Clone Name | bart14a12 |
---|---|
Clone Library Name | barley_pub |
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 1092 bits (551), Expect = 0.0 Identities = 551/551 (100%) Strand = Plus / Plus Query: 39 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423290 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 2423349 Query: 99 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423350 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 2423409 Query: 159 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423410 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 2423469 Query: 219 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423470 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 2423529 Query: 279 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423530 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 2423589 Query: 339 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423590 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 2423649 Query: 399 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 458 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423650 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 2423709 Query: 459 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423710 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 2423769 Query: 519 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 578 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2423770 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 2423829 Query: 579 ttccagcccta 589 ||||||||||| Sbjct: 2423830 ttccagcccta 2423840
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 1092 bits (551), Expect = 0.0 Identities = 551/551 (100%) Strand = Plus / Minus Query: 39 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893761 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 1893702 Query: 99 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893701 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 1893642 Query: 159 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893641 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 1893582 Query: 219 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893581 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 1893522 Query: 279 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893521 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcactgccctaccgctattgg 1893462 Query: 339 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893461 ccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcggca 1893402 Query: 399 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 458 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893401 gtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatcttgg 1893342 Query: 459 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893341 ccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgtca 1893282 Query: 519 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 578 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1893281 ccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatcttca 1893222 Query: 579 ttccagcccta 589 ||||||||||| Sbjct: 1893221 ttccagcccta 1893211
>gb|AY157498.1| Synechococcus sp. PCC 7942 cosmid 4G8, complete sequence Length = 31404 Score = 1019 bits (514), Expect = 0.0 Identities = 547/553 (98%), Gaps = 5/553 (0%) Strand = Plus / Plus Query: 39 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 98 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18857 ctgcagcagatctggagagattcttcatgtccacctcgagcaactttcgagacgcaattc 18916 Query: 99 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18917 gtgaggcccagactagcgcactcgtgggccccagtgtggttcgccgtgccctgccctttg 18976 Query: 159 tgggtggtggtcttgtgctcacctccgtcggtgtttacggcgggctcggtgtcctgggca 218 ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| Sbjct: 18977 tgggtggtggtcttgtgctcacctccgtcggtgtttacg-cgggctcggtgtct--ggca 19033 Query: 219 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19034 gcaaccctagtctgttcatgcccctgtggatcggctcaatcgttctacagctagtgctgt 19093 Query: 279 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcact-gccc-taccgctatt 336 |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| Sbjct: 19094 tctttgttgcccaaggcatcgcctcgcgcgggagcaatagcacttgcccataccgctatt 19153 Query: 337 ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 396 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19154 ggccctgtatggtttgctcaccggcttttcgctgactgggcttattagtgttgccctcgg 19213 Query: 397 cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 456 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19214 cagtgtcggaattggcggtctaggagtcgcagccctcggctgtgggatcacctttatctt 19273 Query: 457 ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 516 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19274 ggccagcatcttcgggcagaaaatgtccgaatcgaccggtcaagccttgacccaaaccgt 19333 Query: 517 caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 576 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 19334 caccttgggtattggcgctctgttcttggtgatgctggtgcagctgattggcggcatctt 19393 Query: 577 cattccagcccta 589 ||||||||||||| Sbjct: 19394 cattccagcccta 19406
>dbj|AB081564.1| Paralichthys olivaceus TCRJd-Cd2-S gene for T cell receptor delta chain (J-C region), partial cds Length = 3764 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcagcaga 48 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 3719 cggccgctctagaactagtggatcccccgggctgcagcaga 3679
>dbj|AB081563.1| Paralichthys olivaceus TCRJd-Cd2-L gene for T cell receptor delta chain (J-C region), partial cds Length = 3980 Score = 77.8 bits (39), Expect = 4e-11 Identities = 39/39 (100%) Strand = Plus / Minus Query: 10 gccgctctagaactagtggatcccccgggctgcagcaga 48 ||||||||||||||||||||||||||||||||||||||| Sbjct: 3932 gccgctctagaactagtggatcccccgggctgcagcaga 3894
>gb|M64598.1|SEINMYC2 Serinus canaria N-myc (N-myc) gene, exon and complete cds Length = 1742 Score = 75.8 bits (38), Expect = 1e-10 Identities = 38/38 (100%) Strand = Plus / Minus Query: 7 tcggccgctctagaactagtggatcccccgggctgcag 44 |||||||||||||||||||||||||||||||||||||| Sbjct: 1729 tcggccgctctagaactagtggatcccccgggctgcag 1692
>dbj|AB178027.1| Ralstonia solanacearum insertion sequence IS1424 DNA Length = 4442 Score = 75.8 bits (38), Expect = 1e-10 Identities = 38/38 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcagc 45 |||||||||||||||||||||||||||||||||||||| Sbjct: 25 cggccgctctagaactagtggatcccccgggctgcagc 62
