ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart13g02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK068002.1| Oryza sativa (japonica cultivar-group) cDNA clon... 426 e-116
2gb|AF297044.1| Zea mays homocysteine S-methyltransferase-1 mRNA,... 295 8e-77
3gb|AY111638.1| Zea mays CL1145_1 mRNA sequence 295 8e-77
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 220 4e-54
5gb|AC105364.2| Oryza sativa (japonica cultivar-group) chromosome... 220 4e-54
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 220 4e-54
7gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome... 220 4e-54
8gb|AF297045.1| Zea mays homocysteine S-methyltransferase-2 mRNA,... 62 2e-06
9gb|BT018744.1| Zea mays clone EL01N0521F07.d mRNA sequence 60 8e-06
10gb|AF297046.1| Zea mays homocysteine S-methyltransferase-3 mRNA,... 60 8e-06
11gb|AY104031.1| Zea mays PCO134410 mRNA sequence 60 8e-06
12dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
13dbj|AK103293.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
14dbj|AK065892.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 5e-04
15gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 54 5e-04
16emb|AL731881.4|CNS08C8L Oryza sativa chromosome 12, . BAC OSJNBa... 54 5e-04
17gb|AY792508.1| Dioscorea trifida clone MTI12 microsatellite sequ... 52 0.002
18gb|AF297047.1| Zea mays homocysteine S-methyltransferase-4 mRNA,... 48 0.030
19gb|AY109808.1| Zea mays CL1142_1 mRNA sequence 48 0.030
20gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, comp... 46 0.12
21gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 46 0.12
22gb|AY543070.1| Bacteriophage T5, complete genome 46 0.12
23gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 46 0.12
24emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 46 0.12
25emb|AJ251438.1|STE251438 Streptomyces tendae Tue901 nikI gene, n... 46 0.12
26gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.12
27emb|AJ244016.1|STE244016 Streptomyces tendae nikkomycin biosynth... 46 0.12
28gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete g... 46 0.12
29gb|CP000088.1| Thermobifida fusca YX, complete genome 44 0.47
30emb|AL929372.16| Mouse DNA sequence from clone RP23-461G6 on chr... 44 0.47
31gb|L78131.1|MXAPILBCT Myxococcus xanthus type IV pilin (pilB, pi... 42 1.9
32ref|XM_541721.2| PREDICTED: Canis familiaris similar to teashirt... 42 1.9
33gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 42 1.9
34gb|CP000133.1| Rhizobium etli CFN 42, complete genome 42 1.9
35gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 42 1.9
36gb|AC104540.9| Mus musculus chromosome 5, clone RP23-301P15, com... 40 7.3
37gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.3
38gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.3
39gb|AC105768.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.3
40ref|NM_001032698.1| Takifugu rubripes alpha-2,3-sialyltransferas... 40 7.3
41gb|U22051.1|BCU22051 Branchiostoma californiense subtilisin-rela... 40 7.3
42emb|AJ626816.1| Takifugu rubripes mRNA for alpha-2,3-sialyltrans... 40 7.3
43emb|CR729064.2|CNS0GPHQ Tetraodon nigroviridis full-length cDNA 40 7.3
44gb|AC142353.1| Pan troglodytes BAC clone RP43-21M1 from 7, compl... 40 7.3
45gb|AC151709.9| Medicago truncatula clone mth2-31g22, complete se... 40 7.3
46gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 7.3
47gb|AC175687.2| Otolemur garnetti, clone XX-8163A7, complete sequ... 40 7.3
48gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.3
49emb|BX053447.1|CNS09DEJ Single read from an extremity of a full-... 40 7.3
50emb|BX053446.1|CNS09DEI Single read from an extremity of a full-... 40 7.3
51emb|BX053321.1|CNS09DB1 Single read from an extremity of a full-... 40 7.3
52emb|BX053320.1|CNS09DB0 Single read from an extremity of a full-... 40 7.3
53emb|AJ705068.1| Takifugu rubripes mRNA for alpha-2,3-sialyltrans... 40 7.3
54emb|BX071008.1|CNS09QYC Single read from an extremity of a full-... 40 7.3
55emb|BX070727.1|CNS09QQJ Single read from an extremity of a full-... 40 7.3
56emb|BX070726.1|CNS09QQI Single read from an extremity of a full-... 40 7.3
57emb|BX067420.1|CNS09O6O Single read from an extremity of a full-... 40 7.3
58emb|BX067419.1|CNS09O6N Single read from an extremity of a full-... 40 7.3
59emb|BX066807.1|CNS09NPN Single read from an extremity of a full-... 40 7.3
60emb|BX066378.1|CNS09NDQ Single read from an extremity of a full-... 40 7.3
61emb|BX066377.1|CNS09NDP Single read from an extremity of a full-... 40 7.3
62emb|BX066183.1|CNS09N8B Single read from an extremity of a full-... 40 7.3
63emb|BX066182.1|CNS09N8A Single read from an extremity of a full-... 40 7.3
64emb|BX062235.1|CNS09K6N Single read from an extremity of a full-... 40 7.3
65emb|BX062234.1|CNS09K6M Single read from an extremity of a full-... 40 7.3
66emb|BX062009.1|CNS09K0D Single read from an extremity of a full-... 40 7.3
67emb|BX061875.1|CNS09JWN Single read from an extremity of a full-... 40 7.3
68emb|BX061874.1|CNS09JWM Single read from an extremity of a full-... 40 7.3
69emb|BX061460.1|CNS09JL4 Single read from an extremity of a full-... 40 7.3
70emb|BX061459.1|CNS09JL3 Single read from an extremity of a full-... 40 7.3
71emb|BX060134.1|CNS09IKA Single read from an extremity of a full-... 40 7.3
72emb|BX060133.1|CNS09IK9 Single read from an extremity of a full-... 40 7.3
73emb|BX059106.1|CNS09HRQ Single read from an extremity of a full-... 40 7.3
74emb|BX057164.1|CNS09G9S Single read from an extremity of a full-... 40 7.3
75emb|BX056407.1|CNS09FOR Single read from an extremity of a full-... 40 7.3
76emb|BX053282.1|CNS09D9Y Single read from an extremity of a full-... 40 7.3
77emb|BX053281.1|CNS09D9X Single read from an extremity of a full-... 40 7.3
78emb|BX051670.1|CNS09C16 Single read from an extremity of a full-... 40 7.3
79emb|BX048289.1|CNS099F9 Single read from an extremity of a full-... 40 7.3
80emb|BX046832.1|CNS098AS Single read from an extremity of a full-... 40 7.3
81emb|BX046831.1|CNS098AR Single read from an extremity of a full-... 40 7.3
82emb|BX046089.1|CNS097Q5 Single read from an extremity of a full-... 40 7.3
83emb|BX043982.1|CNS0963M Single read from an extremity of a full-... 40 7.3
84emb|BX041871.1|CNS094GZ Single read from an extremity of a full-... 40 7.3
85emb|BX040639.1|CNS093IR Single read from an extremity of a full-... 40 7.3
86emb|BX040638.1|CNS093IQ Single read from an extremity of a full-... 40 7.3
87emb|BX034167.1|CNS08YIZ Single read from an extremity of a full-... 40 7.3
88emb|BX034166.1|CNS08YIY Single read from an extremity of a full-... 40 7.3
89emb|BX032780.1|CNS08XGG Single read from an extremity of a full-... 40 7.3
90emb|BX032779.1|CNS08XGF Single read from an extremity of a full-... 40 7.3
91emb|BX032368.1|CNS08X50 Single read from an extremity of a full-... 40 7.3
92emb|BX032367.1|CNS08X4Z Single read from an extremity of a full-... 40 7.3
93emb|BX029710.1|CNS08V36 Single read from an extremity of a full-... 40 7.3
94emb|BX028551.1|CNS08U6Z Single read from an extremity of a full-... 40 7.3
95emb|BX028550.1|CNS08U6Y Single read from an extremity of a full-... 40 7.3
96emb|BX026878.1|CNS08SWI Single read from an extremity of a full-... 40 7.3
97emb|BX026877.1|CNS08SWH Single read from an extremity of a full-... 40 7.3
98emb|BX024644.1|CNS08R6G Single read from an extremity of a full-... 40 7.3
99emb|BX021719.1|CNS08OX7 Single read from an extremity of a full-... 40 7.3
100emb|BX021718.1|CNS08OX6 Single read from an extremity of a full-... 40 7.3
101emb|BX014094.1|CNS08J1E Single read from an extremity of a full-... 40 7.3
102emb|BX014093.1|CNS08J1D Single read from an extremity of a full-... 40 7.3
103emb|BX008623.1|CNS08ETF Single read from an extremity of a full-... 40 7.3
104emb|BX008622.1|CNS08ETE Single read from an extremity of a full-... 40 7.3
105emb|BX006325.1|CNS08D1L Single read from an extremity of a full-... 40 7.3
106emb|BX006035.1|CNS08CTJ Single read from an extremity of a full-... 40 7.3
107emb|BX006034.1|CNS08CTI Single read from an extremity of a full-... 40 7.3
108gb|AF521085.1| Streptomyces nanchangensis NS3226 polyether ionop... 40 7.3
109gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthe... 40 7.3
110emb|BX323601.6| Zebrafish DNA sequence from clone RP71-14P11, co... 40 7.3
111dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.3
112dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.3
113dbj|BA000013.4| Mesorhizobium loti MAFF303099 pMLa DNA, cpmplete... 40 7.3
114gb|AF469956.1| Streptomyces ansochromogenes nikkomycin biosynths... 40 7.3
115dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 7.3
116dbj|AK068607.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.3
117gb|AF092918.1|AF092918 Pseudomonas alcaligenes outer membrane Xc... 40 7.3
118gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 7.3
119gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 40 7.3
120gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.3 
>dbj|AK068002.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013128N24, full
           insert sequence
          Length = 1589

