Clone Name | bart14e07 |
---|---|
Clone Library Name | barley_pub |
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 1070 bits (540), Expect = 0.0 Identities = 540/540 (100%) Strand = Plus / Plus Query: 53 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423290 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 2423349 Query: 113 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423350 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 2423409 Query: 173 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423410 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 2423469 Query: 233 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423470 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 2423529 Query: 293 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423530 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 2423589 Query: 353 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423590 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 2423649 Query: 413 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423650 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 2423709 Query: 473 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423710 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 2423769 Query: 533 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423770 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 2423829
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 1070 bits (540), Expect = 0.0 Identities = 540/540 (100%) Strand = Plus / Minus Query: 53 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893761 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 1893702 Query: 113 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893701 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 1893642 Query: 173 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893641 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 1893582 Query: 233 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893581 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 1893522 Query: 293 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893521 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 1893462 Query: 353 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893461 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 1893402 Query: 413 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893401 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 1893342 Query: 473 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893341 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 1893282 Query: 533 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893281 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 1893222
>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence Length = 31404 Score = 997 bits (503), Expect = 0.0 Identities = 536/542 (98%), Gaps = 5/542 (0%) Strand = Plus / Plus Query: 53 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18857 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 18916 Query: 113 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18917 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 18976 Query: 173 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 232 ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| Sbjct: 18977 tgggtggtggtcttgtgctcacctccgtcggtgtttacg-cgggctcggtgtct--ggca 19033 Query: 233 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19034 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 19093 Query: 293 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcact-gccc-taccgctatt 350 |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| Sbjct: 19094 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcacttgcccataccgctatt 19153 Query: 351 ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 410 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19154 ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 19213 Query: 411 cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19214 cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 19273 Query: 471 ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19274 ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 19333 Query: 531 caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 590 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19334 caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 19393 Query: 591 ca 592 || Sbjct: 19394 ca 19395
>dbj|AB081564.1| Paralichthys olivaceus TCRJd-Cd2-S gene for T cell receptor delta chain (J-C region), partial cds Length = 3764 Score = 93.7 bits (47), Expect = 6e-16 Identities = 59/62 (95%), Gaps = 2/62 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcagca 60 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| Sbjct: 3738 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcagca 3681 Query: 61 ga 62 || Sbjct: 3680 ga 3679
>dbj|AB178027.1| Ralstonia solanacearum insertion sequence IS1424 DNA Length = 4442 Score = 87.7 bits (44), Expect = 4e-14 Identities = 56/59 (94%), Gaps = 2/59 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcagc 59 ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| Sbjct: 6 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcagc 62
>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and gentamicin-3-acetyltransferase genes, complete cds Length = 4768 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and beta-lactamase genes, complete cds Length = 4950 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha) genes, complete cds; and unknown gene Length = 5228 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence Length = 5144 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence Length = 4707 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence Length = 7978 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4076 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence Length = 7277 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4076 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence Length = 8105 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4076 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|AY220481.2| Nicotiana tabacum Avr9/Cf-9 induced kinase 1 (ACIK1) mRNA, complete cds Length = 1774 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 69 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 124
>gb|AY753306.1| Leucoagaricus meleagris pyranose dehydrogenase (pdh1) gene, complete cds Length = 3089 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 43 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 98
>gb|DQ146965.2| Oncorhynchus mykiss insulin-like growth factor binding protein-related protein 1 (IGFBP-rP1) mRNA, complete cds Length = 1217 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 30 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 85
>gb|DQ190459.2| Oncorhynchus mykiss insulin-like growth factor binding protein 6 (IGFBP6) mRNA, complete cds Length = 2188 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 29 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 84