>gb|U25061.1|XXU25061 Cloning vector pBBR1MCS-5 REP, LacZ alpha peptide (lacZ alpha), and gentamicin-3-acetyltransferase genes, complete cds Length = 4768 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U25060.1|XXU25060 Cloning vector pBBR1MCS-4 REP, LacZ alpha peptide (lacZ alpha), and beta-lactamase genes, complete cds Length = 4950 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U25059.1|XXU25059 Cloning vector pBBR1MCS-3 REP and LacZ alpha peptide (lacZ alpha) genes, complete cds; and unknown gene Length = 5228 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U23751.1|CVU23751 Cloning vector pBBR1MCS-2 plasmid pBBR1MCS-2, complete sequence Length = 5144 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|U02374.1|XXU02374 Cloning vector pBBR1MCS plasmid pBBR1MCS, complete sequence Length = 4707 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>gb|DQ228131.1| Moss transformation vector pMBL6, complete sequence Length = 4295 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3264 cggccgctctagaactagtggatcccccgggctgcag 3300 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1033 cggccgctctagaactagtggatcccccgggctgcag 997
>gb|DQ228130.1| Moss transformation vector pMBL5, complete sequence Length = 4296 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2198 cggccgctctagaactagtggatcccccgggctgcag 2234
>gb|DQ230324.1| Shuttle vector pMQ61, complete sequence Length = 7978 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4057 cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|DQ230323.1| Shuttle vector pMQ52, complete sequence Length = 7277 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4057 cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|DQ230322.1| Shuttle vector pMQ51, complete sequence Length = 8105 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4057 cggccgctctagaactagtggatcccccgggctgcag 4021
>gb|AY456904.1| Binary vector pRE1, complete sequence Length = 9769 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 85 cggccgctctagaactagtggatcccccgggctgcag 49
>gb|AY220481.2| Nicotiana tabacum Avr9/Cf-9 induced kinase 1 (ACIK1) mRNA, complete cds Length = 1774 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 88 cggccgctctagaactagtggatcccccgggctgcag 124
>gb|DQ200396.1| Solanum tuberosum clone 070E08 unknown mRNA Length = 1196 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 15 cggccgctctagaactagtggatcccccgggctgcag 51
>gb|AY753306.1| Leucoagaricus meleagris pyranose dehydrogenase (pdh1) gene, complete cds Length = 3089 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 62 cggccgctctagaactagtggatcccccgggctgcag 98
>gb|DQ146965.2| Oncorhynchus mykiss insulin-like growth factor binding protein-related protein 1 (IGFBP-rP1) mRNA, complete cds Length = 1217 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 49 cggccgctctagaactagtggatcccccgggctgcag 85
>gb|DQ190459.2| Oncorhynchus mykiss insulin-like growth factor binding protein 6 (IGFBP6) mRNA, complete cds Length = 2188 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 48 cggccgctctagaactagtggatcccccgggctgcag 84
>ref|NM_001024387.1| Danio rerio wu:fj59e04 (wu:fj59e04), mRNA Length = 2188 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2130 cggccgctctagaactagtggatcccccgggctgcag 2094
>gb|AY423865.1| Cloning vector pMK2017, complete sequence Length = 4252 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 787 cggccgctctagaactagtggatcccccgggctgcag 823
>gb|AY218697.1| Uncultured bacterium clone KD8-88 16S ribosomal RNA gene, partial sequence Length = 1388 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1377 cggccgctctagaactagtggatcccccgggctgcag 1341
>gb|AY218687.1| Uncultured bacterium clone KD8-42 16S ribosomal RNA gene, partial sequence Length = 1363 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1349 cggccgctctagaactagtggatcccccgggctgcag 1313
>gb|U18721.2|GCU18721 Ginglymostoma cirratum clone 7A novel antigen receptor mRNA, complete cds Length = 4146 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 22 cggccgctctagaactagtggatcccccgggctgcag 58
>gb|AY815791.1| Schistosoma japonicum SJCHGC09592 protein mRNA, complete cds Length = 894 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 13 cggccgctctagaactagtggatcccccgggctgcag 49
>gb|AY813632.1| Schistosoma japonicum SJCHGC09300 protein mRNA, complete cds Length = 1371 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 21 cggccgctctagaactagtggatcccccgggctgcag 57
>gb|AY812501.1| Schistosoma japonicum SJCHGC09324 protein mRNA, partial cds Length = 1080 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 23 cggccgctctagaactagtggatcccccgggctgcag 59
>gb|AY811032.1| Schistosoma japonicum SJCHGC09205 protein mRNA, partial cds Length = 812 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 24 cggccgctctagaactagtggatcccccgggctgcag 60
>gb|AY557621.1| Shuttle vector pELS200, complete sequence Length = 7828 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7414 cggccgctctagaactagtggatcccccgggctgcag 7378
>gb|M32616.1|SYNDROCL Cloning vector pHS85 heat-shock protein 82/neomycin phosphotransferase fusion protein (hsp82-neo fusion) gene, complete cds Length = 3727 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3639 cggccgctctagaactagtggatcccccgggctgcag 3675
>gb|AY150810.1| Cloning vector pRS327, complete sequence Length = 9560 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 5856 cggccgctctagaactagtggatcccccgggctgcag 5892
>gb|AY150809.1| Cloning vector pRS317, complete sequence Length = 8601 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 5707 cggccgctctagaactagtggatcccccgggctgcag 5743
>gb|AY150808.1| Cloning vector pRS307, complete sequence Length = 8219 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 5856 cggccgctctagaactagtggatcccccgggctgcag 5892
>gb|AY491501.1| Expression vector hu-beta-MHC-neo-pgk-hygro, complete sequence Length = 9431 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4744 cggccgctctagaactagtggatcccccgggctgcag 4780
>emb|AJ296741.1|PAB296741 Picea abies ATC microsatellite DNA, clone EATC3H03 Length = 519 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 408 cggccgctctagaactagtggatcccccgggctgcag 372
>emb|AJ131096.1|PAB131096 Picea abies microsatellite RNA, clone PAAG2 Length = 824 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 32 cggccgctctagaactagtggatcccccgggctgcag 68
>emb|AJ417488.2|SIN417488 Shuttle integration vector pPL1 Length = 6094 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 127 cggccgctctagaactagtggatcccccgggctgcag 91
>emb|AJ417449.2|SIN417449 Shuttle integration vector pPL2 Length = 6116 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 126 cggccgctctagaactagtggatcccccgggctgcag 90
>gb|AF140577.1| Integration vector mini-CTX2, complete sequence Length = 6755 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 875 cggccgctctagaactagtggatcccccgggctgcag 911
>gb|AF140576.1| Integration vector mini-CTX1, complete sequence Length = 5610 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 875 cggccgctctagaactagtggatcccccgggctgcag 911
>gb|AY428060.1| UAS-less reporter vector pMELalpha2, complete sequence Length = 7304 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7255 cggccgctctagaactagtggatcccccgggctgcag 7291