 Score =  426 bits (215), Expect = e-116
 Identities = 371/423 (87%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtggaggagctggtgaagaaggccggcggatgcgcggtcatcgacggcggcttcgccac 174
           |||||||||| | || | || ||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 159 ggtggaggagatcgtcaggagggccggcgggtgcgccgtgatcgacggcggattcgccac 218

                                                                       
Query: 175 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 234
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 219 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 278

                                                                       
Query: 235 caccaagccgcacctcatcaaggaggtccatatgcagtatcttgaagctggcgccgacgt 294
           ||||||||||||||||||||||||||| || ||||| ||||||||||| || ||||| ||
Sbjct: 279 caccaagccgcacctcatcaaggaggttcacatgcaatatcttgaagcaggtgccgatgt 338

                                                                       
Query: 295 catcatctcctcgtcctaccaggcaactatcccggggttcctggccagaggactgctcct 354
           |||||| ||||| || ||||||||||||||||| || ||| | ||||||||| |||| ||
Sbjct: 339 catcatttcctcatcataccaggcaactatcccaggattcttagccagaggaatgcttct 398

                                                                       
Query: 355 cgaggaggcagaagggttactgcgaaccagcgtccagctggcgctggaggcccgagacga 414
            |||||||||||||||||||||||||  ||| |  |  |||| ||||| || ||||| ||
Sbjct: 399 tgaggaggcagaagggttactgcgaaggagcattgaattggcactggaagcacgagatga 458

                                                                       
Query: 415 gttctggaagtcgacgctgaggaagtcgaagcccgtctacaaccgcgccctcgtcgccgc 474
            |||||||||||||||||||||||||| ||||| || |||||||| || || ||||||||
Sbjct: 459 attctggaagtcgacgctgaggaagtccaagcctgtttacaaccgtgctctggtcgccgc 518

