Clone Name	bart14h05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	1088	0.0
2	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	1088	0.0
3	gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete s...	1015	0.0
4	dbj|AB081564.1| Paralichthys olivaceus TCRJd-Cd2-S gene for T ce...	70	9e-09
5	dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T ce...	70	9e-09
6	dbj|AB178027.1| Ralstonia solanacearum insertion sequence IS1424...	64	5e-07
7	gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha p...	62	2e-06
8	gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha p...	62	2e-06
9	gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alph...	62	2e-06
10	gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-...	62	2e-06
11	gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, c...	62	2e-06
12	gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence	62	2e-06
13	gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence	62	2e-06
14	gb|DQ230324.1| Shuttle vector pMQ61, complete sequence	62	2e-06
15	gb|DQ230323.1| Shuttle vector pMQ52, complete sequence	62	2e-06
16	gb|DQ230322.1| Shuttle vector pMQ51, complete sequence	62	2e-06
17	gb|AY456904.1| Binary vector pRE1, complete sequence	62	2e-06
18	gb|AY220481.2| Nicotiana tabacum Avr9/Cf-9 induced kinase 1 (ACI...	62	2e-06
19	gb|DQ200396.1| Solanum tuberosum clone 070E08 unknown mRNA	62	2e-06
20	gb|DQ200383.1| Solanum tuberosum clone 063B08 DnaJ-like protein ...	62	2e-06
21	gb|AY753306.1| Leucoagaricus meleagris pyranose dehydrogenase (p...	62	2e-06
22	gb|DQ146965.2| Oncorhynchus mykiss insulin-like growth factor bi...	62	2e-06
23	gb|DQ190459.2| Oncorhynchus mykiss insulin-like growth factor bi...	62	2e-06
24	ref|NM_001024387.1| Danio rerio wu:fj59e04 (wu:fj59e04), mRNA	62	2e-06
25	gb|AY423865.1| Cloning vector pMK2017, complete sequence	62	2e-06
26	gb|AY218697.1| Uncultured bacterium clone KD8-88 16S ribosomal R...	62	2e-06
27	gb|AY218687.1| Uncultured bacterium clone KD8-42 16S ribosomal R...	62	2e-06
28	gb|U18721.2|GCU18721 Ginglymostoma cirratum clone 7A novel antig...	62	2e-06
29	gb|AY815791.1| Schistosoma japonicum SJCHGC09592 protein mRNA, c...	62	2e-06
30	gb|AY813632.1| Schistosoma japonicum SJCHGC09300 protein mRNA, c...	62	2e-06
31	gb|AY812501.1| Schistosoma japonicum SJCHGC09324 protein mRNA, p...	62	2e-06
32	gb|AY811032.1| Schistosoma japonicum SJCHGC09205 protein mRNA, p...	62	2e-06
33	gb|AY557621.1| Shuttle vector pELS200, complete sequence	62	2e-06
34	gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/...	62	2e-06
35	gb|AY150810.1| Cloning vector pRS327, complete sequence	62	2e-06
36	gb|AY150809.1| Cloning vector pRS317, complete sequence	62	2e-06
37	gb|AY150808.1| Cloning vector pRS307, complete sequence	62	2e-06
38	gb|AY491501.1| Expression vector hu-beta-MHC-neo-pgk-hygro, comp...	62	2e-06
39	emb|AJ296741.1|PAB296741 Picea abies ATC microsatellite DNA, clo...	62	2e-06
40	emb|AJ131096.1|PAB131096 Picea abies microsatellite RNA, clone P...	62	2e-06
41	emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1	62	2e-06
42	emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2	62	2e-06
43	gb|AF140577.1| Integration vector mini-CTX2, complete sequence	62	2e-06
44	gb|AF140576.1| Integration vector mini-CTX1, complete sequence	62	2e-06
45	gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence	62	2e-06
46	gb|AY428060.1| UAS-less reporter vector pMELalpha2, complete seq...	62	2e-06
47	gb|AY428056.1| UAS-less reporter vector pMELalpha, complete sequ...	62	2e-06
48	gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence	62	2e-06
49	gb|AY283058.1| Cloning vector pHRBar-6 Broad-host-range conditio...	62	2e-06
50	ref|XM_664949.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
51	ref|XM_663685.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
52	ref|XM_663765.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
53	ref|XM_666485.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
54	gb|AY339820.1| Mx-Lox targeting vector, complete sequence	62	2e-06
55	ref|XM_669173.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
56	ref|XM_673755.1| Plasmodium berghei strain ANKA hypothetical pro...	62	2e-06
57	ref|XM_659743.1| Cryptosporidium hominis TU502 LacOPZ-alpha pept...	62	2e-06
58	ref|XM_659801.1| Cryptosporidium hominis TU502 hypothetical prot...	62	2e-06
59	ref|NM_145089.2| Rattus norvegicus asparaginase like 1 (Asrgl1),...	62	2e-06
60	emb|AJ937310.1| Juglans regia mRNA for putative Cys2-His2 zinc f...	62	2e-06
61	emb|X67155.2|HSMKLP1 Homo sapiens mRNA for mitotic kinesin-like ...	62	2e-06
62	gb|AY336796.1| Transformation vector pICon, complete sequence	62	2e-06
63	ref|NM_011684.1| Mus musculus vomeronasal 1 receptor, A2 (V1ra2)...	62	2e-06
64	emb|X68127.1|MARIREDM2 M.auratus mRNA for ribonucleotide reducta...	62	2e-06
65	gb|DQ452049.1| Binary vector pGPro1, complete sequence	62	2e-06
66	gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence	62	2e-06
67	gb|AY291460.1| Shuttle vector pNG168, complete sequence	62	2e-06
68	emb|Z69978.1|AGG13SER A.gambiae mRNA for serine protease	62	2e-06
69	emb|Z31401.1|ATCYC2B A.thaliana (Columbia) cyc2b mRAN for cyclin...	62	2e-06
70	emb|Z11910.1|ZMLIG Z.mobilis tgt and lig genes encoding tRNA gua...	62	2e-06
71	emb|Z12163.1|ATPPHOS1 A.thaliana mRNA encoding protein phosphata...	62	2e-06
72	emb|Y17188.1|PFL17188 Platichthys flesus Ki-ras gene (exons 1 to 4)	62	2e-06
73	emb|Y17187.1|PFL17187 Platichthys flesus Ki-ras gene (exons 1, 2...	62	2e-06
74	emb|Y16416.1|LPNSF Loligo pealei mRNA for putative N-ethylmaleim...	62	2e-06
75	emb|Y14032.1|NTY14032 Nicotiana tabacum mRNA for ferredoxin-NADP...	62	2e-06
76	emb|Y11505.1|MMMPGC60 M.musculus mRNA for Mpgc60 protein	62	2e-06
77	emb|Y11207.1|PSP54MRNA Pisum sativum mRNA for P54 protein	62	2e-06
78	emb|Y09669.1|DRTKRAL1 D.rerio mRNA for tyrosine kinase ligand (A...	62	2e-06
79	emb|X99398.1|AECVP Artificial E.coli vector plasmid	62	2e-06
80	emb|X94368.1|GGLRPP40G G.gallus gene 37LRP/p40	62	2e-06
81	emb|X90729.1|BNPBP3 B.napus mRNA for biotin carboxyl carrier pro...	62	2e-06
82	emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin	62	2e-06
83	emb|X17115.1|HSIGM201 Human mRNA for IgM heavy chain complete se...	62	2e-06
84	emb|X73143.1|ECNIK E.coli DNA sequence of nik locus	62	2e-06
85	emb|X72378.1|GGINTB3 G.gallus mRNA for integrin beta3	62	2e-06
86	emb|X64588.1|CLCYCBMR C.longicaudatus mRNA for cyclin B	62	2e-06
87	emb|X58436.1|DMIPOU D.melanogaster I-POU mRNA for a POU-domain p...	62	2e-06
88	gb|AY013754.1| Aegilops tauschii glutathione S-transferase gene,...	62	2e-06
89	gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence	62	2e-06
90	gb|AY860535.1| Cloning vector p713-1511, complete sequence	62	2e-06
91	gb|AY860534.1| Cloning vector p713-947, complete sequence	62	2e-06
92	gb|AY860533.1| Cloning vector p713-905, complete sequence	62	2e-06
93	emb|AJ784850.1| Cyanophora paradoxa partial mRNA for ATP synthas...	62	2e-06
94	emb|AJ606472.1| Fagus sylvatica mRNA for serine/threonine protei...	62	2e-06
95	emb|AJ586509.1| Fagus sylvatica pk4 mRNA for serine/threonine-pr...	62	2e-06
96	emb|AJ556549.1|DRE556549 Danio rerio mRNA for TRAF4 protein, spl...	62	2e-06
97	emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, spl...	62	2e-06
98	emb|AJ427914.2|RNO427914 Rattus norvegicus mRNA for glial aspara...	62	2e-06
99	emb|AJ316544.1|PDU316544 Platynereis dumerilii mRNA for rhabdome...	62	2e-06
100	emb|AJ316542.1|PDU316542 Platynereis dumerilii mRNA for Six2 pro...	62	2e-06
101	emb|AJ302649.1|DRE302649 Danio rerio mRNA for GABAA receptor bet...	62	2e-06
102	emb|AJ301641.1|FRU301641 Fugu rubripes ORF1 (partial), ORF2-4 DN...	62	2e-06
103	emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain b...	62	2e-06
104	emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm	62	2e-06
105	emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm	62	2e-06
106	emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm	62	2e-06
107	emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2	62	2e-06
108	emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4	62	2e-06
109	emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2	62	2e-06
110	emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative ...	62	2e-06
111	emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative ...	62	2e-06
112	emb|AJ276294.1|CSI276294 Citrus sinensis partial mRNA for ethyle...	62	2e-06
113	emb|AJ250829.1|PVA250829 Penaeus vannamei mRNA for phosphoenolpy...	62	2e-06
114	emb|AJ225049.1|LPAJ5049 Lycopersicon peruvianum mRNA for Hsp20.2...	62	2e-06
115	emb|AJ131845.1|RNO131845 Rattus norvegicus twist gene	62	2e-06
116	emb|AJ011095.2|CSI011095 Citrus sinensis mRNA for ACC synthase (...	62	2e-06
117	emb|AJ011080.1|MMU011080 Mus musculus mRNA for alpha-albumin pro...	62	2e-06
118	emb|AJ005810.1|STU5810 Solanum tuberosum mRNA for phosphatidylin...	62	2e-06
119	emb|AJ005682.1|ATH5682 Arabidopsis thaliana mRNA for inositol 1,...	62	2e-06
120	emb|AJ563382.1|GMA563382 Glycine max mRNA for ornithine decarbox...	62	2e-06
121	emb|AJ868289.1| Transconjugation plasmid pBMK1	62	2e-06
122	gb|AY733073.1| Cloning vector pSW29T, complete sequence	62	2e-06
123	gb|AY733072.1| Cloning vector pSW29, complete sequence	62	2e-06
124	gb|AY733071.1| Cloning vector pSW25T, complete sequence	62	2e-06
125	gb|AY733070.1| Cloning vector pSW25, complete sequence	62	2e-06
126	gb|AY733069.1| Cloning vector pSW27, complete sequence	62	2e-06
127	gb|AY733068.1| Cloning vector pSW26, complete sequence	62	2e-06
128	gb|AY733067.1| Cloning vector pSW24, complete sequence	62	2e-06
129	gb|AY733066.1| Cloning vector pSW23T, complete sequence	62	2e-06
130	gb|AY733065.1| Cloning vector pSW23, complete sequence	62	2e-06
131	ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 ...	62	2e-06
132	gb|AY237650.1| Cloning vector pHR28A10, complete sequence	62	2e-06
133	gb|AY454397.1| Cloning vector pTA6, complete sequence	62	2e-06
134	gb|AF531173.1| Cloning vector pDblet, complete sequence	62	2e-06
135	gb|AF524838.1| P-element cloning system vector pP{Switch1}, comp...	62	2e-06
136	emb|Z47172.1|CSPAG13 Calothrix D253 genomic DNA (clone AG13)	62	2e-06
137	emb|Z47158.1|CSPAG5 Calothrix D253 genomic DNA (clone AG5)	62	2e-06
138	emb|X62445.1|PVXANPTR Potato virus X artificial neomycin phospho...	62	2e-06
139	gb|DQ414707.1| Functional Analysis Plasmid pFA-SAT1, complete se...	62	2e-06
140	gb|AF372620.1| GlnQ allelic exchange vector pAG101, complete seq...	62	2e-06
141	emb|AJ783436.1| Pseudomonas stutzeri recA gene, strain DSM 10701	62	2e-06
142	gb|AF504908.1| Cloning vector pBBRT, complete sequence	62	2e-06
143	gb|AF435436.1| Cloning vector pAM434, complete sequence	62	2e-06
144	dbj|AB236859.1| Trifolium pratense RNA for putative rubisco subu...	62	2e-06
145	dbj|AB236854.1| Trifolium pratense RNA for putative myosin heavy...	62	2e-06
146	dbj|AB236842.1| Trifolium pratense RNA for putative mitochondria...	62	2e-06
147	dbj|AB236836.1| Trifolium pratense RNA for putative fructose bis...	62	2e-06
148	dbj|AB236821.1| Trifolium pratense RNA for putative tetrahydrofo...	62	2e-06
149	dbj|AB236806.1| Trifolium pratense RNA for hypothetical protein,...	62	2e-06
150	dbj|AB236793.1| Trifolium pratense RNA for putative zinc depende...	62	2e-06
151	dbj|AB236760.1| Trifolium pratense RNA for hypothetical protein,...	62	2e-06
152	gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, com...	62	2e-06
153	gb|AY640632.1| SiRNA vector pAAV9(5)-CMV-EGFP-CytB-AS-ohneNot, c...	62	2e-06
154	gb|AY640631.1| SiRNA vector pAAV9(5)-CMV-EGFP-CytB-AS-ohneBgl, c...	62	2e-06
155	gb|AY640630.1| SiRNA vector pAAV9(5)-CMV-DsRed2N1-CytB-AS-ohneNo...	62	2e-06
156	gb|AY640627.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS-ohneBgl, com...	62	2e-06
157	gb|AY640626.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS, complete se...	62	2e-06
158	gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence	62	2e-06
159	gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence	62	2e-06
160	gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence	62	2e-06
161	gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence	62	2e-06
162	gb|S81027.1| Msr-110=EN protein binding gene/engrailed nuclear h...	62	2e-06
163	gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion...	62	2e-06
164	gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion...	62	2e-06
165	gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion...	62	2e-06
166	gb|S71728.1| truncated protein {frame 1, multiple cloning site} ...	62	2e-06
167	emb|AJ518837.1|GMA518837 Glycine max mRNA for putative phosphata...	62	2e-06
168	gb|DQ071886.1| Cloning vector pRD29A-GFP, complete sequence	62	2e-06
169	gb|DQ071887.1| Cloning vector pRD29A-GUS, complete sequence	62	2e-06
170	gb|AF047000.2|AF047000 Borrelia burgdorferi plasmid cp32 2.9-10 ...	62	2e-06