>gb|AY428056.1| UAS-less reporter vector pMELalpha, complete sequence Length = 7305 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7256 cggccgctctagaactagtggatcccccgggctgcag 7292
>gb|L25927.1|YSPSEQA Shuttle vector pJK148, complete sequence Length = 5343 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3053 cggccgctctagaactagtggatcccccgggctgcag 3017
>gb|AY283058.1| Cloning vector pHRBar-6 Broad-host-range conditional lethal plasmid, complete sequence Length = 14708 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7487 cggccgctctagaactagtggatcccccgggctgcag 7451
>ref|XM_664949.1| Plasmodium berghei strain ANKA hypothetical protein (PB000410.03.0) partial mRNA Length = 669 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 633 cggccgctctagaactagtggatcccccgggctgcag 597
>ref|XM_663685.1| Plasmodium berghei strain ANKA hypothetical protein (PB108231.00.0) partial mRNA Length = 269 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 42 cggccgctctagaactagtggatcccccgggctgcag 78
>ref|XM_663765.1| Plasmodium berghei strain ANKA hypothetical protein (PB102643.00.0) partial mRNA Length = 466 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 430 cggccgctctagaactagtggatcccccgggctgcag 394
>ref|XM_666485.1| Plasmodium berghei strain ANKA hypothetical protein (PB104095.00.0) partial mRNA Length = 121 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 39 cggccgctctagaactagtggatcccccgggctgcag 75
>gb|AY339820.1| Mx-Lox targeting vector, complete sequence Length = 14863 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2707 cggccgctctagaactagtggatcccccgggctgcag 2671 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcc 32 ||||||||||||||||||||||||| Sbjct: 2702 cggccgctctagaactagtggatcc 2726
>ref|XM_669173.1| Plasmodium berghei strain ANKA hypothetical protein (PB000102.02.0) partial mRNA Length = 1284 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 68 cggccgctctagaactagtggatcccccgggctgcag 104
>ref|XM_673755.1| Plasmodium berghei strain ANKA hypothetical protein (PB105099.00.0) partial mRNA Length = 210 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 174 cggccgctctagaactagtggatcccccgggctgcag 138
>ref|XM_659743.1| Cryptosporidium hominis TU502 LacOPZ-alpha peptide from pUC9 (Chro.80226) partial mRNA Length = 387 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 241 cggccgctctagaactagtggatcccccgggctgcag 205
>ref|XM_659801.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.80263) partial mRNA Length = 219 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 172 cggccgctctagaactagtggatcccccgggctgcag 136
>ref|NM_145089.2| Rattus norvegicus asparaginase like 1 (Asrgl1), mRNA Length = 2168 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2143 cggccgctctagaactagtggatcccccgggctgcag 2107
>emb|AJ937310.1| Juglans regia mRNA for putative Cys2-His2 zinc finger transcription factor (zfp2 gene) Length = 804 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 29 cggccgctctagaactagtggatcccccgggctgcag 65
>emb|X67155.2|HSMKLP1 Homo sapiens mRNA for mitotic kinesin-like protein-1 (MKLP-1 gene) Length = 3348 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3281 cggccgctctagaactagtggatcccccgggctgcag 3245
>gb|AY336796.1| Transformation vector pICon, complete sequence Length = 23250 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 10189 cggccgctctagaactagtggatcccccgggctgcag 10225
>ref|NM_011684.1| Mus musculus vomeronasal 1 receptor, A2 (V1ra2), mRNA Length = 3403 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3301 cggccgctctagaactagtggatcccccgggctgcag 3265
>emb|X68127.1|MARIREDM2 M.auratus mRNA for ribonucleotide reductase M2 subunit Length = 3481 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2191 cggccgctctagaactagtggatcccccgggctgcag 2155
>gb|DQ452049.1| Binary vector pGPro1, complete sequence Length = 8833 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 8749 cggccgctctagaactagtggatcccccgggctgcag 8785
>gb|AD001531.1|SYNPGR8V Cloning vector pGR8, complete sequence Length = 9655 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7356 cggccgctctagaactagtggatcccccgggctgcag 7392
>gb|AY291460.1| Shuttle vector pNG168, complete sequence Length = 8960 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4687 cggccgctctagaactagtggatcccccgggctgcag 4651
>emb|Z69978.1|AGG13SER A.gambiae mRNA for serine protease Length = 1028 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 47 cggccgctctagaactagtggatcccccgggctgcag 83
>emb|Z31401.1|ATCYC2B A.thaliana (Columbia) cyc2b mRAN for cyclin 2b protein Length = 1798 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 104 cggccgctctagaactagtggatcccccgggctgcag 140
>emb|Z12163.1|ATPPHOS1 A.thaliana mRNA encoding protein phosphatase 1A Length = 1436 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7 cggccgctctagaactagtggatcccccgggctgcag 43
>emb|Y17188.1|PFL17188 Platichthys flesus Ki-ras gene (exons 1 to 4) Length = 1665 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 165 cggccgctctagaactagtggatcccccgggctgcag 201
>emb|Y17187.1|PFL17187 Platichthys flesus Ki-ras gene (exons 1, 2, 3, and 4b) Length = 711 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 15 cggccgctctagaactagtggatcccccgggctgcag 51
>emb|Y16416.1|LPNSF Loligo pealei mRNA for putative N-ethylmaleimide-sensitive fusion protein (NSF) Length = 2003 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1887 cggccgctctagaactagtggatcccccgggctgcag 1851
>emb|Y14032.1|NTY14032 Nicotiana tabacum mRNA for ferredoxin-NADP reductase Length = 1333 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1320 cggccgctctagaactagtggatcccccgggctgcag 1284
>emb|Y11505.1|MMMPGC60 M.musculus mRNA for Mpgc60 protein Length = 515 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 8 cggccgctctagaactagtggatcccccgggctgcag 44
>emb|Y09669.1|DRTKRAL1 D.rerio mRNA for tyrosine kinase ligand (AL-1) Length = 1650 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 19 cggccgctctagaactagtggatcccccgggctgcag 55
>emb|X99398.1|AECVP Artificial E.coli vector plasmid Length = 4291 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 62 cggccgctctagaactagtggatcccccgggctgcag 98
>emb|X73143.1|ECNIK E.coli DNA sequence of nik locus Length = 6310 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6284 cggccgctctagaactagtggatcccccgggctgcag 6248
>emb|X58436.1|DMIPOU D.melanogaster I-POU mRNA for a POU-domain protein Length = 1556 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1541 cggccgctctagaactagtggatcccccgggctgcag 1505
>gb|L25928.3|YSPSEQB Shuttle vector pJK210, complete sequence Length = 5032 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2742 cggccgctctagaactagtggatcccccgggctgcag 2706
>gb|AY860535.1| Cloning vector p713-1511, complete sequence Length = 13907 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 5246 cggccgctctagaactagtggatcccccgggctgcag 5210