                                                                       
Query: 475 gtccgtcgggagctacggagcgtacctcgccgatggatcagagtacagtgggtcgtacgg 534
            ||| | |||||||| ||||| ||||| |||||||| |||||||||||||| ||||| ||
Sbjct: 519 atccattgggagctatggagcttaccttgccgatggctcagagtacagtggatcgtatgg 578

              
Query: 535 aga 537
           |||
Sbjct: 579 aga 581
to top
>gb|AF297044.1| Zea mays homocysteine S-methyltransferase-1 mRNA, complete cds
          Length = 1275

 Score =  295 bits (149), Expect = 8e-77
 Identities = 335/397 (84%)
 Strand = Plus / Plus

                                                                       
Query: 140 ggcggatgcgcggtcatcgacggcggcttcgccacgcagctggaggcgctcggcgccgac 199
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 139 ggcgggtgcgcggtcatcgacggcggcttcgccacgcagctggaggcgctcggcgccgac 198

                                                                       
Query: 200 atcaacgacccgctctggagcgccgcctgcctcatcaccaagccgcacctcatcaaggag 259
           |||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||
Sbjct: 199 atcaacgacccgctctggagcgccgcttgcctcatcaccaggccgcacctcgtcaaggag 258

                                                                       
Query: 260 gtccatatgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccaggca 319
           || ||||||||||||||||||||||| || ||||||||||| || || || |||||||||
Sbjct: 259 gttcatatgcagtatcttgaagctggtgcggacgtcatcatttcatcatcttaccaggca 318

                                                                       
Query: 320 actatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttactgcga 379
           || |||||||| ||| | || |||||| ||    |||  ||||||||||  |||||||||
Sbjct: 319 acaatcccgggtttcatagctagaggaatgtctgtcgctgaggcagaagatttactgcga 378

                                                                       
Query: 380 accagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctgaggaag 439
           || || ||  | |||||    || || ||||| || || |||||||| || |||||||||
Sbjct: 379 acaagtgtaaaactggccaatgaagctcgagatgaattttggaagtcaacactgaggaag 438

                                                                       
Query: 440 tcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggagcgtac 499
           || || ||  | |||||||| || || || || || ||| | || ||||||||||| || 
Sbjct: 439 tccaaacctatttacaaccgtgctctggttgctgcatccattggtagctacggagcctat 498

                                                
Query: 500 ctcgccgatggatcagagtacagtgggtcgtacggag 536
           || || |||||||| ||||||||||| || |||||||
Sbjct: 499 cttgctgatggatcggagtacagtggatcatacggag 535
to top
>gb|AY111638.1| Zea mays CL1145_1 mRNA sequence
          Length = 1228

 Score =  295 bits (149), Expect = 8e-77
 Identities = 335/397 (84%)
 Strand = Plus / Plus

                                                                       
Query: 140 ggcggatgcgcggtcatcgacggcggcttcgccacgcagctggaggcgctcggcgccgac 199
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 139 ggcgggtgcgcggtcatcgacggcggcttcgccacgcagctggaggcgctcggcgccgac 198

                                                                       
Query: 200 atcaacgacccgctctggagcgccgcctgcctcatcaccaagccgcacctcatcaaggag 259
           |||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||
Sbjct: 199 atcaacgacccgctctggagcgccgcttgcctcatcaccaggccgcacctcgtcaaggag 258

                                                                       
Query: 260 gtccatatgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccaggca 319
           || ||||||||||||||||||||||| || ||||||||||| || || || |||||||||
Sbjct: 259 gttcatatgcagtatcttgaagctggtgcggacgtcatcatttcatcatcttaccaggca 318

                                                                       
Query: 320 actatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttactgcga 379
           || |||||||| ||| | || |||||| ||    |||  ||||||||||  |||||||||
Sbjct: 319 acaatcccgggtttcatagctagaggaatgtctgtcgctgaggcagaagatttactgcga 378

                                                                       
Query: 380 accagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctgaggaag 439
           || || ||  | |||||    || || ||||| || || |||||||| || |||||||||
Sbjct: 379 acaagtgtaaaactggccaatgaagctcgagatgaattttggaagtcaacactgaggaag 438

                                                                       
Query: 440 tcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggagcgtac 499
           || || ||  | |||||||| || || || || || ||| | || ||||||||||| || 
Sbjct: 439 tccaaacctatttacaaccgtgctctggttgctgcatccattggtagctacggagcctat 498

                                                
Query: 500 ctcgccgatggatcagagtacagtgggtcgtacggag 536
           || || |||||||| ||||||||||| || |||||||
Sbjct: 499 cttgctgatggatcggagtacagtggatcatacggag 535
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  220 bits (111), Expect = 4e-54
 Identities = 138/147 (93%)
 Strand = Plus / Plus

                                                                           
Query: 115     ggtggaggagctggtgaagaaggccggcggatgcgcggtcatcgacggcggcttcgccac 174
               |||||||||| | || | || ||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 6323297 ggtggaggagatcgtcaggagggccggcgggtgcgccgtgatcgacggcggattcgccac 6323356

                                                                           
Query: 175     gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 234
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6323357 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 6323416

                                          
Query: 235     caccaagccgcacctcatcaaggaggt 261
               |||||||||||||||||||||||||||
Sbjct: 6323417 caccaagccgcacctcatcaaggaggt 6323443



 Score =  159 bits (80), Expect = 1e-35
 Identities = 176/208 (84%)
 Strand = Plus / Plus

                                                                           
Query: 315     aggcaactatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttac 374
               ||||||||||||| || ||| | ||||||||| |||| || |||||||||||||||||||
Sbjct: 6324487 aggcaactatcccaggattcttagccagaggaatgcttcttgaggaggcagaagggttac 6324546

                                                                           
Query: 375     tgcgaaccagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctga 434
               ||||||  ||| |  |  |||| ||||| || ||||| || |||||||||||||||||||
Sbjct: 6324547 tgcgaaggagcattgaattggcactggaagcacgagatgaattctggaagtcgacgctga 6324606