>ref|NM_001024387.1| Danio rerio wu:fj59e04 (wu:fj59e04), mRNA Length = 2188 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2149 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2094
>gb|AY813632.1| Schistosoma japonicum SJCHGC09300 protein mRNA, complete cds Length = 1371 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 57
>gb|AY811032.1| Schistosoma japonicum SJCHGC09205 protein mRNA, partial cds Length = 812 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 5 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 60
>gb|AY557621.1| Shuttle vector pELS200, complete sequence Length = 7828 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7433 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7378
>gb|AY150810.1| Cloning vector pRS327, complete sequence Length = 9560 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 5837 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 5892
>gb|AY150809.1| Cloning vector pRS317, complete sequence Length = 8601 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 5688 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 5743
>gb|AY150808.1| Cloning vector pRS307, complete sequence Length = 8219 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 5837 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 5892
>emb|AJ296741.1|PAB296741 Picea abies ATC microsatellite DNA, clone EATC3H03 Length = 519 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 427 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 372
>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1 Length = 6094 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 146 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 91
>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2 Length = 6116 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 145 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 90
>gb|AF140577.1| Integration vector mini-CTX2, complete sequence Length = 6755 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 856 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 911
>gb|AF140576.1| Integration vector mini-CTX1, complete sequence Length = 5610 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 856 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 911
>gb|AY428060.1| UAS-less reporter vector pMELalpha2, complete sequence Length = 7304 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7236 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7291
>gb|AY428056.1| UAS-less reporter vector pMELalpha, complete sequence Length = 7305 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7237 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7292
>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence Length = 5343 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3072 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3017
>gb|AY283058.1| Cloning vector pHRBar-6 Broad-host-range conditional lethal plasmid, complete sequence Length = 14708 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7506 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7451
>ref|XM_664949.1| Plasmodium berghei strain ANKA hypothetical protein (PB000410.03.0) partial mRNA Length = 669 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 652 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 597
>ref|XM_663685.1| Plasmodium berghei strain ANKA hypothetical protein (PB108231.00.0) partial mRNA Length = 269 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 23 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 78
>ref|XM_663765.1| Plasmodium berghei strain ANKA hypothetical protein (PB102643.00.0) partial mRNA Length = 466 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 449 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 394
>ref|XM_666485.1| Plasmodium berghei strain ANKA hypothetical protein (PB104095.00.0) partial mRNA Length = 121 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 20 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 75
>ref|XM_669173.1| Plasmodium berghei strain ANKA hypothetical protein (PB000102.02.0) partial mRNA Length = 1284 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 49 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 104
>ref|XM_673755.1| Plasmodium berghei strain ANKA hypothetical protein (PB105099.00.0) partial mRNA Length = 210 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 193 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 138
>ref|XM_659743.1| Cryptosporidium hominis TU502 LacOPZ-alpha peptide from pUC9 (Chro.80226) partial mRNA Length = 387 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 260 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 205
>ref|XM_659801.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.80263) partial mRNA Length = 219 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 191 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 136
>emb|AJ937310.1| Juglans regia mRNA for putative Cys2-His2 zinc finger transcription factor (zfp2 gene) Length = 804 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 10 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 65
>emb|X67155.2|HSMKLP1 Homo sapiens mRNA for mitotic kinesin-like protein-1 (MKLP-1 gene) Length = 3348 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3300 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3245
>ref|NM_011684.1| Mus musculus vomeronasal 1 receptor, A2 (V1ra2), mRNA Length = 3403 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3320 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3265
>gb|DQ452049.1| Binary vector pGPro1, complete sequence Length = 8833 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 8730 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 8785
>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence Length = 9655 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7337 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7392
>gb|AY291460.1| Shuttle vector pNG168, complete sequence Length = 8960 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4706 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4651
>emb|Z69978.1|AGG13SER A.gambiae mRNA for serine protease Length = 1028 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 28 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 83
>emb|Z31401.1|ATCYC2B A.thaliana (Columbia) cyc2b mRAN for cyclin 2b protein Length = 1798 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 85 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 140
>emb|Y17188.1|PFL17188 Platichthys flesus Ki-ras gene (exons 1 to 4) Length = 1665 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 146 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 201
>emb|X73143.1|ECNIK E.coli DNA sequence of nik locus Length = 6310 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6303 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6248
>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence Length = 5032 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2761 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2706