>gb|AY860534.1| Cloning vector p713-947, complete sequence Length = 14789 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6128 cggccgctctagaactagtggatcccccgggctgcag 6092
>gb|AY860533.1| Cloning vector p713-905, complete sequence Length = 14999 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6338 cggccgctctagaactagtggatcccccgggctgcag 6302
>emb|AJ784850.1| Cyanophora paradoxa partial mRNA for ATP synthase A chain precursor (atpI-1 gene) Length = 701 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 25 cggccgctctagaactagtggatcccccgggctgcag 61
>emb|AJ606472.1| Fagus sylvatica mRNA for serine/threonine protein kinase (pk5 gene) Length = 1463 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 61 cggccgctctagaactagtggatcccccgggctgcag 97
>emb|AJ586509.1| Fagus sylvatica pk4 mRNA for serine/threonine-protein kinase Length = 1698 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 57 cggccgctctagaactagtggatcccccgggctgcag 93
>emb|AJ556549.1|DRE556549 Danio rerio mRNA for TRAF4 protein, splice variant 2 Length = 1870 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 55 cggccgctctagaactagtggatcccccgggctgcag 91
>emb|AJ556548.1|DRE556548 Danio rerio mRNA for TRAF4 protein, splice variant 1 Length = 1913 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 114 cggccgctctagaactagtggatcccccgggctgcag 150
>emb|AJ427914.2|RNO427914 Rattus norvegicus mRNA for glial asparaginase (gliap gene) Length = 2168 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2143 cggccgctctagaactagtggatcccccgggctgcag 2107
>emb|AJ316544.1|PDU316544 Platynereis dumerilii mRNA for rhabdomeric opsin (r-opsin gene) Length = 1438 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 56 cggccgctctagaactagtggatcccccgggctgcag 92
>emb|AJ316542.1|PDU316542 Platynereis dumerilii mRNA for Six2 protein Length = 1254 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 57 cggccgctctagaactagtggatcccccgggctgcag 93
>emb|AJ302649.1|DRE302649 Danio rerio mRNA for GABAA receptor betaZ2 subunit (gabaabeta2 gene) Length = 2188 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2130 cggccgctctagaactagtggatcccccgggctgcag 2094
>emb|AJ301641.1|FRU301641 Fugu rubripes ORF1 (partial), ORF2-4 DNA and lsm4 gene Length = 36154 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 9804 cggccgctctagaactagtggatcccccgggctgcag 9768
>emb|AJ278266.2|RNO278266 Rattus norvegicus mRNA for SH3-domain binding protein 4 (SH3BP4 gene) Length = 3520 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3506 cggccgctctagaactagtggatcccccgggctgcag 3470
>emb|AJ278283.1|ACL278283 Cloning vector pBRINT-TsKm Length = 8310 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ278282.1|ACL278282 Cloning vector pBRINT-TsGm Length = 7922 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ278281.1|ACL278281 Cloning vector pBRINT-TsCm Length = 8094 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ278280.1|CVE278280 Cloning vector pBRINTs-Kan2 Length = 8405 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ278279.1|CVE278279 Cloning vector pBRINTs-Gen4 Length = 8017 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ278278.1|CVE278278 Cloning vector pBRINTs-Cat2 Length = 8201 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1125 cggccgctctagaactagtggatcccccgggctgcag 1161
>emb|AJ277472.1|OSA277472 Oryza sativa rbbi2-5 gene for putative Bowman Birk tryspin inhibitor Length = 2378 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2361 cggccgctctagaactagtggatcccccgggctgcag 2325
>emb|AJ277470.1|OSA277470 Oryza sativa rbbi2-3 gene for putative Bowman Birk trypsin inhibitor Length = 2336 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 16 cggccgctctagaactagtggatcccccgggctgcag 52
>emb|AJ276294.1|CSI276294 Citrus sinensis partial mRNA for ethylene receptor (ETR-1 gene) Length = 1240 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 22 cggccgctctagaactagtggatcccccgggctgcag 58
>emb|AJ250829.1|PVA250829 Penaeus vannamei mRNA for phosphoenolpyruvate carboxykinase (pepck gene) Length = 2186 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 49 cggccgctctagaactagtggatcccccgggctgcag 85
>emb|AJ225049.1|LPAJ5049 Lycopersicon peruvianum mRNA for Hsp20.2 protein Length = 1144 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 36 cggccgctctagaactagtggatcccccgggctgcag 72
>emb|AJ131845.1|RNO131845 Rattus norvegicus twist gene Length = 1901 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1881 cggccgctctagaactagtggatcccccgggctgcag 1845
>emb|AJ011095.2|CSI011095 Citrus sinensis mRNA for ACC synthase (acs-1 gene) Length = 2876 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 23 cggccgctctagaactagtggatcccccgggctgcag 59
>emb|AJ005810.1|STU5810 Solanum tuberosum mRNA for phosphatidylinositol 4-kinase, partial Length = 2247 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3 cggccgctctagaactagtggatcccccgggctgcag 39
>emb|AJ005682.1|ATH5682 Arabidopsis thaliana mRNA for inositol 1,4,5-trisphosphate 5-phosphatase Length = 3506 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 11 cggccgctctagaactagtggatcccccgggctgcag 47
>emb|AJ563382.1|GMA563382 Glycine max mRNA for ornithine decarboxylase (odc1 gene) Length = 1628 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 21 cggccgctctagaactagtggatcccccgggctgcag 57
>emb|AJ868289.1| Transconjugation plasmid pBMK1 Length = 8613 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 135 cggccgctctagaactagtggatcccccgggctgcag 99
>gb|AY733073.1| Cloning vector pSW29T, complete sequence Length = 1958 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 371 cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733072.1| Cloning vector pSW29, complete sequence Length = 1723 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 136 cggccgctctagaactagtggatcccccgggctgcag 100
>gb|AY733071.1| Cloning vector pSW25T, complete sequence Length = 1963 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 371 cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733070.1| Cloning vector pSW25, complete sequence Length = 2175 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 583 cggccgctctagaactagtggatcccccgggctgcag 547
>gb|AY733069.1| Cloning vector pSW27, complete sequence Length = 1822 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 376 cggccgctctagaactagtggatcccccgggctgcag 340
>gb|AY733068.1| Cloning vector pSW26, complete sequence Length = 1822 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 376 cggccgctctagaactagtggatcccccgggctgcag 340
>gb|AY733067.1| Cloning vector pSW24, complete sequence Length = 2029 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 583 cggccgctctagaactagtggatcccccgggctgcag 547
>gb|AY733066.1| Cloning vector pSW23T, complete sequence Length = 1817 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 371 cggccgctctagaactagtggatcccccgggctgcag 335
