Clone Name | bart14c08 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome | 40 | 0.24 | 2 | emb|AJ307886.1|ZMA307886 Zea mays partial mRNA for pollen signal... | 38 | 0.95 | 3 | gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ... | 36 | 3.8 | 4 | gb|U48404.1|ACU48404 Azotobacter chroococcum ORF1, ORF2, ORF3, O... | 36 | 3.8 |
---|
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 40.1 bits (20), Expect = 0.24 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cgatggccacccagatcagc 36 |||||||||||||||||||| Sbjct: 1890784 cgatggccacccagatcagc 1890803
>emb|AJ307886.1|ZMA307886 Zea mays partial mRNA for pollen signalling protein with adenylyl cyclase activity (psiP gene) Length = 3051 Score = 38.2 bits (19), Expect = 0.95 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 ccaccgcaccaacgatggc 23 ||||||||||||||||||| Sbjct: 82 ccaccgcaccaacgatggc 64
>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete cds Length = 1004 Score = 36.2 bits (18), Expect = 3.8 Identities = 30/34 (88%) Strand = Plus / Plus Query: 4 tccaccgcaccaacgatggccacccagatcagca 37 |||||||| |||| ||||| ||||||||||||| Sbjct: 73 tccaccgccgcaaccatggcgacccagatcagca 106
>gb|U48404.1|ACU48404 Azotobacter chroococcum ORF1, ORF2, ORF3, ORF4, and ORF5 H2-dependent respiration genes, complete cds Length = 2898 Score = 36.2 bits (18), Expect = 3.8 Identities = 21/22 (95%) Strand = Plus / Minus Query: 16 acgatggccacccagatcagca 37 |||||| ||||||||||||||| Sbjct: 2489 acgatgcccacccagatcagca 2468 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 155,795 Number of Sequences: 3902068 Number of extensions: 155795 Number of successful extensions: 38191 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 38161 Number of HSP's gapped (non-prelim): 30 length of query: 37 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 17 effective length of database: 17,155,003,908 effective search space: 291635066436 effective search space used: 291635066436 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)