>gb|AY860535.1| Cloning vector p713-1511, complete sequence Length = 13907 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 5265 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 5210
>gb|AY860534.1| Cloning vector p713-947, complete sequence Length = 14789 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6147 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6092
>gb|AY860533.1| Cloning vector p713-905, complete sequence Length = 14999 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6357 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6302
>emb|AJ784850.1| Cyanophora paradoxa partial mRNA for ATP synthase A chain precursor (atpI-1 gene) Length = 701 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 61
>emb|AJ606472.1| Fagus sylvatica mRNA for serine/threonine protein kinase (pk5 gene) Length = 1463 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 42 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 97
>emb|AJ556549.1|DRE556549 Danio rerio mRNA for TRAF4 protein, splice variant 2 Length = 1870 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 36 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 91
>emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, splice variant 1 Length = 1913 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 95 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 150
>emb|AJ316544.1|PDU316544 Platynereis dumerilii mRNA for rhabdomeric opsin (r-opsin gene) Length = 1438 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 37 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 92
>emb|AJ302649.1|DRE302649 Danio rerio mRNA for GABAA receptor betaZ2 subunit (gabaabeta2 gene) Length = 2188 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2149 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2094
>emb|AJ276294.1|CSI276294 Citrus sinensis partial mRNA for ethylene receptor (ETR-1 gene) Length = 1240 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 58
>emb|AJ250829.1|PVA250829 Penaeus vannamei mRNA for phosphoenolpyruvate carboxykinase (pepck gene) Length = 2186 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 30 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 85
>emb|AJ225049.1|LPAJ5049 Lycopersicon peruvianum mRNA for Hsp20.2 protein Length = 1144 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 17 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 72
>gb|AY733073.1| Cloning vector pSW29T, complete sequence Length = 1958 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 390 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733072.1| Cloning vector pSW29, complete sequence Length = 1723 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 155 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 100
>gb|AY733071.1| Cloning vector pSW25T, complete sequence Length = 1963 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 390 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733070.1| Cloning vector pSW25, complete sequence Length = 2175 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 602 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 547
>gb|AY733069.1| Cloning vector pSW27, complete sequence Length = 1822 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 395 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 340
>gb|AY733068.1| Cloning vector pSW26, complete sequence Length = 1822 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 395 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 340
>gb|AY733067.1| Cloning vector pSW24, complete sequence Length = 2029 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 602 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 547
>gb|AY733066.1| Cloning vector pSW23T, complete sequence Length = 1817 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 390 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733065.1| Cloning vector pSW23, complete sequence Length = 1582 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 155 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 100
>gb|AY454397.1| Cloning vector pTA6, complete sequence Length = 3000 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>gb|AF531173.1| Cloning vector pDblet, complete sequence Length = 6238 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2769 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2714
>emb|Z47172.1|CSPAG13 Calothrix D253 genomic DNA (clone AG13) Length = 476 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 119 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 64
>emb|Z47158.1|CSPAG5 Calothrix D253 genomic DNA (clone AG5) Length = 307 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 167 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 112
>gb|AF504908.1| Cloning vector pBBRT, complete sequence Length = 5973 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3213 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3268
>dbj|AB236859.1| Trifolium pratense RNA for putative rubisco subunit binding-protein alpha subunit, complete cds, clone: C766 Length = 1971 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1964 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1909
>dbj|AB236854.1| Trifolium pratense RNA for putative myosin heavy chain-like protein, complete cds, clone: C675 Length = 2195 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 9 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 64
>dbj|AB236842.1| Trifolium pratense RNA for putative mitochondrial dicarboxylate carrier protein, complete cds, clone: C331 Length = 1385 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 9 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 64
>dbj|AB236821.1| Trifolium pratense RNA for putative tetrahydrofolate synthase, complete cds, clone: C2147 Length = 1526 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 9 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 64
>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence Length = 7414 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1048 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1103
>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence Length = 4570 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4094 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4149
>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence Length = 8182 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4569 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4514
>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence Length = 7168 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3555 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3500
>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence Length = 6333 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3548 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3493
>gb|S81027.1| Msr-110=EN protein binding gene/engrailed nuclear homeoprotein-regulated gene [Drosophila melanogaster, mRNA, 2614 nt] Length = 2614 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2586 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2531
>gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 3, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 169 nt] Length = 169 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 161 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 106
>gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 2, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 151 nt] Length = 151 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 143 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 88
>gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 135 nt] Length = 135 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 127 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 72
>gb|S71728.1| truncated protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF1-12, Other Plasmid Synthetic Partial, 99 nt] Length = 99 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 91 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 36
>emb|AJ518837.1|GMA518837 Glycine max mRNA for putative phosphatase (nod33 gene) Length = 1088 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 56
>gb|DQ071886.1| Cloning vector pRD29A-GFP, complete sequence Length = 14856 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6214 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6159
>gb|DQ071887.1| Cloning vector pRD29A-GUS, complete sequence Length = 15948 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7306 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7251
>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence Length = 3062 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 855 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 800
>gb|DQ062658.1| Cloning vector p713-1160, complete sequence Length = 15595 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6953 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6898
>gb|AY034154.1| Cloning vector pIDN4, complete sequence Length = 2059 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 179 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 124
>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence Length = 2650 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2174 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2229
>dbj|AB206707.1| Aplysia kurodai FaNaC mRNA for FMRFamide-gated Na+ channel, complete cds Length = 2352 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 12 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 67
>gb|AY785150.1| Expression vector pFL190, complete sequence Length = 9538 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7902 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7957
>gb|AY785149.1| Cloning vector pFL122, complete sequence Length = 8652 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 8153 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 8208
>dbj|D88548.2| Homo sapiens NDUFV2 gene for 24-kDa subunit of complex I, partial cds Length = 5729 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2951 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3006
>dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase, complete cds Length = 16886 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3575 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3520
>dbj|AB081498.2| Mus musculus ELYS gene for putative transcription factor, complete cds Length = 56680 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 56317 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 56262
>dbj|D50017.2| Homo sapiens PDGFRA gene for alpha-platelet-derived growth factor receptor, complete cds Length = 17087 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 13485 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 13540
>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence Length = 5647 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3208 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3153
>gb|AF270470.1|AF270470 Cloning vector pBIG, complete sequence Length = 11335 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2873 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2928
>gb|AF269225.1|AF269225 Cloning vector pLITTLE, complete sequence Length = 10036 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2851 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2906
>gb|AF269226.1|AF269226 Cloning vector pTIKL, complete sequence Length = 10036 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2851 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2906
>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4147 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4092
>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4036 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4091
>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3083 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3028
>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2972 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3027
>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence Length = 3417 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 660 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 715
>dbj|AK173397.1| Ciona intestinalis cDNA, clone:citb001a22, full insert sequence Length = 2093 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 34 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 89
>dbj|D89785.1| Xenopus laevis mRNA for XICE-b, complete cds Length = 1526 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1488 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1433
>emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3 protein Length = 531 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 61
>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector Length = 2964 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|AJ269534.1|THA269534 Trichoderma harzianum mRNA for glucose transporter (gtt1 gene) Length = 1972 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 56
>emb|X82626.1|XLCORGLEC X.laevis mRNA for cortical granule lectin Length = 1166 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 29 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 84
>emb|Y16016.1|ECPO157F Escherichia coli plasmid pO157 DNA, 12,5 kb fragment Length = 12518 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 33 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 88
>emb|Z54211.1|ECSHET2B S.flexneri senA gene (isolate 2457T) Length = 2940 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 13 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 68
>emb|Z54194.1|ECSHET2A E.coli senA gene (isolate EI-34) Length = 2940 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 13 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 68
>emb|Z48742.1|HPNIXAGN H.pylori nixA gene Length = 2580 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 52 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 107