>gb|AY733065.1| Cloning vector pSW23, complete sequence Length = 1582 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 136 cggccgctctagaactagtggatcccccgggctgcag 100
>ref|NM_022693.2| Rattus norvegicus SH3-domain binding protein 4 (Sh3bp4), mRNA Length = 3520 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3506 cggccgctctagaactagtggatcccccgggctgcag 3470
>gb|AY454397.1| Cloning vector pTA6, complete sequence Length = 3000 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>gb|AF531173.1| Cloning vector pDblet, complete sequence Length = 6238 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2750 cggccgctctagaactagtggatcccccgggctgcag 2714
>emb|Z47172.1|CSPAG13 Calothrix D253 genomic DNA (clone AG13) Length = 476 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 100 cggccgctctagaactagtggatcccccgggctgcag 64
>emb|Z47158.1|CSPAG5 Calothrix D253 genomic DNA (clone AG5) Length = 307 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 148 cggccgctctagaactagtggatcccccgggctgcag 112
>emb|X62445.1|PVXANPTR Potato virus X artificial neomycin phosphotransferase II mRNA 5'-flank (SEQ4) Length = 92 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 49 cggccgctctagaactagtggatcccccgggctgcag 13
>gb|DQ414707.1| Functional Analysis Plasmid pFA-SAT1, complete sequence Length = 4375 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2033 cggccgctctagaactagtggatcccccgggctgcag 1997
>gb|AF372620.1| GlnQ allelic exchange vector pAG101, complete sequence Length = 5126 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1158 cggccgctctagaactagtggatcccccgggctgcag 1122
>emb|AJ783436.1| Pseudomonas stutzeri recA gene, strain DSM 10701 Length = 1439 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1 cggccgctctagaactagtggatcccccgggctgcag 37
>gb|AF504908.1| Cloning vector pBBRT, complete sequence Length = 5973 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3232 cggccgctctagaactagtggatcccccgggctgcag 3268
>dbj|AB236859.1| Trifolium pratense RNA for putative rubisco subunit binding-protein alpha subunit, complete cds, clone: C766 Length = 1971 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1945 cggccgctctagaactagtggatcccccgggctgcag 1909
>dbj|AB236854.1| Trifolium pratense RNA for putative myosin heavy chain-like protein, complete cds, clone: C675 Length = 2195 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 28 cggccgctctagaactagtggatcccccgggctgcag 64
>dbj|AB236842.1| Trifolium pratense RNA for putative mitochondrial dicarboxylate carrier protein, complete cds, clone: C331 Length = 1385 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 28 cggccgctctagaactagtggatcccccgggctgcag 64
>dbj|AB236836.1| Trifolium pratense RNA for putative fructose bisphosphate aldolase, complete cds, clone: C2543 Length = 1537 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 29 cggccgctctagaactagtggatcccccgggctgcag 65
>dbj|AB236821.1| Trifolium pratense RNA for putative tetrahydrofolate synthase, complete cds, clone: C2147 Length = 1526 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 28 cggccgctctagaactagtggatcccccgggctgcag 64
>dbj|AB236806.1| Trifolium pratense RNA for hypothetical protein, complete cds, clone: C2051 Length = 1275 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 30 cggccgctctagaactagtggatcccccgggctgcag 66
>dbj|AB236793.1| Trifolium pratense RNA for putative zinc dependent protease, complete cds, clone: C1867 Length = 2414 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2388 cggccgctctagaactagtggatcccccgggctgcag 2352
>dbj|AB236760.1| Trifolium pratense RNA for hypothetical protein, partial cds, clone: C1547 Length = 1455 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 23 cggccgctctagaactagtggatcccccgggctgcag 59
>gb|AF402295.1| pk[BIG-alpha] piggyBac transformation vector, complete sequence Length = 7414 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1067 cggccgctctagaactagtggatcccccgggctgcag 1103
>gb|AF519494.1| Shuttle vector pSpcP-lac, complete sequence Length = 4570 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4113 cggccgctctagaactagtggatcccccgggctgcag 4149
>gb|AF174133.1|AF174133 Cloning vector pRS4213, complete sequence Length = 8182 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4550 cggccgctctagaactagtggatcccccgggctgcag 4514
>gb|AF174132.1|AF174132 Cloning vector pRS4210, complete sequence Length = 7168 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3536 cggccgctctagaactagtggatcccccgggctgcag 3500
>gb|AF174131.1|AF174131 Cloning vector pRS4110, complete sequence Length = 6333 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3529 cggccgctctagaactagtggatcccccgggctgcag 3493
>gb|S81027.1| Msr-110=EN protein binding gene/engrailed nuclear homeoprotein-regulated gene [Drosophila melanogaster, mRNA, 2614 nt] Length = 2614 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2567 cggccgctctagaactagtggatcccccgggctgcag 2531
>gb|S71745.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 3, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 169 nt] Length = 169 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 142 cggccgctctagaactagtggatcccccgggctgcag 106
>gb|S71742.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 2, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 151 nt] Length = 151 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 124 cggccgctctagaactagtggatcccccgggctgcag 88
>gb|S71730.1| influenza virus hemagglutinin 5' epitope tag=fusion protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF15,16,17, Other Plasmid Synthetic Partial, 135 nt] Length = 135 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 108 cggccgctctagaactagtggatcccccgggctgcag 72
>gb|S71728.1| truncated protein {frame 1, multiple cloning site} [Saccharomyces cerevisiae=yeast, cloning vector YCpIF1-12, Other Plasmid Synthetic Partial, 99 nt] Length = 99 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 72 cggccgctctagaactagtggatcccccgggctgcag 36
>emb|AJ518837.1|GMA518837 Glycine max mRNA for putative phosphatase (nod33 gene) Length = 1088 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 20 cggccgctctagaactagtggatcccccgggctgcag 56
>gb|DQ071886.1| Cloning vector pRD29A-GFP, complete sequence Length = 14856 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6195 cggccgctctagaactagtggatcccccgggctgcag 6159
>gb|DQ071887.1| Cloning vector pRD29A-GUS, complete sequence Length = 15948 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7287 cggccgctctagaactagtggatcccccgggctgcag 7251
>gb|U56995.1|U56995 Cloning vector pGreenscript A complete sequence Length = 3062 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 836 cggccgctctagaactagtggatcccccgggctgcag 800
>gb|DQ062658.1| Cloning vector p713-1160, complete sequence Length = 15595 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6934 cggccgctctagaactagtggatcccccgggctgcag 6898
