ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart12f06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (... 559 e-156
2dbj|AB079064.1| Oryza sativa (japonica cultivar-group) UXS-3 mRN... 272 7e-70
3dbj|AK100908.1| Oryza sativa (japonica cultivar-group) cDNA clon... 272 7e-70
4dbj|AK060031.1| Oryza sativa (japonica cultivar-group) cDNA clon... 272 7e-70
5emb|AJ295156.1|PCO295156 Phragmites communis mRNA for d-TDP-gluc... 266 5e-68
6gb|AY104952.1| Zea mays PCO092342 mRNA sequence 252 7e-64
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 135 1e-28
8gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 135 1e-28
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 135 1e-28
10ref|NM_114511.2| Arabidopsis thaliana UXS5; catalytic AT3G46440 ... 86 9e-14
11ref|NM_001035743.1| Arabidopsis thaliana UXS5; catalytic AT3G464... 86 9e-14
12gb|AY096586.1| Arabidopsis thaliana putative dTDP-glucose 4-6-de... 86 9e-14
13gb|AY072098.1| Arabidopsis thaliana putative dTDP-glucose 4-6-de... 86 9e-14
14emb|BX823718.1|CNS0A7QP Arabidopsis thaliana Full-length cDNA Co... 86 9e-14
15emb|BX824968.1|CNS0A6QT Arabidopsis thaliana Full-length cDNA Co... 86 9e-14
16gb|AY087118.1| Arabidopsis thaliana clone 31901 mRNA, complete s... 78 2e-11
17gb|BC034457.1| Mus musculus, clone IMAGE:3674229, mRNA 72 1e-09
18gb|BC020372.1| Mus musculus, clone IMAGE:3499050, mRNA 72 1e-09
19dbj|AK155129.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 72 1e-09
20gb|AY619951.1| Nicotiana tabacum putative UDP-glucuronate decarb... 72 1e-09
21ref|NM_125319.2| Arabidopsis thaliana UXS3 (UDP-GLUCURONIC ACID ... 70 5e-09
22emb|BX832416.1|CNS0A12Y Arabidopsis thaliana Full-length cDNA Co... 70 5e-09
23gb|AY088443.1| Arabidopsis thaliana clone 6701 mRNA, complete se... 70 5e-09
24gb|AF387789.1| Arabidopsis thaliana UDP-glucuronic acid decarbox... 70 5e-09
25gb|DQ283529.1| Rana japonica 28S ribosomal RNA gene, partial seq... 68 2e-08
26gb|DQ283504.1| Platymantis pelewensis 28S ribosomal RNA gene, pa... 68 2e-08
27emb|AL133298.1|ATF18L15 Arabidopsis thaliana DNA chromosome 3, B... 66 9e-08
28gb|AF355468.1|AF355468 Saccharopolyspora spinosa DTDP-glucose 4,... 66 9e-08
29gb|AY144409.1| Nemestrinus sp. SLW-2002 28S ribosomal RNA gene, ... 64 3e-07
30dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 62 1e-06
31gb|DQ283485.1| Phrynobatrachus auritus 28S ribosomal RNA gene, p... 60 5e-06
32gb|M38363.1|SPYRRGQ S.marinus 23S rRNA gene, introns 60 5e-06
33gb|M86623.1|SPYRGGA S.marinus 23S ribosomal RNA, partial cds 60 5e-06
34gb|AY652587.1| Trichoplax sp. H8 28S ribosomal RNA gene, partial... 58 2e-05
35gb|AY652586.1| Trichoplax sp. H7 28S ribosomal RNA gene, partial... 58 2e-05
36gb|AY652585.1| Trichoplax sp. H4 28S ribosomal RNA gene, partial... 58 2e-05
37gb|AY652584.1| Trichoplax sp. H2 28S ribosomal RNA gene, partial... 58 2e-05
38gb|AY652583.1| Trichoplax sp. H1 28S ribosomal RNA gene, partial... 58 2e-05
39gb|AF291874.1| Amblyomma americanum 18S ribosomal RNA gene, inte... 58 2e-05
40gb|AY839834.1| Phellinus igniarius strain ASI26002 25S ribosomal... 58 2e-05
41gb|AY839833.1| Inonotus linteus 25S ribosomal RNA gene, partial ... 58 2e-05
42gb|AY839832.1| Inonotus linteus strain ASI26099 25S ribosomal RN... 58 2e-05
43gb|AY839831.1| Inonotus linteus strain ASI26081 25S ribosomal RN... 58 2e-05