                                                                           
Query: 435     ggaagtcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggag 494
               ||||||| ||||| || |||||||| || || |||||||| ||| | |||||||| ||||
Sbjct: 6324607 ggaagtccaagcctgtttacaaccgtgctctggtcgccgcatccattgggagctatggag 6324666

                                           
Query: 495     cgtacctcgccgatggatcagagtacag 522
               | ||||| |||||||| |||||||||||
Sbjct: 6324667 cttaccttgccgatggctcagagtacag 6324694



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                   
Query: 266     atgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccagg 317
               ||||| ||||||||||| || ||||| |||||||| ||||| || |||||||
Sbjct: 6324333 atgcaatatcttgaagcaggtgccgatgtcatcatttcctcatcataccagg 6324384
to top
>gb|AC105364.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09,
            complete sequence
          Length = 146568

 Score =  220 bits (111), Expect = 4e-54
 Identities = 138/147 (93%)
 Strand = Plus / Plus

                                                                        
Query: 115  ggtggaggagctggtgaagaaggccggcggatgcgcggtcatcgacggcggcttcgccac 174
            |||||||||| | || | || ||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 3423 ggtggaggagatcgtcaggagggccggcgggtgcgccgtgatcgacggcggattcgccac 3482

                                                                        
Query: 175  gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 234
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3483 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 3542

                                       
Query: 235  caccaagccgcacctcatcaaggaggt 261
            |||||||||||||||||||||||||||
Sbjct: 3543 caccaagccgcacctcatcaaggaggt 3569



 Score =  159 bits (80), Expect = 1e-35
 Identities = 176/208 (84%)
 Strand = Plus / Plus

                                                                        
Query: 315  aggcaactatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttac 374
            ||||||||||||| || ||| | ||||||||| |||| || |||||||||||||||||||
Sbjct: 4613 aggcaactatcccaggattcttagccagaggaatgcttcttgaggaggcagaagggttac 4672

                                                                        
Query: 375  tgcgaaccagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctga 434
            ||||||  ||| |  |  |||| ||||| || ||||| || |||||||||||||||||||
Sbjct: 4673 tgcgaaggagcattgaattggcactggaagcacgagatgaattctggaagtcgacgctga 4732

                                                                        
Query: 435  ggaagtcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggag 494
            ||||||| ||||| || |||||||| || || |||||||| ||| | |||||||| ||||
Sbjct: 4733 ggaagtccaagcctgtttacaaccgtgctctggtcgccgcatccattgggagctatggag 4792

                                        
Query: 495  cgtacctcgccgatggatcagagtacag 522
            | ||||| |||||||| |||||||||||
Sbjct: 4793 cttaccttgccgatggctcagagtacag 4820



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 266  atgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccagg 317
            ||||| ||||||||||| || ||||| |||||||| ||||| || |||||||
Sbjct: 4459 atgcaatatcttgaagcaggtgccgatgtcatcatttcctcatcataccagg 4510
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  220 bits (111), Expect = 4e-54
 Identities = 138/147 (93%)
 Strand = Plus / Plus

                                                                           
Query: 115     ggtggaggagctggtgaagaaggccggcggatgcgcggtcatcgacggcggcttcgccac 174
               |||||||||| | || | || ||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 6322510 ggtggaggagatcgtcaggagggccggcgggtgcgccgtgatcgacggcggattcgccac 6322569

                                                                           
Query: 175     gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 234
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6322570 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 6322629

                                          
Query: 235     caccaagccgcacctcatcaaggaggt 261
               |||||||||||||||||||||||||||
Sbjct: 6322630 caccaagccgcacctcatcaaggaggt 6322656



 Score =  159 bits (80), Expect = 1e-35
 Identities = 176/208 (84%)
 Strand = Plus / Plus

                                                                           
Query: 315     aggcaactatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttac 374
               ||||||||||||| || ||| | ||||||||| |||| || |||||||||||||||||||
Sbjct: 6323700 aggcaactatcccaggattcttagccagaggaatgcttcttgaggaggcagaagggttac 6323759

                                                                           
Query: 375     tgcgaaccagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctga 434
               ||||||  ||| |  |  |||| ||||| || ||||| || |||||||||||||||||||
Sbjct: 6323760 tgcgaaggagcattgaattggcactggaagcacgagatgaattctggaagtcgacgctga 6323819

                                                                           
Query: 435     ggaagtcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggag 494
               ||||||| ||||| || |||||||| || || |||||||| ||| | |||||||| ||||
Sbjct: 6323820 ggaagtccaagcctgtttacaaccgtgctctggtcgccgcatccattgggagctatggag 6323879

                                           
Query: 495     cgtacctcgccgatggatcagagtacag 522
               | ||||| |||||||| |||||||||||
Sbjct: 6323880 cttaccttgccgatggctcagagtacag 6323907



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                   
Query: 266     atgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccagg 317
               ||||| ||||||||||| || ||||| |||||||| ||||| || |||||||
Sbjct: 6323546 atgcaatatcttgaagcaggtgccgatgtcatcatttcctcatcataccagg 6323597
to top
>gb|AC104474.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0024O21,
              complete sequence
          Length = 155651

 Score =  220 bits (111), Expect = 4e-54
 Identities = 138/147 (93%)
 Strand = Plus / Plus

                                                                          
Query: 115    ggtggaggagctggtgaagaaggccggcggatgcgcggtcatcgacggcggcttcgccac 174
              |||||||||| | || | || ||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 136505 ggtggaggagatcgtcaggagggccggcgggtgcgccgtgatcgacggcggattcgccac 136564

                                                                          
Query: 175    gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 234
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 136565 gcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgccgcctgcctcat 136624

                                         
Query: 235    caccaagccgcacctcatcaaggaggt 261
              |||||||||||||||||||||||||||
Sbjct: 136625 caccaagccgcacctcatcaaggaggt 136651