>gb|AY034154.1| Cloning vector pIDN4, complete sequence Length = 2059 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 160 cggccgctctagaactagtggatcccccgggctgcag 124
>gb|AF517126.1| Cloning vector pSPC-lac, complete sequence Length = 2650 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2193 cggccgctctagaactagtggatcccccgggctgcag 2229
>dbj|AB206707.1| Aplysia kurodai FaNaC mRNA for FMRFamide-gated Na+ channel, complete cds Length = 2352 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 31 cggccgctctagaactagtggatcccccgggctgcag 67
>gb|AY785150.1| Expression vector pFL190, complete sequence Length = 9538 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7921 cggccgctctagaactagtggatcccccgggctgcag 7957
>gb|AY785149.1| Cloning vector pFL122, complete sequence Length = 8652 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 8172 cggccgctctagaactagtggatcccccgggctgcag 8208
>gb|AY237646.1| Cloning vector pHRGFPTC, complete sequence Length = 9233 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2607 cggccgctctagaactagtggatcccccgggctgcag 2643
>dbj|D88548.2| Homo sapiens NDUFV2 gene for 24-kDa subunit of complex I, partial cds Length = 5729 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2970 cggccgctctagaactagtggatcccccgggctgcag 3006
>dbj|D34625.2| Homo sapiens TBXAS1 gene for thromboxane synthase, complete cds Length = 16886 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3556 cggccgctctagaactagtggatcccccgggctgcag 3520
>dbj|AB081498.2| Mus musculus ELYS gene for putative transcription factor, complete cds Length = 56680 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 56298 cggccgctctagaactagtggatcccccgggctgcag 56262
>dbj|D50017.2| Homo sapiens PDGFRA gene for alpha-platelet-derived growth factor receptor, complete cds Length = 17087 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 13504 cggccgctctagaactagtggatcccccgggctgcag 13540
>gb|AF033623.2|AF033623 Ovis aries putative heparan sulfate proteoglycan (novocan) mRNA, complete cds Length = 3050 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 27 cggccgctctagaactagtggatcccccgggctgcag 63
>gb|U64449.2|CVU64449 Cloning vector pOPRSVIMCS from Lacswitch II System, complete sequence Length = 5647 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3189 cggccgctctagaactagtggatcccccgggctgcag 3153
>gb|AF270470.1|AF270470 Cloning vector pBIG, complete sequence Length = 11335 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2892 cggccgctctagaactagtggatcccccgggctgcag 2928
>gb|AF269225.1|AF269225 Cloning vector pLITTLE, complete sequence Length = 10036 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2870 cggccgctctagaactagtggatcccccgggctgcag 2906
>gb|AF269226.1|AF269226 Cloning vector pTIKL, complete sequence Length = 10036 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2870 cggccgctctagaactagtggatcccccgggctgcag 2906
>gb|AY196823.1| PiggyBac transformation vector pB-UAS w+, complete sequence Length = 8936 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 998 cggccgctctagaactagtggatcccccgggctgcag 1034
>gb|AY196822.1| PiggyBac transformation vector pB-MCS w+, complete sequence Length = 8137 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 635 cggccgctctagaactagtggatcccccgggctgcag 671
>gb|AY196821.1| PiggyBac helper plasmid pBlu-uTp, complete sequence Length = 7085 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4794 cggccgctctagaactagtggatcccccgggctgcag 4830
>gb|AF190131.1|AF190131 Cloning vector pVO205 hygromycin-B-phosphotransferase (hph) gene, complete cds Length = 2042 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 18 cggccgctctagaactagtggatcccccgggctgcag 54
>gb|AF178453.1|AF178453 Integration vector pCD13PSK aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4128 cggccgctctagaactagtggatcccccgggctgcag 4092
>gb|AF178452.1|AF178452 Integration vector pCD13PKS aminoglycoside adenyltransferase (aadA) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 4549 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4055 cggccgctctagaactagtggatcccccgggctgcag 4091
>gb|AF178450.1|AF178450 Integration vector pCD11PSK chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3064 cggccgctctagaactagtggatcccccgggctgcag 3028
>gb|AF178449.1|AF178449 Integration vector pCD11PKS chloramphenicol transacetylase (cat) and beta-galactosidase alpha peptide (lacZa) genes, complete cds Length = 3485 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2991 cggccgctctagaactagtggatcccccgggctgcag 3027
>gb|AF153422.1|AF153422 Cloning vector pTG8, complete sequence Length = 3417 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 679 cggccgctctagaactagtggatcccccgggctgcag 715
>emb|AJ427913.1|SOL427913 Spinacia oleracea partial mRNA for sigma factor (sig3 gene) Length = 2040 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2029 cggccgctctagaactagtggatcccccgggctgcag 1993
>emb|AJ576322.1|CAU576322 Carassius auratus mc5R gene for melanocortin 5 receptor Length = 2198 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2183 cggccgctctagaactagtggatcccccgggctgcag 2147
>dbj|AK173397.1| Ciona intestinalis cDNA, clone:citb001a22, full insert sequence Length = 2093 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 53 cggccgctctagaactagtggatcccccgggctgcag 89
>dbj|D89785.1| Xenopus laevis mRNA for XICE-b, complete cds Length = 1526 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1469 cggccgctctagaactagtggatcccccgggctgcag 1433
>emb|AJ586516.1| Fagus sylvatica partial 14.3.3-1 mRNA for 14-3-3 protein Length = 531 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 25 cggccgctctagaactagtggatcccccgggctgcag 61
>emb|AJ586515.1| Fagus sylvatica partial ank1 mRNA for ankyrin-repeat protein Length = 700 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 47 cggccgctctagaactagtggatcccccgggctgcag 83
>dbj|AB121971.1| Thermosynechococcus vulcanus kaiA, kaiB, kaiC genes for circadian clock protein KaiA, circadian clock protein KaiB, circadian clock protein KaiC, complete and partial cds Length = 4102 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4078 cggccgctctagaactagtggatcccccgggctgcag 4042
>gb|L08785.1|SYNBLKSPV BlueScribe KS Plus cloning vector Length = 2964 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>gb|M22848.1|SYNPLKRB Cloning vector pUC129 DNA, polylinker region Length = 147 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 123 cggccgctctagaactagtggatcccccgggctgcag 87
>gb|M22847.1|SYNPLKRA Cloning vector pUC128 DNA, polylinker region Length = 144 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 38 cggccgctctagaactagtggatcccccgggctgcag 74
>emb|AJ269534.1|THA269534 Trichoderma harzianum mRNA for glucose transporter (gtt1 gene) Length = 1972 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 20 cggccgctctagaactagtggatcccccgggctgcag 56
>emb|X82626.1|XLCORGLEC X.laevis mRNA for cortical granule lectin Length = 1166 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 48 cggccgctctagaactagtggatcccccgggctgcag 84