>emb|Z54153.1|OSCHINDPR O.sativa mRNA for chilling-inducible protein Length = 1585 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 41 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 96
>gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence Length = 27608 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 27531 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 27586
>gb|AF179381.1|AF179381 Expression vector pJN105, complete sequence Length = 6055 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2843 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2788
>gb|DQ349231.1| Expression vector peTetOn/FKNF(PacI), complete sequence Length = 11676 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 9477 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 9422 Score = 71.9 bits (36), Expect = 2e-09 Identities = 36/36 (100%) Strand = Plus / Plus Query: 23 ggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||||||||||||||||||||||||||| Sbjct: 1323 ggccgctctagaactagtggatcccccgggctgcag 1358
>gb|DQ349228.1| Expression vector peTetOn(PacI), complete sequence Length = 10199 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 8000 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7945 Score = 71.9 bits (36), Expect = 2e-09 Identities = 36/36 (100%) Strand = Plus / Plus Query: 23 ggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||||||||||||||||||||||||||| Sbjct: 1323 ggccgctctagaactagtggatcccccgggctgcag 1358
>emb|AJ243514.1|THA243514 Trichoderma harzianum mRNA for P4 protein (P4 gene) Length = 1352 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 38 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 93
>emb|AJ269533.1|THA269533 Trichoderma harzianum mRNA for putative L-aminoacid oxidase (aox1 gene) Length = 1829 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 56
>gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence Length = 4133 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 273 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 218
>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green fluorescent protein (AGP1) mRNA, partial cds Length = 3062 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 855 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 800
>emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGreen-2 Length = 3633 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2208 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2263
>emb|X98363.1|PVPIJ2581 Cloning vector pIJ2581 glkA gene for glucose kinase and tsr gene for thiostrepton resistance protein Length = 5192 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2996 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2941
>gb|AY557620.1| Shuttle vector pELS100, complete sequence Length = 7022 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6627 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6572
>emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2 Length = 4358 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2157 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2102 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 758 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4 Length = 3970 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1769 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1714 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 758 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2 Length = 4154 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1953 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1898 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 758 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning vector gltS gene Length = 4670 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1956 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1901
>emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning vector gltS gene Length = 4670 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1845 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1900
>emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning vector gltS gene Length = 4670 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1425 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1480
>emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning vector gltS gene Length = 4670 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1536 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1481
>emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning vector gltS gene Length = 6340 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 959 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1014
>emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning vector gltS gene Length = 6340 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1070 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1015
>emb|AJ007829.1|CVE7829 Cloning Vector pGreen Length = 3228 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 886 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 831
>dbj|AB076895.1| Ciona intestinalis Ci-calumenin mRNA for calumenin homologue, complete cds Length = 1740 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 459 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 514 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 24 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 79
>gb|AF067142.1|AF067142 Cloning vector pSFI polylinker, complete polylinker sequence Length = 209 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 180 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 125
>dbj|AK115638.1| Ciona intestinalis cDNA, clone:cilv010m12, full insert sequence Length = 2307 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 34 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 89
>gb|U61229.1|CVU61229 Cloning vector pKRX, complete sequence Length = 2976 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 777 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 722
>gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete sequence Length = 3345 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2016 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1961 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 721 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 668
>gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete sequence Length = 4285 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2086 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2031 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete sequence Length = 5275 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3076 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3021 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete sequence Length = 4480 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2281 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2226 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete sequence Length = 4252 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2923 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2868 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 721 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 668
>gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete sequence Length = 3357 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2014 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1959 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 612 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 667
>gb|U35130.1|XXU35130 Plasmid pBSL142 cloning vector, complete sequence Length = 4669 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2470 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2415 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35129.1|XXU35129 Plasmid pBSL141 cloning vector, complete sequence Length = 3886 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1687 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1632 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35128.1|XXU35128 Plasmid pBSL130 cloning vector, complete sequence Length = 5035 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2836 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2781 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35127.1|XXU35127 Plasmid pBSL128 cloning vector, complete sequence Length = 5060 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2861 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2806 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35126.1|XXU35126 Plasmid pBSL121 cloning vector, complete sequence Length = 4051 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1852 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1797 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35125.1|XXU35125 Plasmid pBSL119 cloning vector, complete sequence Length = 4842 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2643 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2588 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|AF016889.1|AF016889 Cloning vector pWSK29, complete sequence Length = 5434 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1894 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1839
>gb|U93719.1| Cloning vector pRS422 with 2micron ADE2 marker, complete sequence Length = 6868 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3257 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3202
>gb|U93718.1| Cloning vector pRS412 with CEN/ARS ADE2 marker, complete sequence Length = 6042 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3257 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3202
>gb|U93717.1| Cloning vector pRS402 with ADE2 marker, complete sequence Length = 5528 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3257 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3202
>gb|U93716.1| Cloning vector pRS421 with 2micron MET15 marker, complete sequence Length = 6233 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2622 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2567
>gb|U93715.1| Cloning vector pRS411 with CEN/ARS MET15 marker, complete sequence Length = 5407 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2622 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2567
>gb|U93714.1| Cloning vector pRS401 with MET15 marker, complete sequence Length = 4893 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2622 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2567
>gb|U93713.1| Cloning vector pRS400 with kanMX4 marker, complete sequence Length = 4755 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2484 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2429
>gb|U84006.1|EVU84006 Expression vector pBSII-LUCINT firefly luciferase (LUCINT), beta-galactosidase (lacZ) and beta-lactamase (ampR) genes, complete cds and lac operon promoter sequence Length = 5967 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3113 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3058
>gb|U40861.1|NGU40861 Neisseria gonorrhoeae hemoglobin receptor (hmbR) gene, complete cds Length = 2605 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2597 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2542
>gb|DQ284475.1| Solanum tuberosum clone 132B05 glutamine cyclotransferase precursor-like mRNA, complete cds Length = 1172 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 25 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 80
>gb|U34887.1|U34887 Yeast integrating vector pRS306 containing a fragment of lacZ Length = 5187 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1991 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2046
>emb|AJ312393.1|CTR312393 Chloroplast transformation vector pRB95 Length = 7626 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7464 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7519
>emb|AJ312392.1|CTR312392 Chloroplast transformation vector pRB94 Length = 7626 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 7560 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 7505
>gb|U03442.1|PRS316 Yeast centromere vector pRS316 with URA3 marker, complete sequence Length = 4887 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1991 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2046
>gb|U03441.1|PRS315 Yeast centromere vector pRS315 with LEU2 marker, complete sequence Length = 6018 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3122 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3177
>gb|U03440.1|PRS314 Yeast centromere vector pRS314 with TRP1 marker, complete sequence Length = 4783 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1887 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1942
>gb|U03439.1|PRS313 Yeast centromere vector pRS313 with HIS3 marker, complete sequence Length = 4967 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2071 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2126
>gb|U03438.1|PRS306 Yeast integrative vector pRS306 with URA3 marker, complete sequence Length = 4373 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1991 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2046
>gb|U03437.1|PRS305 Yeast integrative vector pRS305 with LEU2 marker, complete sequence Length = 5504 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3122 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3177
>gb|U03436.1|PRS304 Yeast integrative vector pRS304 with TRP1 marker, complete sequence Length = 4267 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1885 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1940
>gb|U03435.1|PRS303 Yeast integrative vector pRS303 with HIS3 marker, complete sequence Length = 4443 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2071 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2126
>emb|Y12724.1|MMPHEREC2 Mus musculus mRNA for pheromone receptor 2 Length = 3403 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3320 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3265
>emb|Z86120.1|TEZ86120 T.evansi mRNA, clone Q16R1 Length = 851 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 44 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 99