44gb|AY603697.1| Trichoplax adhaerens 28S ribosomal RNA gene, part... 58 2e-05
45gb|AY822609.1| Prorocentrum micans large subunit ribosomal RNA g... 58 2e-05
46gb|AY822610.1| Prorocentrum donghaiense large subunit ribosomal ... 58 2e-05
47gb|DQ266429.1| Metschnikowia sp. SUB 05-213.1 small subunit ribo... 58 2e-05
48gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, parti... 58 2e-05
49gb|AY145423.1|AY145422S2 Vampyroteuthis infernalis 28S ribosomal... 58 2e-05
50gb|AY145421.1| Solemya velum 28S ribosomal RNA gene, partial seq... 58 2e-05
51gb|AY145419.1| Nuculana pernula 28S ribosomal RNA gene, partial ... 58 2e-05
52gb|AY145418.1| Nordotis discus 28S ribosomal RNA gene, partial s... 58 2e-05
53gb|AY145417.1| Nautilus pompilius 28S ribosomal RNA gene, partia... 58 2e-05
54gb|AY145416.1|AY145415S2 Loligo pealei 28S ribosomal RNA gene, p... 58 2e-05
55gb|AY145414.1| Leptochiton asellus 28S ribosomal RNA gene, parti... 58 2e-05
56gb|AY145413.1| Lepetodrilus elevatus 28S ribosomal RNA gene, par... 58 2e-05
57gb|AY145412.1| Ischnochiton comptus 28S ribosomal RNA gene, part... 58 2e-05
58gb|AY145411.1| Ilyanassa obsoleta 28S ribosomal RNA gene, partia... 58 2e-05
59gb|AY145410.1| Histioteuthis sp. YJP-2002 28S ribosomal RNA gene... 58 2e-05
60gb|AY145408.1| Haminoea solitaria 28S ribosomal RNA gene, partia... 58 2e-05
61gb|AY145407.1| Graneledone pacifica 28S ribosomal RNA gene, part... 58 2e-05
62gb|AY145406.1| Gibbula magnus 28S ribosomal RNA gene, partial se... 58 2e-05
63gb|AY145404.1| Deroceras reticulatum 28S ribosomal RNA gene, par... 58 2e-05
64gb|AY145403.1| Dentalium octangulatum 28S ribosomal RNA gene, pa... 58 2e-05
65gb|AY145402.1| Cryptoplax japonica 28S ribosomal RNA gene, parti... 58 2e-05
66gb|AY145401.1| Antalis entalis 28S ribosomal RNA gene, partial s... 58 2e-05
67gb|AY145400.1| Crassostrea virginica 28S ribosomal RNA gene, par... 58 2e-05
68gb|AY145399.1| Chaetopterus variopedatus 28S ribosomal RNA gene,... 58 2e-05
69gb|AY145398.1| Chaetopleura apiculata 28S ribosomal RNA gene, pa... 58 2e-05
70gb|AY145396.1| Cerebratulus lacteus 28S ribosomal RNA gene, part... 58 2e-05
71gb|AY145395.1| Boonea seminuda 28S ribosomal RNA gene, partial s... 58 2e-05
72gb|AY145394.1|AY145393S2 Benthoctopus yaquinae 28S ribosomal RNA... 58 2e-05
73gb|AY145392.1| Arion silvaticus 28S ribosomal RNA gene, partial ... 58 2e-05
74gb|AY145391.1| Argopecten irradians 28S ribosomal RNA gene, part... 58 2e-05
75gb|AY145390.1| Arctica islandica 28S ribosomal RNA gene, partial... 58 2e-05
76gb|AY145389.1| Abraliopsis sp. YJP-2002 28S ribosomal RNA gene, ... 58 2e-05
77gb|AY145388.1| Antalis entalis 28S ribosomal RNA gene, partial s... 58 2e-05
78gb|DQ202352.1| Oxyethira rossi 28S large subunit ribosomal RNA g... 58 2e-05
79gb|DQ202351.1| Merope tuber 28S large subunit ribosomal RNA gene... 58 2e-05
80gb|AC159424.1| Trypanosoma brucei chromosome 6 clone RPCI93-26F1... 58 2e-05
81gb|AC159415.1| Trypanosoma brucei chromosome 7 clone RPCI93-25D2... 58 2e-05
82gb|AC159414.1| Trypanosoma brucei chromosome 3 clone RPCI93-25B2... 58 2e-05
83gb|AC159412.1| Trypanosoma brucei chromosome 7 clone RPCI93-21H1... 58 2e-05
84gb|AY732227.1| Serpula vermicularis 28S ribosomal RNA gene, part... 58 2e-05