171	gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence	62	2e-06
172	gb|DQ062658.1| Cloning vector p713-1160, complete sequence	62	2e-06
173	gb|AY034154.1| Cloning vector pIDN4, complete sequence	62	2e-06
174	gb|AF517126.1| Cloning vector pSPC-lac, complete sequence	62	2e-06
175	dbj|AB206707.1| Aplysia kurodai FaNaC mRNA for FMRFamide-gated N...	62	2e-06
176	gb|AY785150.1| Expression vector pFL190, complete sequence	62	2e-06
177	gb|AY785149.1| Cloning vector pFL122, complete sequence	62	2e-06
178	gb|M64598.1|SEINMYC2 Serinus canaria N-myc (N-myc) gene, exon an...	62	2e-06
179	gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence	62	2e-06
180	dbj|D88548.2| Homo sapiens NDUFV2 gene for 24-kDa subunit of com...	62	2e-06
181	dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase,...	62	2e-06
182	dbj|AB081498.2| Mus musculus ELYS gene for putative transcriptio...	62	2e-06
183	dbj|D50017.2| Homo sapiens PDGFRA gene for alpha-platelet-derive...	62	2e-06
184	gb|AF033623.2|AF033623 Ovis aries putative heparan sulfate prote...	62	2e-06
185	gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II...	62	2e-06
186	gb|AF270470.1|AF270470 Cloning vector pBIG, complete sequence	62	2e-06
187	gb|AF269225.1|AF269225 Cloning vector pLITTLE, complete sequence	62	2e-06
188	gb|AF269226.1|AF269226 Cloning vector pTIKL, complete sequence	62	2e-06
189	gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, compl...	62	2e-06
190	gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, compl...	62	2e-06
191	gb|AF298781.1|AF298781 PCR template vector pUG30, complete sequence	62	2e-06
192	gb|AY196823.1| PiggyBac transformation vector pB-UAS w+, complet...	62	2e-06
193	gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complet...	62	2e-06
194	gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence	62	2e-06
195	dbj|AB044085.1| Coprinopsis cinerea Pri1p mRNA for DNA primase, ...	62	2e-06
196	gb|AF190131.1|AF190131 Cloning vector pVO205 hygromycin-B-phosph...	62	2e-06
197	gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycosid...	62	2e-06
198	gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycosid...	62	2e-06
199	gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenic...	62	2e-06
200	gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenic...	62	2e-06
201	gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence	62	2e-06
202	emb|AJ427913.1|SOL427913 Spinacia oleracea partial mRNA for sigm...	62	2e-06
203	emb|AJ576322.1|CAU576322 Carassius auratus mc5R gene for melanoc...	62	2e-06
204	dbj|AK173397.1| Ciona intestinalis cDNA, clone:citb001a22, full ...	62	2e-06
205	dbj|D89785.1| Xenopus laevis mRNA for XICE-b, complete cds	62	2e-06
206	emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3...	62	2e-06
207	emb|AJ586515.1| Fagus sylvatica partial ank1 mRNA for ankyrin-re...	62	2e-06
208	emb|X87170.1|TMGABAALA T.marmorata mRNA for GABA/beta-alanine tr...	62	2e-06
209	dbj|AB158265.1| Cloning vector TFV5 gene for M13 pIII, partial cds	62	2e-06
210	dbj|AB158264.1| Cloning vector TFV4 gene for M13 pIII, partial cds	62	2e-06
211	dbj|AB158263.1| Cloning vector TFV3 gene for M13 pIII, partial cds	62	2e-06
212	dbj|AB121971.1| Thermosynechococcus vulcanus kaiA, kaiB, kaiC ge...	62	2e-06
213	gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector	62	2e-06
214	gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region	62	2e-06
215	gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region	62	2e-06
216	emb|AJ269534.1|THA269534 Trichoderma harzianum mRNA for glucose ...	62	2e-06
217	emb|X82626.1|XLCORGLEC X.laevis mRNA for cortical granule lectin	62	2e-06
218	emb|Y16016.1|ECPO157F Escherichia coli plasmid pO157 DNA, 12,5 k...	62	2e-06
219	emb|Z54211.1|ECSHET2B S.flexneri senA gene (isolate 2457T)	62	2e-06
220	emb|Z54194.1|ECSHET2A E.coli senA gene (isolate EI-34)	62	2e-06
221	emb|Z48742.1|HPNIXAGN H.pylori nixA gene	62	2e-06
222	gb|AF041426.1|AF041426 Cloning vector pVLH-1, complete sequence	62	2e-06
223	emb|Y17969.1|ATH17969 Arabidopsis thaliana erg gene	62	2e-06
224	emb|Z54153.1|OSCHINDPR O.sativa mRNA for chilling-inducible protein	62	2e-06
225	emb|Z50800.1|MSASET2MR M.sativa mRNA for ASET2	62	2e-06
226	emb|AJ012719.1|GSU012719 Galdieria sulphuraria mRNA for phosphor...	62	2e-06
227	emb|AJ131342.1|ATH131342 Arabidopsis thaliana mRNA for LEA-like ...	62	2e-06
228	gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA	62	2e-06
229	gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence	62	2e-06
230	gb|AF030383.1|AF030383 Cucumis melo ADP-glucose pyrophosphorylas...	62	2e-06
231	gb|AF179381.1|AF179381 Expression vector pJN105, complete sequence	62	2e-06
232	gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence	62	2e-06
233	gb|AF123263.1|AF123263 Mus musculus phenylalanyl tRNA synthetase...	62	2e-06
234	gb|AF157496.1|AF157496 Suillus bovinus heterotrimeric G protein ...	62	2e-06
235	gb|DQ349231.1| Expression vector peTetOn/FKNF(PacI), complete se...	62	2e-06
236	gb|DQ349230.1| Expression vector pe2TetOn/FKNF(PacI), complete s...	62	2e-06
237	gb|DQ349229.1| Expression vector pe2TetOn(PacI), complete sequence	62	2e-06
238	gb|DQ349228.1| Expression vector peTetOn(PacI), complete sequence	62	2e-06
239	gb|AF092931.1|AF092931 Shuttle vector pCGL0609, complete sequence	62	2e-06
240	emb|AJ243514.1|THA243514 Trichoderma harzianum mRNA for P4 prote...	62	2e-06
241	gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence	62	2e-06
242	emb|AJ269533.1|THA269533 Trichoderma harzianum mRNA for putative...	62	2e-06
243	gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence	62	2e-06
244	emb|AJ000347.1|RN325SAL3 Rattus norvegicus mRNA for 3'(2'),5'-bi...	62	2e-06
245	gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence	62	2e-06
246	gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete seq...	62	2e-06
247	emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4	62	2e-06
248	gb|AF092036.1|AF092036 Shuttle vector pCGL0482, complete sequence	62	2e-06
249	gb|AF091268.1|AF091268 Shuttle vector pCGL0243, complete sequence	62	2e-06
250	dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycos...	62	2e-06
251	dbj|AB055064.1| Synthetic transposable element dAc-I-RS DNA, com...	62	2e-06
252	emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGre...	62	2e-06
253	emb|X98363.1|PVPIJ2581 Cloning vector pIJ2581 glkA gene for gluc...	62	2e-06
254	gb|AY557620.1| Shuttle vector pELS100, complete sequence	62	2e-06
255	emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid ...	62	2e-06
256	emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid ...	62	2e-06
257	emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid ...	62	2e-06
258	emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid ...	62	2e-06
259	emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid exci...	62	2e-06
260	emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid exci...	62	2e-06
261	emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid exci...	62	2e-06
262	emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid exci...	62	2e-06
263	emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2	62	2e-06
264	emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4	62	2e-06
265	emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2	62	2e-06
266	emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning v...	62	2e-06
267	emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning v...	62	2e-06
268	emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning v...	62	2e-06
269	emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning v...	62	2e-06
270	emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning ve...	62	2e-06
271	emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning ve...	62	2e-06
272	emb|AJ007829.1|CVE7829 Cloning Vector pGreen	62	2e-06
273	dbj|AB078885.1| Halocynthia roretzi MASPa gene for mannose-bindi...	62	2e-06
274	dbj|AB076895.1| Ciona intestinalis Ci-calumenin mRNA for calumen...	62	2e-06
275	emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside...	62	2e-06
276	gb|AF067142.1|AF067142 Cloning vector pSFI polylinker, complete ...	62	2e-06
277	dbj|AK115638.1| Ciona intestinalis cDNA, clone:cilv010m12, full ...	62	2e-06
278	gb|U46128.1|GGU46128 Gallus gallus cardiac-enriched TEA domain t...	62	2e-06
279	emb|AJ306631.1|LES306631 Lycopersicon esculentum mRNA for Na+/H+...	62	2e-06
280	gb|U61229.1|CVU61229 Cloning vector pKRX, complete sequence	62	2e-06
281	gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete se...	62	2e-06
282	gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete seq...	62	2e-06
283	gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete seq...	62	2e-06
284	gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete se...	62	2e-06
285	gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete se...	62	2e-06
286	gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete se...	62	2e-06
287	gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete se...	62	2e-06
288	gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete se...	62	2e-06
289	gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete se...	62	2e-06
290	gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete se...	62	2e-06
291	gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete se...	62	2e-06
292	gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete se...	62	2e-06
293	gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete se...	62	2e-06
294	gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete se...	62	2e-06
295	ref|NM_171990.1| Rattus norvegicus bisphosphate 3'-nucleotidase ...	62	2e-06
296	gb|DQ289040.1| Gene replacement vector pLAW344, complete sequence	62	2e-06
297	gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence	62	2e-06
298	gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, com...	62	2e-06
299	gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, com...	62	2e-06
300	gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete se...	62	2e-06
301	gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, co...	62	2e-06
302	gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, co...	62	2e-06
303	gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete s...	62	2e-06
304	gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete ...	62	2e-06
305	emb|Z82982.1|NTZ82982 Nicotina tabacum mRNA for caffeoyl-CoA O-m...	62	2e-06
306	gb|AF013284.1|AF013284 Sparus aurata keratin mRNA, partial cds	62	2e-06
307	emb|AM159094.1| Plantago major partial mRNA for sinapyl alcohol ...	62	2e-06
308	emb|AM159093.1| Plantago major partial mRNA for 4-coumaryl-CoA l...	62	2e-06
309	emb|AM158910.1| Plantago major partial mRNA for monodehydroascor...	62	2e-06
310	gb|U62937.1|UGU62937 Ureaplasma gallorale 16S ribosomal RNA gene...	62	2e-06
311	gb|U84006.1|EVU84006 Expression vector pBSII-LUCINT firefly luci...	62	2e-06
312	dbj|AB208880.1| Homo sapiens mRNA for DNA cytosine-5 methyltrans...	62	2e-06
313	gb|U40861.1|NGU40861 Neisseria gonorrhoeae hemoglobin receptor (...	62	2e-06
314	gb|U26966.1|TVU26966 Trichomonas vaginalis TVAGHSP60 gene, compl...	62	2e-06
315	gb|U53587.1|SCU53587 Artificial Corynebacterium glutamicum IS120...	62	2e-06
316	gb|U09857.1|ECU09857 Escherichia coli 4787 o115:v165:f165 fimbri...	62	2e-06
317	gb|DQ284475.1| Solanum tuberosum clone 132B05 glutamine cyclotra...	62	2e-06
318	gb|U37689.1|HSU37689 Human RNA polymerase II subunit (hsRPB8) mR...	62	2e-06
319	emb|AJ299411.1|DRE299411 Danio rerio partial mRNA for hypothetic...	62	2e-06
320	gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a ...	62	2e-06
321	emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95	62	2e-06
322	emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94	62	2e-06
323	gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 mark...	62	2e-06
324	gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 mark...	62	2e-06
325	gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 mark...	62	2e-06
326	gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 mark...	62	2e-06
327	gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 mar...	62	2e-06
328	gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 mar...	62	2e-06
329	gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 mar...	62	2e-06
330	gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 mar...	62	2e-06
331	emb|Y12724.1|MMPHEREC2 Mus musculus mRNA for pheromone receptor 2	62	2e-06
332	emb|Z86120.1|TEZ86120 T.evansi mRNA, clone Q16R1	62	2e-06
333	gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker...	62	2e-06
334	gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker...	62	2e-06
335	gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker...	62	2e-06
336	gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker...	62	2e-06
337	gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 mark...	62	2e-06