>gb|U03451.1|PRS426 Yeast episomal vector pRS426 with URA3 marker, complete sequence Length = 5726 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2113 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2058
>gb|U03452.1|PRS425 Yeast episomal vector pRS425 with LEU2 marker, complete sequence Length = 6849 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3236 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3181
>gb|U03453.1|PRS424 Yeast episomal vector pRS424 with TRP1 marker, complete sequence Length = 5616 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2003 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1948
>gb|U03454.1|PRS423 Yeast episomal vector pRS423 with HIS3 marker, complete sequence Length = 5797 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2185 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2130
>gb|U03450.1|PRS416 Yeast centromere vector pRS416 with URA3 marker, complete sequence Length = 4898 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2113 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2058
>gb|U03449.1|PRS415 Yeast centromere vector pRS415 with LEU2 marker, complete sequence Length = 6021 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3236 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3181
>gb|U03448.1|PRS414 Yeast centromere vector pRS414 with TRP1 marker, complete sequence Length = 4788 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2003 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1948
>gb|U03447.1|PRS413 Yeast centromere vector pRS413 with HIS3 marker, complete sequence Length = 4970 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2185 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2130
>gb|U03446.1|PRS406 Yeast integrative vector pRS406 with URA3 marker, complete sequence Length = 4384 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2113 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2058
>gb|U03445.1|PRS405 Yeast integrative vector pRS405 with LEU2 marker, complete sequence Length = 5507 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3236 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3181
>gb|U03444.1|PRS404 Yeast integrative vector pRS404 with TRP1 marker, complete sequence Length = 4274 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2003 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1948
>gb|U03443.1|PRS403 Yeast integrative vector pRS403 with HIS3 marker, complete sequence Length = 4456 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2185 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2130
>gb|U14125.1|CVU14125 Cloning vector pSG926, HIS4-based plasmid, complete sequence Length = 5634 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 665 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 720
>gb|U14120.1|CVU14120 Cloning vector pSG927, HIS4-based plasmid, complete sequence Length = 5634 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 776 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 721
>gb|U25267.1|CVKSLIC Ligation-independent cloning vector pBluescript II KS(+)/LIC, complete sequence Length = 2979 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>emb|AJ132110.1|OCU132110 Oryctolagus cuniculus mRNA for epithelial sodium channel, gamma subunit Length = 2448 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 36 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 91
>emb|AJ316541.1|PDU316541 Platynereis dumerilii partial mRNA for Pax6 protein Length = 1365 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 58
>emb|X85998.1|DMELAST D.melanogaster mRNA for elastin-like protein Length = 562 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 56
>gb|L08874.1|SYNPHSCSKV PhageScript SK cloning vector Length = 7372 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 6271 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 6326
>gb|L08786.1|SYNBLSKMV BlueScribe SK Minus cloning vector Length = 2964 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|L08784.1|SYNBLKSMV BlueScribe KS Minus cloning vector Length = 2964 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 651 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 706
>gb|L08787.1|SYNBLDKPV BlueScribe SK Plus cloning vector Length = 2964 Score = 85.7 bits (43), Expect = 2e-13 Identities = 55/58 (94%), Gaps = 2/58 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 762 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>emb|Y09669.1|DRTKRAL1 D.rerio mRNA for tyrosine kinase ligand (AL-1) Length = 1650 Score = 83.8 bits (42), Expect = 6e-13 Identities = 54/57 (94%), Gaps = 2/57 (3%) Strand = Plus / Plus Query: 2 ggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 ggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 55
>emb|AJ586509.1| Fagus sylvatica pk4 mRNA for serine/threonine-protein kinase Length = 1698 Score = 83.8 bits (42), Expect = 6e-13 Identities = 54/57 (94%), Gaps = 2/57 (3%) Strand = Plus / Plus Query: 2 ggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 39 ggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 93
>emb|AJ131342.1|ATH131342 Arabidopsis thaliana mRNA for LEA-like protein Length = 1100 Score = 83.8 bits (42), Expect = 6e-13 Identities = 54/57 (94%), Gaps = 2/57 (3%) Strand = Plus / Plus Query: 2 ggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 ggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 55
>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence Length = 4295 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3247 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3300 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 22 cggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||||||||||||||||||||||| Sbjct: 1033 cggccgctctagaactagtggatcccccgggctgcag 997
>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence Length = 4296 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2181 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2234
>gb|AY456904.1| Binary vector pRE1, complete sequence Length = 9769 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 102 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 49
>gb|AY491501.1| Expression vector hu-beta-MHC-neo-pgk-hygro, complete sequence Length = 9431 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 4727 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 4780
>emb|X99398.1|AECVP Artificial E.coli vector plasmid Length = 4291 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 45 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 98
>emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative Bowman Birk tryspin inhibitor Length = 2378 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2378 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2325
>emb|X62445.1|PVXANPTR Potato virus X artificial neomycin phosphotransferase II mRNA 5'-flank (SEQ4) Length = 92 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 66 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 13