85gb|AY732226.1| Sabellaria cementarium 28S ribosomal RNA gene, pa... 58 2e-05
86gb|AY732225.1| Schizobranchia insignis 28S ribosomal RNA gene, p... 58 2e-05
87gb|AC012647.18| Trypanosoma brucei chromosome 2 clone RPCI93-27H... 58 2e-05
88gb|AC008031.6| Trypanosoma brucei chromosome 2 clone RPCI93-25N1... 58 2e-05
89gb|DQ002502.1| Tetraplatia volitans 28S large subunit ribosomal ... 58 2e-05
90gb|AY616164.1| Besnoitia tarandi large subunit ribosomal RNA gen... 58 2e-05
91gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8... 58 2e-05
92gb|BT016244.1| Zea mays clone Contig77 mRNA sequence 58 2e-05
93gb|AY440168.1| Armigeres subalbatus ASAP ID: 43995 questionable:... 58 2e-05
94gb|AY433294.1| Aedes aegypti ASAP ID: 42873 conserved unknown mR... 58 2e-05
95gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 58 2e-05
96gb|AF115465.1| Leishmania donovani 28S ribosomal RNA subunit bet... 58 2e-05
97gb|AF345632.1| Leishmania hoogstraali large subunit 24S beta rib... 58 2e-05
98gb|AY260899.1| Cyprinus carpio 28S ribosomal RNA gene, partial s... 58 2e-05
99gb|AF356652.1| Filobasidiella neoformans var. neoformans 5S ribo... 58 2e-05
100gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence 58 2e-05
101gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 58 2e-05
102gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence 58 2e-05
103gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence 58 2e-05
104gb|AF184038.1| Drosophila stonei 28S large subunit ribosomal RNA... 58 2e-05
105gb|AF184037.1| Drosophila pseudoobscura 28S large subunit riboso... 58 2e-05
106gb|AF184036.1| Drosophila novamexicana 28S large subunit ribosom... 58 2e-05
107gb|AF184033.1| Drosophila pachea 28S large subunit ribosomal RNA... 58 2e-05
108gb|AF184032.1| Drosophila canalinea 28S large subunit ribosomal ... 58 2e-05
109gb|AF184031.1| Drosophila mercatorum 28S large subunit ribosomal... 58 2e-05
110gb|AF184030.1| Drosophila hexastigma 28S large subunit ribosomal... 58 2e-05
111gb|AF184029.1| Drosophila buzzatii 28S large subunit ribosomal R... 58 2e-05
112gb|AF184027.1| Drosophila immigrans 28S large subunit ribosomal ... 58 2e-05
113gb|AF184026.1| Drosophila tripunctata 28S large subunit ribosoma... 58 2e-05
114gb|AF184025.1| Drosophila cardini 28S large subunit ribosomal RN... 58 2e-05
115gb|AF184023.1| Drosophila guttifera 28S large subunit ribosomal ... 58 2e-05
116gb|AF184022.1| Drosophila quinaria 28S large subunit ribosomal R... 58 2e-05
117gb|AF184021.1| Drosophila putrida 28S large subunit ribosomal RN... 58 2e-05
118gb|AF184020.1| Drosophila orientacea 28S large subunit ribosomal... 58 2e-05
119gb|AF184019.1| Drosophila neotestacea 28S large subunit ribosoma... 58 2e-05
120gb|AF184018.1| Drosophila testacea 28S large subunit ribosomal R... 58 2e-05
121gb|AF183984.1| Drosophila aracataca 28S ribosomal RNA gene, part... 58 2e-05
122gb|AF183983.1| Drosophila lacertosa 28S ribosomal RNA gene, part... 58 2e-05
123gb|AF183982.1| Drosophila wassermani 28S ribosomal RNA gene, par... 58 2e-05
124gb|AF183981.1| Drosophila acanthoptera 28S ribosomal RNA gene, p... 58 2e-05
125gb|AY546686.1| Polychytrium aggregatum isolate AFTOL-ID 24 28S l... 58 2e-05
126gb|AY546687.1| Monoblepharella sp. M15 isolate AFTOL-ID 25 28S l... 58 2e-05
127gb|AY546688.1| Cladochytrium replicatum isolate AFTOL-ID 27 28S ... 58 2e-05