338	gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 mark...	62	2e-06
339	gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 mark...	62	2e-06
340	gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 mark...	62	2e-06
341	gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 mar...	62	2e-06
342	gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 mar...	62	2e-06
343	gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 mar...	62	2e-06
344	gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 mar...	62	2e-06
345	gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, ...	62	2e-06
346	gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, ...	62	2e-06
347	gb|U25267.1|CVKSLIC Ligation-independent cloning vector pBluescr...	62	2e-06
348	emb|X99300.1|MMEPIDY M.musculus epidymal sperm gene	62	2e-06
349	emb|AJ132110.1|OCU132110 Oryctolagus cuniculus mRNA for epitheli...	62	2e-06
350	gb|L20299.1|XELETCREC Xenopus laevis endothelin-3 receptor mRNA,...	62	2e-06
351	emb|AJ316541.1|PDU316541 Platynereis dumerilii partial mRNA for ...	62	2e-06
352	emb|X85998.1|DMELAST D.melanogaster mRNA for elastin-like protein	62	2e-06
353	gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector	62	2e-06
354	gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector	62	2e-06
355	gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector	62	2e-06
356	gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector	62	2e-06
357	emb|Z82022.1|HSGLCNACT H.sapiens mRNA for GlcNac-1-P transferase	62	2e-06
358	gb|L26101.1|BOVCALBTA Bos taurus (clone gt10) calcium activated ...	62	2e-06
359	dbj|D38160.1|SPEATSBP Sacrophaga peregrina ATBP mRNA for A/T-str...	62	2e-06
360	dbj|AB025781.1| Octopus vulgaris OvGao mRNA for G protein a subu...	62	2e-06
361	dbj|D13039.1|YSCCRM1 S. cerevisiae CRM1 gene	62	2e-06
362	dbj|AB010407.1| Arabidopsis thaliana DNA for phosphoglycerate de...	62	2e-06
363	dbj|AB034915.1| Macrophoma commelinae mRNA for macrophomate synt...	62	2e-06
364	dbj|AB019242.1| Bos taurus SSAO mRNA for semicarbazide-sensitive...	62	2e-06
365	gb|DQ019862.2| Saccharomyces cerevisiae expression vector p423GA...	60	8e-06
366	gb|AY445093.2| Drosophila lummei heat shock protein Hsp70c pseud...	60	8e-06
367	gb|AY660719.1| Mammalian expression vector pBGSA, partial sequence	60	8e-06
368	gb|DQ019861.2| Saccharomyces cerevisiae expression vector p426GP...	60	8e-06
369	emb|X65982.1|NTXACCSYN N.tabacum mRNA for 1-aminocyclopropane-1-...	60	8e-06
370	emb|AJ277471.1|OSA277471 Oryza sativa rbbi2-4 gene for putative ...	60	8e-06
371	emb|AJ010386.1|RNO010386 Rattus norvegicus mRNA for ETR-R3b prot...	60	8e-06
372	gb|DQ023272.1| NiaD::cre expression module recombinase (cre) gen...	60	8e-06
373	dbj|AB197018.1| Haliotis discus hannai DNA, microsatellite Hdh1426	60	8e-06
374	gb|AF298789.1| Recombinase expression vector pSH63, complete seq...	60	8e-06
375	gb|AF298785.1| Recombinase expression vector pSH62, complete seq...	60	8e-06
376	gb|AF298782.1| Recombinase expression vector pSH47, complete seq...	60	8e-06
377	gb|AF298780.1| Recombinase expression vector pSH65, partial sequ...	60	8e-06
378	gb|AF190176.2|HHP3255S2 Homo sapiens/human papillomavirus type 1...	60	8e-06
379	gb|S66164.1| Caenorhabditis elegans globin mRNA, complete cds	60	8e-06
380	gb|S83278.1| BMP5=bone morphogenetic protein 5 [chickens, embryo...	60	8e-06
381	gb|DQ023608.1| Yeast expression vector p426GALL, complete sequence	60	8e-06
382	gb|AF298791.1|AF298791 N-terminal GFP fusion vector pUG36, compl...	60	8e-06
383	gb|AF298784.1|AF298784 N-terminal GFP fusion vector pUG34, compl...	60	8e-06
384	gb|AF192534.1|AF192534 Expression vector Ad5CMV-p53 tumor suppre...	60	8e-06
385	emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin	60	8e-06
386	gb|AF000670.1|AF000670 Homo sapiens elf-1 related protein (ELFR)...	60	8e-06
387	gb|DQ269148.1| Yeast centromeric expression vector p416GPD, comp...	60	8e-06
388	dbj|AB079688.1| Branchiostoma belcheri ampAA mRNA for amyloid pr...	60	8e-06
389	emb|AJ582392.1|PDU582392 Platynereis dumerilii mRNA for putative...	58	3e-05
390	dbj|AB196476.1| Herbaspirillum sp. B501 nifH, nifD genes for nit...	58	3e-05
391	gb|AF272030.2|AF272030 Cloning vector pHIS3NX, complete sequence	58	3e-05
392	gb|U84118.1|AAU84118 Aedes aegypti asparagine synthetase mRNA, c...	58	3e-05
393	gb|AY108473.1| Zea mays PCO146945 mRNA sequence	58	3e-05
394	emb|X16918.1|HSPFK10 Human PFKL gene for liver-type 6-phosphofru...	58	3e-05
395	emb|AJ005572.1|PFAJ5572 Plasmodium falciparum mRNA for hypotheti...	58	3e-05
396	gb|L33810.1|HUMXQ133D Human (clone HFB880H6-E5) partial mRNA	58	3e-05
397	emb|AJ243068.1|DME243068 Drosophila melanogaster miniparamyosin ...	58	3e-05
398	dbj|D14062.1|YSPORF3 Schizosaccharomyces pombe mRNA for ORF	58	3e-05
399	dbj|D10859.1|RICORFA Oryza sativa (japonica cultivar-group) mRNA...	58	3e-05
400	emb|AJ000923.1|CPJ000923 Carica papaya mRNA for glutathione tran...	56	1e-04
401	gb|AY785148.1| Suicide plasmid pEE3, complete sequence	56	1e-04
402	gb|U27963.1|SVU27963 Stealth virus clone C16246 T7	56	1e-04
403	gb|M32471.1|XELFINAA X.borealis finger protein mRNA, complete cd...	56	1e-04
404	dbj|D13509.1|MUSPAPA Mus musculus mRNA for PAP homologous protei...	56	1e-04
405	gb|DQ200357.1| Solanum tuberosum clone 052E05 dehydroascorbate r...	54	5e-04
406	emb|AJ577293.1|CGI577293 Crassostrea gigas bmpr1 gene for BMP ty...	54	5e-04
407	emb|X75648.1|SPDNAPD S.pombe pyruvate dehydrogenase like gene	54	5e-04
408	emb|X16493.1|MMZPF1 M.musculus mRNA for Zpf-1 zinc finger protein	54	5e-04
409	gb|AF285441.1| Streptococcus pneumoniae putative protein phospha...	54	5e-04
410	gb|DQ409020.1| Uncultured bacterium clone s314 16S ribosomal RNA...	54	5e-04
411	gb|L04967.1|RICTPI2A Oryza sativa triosephosphate isomerase (Ric...	54	5e-04
412	emb|AJ491805.1|PVU491805 Patella vulgata partial mRNA for Wnta p...	54	5e-04
413	dbj|AB030900.1| Danio rerio mRNA for JNK1, complete cds	54	5e-04
414	emb|AJ538323.1|PFL538323 Platichthys flesus microsatellite DNA, ...	52	0.002
415	ref|XM_667058.1| Plasmodium berghei strain ANKA hypothetical pro...	52	0.002
416	emb|X66819.1|EGHBX3 E.granulosus EgHbx3 homeobox gene	52	0.002
417	emb|AJ311768.1|MSP311768 Mus musculus art3 gene for mono(ADP-rib...	52	0.002
418	gb|U90878.1|HSU90878 Homo sapiens carboxyl terminal LIM domain p...	52	0.002
419	gb|DQ232594.1| Expression vector p413-PGAL1, complete sequence	52	0.002
420	dbj|D85079.1|SUSSPHMX Sea urchin homeobox (SpHmx) mRNA, complete...	52	0.002
421	gb|AY814099.1| Schistosoma japonicum SJCHGC09128 protein mRNA, c...	50	0.008
422	gb|AY170009.1| Cloning vector pCAT-3', complete sequence	50	0.008
423	gb|AY047229.1| Cloning vector mini-Tn4001tet, complete sequence	50	0.008
424	emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2	50	0.008
425	emb|AJ277123.1|CCA277123 Cyprinus carpio mRNA for retinol bindin...	50	0.008
426	emb|AJ868288.1| Transconjugation Plasmid pEMOC2	50	0.008
427	dbj|AB242851.1| Quercus mongolica var. crispula DNA, microsatell...	50	0.008
428	dbj|AB091480.1| Haliotis discus hannai gene, repeat sequence, mi...	50	0.008
429	gb|AY786538.1| Plasmid vector pKS1, complete sequence	50	0.008
430	dbj|AB181912.1| Dugesia japonica 03133HH mRNA for HMG protein TC...	50	0.008
431	emb|AJ234771.1|HVU234771 Hordeum vulgare genomic DNA fragment; c...	50	0.008
432	gb|AF093826.1|AF093826 Plasmodium berghei GTP binding protein (r...	50	0.008
433	gb|AY737283.1| C-terminal TAP T-DNA vector pYL436, complete sequ...	50	0.008
434	emb|Z98267.1|HSZ98267 Homo sapiens encoding exon 14	50	0.008
435	emb|AJ131020.1|CVE131020 Cloning vector pOT1	50	0.008
436	emb|AM156905.1| Zea mays mRNA for transcription factor MYB8 (myb...	50	0.008
437	gb|U65077.1|CVU65077 Promoter-probe vector pNF2283 with ampicill...	50	0.008
438	gb|U51199.1|OAU51199 Ovis aries corticoptropin releasing factor ...	50	0.008
439	gb|AY827555.1| Shuttle vector pNAK1, complete sequence	48	0.032
440	gb|AY737005.1| Cloning vector pUC18-mini-Tn7T-Tp, complete sequence	48	0.032
441	gb|AY737006.1| Cloning vector pUC18-mini-Tn7T-Tp-Gateway, comple...	48	0.032
442	gb|AY737004.1| Cloning vector pUC18-mini-Tn7T-Gm-Gateway, comple...	48	0.032
443	gb|AY618909.1| Phage display vector pTScDisp, complete sequence	48	0.032
444	emb|Z86091.1|FXATCTP Fragaria x ananassa mRNA for TCTP protein	48	0.032
445	gb|DQ153108.1| Cloning vector pUC18R6K-mini-Tn7T-Gm, complete se...	48	0.032
446	emb|AJ237707.1|YLI237707 Yarrowia lipolytica odc gene for ornith...	48	0.032
447	emb|AJ851292.1| Cloning vector pRU1156 gusA gene for beta-glucur...	48	0.032
448	emb|AJ851291.1| Cloning vector pRU1161 gusA gene for beta-glucur...	48	0.032
449	emb|AJ851290.1| Cloning vector pRU1076 gusA gene for beta-glucur...	48	0.032
450	emb|AJ851289.1| Cloning vector pRU1075 gusA gene for beta-glucur...	48	0.032
451	emb|AJ851288.1| Cloning vector pRU1064 gfpUV gene for green fluo...	48	0.032
452	emb|AJ851287.1| Cloning vector pRU1144 mRFP1 gene for mono Red f...	48	0.032
453	emb|AJ851286.1| Cloning vector pRU1106 dsRedT4 gene for Ds Red f...	48	0.032
454	emb|AJ851285.1| Cloning vector pRU1105 dsRedT3 gene for Ds Red f...	48	0.032
455	emb|AJ851284.1| CLoning vector pRU1104 dsRed2 gene for Ds Red fl...	48	0.032
456	emb|AJ851283.1| Cloning vector pRU1103 lacZ gene for beta galact...	48	0.032
457	emb|AJ851282.1| Cloning vector pRU1101 gfpmut3.1 ASV gene for gr...	48	0.032
458	emb|AJ851281.1| Cloning vector pRU1100 gfpmut3.1 LVA gene for gr...	48	0.032
459	emb|AJ851280.1| Cloning vector pRU1099 gfpmut3.1 AAV gene for gr...	48	0.032
460	emb|AJ851279.1| Cloning vector pRU1098 gfpmut3.1 LAA gene for gr...	48	0.032
461	emb|AJ851278.1| Cloning vector pRU1097 gfpmut3.1 gene for green ...	48	0.032
462	emb|AJ851277.1| Cloning vector pRU1701 gfpplus gene for green fl...	48	0.032
463	gb|AC093435.3| Drosophila melanogaster 3L BAC RP98-7A5 (Roswell ...	48	0.032
464	dbj|AB219970.1| Tenebrio molitor Tm-PGRP-SA mRNA for Tm-peptidog...	48	0.032
465	gb|AC091220.3| Drosophila melanogaster 3L BAC RP98-7E7 (Roswell ...	48	0.032
466	gb|AF369963.1|AF369963 Cloning vector pAAV-RC, complete sequence	48	0.032
467	gb|AY712953.1| Mini-Tn7 delivery vector pUC18R6KT-mini-Tn7T, com...	48	0.032
468	gb|AY599234.1| Cloning and expression vector pUC18-mini-Tn7T-LAC...	48	0.032
469	gb|AY599233.1| Cloning vector pUC18-mini-Tn7T-Gm-lacZ, complete ...	48	0.032
470	gb|AY599232.1| Cloning vector pUC18T-mini-Tn7T-Gm, complete sequ...	48	0.032
471	gb|AY599231.1| Cloning vector pUC18-mini-Tn7T-Gm, complete sequence	48	0.032
472	gb|AY599230.1| Cloning vector pUC18T-mini-Tn7T, complete sequence	48	0.032
473	gb|AY599229.1| Cloning vector pUC18Pv-mini-Tn7T, complete sequence	48	0.032
474	gb|AY599228.1| Cloning vector pUC18-R6K-mini-Tn7T, complete sequ...	48	0.032
475	gb|AY599227.1| Cloning vector pUC18-mini-Tn7T, complete sequence	48	0.032
476	gb|AY599226.1| Cloning vector pUC18-mini-Tn7, complete sequence	48	0.032
477	gb|AY619006.1| Cloning vector pUC18R6K-mini-Tn7T-Km, complete se...	48	0.032
478	gb|AY619005.1| Cloning vector pUC18-mini-Tn7-LACM15, complete se...	48	0.032
479	gb|AY619004.1| Cloning vector pUC18-mini-Tn7-Gm, complete sequence	48	0.032
480	gb|AY619007.1| Pseudomonas aeruginosa PA5548 (PA5548) gene, part...	48	0.032
481	gb|U85976.1|HSU85976 Human nucleoside diphosphate kinase (NDK) p...	48	0.032
482	dbj|AB205184.1| Tenebrio molitor MIP mRNA for melanin-inhibiting...	48	0.032
483	gb|AY196825.1| PiggyBac transformation vector pB-UGIR w+, comple...	48	0.032
484	gb|AY196824.1| PiggyBac transformation vector pB-UGateway w+, co...	48	0.032
485	gb|AY962893.1| Transcriptional fusion vector pUC18-mini-Tn7T-Gm-...	48	0.032
486	emb|AJ225059.1|ATJ25059 Arabidopsis thaliana mRNA for v-ATPase s...	48	0.032
487	gb|AF529182.1| Episomal transfection vector pHygD complete sequence	48	0.032
488	gb|AY107979.1| Zea mays PCO116620 mRNA sequence	48	0.032
489	gb|AY107071.1| Zea mays PCO084702 mRNA sequence	48	0.032
490	gb|AE003550.4| Drosophila melanogaster chromosome 3L, section 35...	48	0.032
491	gb|AY884834.1| Cloning and Tn7 delivery vector pUC18R6K-mini-Tn7...	48	0.032
492	emb|AJ310442.1|CVE310442 Cloning vector pOT2 gfpUV gene, rep gen...	48	0.032
493	dbj|D88110.1| Homo sapiens DNA, clone:pHGC39	48	0.032
494	dbj|AB076897.1| Ciona intestinalis Ci-IQGAP mRNA for IQ motif co...	48	0.032
495	gb|DQ232604.1| Sender Vector p416-GAL1-AtIPT4, complete sequence	48	0.032
496	gb|DQ232599.1| Quorum Sensing Vector p413-PGAL1-AtIPT4, complete...	48	0.032
497	gb|AF016705.1|HSUBE3AL3 Homo sapiens E6-AP ubiquitin-protein lig...	48	0.032
498	gb|U33015.1|DMU33015 Drosophila melanogaster Cdk8 mRNA, complete...	48	0.032
499	dbj|AB036854.1| Ciona intestinalis mRNA for leprecan, complete cds	48	0.032
500	gb|AY189981.1| Expression vector pBS-35S-YFP, complete sequence	46	0.13