>gb|DQ414707.1| Functional Analysis Plasmid pFA-SAT1, complete sequence Length = 4375 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2050 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1997
>gb|AF372620.1| GlnQ allelic exchange vector pAG101, complete sequence Length = 5126 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1175 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1122
>gb|AF033623.2|AF033623 Ovis aries putative heparan sulfate proteoglycan (novocan) mRNA, complete cds Length = 3050 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 10 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 63
>gb|AF190131.1|AF190131 Cloning vector pVO205 hygromycin-B-phosphotransferase (hph) gene, complete cds Length = 2042 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 54
>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region Length = 147 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 140 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 87
>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region Length = 144 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 21 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 74
>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence Length = 3574 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 3300 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 3353
>gb|AF092931.1|AF092931 Shuttle vector pCGL0609, complete sequence Length = 6398 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 48 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 101
>gb|AF092036.1|AF092036 Shuttle vector pCGL0482, complete sequence Length = 6241 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 48 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 101
>gb|AF091268.1|AF091268 Shuttle vector pCGL0243, complete sequence Length = 6272 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 48 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 101
>emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside 3'-phosphotransferase and bla gene for beta-lactamase Length = 4155 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1847 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 1900
>gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete sequence Length = 4289 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1981 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2034 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 760 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35131.1|XXU35131 Plasmid pBSL159 cloning vector, complete sequence Length = 4144 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Plus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2692 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2745 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/56 (94%), Gaps = 2/56 (3%) Strand = Plus / Minus Query: 3 gagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 721 gagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 668
>gb|U62937.1|UGU62937 Ureaplasma gallorale 16S ribosomal RNA gene, partial sequence Length = 1523 Score = 79.8 bits (40), Expect = 9e-12 Identities = 54/58 (93%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1512 tggagctccaccgcggtg---cggccgctctagaactagtggatcccccgggctgcag 1458
>gb|U37689.1|HSU37689 Human RNA polymerase II subunit (hsRPB8) mRNA, complete cds Length = 867 Score = 79.8 bits (40), Expect = 9e-12 Identities = 54/58 (93%), Gaps = 3/58 (5%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 23 tggagctccaccgcggtg---cggccgctctagaactagtggatcccccgggctgcag 77
>dbj|D13509.1|MUSPAPA Mus musculus mRNA for PAP homologous protein, complete cds Length = 745 Score = 79.8 bits (40), Expect = 9e-12 Identities = 52/55 (94%), Gaps = 2/55 (3%) Strand = Plus / Minus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctg 55 ||||||||||||||||| | |||||||||||||||||||||||||||||||||| Sbjct: 614 tggagctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctg 562
>dbj|AB019242.1| Bos taurus SSAO mRNA for semicarbazide-sensitive amine oxidase, complete cds Length = 3624 Score = 79.8 bits (40), Expect = 9e-12 Identities = 54/58 (93%), Gaps = 3/58 (5%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 4 tggagctccaccgcggtg---cggccgctctagaactagtggatcccccgggctgcag 58
>emb|AJ577293.1|CGI577293 Crassostrea gigas bmpr1 gene for BMP type 1b receptor, exons 1-11 Length = 10121 Score = 77.8 bits (39), Expect = 4e-11 Identities = 54/58 (93%), Gaps = 2/58 (3%) Strand = Plus / Plus Query: 1 tggagctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||| Sbjct: 29 tggagctccaccgcggtgg--cggccgctctagaactagtggatcctccgggctgcag 84
>emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative Bowman Birk trypsin inhibitor Length = 2336 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/54 (94%), Gaps = 2/54 (3%) Strand = Plus / Plus Query: 5 gctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 gctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 52
>emb|AJ576322.1|CAU576322 Carassius auratus mc5R gene for melanocortin 5 receptor Length = 2198 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/54 (94%), Gaps = 2/54 (3%) Strand = Plus / Minus Query: 5 gctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 2198 gctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 2147
>dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T cell receptor delta chain (J-C region), partial cds Length = 3980 Score = 77.8 bits (39), Expect = 4e-11 Identities = 39/39 (100%) Strand = Plus / Minus Query: 24 gccgctctagaactagtggatcccccgggctgcagcaga 62 ||||||||||||||||||||||||||||||||||||||| Sbjct: 3932 gccgctctagaactagtggatcccccgggctgcagcaga 3894
>emb|AJ299411.1|DRE299411 Danio rerio partial mRNA for hypothetical protein (ORF) Length = 2605 Score = 77.8 bits (39), Expect = 4e-11 Identities = 51/54 (94%), Gaps = 2/54 (3%) Strand = Plus / Plus Query: 5 gctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 ||||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 gctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 52
>gb|DQ200396.1| Solanum tuberosum clone 070E08 unknown mRNA Length = 1196 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/53 (94%), Gaps = 2/53 (3%) Strand = Plus / Plus Query: 6 ctccaccgcggttgtccggccgctctagaactagtggatcccccgggctgcag 58 |||||||||||| | ||||||||||||||||||||||||||||||||||||| Sbjct: 1 ctccaccgcggtgg--cggccgctctagaactagtggatcccccgggctgcag 51 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,637,019 Number of Sequences: 3902068 Number of extensions: 3637019 Number of successful extensions: 68348 Number of sequences better than 10.0: 807 Number of HSP's better than 10.0 without gapping: 779 Number of HSP's successfully gapped in prelim test: 28 Number of HSP's that attempted gapping in prelim test: 66882 Number of HSP's gapped (non-prelim): 1135 length of query: 592 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 569 effective length of database: 17,143,297,704 effective search space: 9754536393576 effective search space used: 9754536393576 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)