128gb|AY546689.1| Coemansia reversa isolate AFTOL-ID 140 28S large ... 58 2e-05
129gb|AY546690.1| Piptocephalis corymbifera isolate AFTOL-ID 145 28... 58 2e-05
130gb|AY546691.1| Conidiobolus coronatus isolate AFTOL-ID 137 28S l... 58 2e-05
131gb|AY546693.1| Batrachochytrium dendrobatidis isolate AFTOL-ID 2... 58 2e-05
132gb|AY552525.1| Allomyces arbuscula isolate AFTOL-ID 300 28S larg... 58 2e-05
133gb|AY248755.1| Mus musculus 28S ribosomal RNA-like mRNA, partial... 58 2e-05
134gb|AC133464.11| Mus musculus chromosome 16, clone RP24-459O21, c... 58 2e-05
135gb|AY643504.1| Philasterides dicentrarchi 26S ribosomal RNA gene... 58 2e-05
136gb|AY580057.1| Xiphinema brevicollum 28S ribosomal RNA gene, 28S... 58 2e-05
137gb|AY580056.1| Xiphinema americanum 28S ribosomal RNA gene, 28S-... 58 2e-05
138gb|AY580055.1| Longidorus macrosoma 28S ribosomal RNA gene, 28S-... 58 2e-05
139gb|AY604482.1| Caenorhabditis sp. PS1010 28S large subunit ribos... 58 2e-05
140gb|AY604481.1| Caenorhabditis briggsae strain PB800 28S large su... 58 2e-05
141gb|AY602176.1| Oscheius myriophila strain DF5020 28S large subun... 58 2e-05
142gb|AY602175.1| Caenorhabditis sp. CB5161 28S large subunit ribos... 58 2e-05
143gb|AY602174.1| Caenorhabditis remanei strain EM464 28S large sub... 58 2e-05
144gb|AY602173.1| Caenorhabditis japonica strain SB339 28S large su... 58 2e-05
145gb|AY602172.1| Caenorhabditis drosophilae strain DF5077 28S larg... 58 2e-05
146gb|AY602171.1| Caenorhabditis sp. DF5070 28S large subunit ribos... 58 2e-05
147gb|AY602170.1| Caenorhabditis sp. SB341 28S large subunit riboso... 58 2e-05
148gb|AY602169.1| Prodontorhabditis wirthi strain DF5074 28S large ... 58 2e-05
149gb|AY602168.1| Protorhabditis sp. DF5055 28S large subunit ribos... 58 2e-05
150gb|AY602167.1| Caenorhabditis plicata strain SB355 28S large sub... 58 2e-05
151gb|DQ493955.1| Magnaporthe grisea 70-15 clone 61J04 telomere reg... 58 2e-05
152gb|AY859618.1| Zelanion antipodus 28S ribosomal RNA gene, partia... 58 2e-05
153gb|AY859614.1| Zootermopsis angusticollis internal transcribed s... 58 2e-05
154gb|AY859612.1| Vespula pensylvanica internal transcribed spacer ... 58 2e-05
155gb|AY859609.1| Triacanthella sp. JM-2004 28S ribosomal RNA gene,... 58 2e-05
156gb|AY859607.1| Sphaerotheriidae sp. JM-2004 28S ribosomal RNA ge... 58 2e-05
157gb|AY859603.1| Sminthurus viridis internal transcribed spacer 1,... 58 2e-05
158gb|AY859602.1| Siro rubens internal transcribed spacer 1, partia... 58 2e-05
159gb|AY859601.1| Scutigera coleoptrata 5.8S ribosomal RNA gene, pa... 58 2e-05
160gb|AY859599.1| Sacculinidae sp. JM-2004 internal transcribed spa... 58 2e-05
161gb|AY859597.1| Pycnophyes sp. Tjarno 5.8S ribosomal RNA gene, pa... 58 2e-05
162gb|AY859595.1| Polyxenidae sp. JM-2004 5.8S ribosomal RNA gene, ... 58 2e-05
163gb|AY859594.1| Paraphrynus sp. JM-2004 28S ribosomal RNA gene, p... 58 2e-05
164gb|AY859593.1| Parajapyx emeryanus 28S ribosomal RNA gene, parti... 58 2e-05
165gb|AY859588.1| Megabalanus californicus internal transcribed spa... 58 2e-05
166gb|AY859587.1| Mastigoproctus giganteus 5.8S ribosomal RNA gene,... 58 2e-05
167gb|AY859585.1| Mantis religiosa internal transcribed spacer 1, p... 58 2e-05
168gb|AY859583.1| Leucorrhinia sp. JM-2004 internal transcribed spa... 58 2e-05