---

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 1088 bits (549), Expect = 0.0
 Identities = 552/553 (99%)
 Strand = Plus / Plus

                                                                           
Query: 26      ctgcagcagatctggagagattcttcatctccacctcgagcaactttcgagacgcaattc 85
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2423290 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 2423349

                                                                           
Query: 86      gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 145
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423350 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 2423409

                                                                           
Query: 146     tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 205
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423410 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 2423469

                                                                           
Query: 206     gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 265
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423470 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 2423529

                                                                           
Query: 266     tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 325
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423530 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 2423589

                                                                           
Query: 326     ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 385
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423590 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 2423649

                                                                           
Query: 386     gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 445
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423650 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 2423709

                                                                           
Query: 446     ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 505
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423710 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 2423769

                                                                           
Query: 506     ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 565
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2423770 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 2423829

                            
Query: 566     ttccagccctacg 578
               |||||||||||||
Sbjct: 2423830 ttccagccctacg 2423842

---

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 1088 bits (549), Expect = 0.0
 Identities = 552/553 (99%)
 Strand = Plus / Minus

                                                                           
Query: 26      ctgcagcagatctggagagattcttcatctccacctcgagcaactttcgagacgcaattc 85
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1893761 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 1893702

                                                                           
Query: 86      gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 145
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893701 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 1893642

                                                                           
Query: 146     tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 205
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893641 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 1893582

                                                                           
Query: 206     gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 265
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893581 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 1893522

                                                                           
Query: 266     tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 325
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893521 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 1893462

                                                                           
Query: 326     ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 385
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893461 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 1893402

                                                                           
Query: 386     gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 445
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893401 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 1893342

