 114911

 Score = 38.2 bits (19), Expect = 1.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    gcatggcatgatgctggca 45
             |||||||||||||||||||
Sbjct: 76120 gcatggcatgatgctggca 76102



to top

>ref|NM_179276.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.2 mRNA, complete cds
          Length = 999

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 126 cccatcatggtccgactcgcatggca 151



to top

>ref|NM_202057.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.3 mRNA, complete cds
          Length = 1012

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 139 cccatcatggtccgactcgcatggca 164



to top

>ref|NM_100663.2| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.1 mRNA, complete cds
          Length = 1116

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 243 cccatcatggtccgactcgcatggca 268



to top

>ref|NM_001035915.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.5 mRNA, complete cds
          Length = 1291

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 338 cccatcatggtccgactcgcatggca 363



to top

>ref|NM_001035914.1| Arabidopsis thaliana APX1; L-ascorbate peroxidase AT1G07890 (APX1)
           transcript variant AT1G07890.4 mRNA, complete cds
          Length = 1294

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 338 cccatcatggtccgactcgcatggca 363



to top

>gb|AY789051.1| Populus tomentosa ascorbate peroxidase mRNA, complete cds
          Length = 969

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 33/38 (86%)
 Strand = Plus / Plus

                                                 
Query: 3   tgcgcccccatcatgctccgcctcgcatggcatgatgc 40
           ||||| || |||||||||||| | || |||||||||||
Sbjct: 104 tgcgctcctatcatgctccgcttagcgtggcatgatgc 141



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                         
Query: 3       tgcgcccccatcatgctccgcctcgc 28
               ||||||||  ||||||||||||||||
Sbjct: 9815482 tgcgcccctctcatgctccgcctcgc 9815507



to top

>emb|X59600.1|ATASCOR A.thaliana mRNA for ascorbate peroxidase
          Length = 1023

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 139 cccatcatggtccgactcgcatggca 164



to top

>emb|AJ006358.1|HVU6 Hordeum vulgare mRNA for ascorbate peroxidase
          Length = 1050

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 13  tcatgctccgcctcgcatggca 34
           |||||||||||||||| |||||
Sbjct: 177 tcatgctccgcctcgcgtggca 198



to top

>emb|AJ000223.1|HVJ000223 Hordeum vulgare mRNA for expressed sequence tag
          Length = 550

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 13  tcatgctccgcctcgcatggca 34
           |||||||||||||||| |||||
Sbjct: 177 tcatgctccgcctcgcgtggca 198



to top

>gb|AY094002.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 753

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 100 cccatcatggtccgactcgcatggca 125



to top

>gb|AY056395.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1060

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 190 cccatcatggtccgactcgcatggca 215



to top

>gb|AY039879.1| Arabidopsis thaliana At1g07890/F24B9_2 mRNA, complete cds
          Length = 1059

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 190 cccatcatggtccgactcgcatggca 215



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                          
Query: 3        tgcgcccccatcatgctccgcctcgc 28
                ||||||||  ||||||||||||||||
Sbjct: 29532553 tgcgccccactcatgctccgcctcgc 29532528



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                         
Query: 3       tgcgcccccatcatgctccgcctcgc 28
               ||||||||  ||||||||||||||||
Sbjct: 9813603 tgcgcccctctcatgctccgcctcgc 9813628



to top

>emb|BX816429.1|CNS0ABNP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH48ZA02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1032

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 167 cccatcatggtccgactcgcatggca 192



to top

>emb|BX815448.1|CNS0AE8X Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTLS60ZF11 of Adult vegetative tissue of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 929

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                    
Query: 9  cccatcatgctccgcctcgcatggca 34
          ||||||||| |||| |||||||||||
Sbjct: 58 cccatcatggtccgactcgcatggca 83



to top

>emb|BX813944.1|CNS0AEB8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 138 cccatcatggtccgactcgcatggca 163



to top

>emb|BX815850.1|CNS0ABNN Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH12ZD09 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 907

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                    
Query: 9  cccatcatgctccgcctcgcatggca 34
          ||||||||| |||| |||||||||||
Sbjct: 34 cccatcatggtccgactcgcatggca 59



to top

>emb|BX813948.1|CNS0ACBX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB49ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1045

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 174 cccatcatggtccgactcgcatggca 199



to top

>emb|BX815873.1|CNS0ABWS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 177 cccatcatggtccgactcgcatggca 202



to top

>emb|BX814227.1|CNS0AC1P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 998

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 166 cccatcatggtccgactcgcatggca 191



to top

>emb|BX817157.1|CNS0ABKO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZD10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1033

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 173 cccatcatggtccgactcgcatggca 198



to top

>emb|BX816810.1|CNS0ABP3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH69ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 166 cccatcatggtccgactcgcatggca 191



to top

>emb|BX815009.1|CNS0ABC3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZF04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1023

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 166 cccatcatggtccgactcgcatggca 191



to top

>emb|BX841772.1|CNS09Y65 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZA07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 114 cccatcatggtccgactcgcatggca 139



to top

>gb|AY086425.1| Arabidopsis thaliana clone 25057 mRNA, complete sequence
          Length = 1112

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 9   cccatcatgctccgcctcgcatggca 34
           ||||||||| |||| |||||||||||
Sbjct: 243 cccatcatggtccgactcgcatggca 268



to top

>gb|AC134232.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0013D02, complete sequence
          Length = 131883

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 3     tgcgcccccatcatgctccgcctcgc 28
             ||||||||  ||||||||||||||||
Sbjct: 59015 tgcgcccctctcatgctccgcctcgc 58990



to top

>dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0627E10
          Length = 163388

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 3     tgcgcccccatcatgctccgcctcgc 28
             ||||||||  ||||||||||||||||
Sbjct: 59225 tgcgccccactcatgctccgcctcgc 59200



to top

>emb|X14921.1|XLIMVJ4 Xenopus laevis mRNA fragment for IgM VH-region (J4)
          Length = 386

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 29  atggcatgatgctggcac 46
           ||||||||||||||||||
Sbjct: 184 atggcatgatgctggcac 201



to top

>gb|AC124095.7| Mus musculus chromosome 1, clone RP23-245G9, complete sequence
          Length = 198825

 Score = 36.2 bits (18), Expect = 6.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 32     gcatgatgctggcaccta 49
              ||||||||||||||||||
Sbjct: 155127 gcatgatgctggcaccta 155144


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 278,110
Number of Sequences: 3902068
Number of extensions: 278110
Number of successful extensions: 70257
Number of sequences better than 10.0: 94
Number of HSP's better than 10.0 without gapping: 94
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70022
Number of HSP's gapped (non-prelim): 235
length of query: 51
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 31
effective length of database: 17,155,003,908
effective search space: 531805121148
effective search space used: 531805121148
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top