>emb|Y16016.1|ECPO157F Escherichia coli plasmid pO157 DNA, 12,5 kb fragment Length = 12518 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 52 cggccgctctagaactagtggatcccccgggctgcag 88
>emb|Z54211.1|ECSHET2B S.flexneri senA gene (isolate 2457T) Length = 2940 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 32 cggccgctctagaactagtggatcccccgggctgcag 68
>emb|Z54194.1|ECSHET2A E.coli senA gene (isolate EI-34) Length = 2940 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 32 cggccgctctagaactagtggatcccccgggctgcag 68
>emb|Z48742.1|HPNIXAGN H.pylori nixA gene Length = 2580 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 71 cggccgctctagaactagtggatcccccgggctgcag 107
>gb|AF041426.1|AF041426 Cloning vector pVLH-1, complete sequence Length = 7823 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 4915 cggccgctctagaactagtggatcccccgggctgcag 4879
>emb|Z54153.1|OSCHINDPR O.sativa mRNA for chilling-inducible protein Length = 1585 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 60 cggccgctctagaactagtggatcccccgggctgcag 96
>emb|AJ012719.1|GSU012719 Galdieria sulphuraria mRNA for phosphoribulokinase Length = 1524 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2 cggccgctctagaactagtggatcccccgggctgcag 38
>emb|AJ131342.1|ATH131342 Arabidopsis thaliana mRNA for LEA-like protein Length = 1100 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 19 cggccgctctagaactagtggatcccccgggctgcag 55
>gb|AF184978.1|AF184978 Binary vector pCLD04541, complete sequence Length = 27608 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 27550 cggccgctctagaactagtggatcccccgggctgcag 27586
>gb|AF179381.1|AF179381 Expression vector pJN105, complete sequence Length = 6055 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2824 cggccgctctagaactagtggatcccccgggctgcag 2788
>gb|AF139061.1|AF139061 Binary vector pCB301, complete sequence Length = 3574 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3317 cggccgctctagaactagtggatcccccgggctgcag 3353
>gb|AF123263.1|AF123263 Mus musculus phenylalanyl tRNA synthetase beta subunit (Frsb) mRNA, complete cds Length = 1995 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1983 cggccgctctagaactagtggatcccccgggctgcag 1947
>gb|AF157496.1|AF157496 Suillus bovinus heterotrimeric G protein alpha subunit mRNA, complete cds Length = 1486 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 13 cggccgctctagaactagtggatcccccgggctgcag 49
>gb|DQ349231.1| Expression vector peTetOn/FKNF(PacI), complete sequence Length = 11676 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 9458 cggccgctctagaactagtggatcccccgggctgcag 9422 Score = 71.9 bits (36), Expect = 2e-09 Identities = 36/36 (100%) Strand = Plus / Plus Query: 9 ggccgctctagaactagtggatcccccgggctgcag 44 |||||||||||||||||||||||||||||||||||| Sbjct: 1323 ggccgctctagaactagtggatcccccgggctgcag 1358
>gb|DQ349228.1| Expression vector peTetOn(PacI), complete sequence Length = 10199 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 7981 cggccgctctagaactagtggatcccccgggctgcag 7945 Score = 71.9 bits (36), Expect = 2e-09 Identities = 36/36 (100%) Strand = Plus / Plus Query: 9 ggccgctctagaactagtggatcccccgggctgcag 44 |||||||||||||||||||||||||||||||||||| Sbjct: 1323 ggccgctctagaactagtggatcccccgggctgcag 1358
>gb|AF092931.1|AF092931 Shuttle vector pCGL0609, complete sequence Length = 6398 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 65 cggccgctctagaactagtggatcccccgggctgcag 101
>emb|AJ243514.1|THA243514 Trichoderma harzianum mRNA for P4 protein (P4 gene) Length = 1352 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 57 cggccgctctagaactagtggatcccccgggctgcag 93
>gb|AF110459.1|AF110459 Cloning vector pBBR1-GFP, complete sequence Length = 6640 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2607 cggccgctctagaactagtggatcccccgggctgcag 2643
>emb|AJ269533.1|THA269533 Trichoderma harzianum mRNA for putative L-aminoacid oxidase (aox1 gene) Length = 1829 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 20 cggccgctctagaactagtggatcccccgggctgcag 56
>gb|AY568055.1| Cloning vector pAGRIKOLA, complete sequence Length = 10459 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3968 cggccgctctagaactagtggatcccccgggctgcag 3932
>emb|AJ000347.1|RN325SAL3 Rattus norvegicus mRNA for 3'(2'),5'-bisphosphate nucleotidase Length = 2002 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1946 cggccgctctagaactagtggatcccccgggctgcag 1982
>gb|AF106619.1|AF106619 Cloning vector pDR1149 complete sequence Length = 4133 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 254 cggccgctctagaactagtggatcccccgggctgcag 218
>gb|U47947.1|CVU47947 Cloning vector pGreenscript I, complete sequence including green fluorescent protein (AGP1) mRNA, partial cds Length = 3062 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 836 cggccgctctagaactagtggatcccccgggctgcag 800
>emb|X54650.1|DMFRIZZ3 D. melanogaster frizzled gene exons 3 and 4 Length = 1047 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 978 cggccgctctagaactagtggatcccccgggctgcag 942
>gb|AF092036.1|AF092036 Shuttle vector pCGL0482, complete sequence Length = 6241 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 65 cggccgctctagaactagtggatcccccgggctgcag 101
>gb|AF091268.1|AF091268 Shuttle vector pCGL0243, complete sequence Length = 6272 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 65 cggccgctctagaactagtggatcccccgggctgcag 101
>dbj|D85525.1|SYNPBEN66 Cloning vector pBEN66 DNA for aminoglycoside 3'-phosphotransferase, beta-lactamase, complete cds Length = 3306 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 138 cggccgctctagaactagtggatcccccgggctgcag 102
>dbj|AB055064.1| Synthetic transposable element dAc-I-RS DNA, complete sequence Length = 7635 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1889 cggccgctctagaactagtggatcccccgggctgcag 1925 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcc 32 ||||||||||||||||||||||||| Sbjct: 4656 cggccgctctagaactagtggatcc 4680
>emb|Y09374.1|ASPGREEN2 Artificial sequences, plasmid vector pGreen-2 Length = 3633 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2227 cggccgctctagaactagtggatcccccgggctgcag 2263
>emb|X98363.1|PVPIJ2581 Cloning vector pIJ2581 glkA gene for glucose kinase and tsr gene for thiostrepton resistance protein Length = 5192 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2977 cggccgctctagaactagtggatcccccgggctgcag 2941
>gb|AY557620.1| Shuttle vector pELS100, complete sequence Length = 7022 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 6608 cggccgctctagaactagtggatcccccgggctgcag 6572