                                                                           
Query: 446     ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 505
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893341 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 1893282

                                                                           
Query: 506     ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 565
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1893281 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 1893222

                            
Query: 566     ttccagccctacg 578
               |||||||||||||
Sbjct: 1893221 ttccagccctacg 1893209

---

>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence
          Length = 31404

 Score = 1015 bits (512), Expect = 0.0
 Identities = 548/555 (98%), Gaps = 5/555 (0%)
 Strand = Plus / Plus

                                                                         
Query: 26    ctgcagcagatctggagagattcttcatctccacctcgagcaactttcgagacgcaattc 85
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 18857 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 18916

                                                                         
Query: 86    gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 145
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18917 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 18976

                                                                         
Query: 146   tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 205
             ||||||||||||||||||||||||||||||||||||||| |||||||||||||   ||||
Sbjct: 18977 tgggtggtggtcttgtgctcacctccgtcggtgtttacg-cgggctcggtgtct--ggca 19033

                                                                         
Query: 206   gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 265
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19034 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 19093

                                                                         
Query: 266   tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcact-gccc-taccgctatt 323
             |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||
Sbjct: 19094 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcacttgcccataccgctatt 19153

                                                                         
Query: 324   ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 383
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19154 ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 19213

                                                                         
Query: 384   cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 443
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19214 cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 19273

                                                                         
Query: 444   ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 503
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19274 ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 19333

                                                                         
Query: 504   caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 563
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19334 caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 19393

                            
Query: 564   cattccagccctacg 578
             |||||||||||||||
Sbjct: 19394 cattccagccctacg 19408

---

>dbj|AB081564.1| Paralichthys olivaceus TCRJd-Cd2-S gene for T cell receptor delta
            chain (J-C region), partial cds
          Length = 3764

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 1    ctctagaactagtggatcccccgggctgcagcaga 35
            |||||||||||||||||||||||||||||||||||
Sbjct: 3713 ctctagaactagtggatcccccgggctgcagcaga 3679

---

>dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T cell receptor delta
            chain (J-C region), partial cds
          Length = 3980

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 1    ctctagaactagtggatcccccgggctgcagcaga 35
            |||||||||||||||||||||||||||||||||||
Sbjct: 3928 ctctagaactagtggatcccccgggctgcagcaga 3894

---

>dbj|AB178027.1| Ralstonia solanacearum insertion sequence IS1424 DNA
          Length = 4442

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                          
Query: 1  ctctagaactagtggatcccccgggctgcagc 32
          ||||||||||||||||||||||||||||||||
Sbjct: 31 ctctagaactagtggatcccccgggctgcagc 62

---

>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and
            gentamicin-3-acetyltransferase genes, complete cds
          Length = 4768

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and
            beta-lactamase genes, complete cds
          Length = 4950

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha)
            genes, complete cds; and unknown gene
          Length = 5228

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence
          Length = 5144

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence
          Length = 4707

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence
          Length = 4295

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3270 ctctagaactagtggatcccccgggctgcag 3300



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1027 ctctagaactagtggatcccccgggctgcag 997

---

>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence
          Length = 4296

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2204 ctctagaactagtggatcccccgggctgcag 2234

---

>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence
          Length = 7978

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4051 ctctagaactagtggatcccccgggctgcag 4021

---

>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence
          Length = 7277

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4051 ctctagaactagtggatcccccgggctgcag 4021

---

>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence
          Length = 8105

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4051 ctctagaactagtggatcccccgggctgcag 4021

---

>gb|AY456904.1| Binary vector pRE1, complete sequence
          Length = 9769

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 79 ctctagaactagtggatcccccgggctgcag 49

---

>gb|AY220481.2| Nicotiana tabacum Avr9/Cf-9 induced kinase 1 (ACIK1) mRNA, complete
           cds
          Length = 1774

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 94  ctctagaactagtggatcccccgggctgcag 124

---

>gb|DQ200396.1| Solanum tuberosum clone 070E08 unknown mRNA
          Length = 1196

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 21 ctctagaactagtggatcccccgggctgcag 51

---

>gb|DQ200383.1| Solanum tuberosum clone 063B08 DnaJ-like protein mRNA, complete
          cds
          Length = 1515

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 13 ctctagaactagtggatcccccgggctgcag 43

---

>gb|AY753306.1| Leucoagaricus meleagris pyranose dehydrogenase (pdh1) gene,
          complete cds
          Length = 3089

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 68 ctctagaactagtggatcccccgggctgcag 98

---

>gb|DQ146965.2| Oncorhynchus mykiss insulin-like growth factor binding
          protein-related protein 1 (IGFBP-rP1) mRNA, complete
          cds
          Length = 1217

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 55 ctctagaactagtggatcccccgggctgcag 85

---

>gb|DQ190459.2| Oncorhynchus mykiss insulin-like growth factor binding protein 6
          (IGFBP6) mRNA, complete cds
          Length = 2188

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 54 ctctagaactagtggatcccccgggctgcag 84

---

>ref|NM_001024387.1| Danio rerio wu:fj59e04 (wu:fj59e04), mRNA
          Length = 2188

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2124 ctctagaactagtggatcccccgggctgcag 2094

---

>gb|AY423865.1| Cloning vector pMK2017, complete sequence
          Length = 4252

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 793 ctctagaactagtggatcccccgggctgcag 823

---

>gb|AY218697.1| Uncultured bacterium clone KD8-88 16S ribosomal RNA gene, partial
            sequence
          Length = 1388

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1371 ctctagaactagtggatcccccgggctgcag 1341

---

>gb|AY218687.1| Uncultured bacterium clone KD8-42 16S ribosomal RNA gene, partial
            sequence
          Length = 1363

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1343 ctctagaactagtggatcccccgggctgcag 1313

---

>gb|U18721.2|GCU18721 Ginglymostoma cirratum clone 7A novel antigen receptor mRNA,
          complete cds
          Length = 4146

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 28 ctctagaactagtggatcccccgggctgcag 58

---

>gb|AY815791.1| Schistosoma japonicum SJCHGC09592 protein mRNA, complete cds
          Length = 894

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 19 ctctagaactagtggatcccccgggctgcag 49

---

>gb|AY813632.1| Schistosoma japonicum SJCHGC09300 protein mRNA, complete cds
          Length = 1371

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 27 ctctagaactagtggatcccccgggctgcag 57

---

>gb|AY812501.1| Schistosoma japonicum SJCHGC09324 protein mRNA, partial cds
          Length = 1080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 29 ctctagaactagtggatcccccgggctgcag 59

---

>gb|AY811032.1| Schistosoma japonicum SJCHGC09205 protein mRNA, partial cds
          Length = 812

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 30 ctctagaactagtggatcccccgggctgcag 60

---

>gb|AY557621.1| Shuttle vector pELS200, complete sequence
          Length = 7828

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7408 ctctagaactagtggatcccccgggctgcag 7378

---

>gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/neomycin
            phosphotransferase fusion protein (hsp82-neo fusion)
            gene, complete cds
          Length = 3727

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3645 ctctagaactagtggatcccccgggctgcag 3675

---

>gb|AY150810.1| Cloning vector pRS327, complete sequence
          Length = 9560

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5862 ctctagaactagtggatcccccgggctgcag 5892

---

>gb|AY150809.1| Cloning vector pRS317, complete sequence
          Length = 8601

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5713 ctctagaactagtggatcccccgggctgcag 5743

---

>gb|AY150808.1| Cloning vector pRS307, complete sequence
          Length = 8219

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5862 ctctagaactagtggatcccccgggctgcag 5892

---

>gb|AY491501.1| Expression vector hu-beta-MHC-neo-pgk-hygro, complete sequence
          Length = 9431

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4750 ctctagaactagtggatcccccgggctgcag 4780

---

>emb|AJ296741.1|PAB296741 Picea abies ATC microsatellite DNA, clone EATC3H03
          Length = 519

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 402 ctctagaactagtggatcccccgggctgcag 372

---

>emb|AJ131096.1|PAB131096 Picea abies microsatellite RNA, clone PAAG2
          Length = 824

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 38 ctctagaactagtggatcccccgggctgcag 68

---

>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1
          Length = 6094

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 121 ctctagaactagtggatcccccgggctgcag 91

---

>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2
          Length = 6116

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 120 ctctagaactagtggatcccccgggctgcag 90

---

>gb|AF140577.1| Integration vector mini-CTX2, complete sequence
          Length = 6755

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 881 ctctagaactagtggatcccccgggctgcag 911

---

>gb|AF140576.1| Integration vector mini-CTX1, complete sequence
          Length = 5610

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 881 ctctagaactagtggatcccccgggctgcag 911

---

>gb|AY436765.1| Binary vector pAMPAT-MCS, complete sequence
          Length = 5274

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2027 ctctagaactagtggatcccccgggctgcag 1997

---

>gb|AY428060.1| UAS-less reporter vector pMELalpha2, complete sequence
          Length = 7304

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7261 ctctagaactagtggatcccccgggctgcag 7291

---

>gb|AY428056.1| UAS-less reporter vector pMELalpha, complete sequence
          Length = 7305

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7262 ctctagaactagtggatcccccgggctgcag 7292

---

>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence
          Length = 5343

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3047 ctctagaactagtggatcccccgggctgcag 3017

---

>gb|AY283058.1| Cloning vector pHRBar-6 Broad-host-range conditional lethal plasmid,
            complete sequence
          Length = 14708

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7481 ctctagaactagtggatcccccgggctgcag 7451

---

>ref|XM_664949.1| Plasmodium berghei strain ANKA hypothetical protein (PB000410.03.0)
           partial mRNA
          Length = 669

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 627 ctctagaactagtggatcccccgggctgcag 597

---

>ref|XM_663685.1| Plasmodium berghei strain ANKA hypothetical protein
          (PB108231.00.0) partial mRNA
          Length = 269

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 48 ctctagaactagtggatcccccgggctgcag 78

---

>ref|XM_663765.1| Plasmodium berghei strain ANKA hypothetical protein (PB102643.00.0)
           partial mRNA
          Length = 466

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 424 ctctagaactagtggatcccccgggctgcag 394

---

>ref|XM_666485.1| Plasmodium berghei strain ANKA hypothetical protein
          (PB104095.00.0) partial mRNA
          Length = 121

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 45 ctctagaactagtggatcccccgggctgcag 75

---

>gb|AY339820.1| Mx-Lox targeting vector, complete sequence
          Length = 14863

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2701 ctctagaactagtggatcccccgggctgcag 2671

---

>ref|XM_669173.1| Plasmodium berghei strain ANKA hypothetical protein (PB000102.02.0)
           partial mRNA
          Length = 1284

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 74  ctctagaactagtggatcccccgggctgcag 104

---

>ref|XM_673755.1| Plasmodium berghei strain ANKA hypothetical protein (PB105099.00.0)
           partial mRNA
          Length = 210

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 168 ctctagaactagtggatcccccgggctgcag 138

---

>ref|XM_659743.1| Cryptosporidium hominis TU502 LacOPZ-alpha peptide from pUC9
           (Chro.80226) partial mRNA
          Length = 387

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 235 ctctagaactagtggatcccccgggctgcag 205

---

>ref|XM_659801.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.80263)
           partial mRNA
          Length = 219

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 166 ctctagaactagtggatcccccgggctgcag 136

---

>ref|NM_145089.2| Rattus norvegicus asparaginase like 1 (Asrgl1), mRNA
          Length = 2168

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2137 ctctagaactagtggatcccccgggctgcag 2107