 Score =  159 bits (80), Expect = 1e-35
 Identities = 176/208 (84%)
 Strand = Plus / Plus

                                                                          
Query: 315    aggcaactatcccggggttcctggccagaggactgctcctcgaggaggcagaagggttac 374
              ||||||||||||| || ||| | ||||||||| |||| || |||||||||||||||||||
Sbjct: 137695 aggcaactatcccaggattcttagccagaggaatgcttcttgaggaggcagaagggttac 137754

                                                                          
Query: 375    tgcgaaccagcgtccagctggcgctggaggcccgagacgagttctggaagtcgacgctga 434
              ||||||  ||| |  |  |||| ||||| || ||||| || |||||||||||||||||||
Sbjct: 137755 tgcgaaggagcattgaattggcactggaagcacgagatgaattctggaagtcgacgctga 137814

                                                                          
Query: 435    ggaagtcgaagcccgtctacaaccgcgccctcgtcgccgcgtccgtcgggagctacggag 494
              ||||||| ||||| || |||||||| || || |||||||| ||| | |||||||| ||||
Sbjct: 137815 ggaagtccaagcctgtttacaaccgtgctctggtcgccgcatccattgggagctatggag 137874

                                          
Query: 495    cgtacctcgccgatggatcagagtacag 522
              | ||||| |||||||| |||||||||||
Sbjct: 137875 cttaccttgccgatggctcagagtacag 137902



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 266    atgcagtatcttgaagctggcgccgacgtcatcatctcctcgtcctaccagg 317
              ||||| ||||||||||| || ||||| |||||||| ||||| || |||||||
Sbjct: 137541 atgcaatatcttgaagcaggtgccgatgtcatcatttcctcatcataccagg 137592
to top
>gb|AF297045.1| Zea mays homocysteine S-methyltransferase-2 mRNA, complete cds
          Length = 1535

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 156 tcgacggcggcttcgccacgcagctggaggcgctcggcgccgacatcaacgacccgctct 215
           ||||||||||  | |||||| |||| |||||   |||||||||| |||||||||||||||
Sbjct: 193 tcgacggcgggctggccacggagctcgaggccaacggcgccgacctcaacgacccgctct 252

                  
Query: 216 ggagcgc 222
           |||||||
Sbjct: 253 ggagcgc 259
to top
>gb|BT018744.1| Zea mays clone EL01N0521F07.d mRNA sequence
          Length = 1423

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 190 cggcgccgacatcaacgacccgctctggagcgcc 223
           |||||||||| |||||||||||||||||||||||
Sbjct: 73  cggcgccgacctcaacgacccgctctggagcgcc 106
to top
>gb|AF297046.1| Zea mays homocysteine S-methyltransferase-3 mRNA, complete cds
          Length = 1583

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 190 cggcgccgacatcaacgacccgctctggagcgcc 223
           |||||||||| |||||||||||||||||||||||
Sbjct: 242 cggcgccgacctcaacgacccgctctggagcgcc 275
to top
>gb|AY104031.1| Zea mays PCO134410 mRNA sequence
          Length = 1600

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 190 cggcgccgacatcaacgacccgctctggagcgcc 223
           |||||||||| |||||||||||||||||||||||
Sbjct: 252 cggcgccgacctcaacgacccgctctggagcgcc 285
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                               
Query: 177      agctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
                ||||||||||   |||||||||| | |||||||||||||||||||||
Sbjct: 25675678 agctggaggccaacggcgccgacctgaacgacccgctctggagcgcc 25675724
to top
>dbj|AK103293.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125A08, full
           insert sequence
          Length = 1791

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 177 agctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
           ||||||||||   |||||||||| | |||||||||||||||||||||
Sbjct: 280 agctggaggccaacggcgccgacctgaacgacccgctctggagcgcc 326
to top
>dbj|AK065892.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013044M21, full
           insert sequence
          Length = 1557

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 177 agctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
           ||||||||||   |||||||||| | |||||||||||||||||||||
Sbjct: 222 agctggaggccaacggcgccgacctgaacgacccgctctggagcgcc 268
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                               
Query: 177      agctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
                ||||||||||   |||||||||| | |||||||||||||||||||||
Sbjct: 25603854 agctggaggccaacggcgccgacctgaacgacccgctctggagcgcc 25603900
to top
>emb|AL731881.4|CNS08C8L Oryza sativa chromosome 12, . BAC OSJNBa0002L05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 167131

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 177   agctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
             ||||||||||   |||||||||| | |||||||||||||||||||||
Sbjct: 42916 agctggaggccaacggcgccgacctgaacgacccgctctggagcgcc 42962
to top
>gb|AY792508.1| Dioscorea trifida clone MTI12 microsatellite sequence
          Length = 547

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                       
Query: 138 ccggcggatgcgcggtcatcgacggcggcttcgccacgcagctggaggcgctcggcgccg 197
           |||||||||| || |||||||| || ||| |||||||| ||||||| || |  |||||| 
Sbjct: 184 ccggcggatgtgccgtcatcgatgggggcctcgccacggagctggaagcccatggcgcca 243

                                                 
Query: 198 acatcaacgacccgctctggagcgccgcctgcctcatc 235
           |  |||| || ||||||||||| |||  ||||||||||
Sbjct: 244 atctcaatgatccgctctggagtgcccactgcctcatc 281
to top
>gb|AF297047.1| Zea mays homocysteine S-methyltransferase-4 mRNA, complete cds
          Length = 1172

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 172 cacgcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
           |||| |||||||||||| |||||| ||| |  ||||| ||||||||||||||
Sbjct: 104 cacggagctggaggcgcacggcgcggacctgcacgacgcgctctggagcgcc 155
to top
>gb|AY109808.1| Zea mays CL1142_1 mRNA sequence
          Length = 1124