>emb|X52330.1|ARBL2SKM pBluescript II SK(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52329.1|ARBL2KSM pBluescript II KS(-) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52328.1|ARBL2SKP pBluescript II SK(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52327.1|ARBL2KSP pBluescript II KS(+) vector DNA, phagemid excised from lambda ZAPII Length = 2961 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52331.1|ARBLKSP pBluescript KS(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52326.1|ARBLKSM pBluescript KS(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>emb|X52325.1|ARBLSKP pBluescript SK(+) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>emb|X52324.1|ARBLSKM pBluescript SK(-) vector DNA, phagemid excised from lambda ZAP Length = 2958 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>emb|AJ403984.1|CVE403984 Cloning vector pBPSKan2 Length = 4358 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2138 cggccgctctagaactagtggatcccccgggctgcag 2102 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 741 cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ403983.1|CVE403983 Cloning vector pBPSGen4 Length = 3970 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1750 cggccgctctagaactagtggatcccccgggctgcag 1714 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 741 cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ403982.1|CVE403982 Cloning vector pBPSCat2 Length = 4154 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1934 cggccgctctagaactagtggatcccccgggctgcag 1898 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 741 cggccgctctagaactagtggatcccccgggctgcag 705
>emb|AJ005330.1|ASAJ5330 pGAII(-) SK positive selection cloning vector gltS gene Length = 4670 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1937 cggccgctctagaactagtggatcccccgggctgcag 1901
>emb|AJ005329.1|ASAJ5329 pGAII(-) KS positive selection cloning vector gltS gene Length = 4670 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1864 cggccgctctagaactagtggatcccccgggctgcag 1900
>emb|AJ005327.1|ASAJ5327 pGAII(+) SK positive selection cloning vector gltS gene Length = 4670 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1444 cggccgctctagaactagtggatcccccgggctgcag 1480
>emb|AJ005326.1|ASAJ5326 pGAII(+) KS positive selection cloning vector gltS gene Length = 4670 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1517 cggccgctctagaactagtggatcccccgggctgcag 1481
>emb|AJ005324.1|ASAJ5324 pCP1(-) SK positive selection cloning vector gltS gene Length = 6340 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 978 cggccgctctagaactagtggatcccccgggctgcag 1014
>emb|AJ005323.1|ASAJ5323 pCP1(-) KS positive selection cloning vector gltS gene Length = 6340 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1051 cggccgctctagaactagtggatcccccgggctgcag 1015
>emb|AJ007829.1|CVE7829 Cloning Vector pGreen Length = 3228 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 867 cggccgctctagaactagtggatcccccgggctgcag 831
>dbj|AB078885.1| Halocynthia roretzi MASPa gene for mannose-binding lectin-associated serine protease, complete cds Length = 6856 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 17 cggccgctctagaactagtggatcccccgggctgcag 53
>dbj|AB076895.1| Ciona intestinalis Ci-calumenin mRNA for calumenin homologue, complete cds Length = 1740 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 478 cggccgctctagaactagtggatcccccgggctgcag 514 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 43 cggccgctctagaactagtggatcccccgggctgcag 79
>emb|AM179852.1| Synthetic construct nptI gene for aminoglycoside 3'-phosphotransferase and bla gene for beta-lactamase Length = 4155 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1864 cggccgctctagaactagtggatcccccgggctgcag 1900
>gb|AF067142.1|AF067142 Cloning vector pSFI polylinker, complete polylinker sequence Length = 209 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 161 cggccgctctagaactagtggatcccccgggctgcag 125
>dbj|AK115638.1| Ciona intestinalis cDNA, clone:cilv010m12, full insert sequence Length = 2307 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 53 cggccgctctagaactagtggatcccccgggctgcag 89
>gb|U61229.1|CVU61229 Cloning vector pKRX, complete sequence Length = 2976 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 758 cggccgctctagaactagtggatcccccgggctgcag 722
>gb|U35235.1|XXU35235 Plasmid pBSL167 cloning vector, complete sequence Length = 3345 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1997 cggccgctctagaactagtggatcccccgggctgcag 1961 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 704 cggccgctctagaactagtggatcccccgggctgcag 668
>gb|U35137.1|XXU35137 Plasmid pBSL99 cloning vector, complete sequence Length = 4285 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2067 cggccgctctagaactagtggatcccccgggctgcag 2031 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 670 cggccgctctagaactagtggatcccccgggctgcag 706
>gb|U35136.1|XXU35136 Plasmid pBSL97 cloning vector, complete sequence Length = 4289 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1998 cggccgctctagaactagtggatcccccgggctgcag 2034 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35135.1|XXU35135 Plasmid pBSL193 cloning vector, complete sequence Length = 5275 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 3057 cggccgctctagaactagtggatcccccgggctgcag 3021 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35134.1|XXU35134 Plasmid pBSL190 cloning vector, complete sequence Length = 4480 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2262 cggccgctctagaactagtggatcccccgggctgcag 2226 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 743 cggccgctctagaactagtggatcccccgggctgcag 707
>gb|U35133.1|XXU35133 Plasmid pBSL175 cloning vector, complete sequence Length = 4252 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 2904 cggccgctctagaactagtggatcccccgggctgcag 2868 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 704 cggccgctctagaactagtggatcccccgggctgcag 668
>gb|U35132.1|XXU35132 Plasmid pBSL168 cloning vector, complete sequence Length = 3357 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Minus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 1995 cggccgctctagaactagtggatcccccgggctgcag 1959 Score = 73.8 bits (37), Expect = 6e-10 Identities = 37/37 (100%) Strand = Plus / Plus Query: 8 cggccgctctagaactagtggatcccccgggctgcag 44 ||||||||||||||||||||||||||||||||||||| Sbjct: 631 cggccgctctagaactagtggatcccccgggctgcag 667 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,718,082 Number of Sequences: 3902068 Number of extensions: 3718082 Number of successful extensions: 69421 Number of sequences better than 10.0: 789 Number of HSP's better than 10.0 without gapping: 779 Number of HSP's successfully gapped in prelim test: 10 Number of HSP's that attempted gapping in prelim test: 68345 Number of HSP's gapped (non-prelim): 1070 length of query: 589 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 566 effective length of database: 17,143,297,704 effective search space: 9703106500464 effective search space used: 9703106500464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)