---

>emb|AJ937310.1| Juglans regia mRNA for putative Cys2-His2 zinc finger
          transcription factor (zfp2 gene)
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 35 ctctagaactagtggatcccccgggctgcag 65

---

>emb|X67155.2|HSMKLP1 Homo sapiens mRNA for mitotic kinesin-like protein-1 (MKLP-1 gene)
          Length = 3348

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3275 ctctagaactagtggatcccccgggctgcag 3245

---

>gb|AY336796.1| Transformation vector pICon, complete sequence
          Length = 23250

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                            
Query: 1     ctctagaactagtggatcccccgggctgcag 31
             |||||||||||||||||||||||||||||||
Sbjct: 10195 ctctagaactagtggatcccccgggctgcag 10225

---

>ref|NM_011684.1| Mus musculus vomeronasal 1 receptor, A2 (V1ra2), mRNA
          Length = 3403

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3295 ctctagaactagtggatcccccgggctgcag 3265

---

>emb|X68127.1|MARIREDM2 M.auratus mRNA for ribonucleotide reductase M2 subunit
          Length = 3481

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2185 ctctagaactagtggatcccccgggctgcag 2155

---

>gb|DQ452049.1| Binary vector pGPro1, complete sequence
          Length = 8833

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 8755 ctctagaactagtggatcccccgggctgcag 8785

---

>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence
          Length = 9655

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7362 ctctagaactagtggatcccccgggctgcag 7392

---

>gb|AY291460.1| Shuttle vector pNG168, complete sequence
          Length = 8960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4681 ctctagaactagtggatcccccgggctgcag 4651

---

>emb|Z69978.1|AGG13SER A.gambiae mRNA for serine protease
          Length = 1028

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 53 ctctagaactagtggatcccccgggctgcag 83

---

>emb|Z31401.1|ATCYC2B A.thaliana (Columbia) cyc2b mRAN for cyclin 2b protein
          Length = 1798

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 110 ctctagaactagtggatcccccgggctgcag 140

---

>emb|Z11910.1|ZMLIG Z.mobilis tgt and lig genes encoding tRNA guanine
          transglycosylase and DNA ligase
          Length = 3153

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 3  ctctagaactagtggatcccccgggctgcag 33

---

>emb|Z12163.1|ATPPHOS1 A.thaliana mRNA encoding protein phosphatase 1A
          Length = 1436

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 13 ctctagaactagtggatcccccgggctgcag 43

---

>emb|Y17188.1|PFL17188 Platichthys flesus Ki-ras gene (exons 1 to 4)
          Length = 1665

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 171 ctctagaactagtggatcccccgggctgcag 201

---

>emb|Y17187.1|PFL17187 Platichthys flesus Ki-ras gene (exons 1, 2, 3, and 4b)
          Length = 711

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 21 ctctagaactagtggatcccccgggctgcag 51

---

>emb|Y16416.1|LPNSF Loligo pealei mRNA for putative N-ethylmaleimide-sensitive fusion
            protein (NSF)
          Length = 2003

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1881 ctctagaactagtggatcccccgggctgcag 1851

---

>emb|Y14032.1|NTY14032 Nicotiana tabacum mRNA for ferredoxin-NADP reductase
          Length = 1333

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1314 ctctagaactagtggatcccccgggctgcag 1284

---

>emb|Y11505.1|MMMPGC60 M.musculus mRNA for Mpgc60 protein
          Length = 515

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 14 ctctagaactagtggatcccccgggctgcag 44

---

>emb|Y11207.1|PSP54MRNA Pisum sativum mRNA for P54 protein
          Length = 1677

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 6  ctctagaactagtggatcccccgggctgcag 36

---

>emb|Y09669.1|DRTKRAL1 D.rerio mRNA for tyrosine kinase ligand (AL-1)
          Length = 1650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 25 ctctagaactagtggatcccccgggctgcag 55

---

>emb|X99398.1|AECVP Artificial E.coli vector plasmid
          Length = 4291

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 68 ctctagaactagtggatcccccgggctgcag 98

---

>emb|X94368.1|GGLRPP40G G.gallus gene 37LRP/p40
          Length = 6209

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 70 ctctagaactagtggatcccccgggctgcag 40

---

>emb|X90729.1|BNPBP3 B.napus mRNA for biotin carboxyl carrier protein (pBP3)
          Length = 924

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 920 ctctagaactagtggatcccccgggctgcag 890

---

>emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin
          Length = 1519

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1518 ctctagaactagtggatcccccgggctgcag 1488

---

>emb|X17115.1|HSIGM201 Human mRNA for IgM heavy chain complete sequence
          Length = 2213

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 2  ctctagaactagtggatcccccgggctgcag 32

---

>emb|X73143.1|ECNIK E.coli DNA sequence of nik locus
          Length = 6310

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6278 ctctagaactagtggatcccccgggctgcag 6248

---

>emb|X72378.1|GGINTB3 G.gallus mRNA for integrin beta3
          Length = 3482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3480 ctctagaactagtggatcccccgggctgcag 3450

---

>emb|X64588.1|CLCYCBMR C.longicaudatus mRNA for cyclin B
          Length = 2372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 27 ctctagaactagtggatcccccgggctgcag 57

---

>emb|X58436.1|DMIPOU D.melanogaster I-POU mRNA for a POU-domain protein
          Length = 1556

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1535 ctctagaactagtggatcccccgggctgcag 1505

---

>gb|AY013754.1| Aegilops tauschii glutathione S-transferase gene, complete cds
          Length = 2453

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 2  ctctagaactagtggatcccccgggctgcag 32

---

>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence
          Length = 5032

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2736 ctctagaactagtggatcccccgggctgcag 2706

---

>gb|AY860535.1| Cloning vector p713-1511, complete sequence
          Length = 13907

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5240 ctctagaactagtggatcccccgggctgcag 5210

---

>gb|AY860534.1| Cloning vector p713-947, complete sequence
          Length = 14789

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6122 ctctagaactagtggatcccccgggctgcag 6092

---

>gb|AY860533.1| Cloning vector p713-905, complete sequence
          Length = 14999

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6332 ctctagaactagtggatcccccgggctgcag 6302

---

>emb|AJ784850.1| Cyanophora paradoxa partial mRNA for ATP synthase A chain
          precursor (atpI-1 gene)
          Length = 701

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 31 ctctagaactagtggatcccccgggctgcag 61

---

>emb|AJ606472.1| Fagus sylvatica mRNA for serine/threonine protein kinase (pk5
          gene)
          Length = 1463

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 67 ctctagaactagtggatcccccgggctgcag 97

---

>emb|AJ586509.1| Fagus sylvatica pk4 mRNA for serine/threonine-protein kinase
          Length = 1698

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 63 ctctagaactagtggatcccccgggctgcag 93

---

>emb|AJ556549.1|DRE556549 Danio rerio mRNA for TRAF4 protein, splice variant 2
          Length = 1870

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 61 ctctagaactagtggatcccccgggctgcag 91

---

>emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, splice variant 1
          Length = 1913

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 120 ctctagaactagtggatcccccgggctgcag 150

---

>emb|AJ427914.2|RNO427914 Rattus norvegicus mRNA for glial asparaginase (gliap gene)
          Length = 2168

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2137 ctctagaactagtggatcccccgggctgcag 2107

---

>emb|AJ316544.1|PDU316544 Platynereis dumerilii mRNA for rhabdomeric opsin (r-opsin gene)
          Length = 1438

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 62 ctctagaactagtggatcccccgggctgcag 92

---

>emb|AJ316542.1|PDU316542 Platynereis dumerilii mRNA for Six2 protein
          Length = 1254

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 63 ctctagaactagtggatcccccgggctgcag 93

---

>emb|AJ302649.1|DRE302649 Danio rerio mRNA for GABAA receptor betaZ2 subunit (gabaabeta2 gene)
          Length = 2188

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2124 ctctagaactagtggatcccccgggctgcag 2094

---

>emb|AJ301641.1|FRU301641 Fugu rubripes ORF1 (partial), ORF2-4 DNA and lsm4 gene
          Length = 36154

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 9798 ctctagaactagtggatcccccgggctgcag 9768

---

>emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain binding protein 4 (SH3BP4 gene)
          Length = 3520

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3500 ctctagaactagtggatcccccgggctgcag 3470

---

>emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm
          Length = 8310

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm
          Length = 7922

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm
          Length = 8094

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2
          Length = 8405

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4
          Length = 8017

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2
          Length = 8201

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1131 ctctagaactagtggatcccccgggctgcag 1161

---

>emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative Bowman Birk tryspin inhibitor
          Length = 2378

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2355 ctctagaactagtggatcccccgggctgcag 2325

---

>emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative Bowman Birk trypsin
          inhibitor
          Length = 2336

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 22 ctctagaactagtggatcccccgggctgcag 52

---

>emb|AJ276294.1|CSI276294 Citrus sinensis partial mRNA for ethylene receptor (ETR-1 gene)
          Length = 1240

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 28 ctctagaactagtggatcccccgggctgcag 58

---

>emb|AJ250829.1|PVA250829 Penaeus vannamei mRNA for phosphoenolpyruvate carboxykinase
          (pepck gene)
          Length = 2186

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 55 ctctagaactagtggatcccccgggctgcag 85

---

>emb|AJ225049.1|LPAJ5049 Lycopersicon peruvianum mRNA for Hsp20.2 protein
          Length = 1144

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 42 ctctagaactagtggatcccccgggctgcag 72

---

>emb|AJ131845.1|RNO131845 Rattus norvegicus twist gene
          Length = 1901

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1875 ctctagaactagtggatcccccgggctgcag 1845

---

>emb|AJ011095.2|CSI011095 Citrus sinensis mRNA for ACC synthase (acs-1 gene)
          Length = 2876

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 29 ctctagaactagtggatcccccgggctgcag 59

---

>emb|AJ011080.1|MMU011080 Mus musculus mRNA for alpha-albumin protein
          Length = 2080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 1  ctctagaactagtggatcccccgggctgcag 31

---

>emb|AJ005810.1|STU5810 Solanum tuberosum mRNA for phosphatidylinositol 4-kinase, partial
          Length = 2247

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 9  ctctagaactagtggatcccccgggctgcag 39

---

>emb|AJ005682.1|ATH5682 Arabidopsis thaliana mRNA for inositol 1,4,5-trisphosphate
          5-phosphatase
          Length = 3506

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 17 ctctagaactagtggatcccccgggctgcag 47

---

>emb|AJ563382.1|GMA563382 Glycine max mRNA for ornithine decarboxylase (odc1 gene)
          Length = 1628

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 27 ctctagaactagtggatcccccgggctgcag 57

---

>emb|AJ868289.1| Transconjugation plasmid pBMK1
          Length = 8613

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 129 ctctagaactagtggatcccccgggctgcag 99

---

>gb|AY733073.1| Cloning vector pSW29T, complete sequence
          Length = 1958

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 365 ctctagaactagtggatcccccgggctgcag 335

---

>gb|AY733072.1| Cloning vector pSW29, complete sequence
          Length = 1723

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 130 ctctagaactagtggatcccccgggctgcag 100

---

>gb|AY733071.1| Cloning vector pSW25T, complete sequence
          Length = 1963

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 365 ctctagaactagtggatcccccgggctgcag 335

---

>gb|AY733070.1| Cloning vector pSW25, complete sequence
          Length = 2175

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 577 ctctagaactagtggatcccccgggctgcag 547

---

>gb|AY733069.1| Cloning vector pSW27, complete sequence
          Length = 1822

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 370 ctctagaactagtggatcccccgggctgcag 340

---

>gb|AY733068.1| Cloning vector pSW26, complete sequence
          Length = 1822

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 370 ctctagaactagtggatcccccgggctgcag 340