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 172 cacgcagctggaggcgctcggcgccgacatcaacgacccgctctggagcgcc 223
           |||| |||||||||||| |||||| ||| |  ||||| ||||||||||||||
Sbjct: 113 cacggagctggaggcgcacggcgcggacctgcacgacgcgctctggagcgcc 164
to top
>gb|AY692264.1| Bacteriophage T5 strain st0 deletion mutant, complete genome
          Length = 113238

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 114   tggtggaggagctggtgaagaag 136
             |||||||||||||||||||||||
Sbjct: 42015 tggtggaggagctggtgaagaag 41993
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 148    cgcggtcatcgacggcggcttcg 170
              |||||||||||||||||||||||
Sbjct: 273818 cgcggtcatcgacggcggcttcg 273796
to top
>gb|AY543070.1| Bacteriophage T5, complete genome
          Length = 121750

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 114   tggtggaggagctggtgaagaag 136
             |||||||||||||||||||||||
Sbjct: 50220 tggtggaggagctggtgaagaag 50198
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 155     atcgacggcggcttcgccacgca 177
               |||||||||||||||||||||||
Sbjct: 3311729 atcgacggcggcttcgccacgca 3311751
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 148     cgcggtcatcgacggcggcttcg 170
               |||||||||||||||||||||||
Sbjct: 1599619 cgcggtcatcgacggcggcttcg 1599597
to top
>emb|AJ251438.1|STE251438 Streptomyces tendae Tue901 nikI gene, nikJ gene, nikK gene, nikL
            gene, nikM gene, nikN gene, nikO gene, ORF1 and ORF2
          Length = 11591

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 163  cggcttcgccacgcagctggaggcgctcggc 193
            |||||||||| || |||||||||||||||||
Sbjct: 8319 cggcttcgccccggagctggaggcgctcggc 8349
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 155     atcgacggcggcttcgccacgca 177
               |||||||||||||||||||||||
Sbjct: 2831040 atcgacggcggcttcgccacgca 2831018
to top
>emb|AJ244016.1|STE244016 Streptomyces tendae nikkomycin biosynthesis gene nikO, strain Tue901
          Length = 1730

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 163  cggcttcgccacgcagctggaggcgctcggc 193
            |||||||||| || |||||||||||||||||
Sbjct: 1159 cggcttcgccccggagctggaggcgctcggc 1189
to top
>gb|AY587007.1| Bacteriophage T5 strain ATCC 11303-B5, complete genome
          Length = 121752

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 114   tggtggaggagctggtgaagaag 136
             |||||||||||||||||||||||
Sbjct: 50140 tggtggaggagctggtgaagaag 50118
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 187     gctcggcgccgacatcaacgacccgc 212
               ||||||||| ||||||||||||||||
Sbjct: 1500798 gctcggcgcggacatcaacgacccgc 1500823
to top
>emb|AL929372.16| Mouse DNA sequence from clone RP23-461G6 on chromosome 2, complete
             sequence
          Length = 170342

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 32    cctgctgcgcttggtgctgaga 53
             ||||||||||||||||||||||
Sbjct: 33526 cctgctgcgcttggtgctgaga 33547
to top
>gb|L78131.1|MXAPILBCT Myxococcus xanthus type IV pilin (pilB, pilC, pilT) genes, complete
            cds's
          Length = 4600

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 112  ggtggtggaggagctggtgaagaag 136
            |||||||| ||||||||||||||||
Sbjct: 2465 ggtggtggcggagctggtgaagaag 2489
to top
>ref|XM_541721.2| PREDICTED: Canis familiaris similar to teashirt 3 (LOC484607), mRNA
          Length = 3856

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 117  tggaggagctggtgaagaagg 137
            |||||||||||||||||||||
Sbjct: 1997 tggaggagctggtgaagaagg 2017
to top
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 451    ctacaaccgcgccctcgtcgccgcg 475
              ||||||||||||| |||||||||||
Sbjct: 558007 ctacaaccgcgccttcgtcgccgcg 557983
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 148    cgcggtcatcgacggcggctt 168
              |||||||||||||||||||||
Sbjct: 477061 cgcggtcatcgacggcggctt 477041
to top
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 457     ccgcgccctcgtcgccgcgtc 477
               |||||||||||||||||||||
Sbjct: 1342213 ccgcgccctcgtcgccgcgtc 1342233
to top
>gb|AC104540.9| Mus musculus chromosome 5, clone RP23-301P15, complete sequence
          Length = 221681

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 331   gttcctggccagaggactgc 350
             ||||||||||||||||||||
Sbjct: 66780 gttcctggccagaggactgc 66761
to top
>gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
              OSJNBb0004A05, complete sequence
          Length = 157913

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 187    gctcggcgccgacatcaacgacccgctc 214
              ||||| |||||||||||||||| |||||
Sbjct: 126111 gctcgacgccgacatcaacgacgcgctc 126084
to top
>gb|AC148611.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1007D10,
             complete sequence
          Length = 153366

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gcggcggggtggtggaggag 124
             ||||||||||||||||||||
Sbjct: 31340 gcggcggggtggtggaggag 31359
to top
>gb|AC105768.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1122_B08,
             complete sequence
          Length = 143955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 287   gccgacgtcatcatctcctc 306
             ||||||||||||||||||||
Sbjct: 43464 gccgacgtcatcatctcctc 43483
to top
>ref|NM_001032698.1| Takifugu rubripes alpha-2,3-sialyltransferase ST3Gal I (siat4),
           mRNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 gcggggtggtggaggagctg 127
           ||||||||||||||||||||
Sbjct: 323 gcggggtggtggaggagctg 342
to top
>gb|U22051.1|BCU22051 Branchiostoma californiense subtilisin-related protease SPC2 mRNA,
           complete cds
          Length = 2234