---

>gb|AY733067.1| Cloning vector pSW24, complete sequence
          Length = 2029

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 577 ctctagaactagtggatcccccgggctgcag 547

---

>gb|AY733066.1| Cloning vector pSW23T, complete sequence
          Length = 1817

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 365 ctctagaactagtggatcccccgggctgcag 335

---

>gb|AY733065.1| Cloning vector pSW23, complete sequence
          Length = 1582

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 130 ctctagaactagtggatcccccgggctgcag 100

---

>ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 (Sh3bp4), mRNA
          Length = 3520

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3500 ctctagaactagtggatcccccgggctgcag 3470

---

>gb|AY237650.1| Cloning vector pHR28A10, complete sequence
          Length = 10706

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6797 ctctagaactagtggatcccccgggctgcag 6827

---

>gb|AY454397.1| Cloning vector pTA6, complete sequence
          Length = 3000

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 676 ctctagaactagtggatcccccgggctgcag 706

---

>gb|AF531173.1| Cloning vector pDblet, complete sequence
          Length = 6238

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2744 ctctagaactagtggatcccccgggctgcag 2714

---

>gb|AF524838.1| P-element cloning system vector pP{Switch1}, complete sequence
          Length = 10941

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3265 ctctagaactagtggatcccccgggctgcag 3235

---

>emb|Z47172.1|CSPAG13 Calothrix D253 genomic DNA (clone AG13)
          Length = 476

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 94 ctctagaactagtggatcccccgggctgcag 64

---

>emb|Z47158.1|CSPAG5 Calothrix D253 genomic DNA (clone AG5)
          Length = 307

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 142 ctctagaactagtggatcccccgggctgcag 112

---

>emb|X62445.1|PVXANPTR Potato virus X artificial neomycin phosphotransferase II mRNA
          5'-flank (SEQ4)
          Length = 92

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 43 ctctagaactagtggatcccccgggctgcag 13

---

>gb|DQ414707.1| Functional Analysis Plasmid pFA-SAT1, complete sequence
          Length = 4375

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2027 ctctagaactagtggatcccccgggctgcag 1997

---

>gb|AF372620.1| GlnQ allelic exchange vector pAG101, complete sequence
          Length = 5126

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1152 ctctagaactagtggatcccccgggctgcag 1122

---

>emb|AJ783436.1| Pseudomonas stutzeri recA gene, strain DSM 10701
          Length = 1439

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 7  ctctagaactagtggatcccccgggctgcag 37

---

>gb|AF504908.1| Cloning vector pBBRT, complete sequence
          Length = 5973

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3238 ctctagaactagtggatcccccgggctgcag 3268

---

>gb|AF435436.1| Cloning vector pAM434, complete sequence
          Length = 3410

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1578 ctctagaactagtggatcccccgggctgcag 1608

---

>dbj|AB236859.1| Trifolium pratense RNA for putative rubisco subunit binding-protein
            alpha subunit, complete cds, clone: C766
          Length = 1971

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1939 ctctagaactagtggatcccccgggctgcag 1909

---

>dbj|AB236854.1| Trifolium pratense RNA for putative myosin heavy chain-like
          protein, complete cds, clone: C675
          Length = 2195

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 34 ctctagaactagtggatcccccgggctgcag 64

---

>dbj|AB236842.1| Trifolium pratense RNA for putative mitochondrial dicarboxylate
          carrier protein, complete cds, clone: C331
          Length = 1385

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 34 ctctagaactagtggatcccccgggctgcag 64

---

>dbj|AB236836.1| Trifolium pratense RNA for putative fructose bisphosphate
          aldolase, complete cds, clone: C2543
          Length = 1537

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 35 ctctagaactagtggatcccccgggctgcag 65

---

>dbj|AB236821.1| Trifolium pratense RNA for putative tetrahydrofolate synthase,
          complete cds, clone: C2147
          Length = 1526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 34 ctctagaactagtggatcccccgggctgcag 64

---

>dbj|AB236806.1| Trifolium pratense RNA for hypothetical protein, complete cds,
          clone: C2051
          Length = 1275

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 36 ctctagaactagtggatcccccgggctgcag 66

---

>dbj|AB236793.1| Trifolium pratense RNA for putative zinc dependent protease, complete
            cds, clone: C1867
          Length = 2414

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2382 ctctagaactagtggatcccccgggctgcag 2352

---

>dbj|AB236760.1| Trifolium pratense RNA for hypothetical protein, partial cds,
          clone: C1547
          Length = 1455

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 29 ctctagaactagtggatcccccgggctgcag 59

---

>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence
          Length = 7414

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1073 ctctagaactagtggatcccccgggctgcag 1103

---

>gb|AY640632.1| SiRNA vector pAAV9(5)-CMV-EGFP-CytB-AS-ohneNot, complete sequence
          Length = 7187

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1778 ctctagaactagtggatcccccgggctgcag 1808

---

>gb|AY640631.1| SiRNA vector pAAV9(5)-CMV-EGFP-CytB-AS-ohneBgl, complete sequence
          Length = 7169

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1635 ctctagaactagtggatcccccgggctgcag 1665

---

>gb|AY640630.1| SiRNA vector pAAV9(5)-CMV-DsRed2N1-CytB-AS-ohneNot, complete sequence
          Length = 7147

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1738 ctctagaactagtggatcccccgggctgcag 1768

---

>gb|AY640627.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS-ohneBgl, complete sequence
          Length = 4944

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2336 ctctagaactagtggatcccccgggctgcag 2366

---

>gb|AY640626.1| SiRNA vector pSUPER-CMV-EGFP-CytB-AS, complete sequence
          Length = 4962

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2336 ctctagaactagtggatcccccgggctgcag 2366

---

>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence
          Length = 4570

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4119 ctctagaactagtggatcccccgggctgcag 4149

---

>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence
          Length = 8182

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4544 ctctagaactagtggatcccccgggctgcag 4514

---

>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence
          Length = 7168

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3530 ctctagaactagtggatcccccgggctgcag 3500

---

>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence
          Length = 6333

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3523 ctctagaactagtggatcccccgggctgcag 3493

---

>gb|S81027.1| Msr-110=EN protein binding gene/engrailed nuclear
            homeoprotein-regulated gene [Drosophila melanogaster,
            mRNA, 2614 nt]
          Length = 2614

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2561 ctctagaactagtggatcccccgggctgcag 2531

---

>gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame
           3, multiple cloning site} [Saccharomyces
           cerevisiae=yeast, cloning vector YCpIF15,16,17, Other
           Plasmid Synthetic Partial, 169 nt]
          Length = 169

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 136 ctctagaactagtggatcccccgggctgcag 106

---

>gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame
           2, multiple cloning site} [Saccharomyces
           cerevisiae=yeast, cloning vector YCpIF15,16,17, Other
           Plasmid Synthetic Partial, 151 nt]
          Length = 151

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 118 ctctagaactagtggatcccccgggctgcag 88

---

>gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame
           1, multiple cloning site} [Saccharomyces
           cerevisiae=yeast, cloning vector YCpIF15,16,17, Other
           Plasmid Synthetic Partial, 135 nt]
          Length = 135

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 102 ctctagaactagtggatcccccgggctgcag 72

---

>gb|S71728.1| truncated protein {frame 1, multiple cloning site} [Saccharomyces
          cerevisiae=yeast, cloning vector YCpIF1-12, Other
          Plasmid Synthetic Partial, 99 nt]
          Length = 99

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 66 ctctagaactagtggatcccccgggctgcag 36

---

>emb|AJ518837.1|GMA518837 Glycine max mRNA for putative phosphatase (nod33 gene)
          Length = 1088

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 26 ctctagaactagtggatcccccgggctgcag 56

---

>gb|DQ071886.1| Cloning vector pRD29A-GFP, complete sequence
          Length = 14856

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6189 ctctagaactagtggatcccccgggctgcag 6159

---

>gb|DQ071887.1| Cloning vector pRD29A-GUS, complete sequence
          Length = 15948

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7281 ctctagaactagtggatcccccgggctgcag 7251

---

>gb|AF047000.2|AF047000 Borrelia burgdorferi plasmid cp32 2.9-10 BlyA (blyA), BlyB
          (blyB), Rev (rev), and Mlp10 (mlp10) genes, complete
          cds; and unknown genes
          Length = 3308

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 46 ctctagaactagtggatcccccgggctgcag 76

---

>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence
          Length = 3062

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 830 ctctagaactagtggatcccccgggctgcag 800

---

>gb|DQ062658.1| Cloning vector p713-1160, complete sequence
          Length = 15595

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 6928 ctctagaactagtggatcccccgggctgcag 6898

---

>gb|AY034154.1| Cloning vector pIDN4, complete sequence
          Length = 2059

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 154 ctctagaactagtggatcccccgggctgcag 124

---

>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence
          Length = 2650

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2199 ctctagaactagtggatcccccgggctgcag 2229

---

>dbj|AB206707.1| Aplysia kurodai FaNaC mRNA for FMRFamide-gated Na+ channel,
          complete cds
          Length = 2352

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 37 ctctagaactagtggatcccccgggctgcag 67

---

>gb|AY785150.1| Expression vector pFL190, complete sequence
          Length = 9538

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7927 ctctagaactagtggatcccccgggctgcag 7957

---

>gb|AY785149.1| Cloning vector pFL122, complete sequence
          Length = 8652

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 8178 ctctagaactagtggatcccccgggctgcag 8208

---

>gb|M64598.1|SEINMYC2 Serinus canaria N-myc (N-myc) gene, exon and complete cds
          Length = 1742

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1722 ctctagaactagtggatcccccgggctgcag 1692

---

>gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence
          Length = 9233

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2613 ctctagaactagtggatcccccgggctgcag 2643

---

>dbj|D88548.2| Homo sapiens NDUFV2 gene for 24-kDa subunit of complex I, partial cds
          Length = 5729

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2976 ctctagaactagtggatcccccgggctgcag 3006

---

>dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase, complete cds
          Length = 16886

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3550 ctctagaactagtggatcccccgggctgcag 3520

---

>dbj|AB081498.2| Mus musculus ELYS gene for putative transcription factor, complete cds
          Length = 56680

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                            
Query: 1     ctctagaactagtggatcccccgggctgcag 31
             |||||||||||||||||||||||||||||||
Sbjct: 56292 ctctagaactagtggatcccccgggctgcag 56262

---

>dbj|D50017.2| Homo sapiens PDGFRA gene for alpha-platelet-derived growth factor
             receptor, complete cds
          Length = 17087

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                            
Query: 1     ctctagaactagtggatcccccgggctgcag 31
             |||||||||||||||||||||||||||||||
Sbjct: 13510 ctctagaactagtggatcccccgggctgcag 13540

---

>gb|AF033623.2|AF033623 Ovis aries putative heparan sulfate proteoglycan (novocan) mRNA,
          complete cds
          Length = 3050

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 33 ctctagaactagtggatcccccgggctgcag 63

---

>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence
          Length = 5647

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3183 ctctagaactagtggatcccccgggctgcag 3153

---

>gb|AF270470.1|AF270470 Cloning vector pBIG, complete sequence
          Length = 11335

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2898 ctctagaactagtggatcccccgggctgcag 2928

---

>gb|AF269225.1|AF269225 Cloning vector pLITTLE, complete sequence
          Length = 10036

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2876 ctctagaactagtggatcccccgggctgcag 2906

---

>gb|AF269226.1|AF269226 Cloning vector pTIKL, complete sequence
          Length = 10036

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2876 ctctagaactagtggatcccccgggctgcag 2906