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 196 cgacatcaacgacccgctct 215
           ||||||||||||||||||||
Sbjct: 545 cgacatcaacgacccgctct 564
to top
>emb|AJ626816.1| Takifugu rubripes mRNA for alpha-2,3-sialyltransferase ST3Gal I
           (siat4 gene)
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 gcggggtggtggaggagctg 127
           ||||||||||||||||||||
Sbjct: 323 gcggggtggtggaggagctg 342
to top
>emb|CR729064.2|CNS0GPHQ Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 409 agacgagttctggaagtcga 428
           ||||||||||||||||||||
Sbjct: 6   agacgagttctggaagtcga 25
to top
>gb|AC142353.1| Pan troglodytes BAC clone RP43-21M1 from 7, complete sequence
          Length = 182634

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 109    cggggtggtggaggagctgg 128
              ||||||||||||||||||||
Sbjct: 140206 cggggtggtggaggagctgg 140225
to top
>gb|AC151709.9| Medicago truncatula clone mth2-31g22, complete sequence
          Length = 116699

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 265   tatgcagtatcttgaagctg 284
             ||||||||||||||||||||
Sbjct: 76334 tatgcagtatcttgaagctg 76315



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 265   tatgcagtatcttgaagctg 284
             ||||||||||||||||||||
Sbjct: 46744 tatgcagtatcttgaagctg 46725
to top
>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 175     gcagctggaggcgctcggcg 194
               ||||||||||||||||||||
Sbjct: 1645480 gcagctggaggcgctcggcg 1645499
to top
>gb|AC175687.2| Otolemur garnetti, clone XX-8163A7, complete sequence
          Length = 39483

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   tggaggagctggtgaagaag 136
             ||||||||||||||||||||
Sbjct: 17376 tggaggagctggtgaagaag 17357
to top
>gb|AC093489.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_A10,
             complete sequence
          Length = 102275

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gcggcggggtggtggaggag 124
             ||||||||||||||||||||
Sbjct: 30180 gcggcggggtggtggaggag 30199
to top
>emb|BX053447.1|CNS09DEJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 384 tggaggagctggtgaagaag 365
to top
>emb|BX053446.1|CNS09DEI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 743 tggaggagctggtgaagaag 762
to top
>emb|BX053321.1|CNS09DB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 368 tggaggagctggtgaagaag 349
to top
>emb|BX053320.1|CNS09DB0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 730 tggaggagctggtgaagaag 749
to top
>emb|AJ705068.1| Takifugu rubripes mRNA for alpha-2,3-sialyltransferase (st3Gal I
           gene)
          Length = 1002

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 108 gcggggtggtggaggagctg 127
           ||||||||||||||||||||
Sbjct: 323 gcggggtggtggaggagctg 342
to top
>emb|BX071008.1|CNS09QYC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 376 tggaggagctggtgaagaag 357
to top
>emb|BX070727.1|CNS09QQJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 363 tggaggagctggtgaagaag 344
to top
>emb|BX070726.1|CNS09QQI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 732 tggaggagctggtgaagaag 751
to top
>emb|BX067420.1|CNS09O6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 362 tggaggagctggtgaagaag 343
to top
>emb|BX067419.1|CNS09O6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 729 tggaggagctggtgaagaag 748
to top
>emb|BX066807.1|CNS09NPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 82  tggaggagctggtgaagaag 63
to top
>emb|BX066378.1|CNS09NDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 377 tggaggagctggtgaagaag 358
to top
>emb|BX066377.1|CNS09NDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 735 tggaggagctggtgaagaag 754
to top
>emb|BX066183.1|CNS09N8B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 371 tggaggagctggtgaagaag 352
to top
>emb|BX066182.1|CNS09N8A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 740 tggaggagctggtgaagaag 759
to top
>emb|BX062235.1|CNS09K6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 364 tggaggagctggtgaagaag 345
to top
>emb|BX062234.1|CNS09K6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 731 tggaggagctggtgaagaag 750
to top
>emb|BX062009.1|CNS09K0D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 336 tggaggagctggtgaagaag 317
to top
>emb|BX061875.1|CNS09JWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 371 tggaggagctggtgaagaag 352
to top
>emb|BX061874.1|CNS09JWM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 728 tggaggagctggtgaagaag 747
to top
>emb|BX061460.1|CNS09JL4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 344 tggaggagctggtgaagaag 325
to top
>emb|BX061459.1|CNS09JL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 746 tggaggagctggtgaagaag 765
to top
>emb|BX060134.1|CNS09IKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 360 tggaggagctggtgaagaag 341
to top
>emb|BX060133.1|CNS09IK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 726 tggaggagctggtgaagaag 745
to top
>emb|BX059106.1|CNS09HRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 359 tggaggagctggtgaagaag 340
to top
>emb|BX057164.1|CNS09G9S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 351

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 297 tggaggagctggtgaagaag 278
to top
>emb|BX056407.1|CNS09FOR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 377 tggaggagctggtgaagaag 358
to top
>emb|BX053282.1|CNS09D9Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 369 tggaggagctggtgaagaag 350
to top
>emb|BX053281.1|CNS09D9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 737 tggaggagctggtgaagaag 756
to top
>emb|BX051670.1|CNS09C16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 543