---

>gb|AF298787.1|AF298787 C-terminal GFP fusion vector pUG35, complete sequence
          Length = 6231

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3057 ctctagaactagtggatcccccgggctgcag 3027

---

>gb|AF298783.1|AF298783 C-terminal GFP fusion vector pUG23, complete sequence
          Length = 6303

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3129 ctctagaactagtggatcccccgggctgcag 3099

---

>gb|AF298781.1|AF298781 PCR template vector pUG30, complete sequence
          Length = 5785

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 620 ctctagaactagtggatcccccgggctgcag 650

---

>gb|AY196823.1| PiggyBac transformation vector pB-UAS w+, complete sequence
          Length = 8936

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1004 ctctagaactagtggatcccccgggctgcag 1034

---

>gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complete sequence
          Length = 8137

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 641 ctctagaactagtggatcccccgggctgcag 671

---

>gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence
          Length = 7085

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4800 ctctagaactagtggatcccccgggctgcag 4830

---

>dbj|AB044085.1| Coprinopsis cinerea Pri1p mRNA for DNA primase, partial cds
          Length = 732

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 728 ctctagaactagtggatcccccgggctgcag 698

---

>gb|AF190131.1|AF190131 Cloning vector pVO205 hygromycin-B-phosphotransferase (hph) gene,
          complete cds
          Length = 2042

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 24 ctctagaactagtggatcccccgggctgcag 54

---

>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4122 ctctagaactagtggatcccccgggctgcag 4092

---

>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA)
            and beta-galactosidase alpha peptide (lacZa) genes,
            complete cds
          Length = 4549

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4061 ctctagaactagtggatcccccgggctgcag 4091

---

>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3058 ctctagaactagtggatcccccgggctgcag 3028

---

>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and
            beta-galactosidase alpha peptide (lacZa) genes, complete
            cds
          Length = 3485

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2997 ctctagaactagtggatcccccgggctgcag 3027

---

>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence
          Length = 3417

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 685 ctctagaactagtggatcccccgggctgcag 715

---

>emb|AJ427913.1|SOL427913 Spinacia oleracea partial mRNA for sigma factor (sig3 gene)
          Length = 2040

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2023 ctctagaactagtggatcccccgggctgcag 1993

---

>emb|AJ576322.1|CAU576322 Carassius auratus mc5R gene for melanocortin 5 receptor
          Length = 2198

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2177 ctctagaactagtggatcccccgggctgcag 2147

---

>dbj|AK173397.1| Ciona intestinalis cDNA, clone:citb001a22, full insert sequence
          Length = 2093

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 59 ctctagaactagtggatcccccgggctgcag 89

---

>dbj|D89785.1| Xenopus laevis mRNA for XICE-b, complete cds
          Length = 1526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1463 ctctagaactagtggatcccccgggctgcag 1433

---

>emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3 protein
          Length = 531

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 31 ctctagaactagtggatcccccgggctgcag 61

---

>emb|AJ586515.1| Fagus sylvatica partial ank1 mRNA for ankyrin-repeat protein
          Length = 700

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 53 ctctagaactagtggatcccccgggctgcag 83

---

>emb|X87170.1|TMGABAALA T.marmorata mRNA for GABA/beta-alanine transporter
          Length = 2976

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2973 ctctagaactagtggatcccccgggctgcag 2943

---

>dbj|AB158265.1| Cloning vector TFV5 gene for M13 pIII, partial cds
          Length = 6470

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5813 ctctagaactagtggatcccccgggctgcag 5783

---

>dbj|AB158264.1| Cloning vector TFV4 gene for M13 pIII, partial cds
          Length = 6470

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5813 ctctagaactagtggatcccccgggctgcag 5783

---

>dbj|AB158263.1| Cloning vector TFV3 gene for M13 pIII, partial cds
          Length = 5935

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 5278 ctctagaactagtggatcccccgggctgcag 5248

---

>dbj|AB121971.1| Thermosynechococcus vulcanus kaiA, kaiB, kaiC genes for circadian
            clock protein KaiA, circadian clock protein KaiB,
            circadian clock protein KaiC, complete and partial cds
          Length = 4102

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4072 ctctagaactagtggatcccccgggctgcag 4042

---

>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector
          Length = 2964

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 676 ctctagaactagtggatcccccgggctgcag 706

---

>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region
          Length = 147

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 117 ctctagaactagtggatcccccgggctgcag 87

---

>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region
          Length = 144

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 44 ctctagaactagtggatcccccgggctgcag 74

---

>emb|AJ269534.1|THA269534 Trichoderma harzianum mRNA for glucose transporter (gtt1 gene)
          Length = 1972

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 26 ctctagaactagtggatcccccgggctgcag 56

---

>emb|X82626.1|XLCORGLEC X.laevis mRNA for cortical granule lectin
          Length = 1166

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 54 ctctagaactagtggatcccccgggctgcag 84

---

>emb|Y16016.1|ECPO157F Escherichia coli plasmid pO157 DNA, 12,5 kb fragment
          Length = 12518

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 58 ctctagaactagtggatcccccgggctgcag 88

---

>emb|Z54211.1|ECSHET2B S.flexneri senA gene (isolate 2457T)
          Length = 2940

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 38 ctctagaactagtggatcccccgggctgcag 68

---

>emb|Z54194.1|ECSHET2A E.coli senA gene (isolate EI-34)
          Length = 2940

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 38 ctctagaactagtggatcccccgggctgcag 68

---

>emb|Z48742.1|HPNIXAGN H.pylori nixA gene
          Length = 2580

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 77  ctctagaactagtggatcccccgggctgcag 107

---

>gb|AF041426.1|AF041426 Cloning vector pVLH-1, complete sequence
          Length = 7823

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 4909 ctctagaactagtggatcccccgggctgcag 4879

---

>emb|Y17969.1|ATH17969 Arabidopsis thaliana erg gene
          Length = 2471

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1189 ctctagaactagtggatcccccgggctgcag 1159

---

>emb|Z54153.1|OSCHINDPR O.sativa mRNA for chilling-inducible protein
          Length = 1585

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 66 ctctagaactagtggatcccccgggctgcag 96

---

>emb|Z50800.1|MSASET2MR M.sativa mRNA for ASET2
          Length = 1193

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 21 ctctagaactagtggatcccccgggctgcag 51

---

>emb|AJ012719.1|GSU012719 Galdieria sulphuraria mRNA for phosphoribulokinase
          Length = 1524

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 8  ctctagaactagtggatcccccgggctgcag 38

---

>emb|AJ131342.1|ATH131342 Arabidopsis thaliana mRNA for LEA-like protein
          Length = 1100

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 25 ctctagaactagtggatcccccgggctgcag 55

---

>gb|AY810440.1| Schistosoma japonicum clone SJCHGC09357 unknown mRNA
          Length = 1145

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 21 ctctagaactagtggatcccccgggctgcag 51

---

>gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence
          Length = 27608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                            
Query: 1     ctctagaactagtggatcccccgggctgcag 31
             |||||||||||||||||||||||||||||||
Sbjct: 27556 ctctagaactagtggatcccccgggctgcag 27586

---

>gb|AF030383.1|AF030383 Cucumis melo ADP-glucose pyrophosphorylase large subunit (mlf1)
          mRNA, complete cds
          Length = 2009

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 25 ctctagaactagtggatcccccgggctgcag 55

---

>gb|AF179381.1|AF179381 Expression vector pJN105, complete sequence
          Length = 6055

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2818 ctctagaactagtggatcccccgggctgcag 2788

---

>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence
          Length = 3574

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3323 ctctagaactagtggatcccccgggctgcag 3353

---

>gb|AF123263.1|AF123263 Mus musculus phenylalanyl tRNA synthetase beta subunit (Frsb) mRNA,
            complete cds
          Length = 1995

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1977 ctctagaactagtggatcccccgggctgcag 1947

---

>gb|AF157496.1|AF157496 Suillus bovinus heterotrimeric G protein alpha subunit mRNA,
          complete cds
          Length = 1486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 19 ctctagaactagtggatcccccgggctgcag 49

---

>gb|DQ349231.1| Expression vector peTetOn/FKNF(PacI), complete sequence
          Length = 11676

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 9452 ctctagaactagtggatcccccgggctgcag 9422



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1328 ctctagaactagtggatcccccgggctgcag 1358

---

>gb|DQ349230.1| Expression vector pe2TetOn/FKNF(PacI), complete sequence
          Length = 11526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1328 ctctagaactagtggatcccccgggctgcag 1358

---

>gb|DQ349229.1| Expression vector pe2TetOn(PacI), complete sequence
          Length = 10049

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1328 ctctagaactagtggatcccccgggctgcag 1358

---

>gb|DQ349228.1| Expression vector peTetOn(PacI), complete sequence
          Length = 10199

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 7975 ctctagaactagtggatcccccgggctgcag 7945



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1328 ctctagaactagtggatcccccgggctgcag 1358

---

>gb|AF092931.1|AF092931 Shuttle vector pCGL0609, complete sequence
          Length = 6398

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 71  ctctagaactagtggatcccccgggctgcag 101

---

>emb|AJ243514.1|THA243514 Trichoderma harzianum mRNA for P4 protein (P4 gene)
          Length = 1352

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 63 ctctagaactagtggatcccccgggctgcag 93

---

>gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence
          Length = 6640

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 2613 ctctagaactagtggatcccccgggctgcag 2643

---

>emb|AJ269533.1|THA269533 Trichoderma harzianum mRNA for putative L-aminoacid oxidase (aox1
          gene)
          Length = 1829

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                         
Query: 1  ctctagaactagtggatcccccgggctgcag 31
          |||||||||||||||||||||||||||||||
Sbjct: 26 ctctagaactagtggatcccccgggctgcag 56

---

>gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence
          Length = 10459

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 3962 ctctagaactagtggatcccccgggctgcag 3932

---

>emb|AJ000347.1|RN325SAL3 Rattus norvegicus mRNA for 3'(2'),5'-bisphosphate nucleotidase
          Length = 2002

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                           
Query: 1    ctctagaactagtggatcccccgggctgcag 31
            |||||||||||||||||||||||||||||||
Sbjct: 1952 ctctagaactagtggatcccccgggctgcag 1982

---

>gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence
          Length = 4133

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 248 ctctagaactagtggatcccccgggctgcag 218

---

>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green
           fluorescent protein (AGP1) mRNA, partial cds
          Length = 3062

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 830 ctctagaactagtggatcccccgggctgcag 800

---

>emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4
          Length = 1047

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 972 ctctagaactagtggatcccccgggctgcag 942

---

>gb|AF092036.1|AF092036 Shuttle vector pCGL0482, complete sequence
          Length = 6241

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 71  ctctagaactagtggatcccccgggctgcag 101

---

>gb|AF091268.1|AF091268 Shuttle vector pCGL0243, complete sequence
          Length = 6272

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Plus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 71  ctctagaactagtggatcccccgggctgcag 101

---

>dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycoside 3'-phosphotransferase,
           beta-lactamase, complete cds
          Length = 3306

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 1   ctctagaactagtggatcccccgggctgcag 31
           |||||||||||||||||||||||||||||||
Sbjct: 132 ctctagaactagtggatcccccgggctgcag 102


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,782,163
Number of Sequences: 3902068
Number of extensions: 3782163
Number of successful extensions: 71042
Number of sequences better than 10.0: 664
Number of HSP's better than 10.0 without gapping: 661
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 70149
Number of HSP's gapped (non-prelim): 889
length of query: 578
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 555
effective length of database: 17,143,297,704
effective search space: 9514530225720
effective search space used: 9514530225720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---