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 369 tggaggagctggtgaagaag 350
to top
>emb|BX048289.1|CNS099F9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 369 tggaggagctggtgaagaag 350
to top
>emb|BX046832.1|CNS098AS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 393 tggaggagctggtgaagaag 374
to top
>emb|BX046831.1|CNS098AR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 744 tggaggagctggtgaagaag 763
to top
>emb|BX046089.1|CNS097Q5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 729 tggaggagctggtgaagaag 748
to top
>emb|BX043982.1|CNS0963M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 733 tggaggagctggtgaagaag 752
to top
>emb|BX041871.1|CNS094GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 740 tggaggagctggtgaagaag 759
to top
>emb|BX040639.1|CNS093IR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 361 tggaggagctggtgaagaag 342
to top
>emb|BX040638.1|CNS093IQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 726 tggaggagctggtgaagaag 745
to top
>emb|BX034167.1|CNS08YIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 360 tggaggagctggtgaagaag 341
to top
>emb|BX034166.1|CNS08YIY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 731 tggaggagctggtgaagaag 750
to top
>emb|BX032780.1|CNS08XGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 373 tggaggagctggtgaagaag 354
to top
>emb|BX032779.1|CNS08XGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 747 tggaggagctggtgaagaag 766
to top
>emb|BX032368.1|CNS08X50 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 160 tggaggagctggtgaagaag 141
to top
>emb|BX032367.1|CNS08X4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 526 tggaggagctggtgaagaag 545
to top
>emb|BX029710.1|CNS08V36 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 361 tggaggagctggtgaagaag 342
to top
>emb|BX028551.1|CNS08U6Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 376 tggaggagctggtgaagaag 357
to top
>emb|BX028550.1|CNS08U6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 733 tggaggagctggtgaagaag 752
to top
>emb|BX026878.1|CNS08SWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 372 tggaggagctggtgaagaag 353
to top
>emb|BX026877.1|CNS08SWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 736 tggaggagctggtgaagaag 755
to top
>emb|BX024644.1|CNS08R6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 355 tggaggagctggtgaagaag 374
to top
>emb|BX021719.1|CNS08OX7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 384 tggaggagctggtgaagaag 365
to top
>emb|BX021718.1|CNS08OX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 745 tggaggagctggtgaagaag 764
to top
>emb|BX014094.1|CNS08J1E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 361 tggaggagctggtgaagaag 342
to top
>emb|BX014093.1|CNS08J1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 747 tggaggagctggtgaagaag 766
to top
>emb|BX008623.1|CNS08ETF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 417

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 46  tggaggagctggtgaagaag 27
to top
>emb|BX008622.1|CNS08ETE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 701 tggaggagctggtgaagaag 720
to top
>emb|BX006325.1|CNS08D1L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 372 tggaggagctggtgaagaag 353
to top
>emb|BX006035.1|CNS08CTJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 380 tggaggagctggtgaagaag 361
to top
>emb|BX006034.1|CNS08CTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 117 tggaggagctggtgaagaag 136
           ||||||||||||||||||||
Sbjct: 741 tggaggagctggtgaagaag 760
to top
>gb|AF521085.1| Streptomyces nanchangensis NS3226 polyether ionophore nanchangmycin
             biosynthetic gene cluster, complete sequence
          Length = 132544

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   agctggaggcgctcggcgcc 196
             ||||||||||||||||||||
Sbjct: 96333 agctggaggcgctcggcgcc 96314
to top
>gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthetic gene cluster and
             flanking regions
          Length = 116831

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   agctggaggcgctcggcgcc 196
             ||||||||||||||||||||
Sbjct: 52288 agctggaggcgctcggcgcc 52307
to top
>emb|BX323601.6| Zebrafish DNA sequence from clone RP71-14P11, complete sequence
          Length = 207067

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 222    ccgcctgcctcatcaccaag 241
              ||||||||||||||||||||
Sbjct: 122774 ccgcctgcctcatcaccaag 122793
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 187      gctcggcgccgacatcaacgacccgctc 214
                ||||| |||||||||||||||| |||||
Sbjct: 19195215 gctcgacgccgacatcaacgacgcgctc 19195188
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 287     gccgacgtcatcatctcctc 306
               ||||||||||||||||||||
Sbjct: 8322420 gccgacgtcatcatctcctc 8322439



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 105     gcggcggggtggtggaggag 124
               ||||||||||||||||||||
Sbjct: 5344666 gcggcggggtggtggaggag 5344685
to top
>dbj|BA000013.4| Mesorhizobium loti MAFF303099 pMLa DNA, cpmplete genome
          Length = 351911

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   catcgacggcggcttcgcca 173
             ||||||||||||||||||||
Sbjct: 30756 catcgacggcggcttcgcca 30737
to top
>gb|AF469956.1| Streptomyces ansochromogenes nikkomycin biosynthsis protein SanX
            (sanX) gene, complete cds
          Length = 1435

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 163  cggcttcgccacgcagctggaggcgctcggcg 194
            |||||||||| || |||||| |||||||||||
Sbjct: 1120 cggcttcgccccggagctgggggcgctcggcg 1151
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 447     ccgtctacaaccgcgccctcgtcg 470
               ||||| ||||||||||||||||||
Sbjct: 1955001 ccgtccacaaccgcgccctcgtcg 1955024
to top
>dbj|AK068607.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013157O06, full
           insert sequence
          Length = 1890

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 187 gctcggcgccgacatcaacgacccgctc 214
           ||||| |||||||||||||||| |||||
Sbjct: 641 gctcgacgccgacatcaacgacgcgctc 668
to top
>gb|AF092918.1|AF092918 Pseudomonas alcaligenes outer membrane Xcp-secretion system gene
            cluster
          Length = 20758

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 387  tccagctggcgctggaggcc 406
            ||||||||||||||||||||
Sbjct: 5917 tccagctggcgctggaggcc 5936
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 174     cgcagctggaggcgctcggcgccg 197
               |||||||||||||||| |||||||
Sbjct: 3296340 cgcagctggaggcgctgggcgccg 3296317
to top
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 459     gcgccctcgtcgccgcgtccgtcg 482
               |||||| |||||||||||||||||
Sbjct: 1954674 gcgcccgcgtcgccgcgtccgtcg 1954697
to top
>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12,
             complete sequence
          Length = 88725

 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gcggcggggtggtggaggag 124
             ||||||||||||||||||||
Sbjct: 81367 gcggcggggtggtggaggag 81386


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,598,071
Number of Sequences: 3902068
Number of extensions: 3598071
Number of successful extensions: 80455
Number of sequences better than 10.0: 120
Number of HSP's better than 10.0 without gapping: 119
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 78575
Number of HSP's gapped (non-prelim): 1879
length of query: 541
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 518
effective length of database: 17,143,297,704
effective search space: 8880228210672
effective search space used: 8880228210672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top