169gb|AY859582.1| Dermacentor sp. JM-2004 internal transcribed spac... 58 2e-05
170gb|AY859581.1| Homarus americanus internal transcribed spacer 2 ... 58 2e-05
171gb|AY859574.1| Eulimnadia texana internal transcribed spacer 1, ... 58 2e-05
172gb|AY859572.1| Eremobates sp. JM-2004 5.8S ribosomal RNA gene, p... 58 2e-05
173gb|AY859569.1| Craterostigmus tasmanianus internal transcribed s... 58 2e-05
174gb|AY859562.1| Cherokia georgiana 5.8S ribosomal RNA gene, parti... 58 2e-05
175gb|AY859560.1| Campodeidae sp. JM-2004 internal transcribed spac... 58 2e-05
176gb|AY859557.1| Callibaetis ferrugineus internal transcribed spac... 58 2e-05
177gb|AY859556.1| Baculentulus tianmushanensis 28S ribosomal RNA ge... 58 2e-05
178gb|AY859550.1| Anoplodactylus portus 5.8S ribosomal RNA gene, pa... 58 2e-05
179gb|AY859549.1| Anaspides tasmaniae internal transcribed spacer 2... 58 2e-05
180gb|AY859546.1| Gomphocerinae sp. JM-2004 internal transcribed sp... 58 2e-05
181gb|AY859544.1| Acheta domesticus internal transcribed spacer 2 a... 58 2e-05
182gb|AY225102.1| Pseudopleuronectes americanus 28S ribosomal RNA g... 58 2e-05
183gb|AY750699.1| Oligonychus coffeae 28S ribosomal RNA gene, parti... 58 2e-05
184gb|AY750698.1| Panonychus ulmi 28S ribosomal RNA gene, partial s... 58 2e-05
185gb|AY750697.1| Panonychus citri 28S ribosomal RNA gene, partial ... 58 2e-05
186gb|AY750696.1| Petrobia harti 28S ribosomal RNA gene, partial se... 58 2e-05
187gb|AY750695.1| Tetranychus hydrangeae 28S ribosomal RNA gene, pa... 58 2e-05
188gb|AY750694.1| Tetranychus piercei 28S ribosomal RNA gene, parti... 58 2e-05
189gb|AY750693.1| Tetranychus urticae 28S ribosomal RNA gene, parti... 58 2e-05
190gb|AY750692.1| Tetranychus truncatus 28S ribosomal RNA gene, par... 58 2e-05
191gb|AY750691.1| Tetranychus kanzawai 28S ribosomal RNA gene, part... 58 2e-05
192gb|DQ485344.1| Arachis hypogaea 25S ribosomal RNA gene, partial ... 58 2e-05
193gb|DQ226907.1| Boechera divaricarpa isolate SLW-D-B12 mRNA sequence 58 2e-05
194gb|AC125254.9| Mus musculus chromosome 9, clone RP24-156I15, com... 58 2e-05
195gb|AY267553.1| Therevid NCSU-0300013 28S ribosomal RNA gene, par... 58 2e-05
196gb|AY267552.1| Hemigephyra sp. MEI124388 28S ribosomal RNA gene,... 58 2e-05
197gb|AY267551.1| Therevid NCSU-0300008 28S ribosomal RNA gene, par... 58 2e-05
198gb|AY267550.1| Actenomeros sp. NCSU-0300002 28S ribosomal RNA ge... 58 2e-05
199gb|DQ158858.1| Bigelowiella natans nucleomorph chromosome 3, par... 58 2e-05
200gb|DQ158857.1| Bigelowiella natans nucleomorph chromosome 2, par... 58 2e-05
201gb|DQ158856.1| Bigelowiella natans nucleomorph chromosome 1, par... 58 2e-05
202gb|AY305327.1| Perkinsus andrewsi large subunit ribosomal RNA an... 58 2e-05
203gb|AY305326.1| Perkinsus andrewsi 5S ribosomal RNA, small subuni... 58 2e-05
204gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete... 58 2e-05
205gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ... 58 2e-05
206gb|DQ168804.1| Nemotelus sp. CB0506 28S ribosomal RNA gene, part... 58 2e-05
207gb|DQ168802.1| Chloromyia formosa voucher CB0502 28S ribosomal R... 58 2e-05
208gb|DQ168800.1| Beridops sp. CB0437 28S ribosomal RNA gene, parti... 58 2e-05
209gb|DQ168799.1| Chordonota sp. CB0436 28S ribosomal RNA gene, par... 58 2e-05
210gb|DQ168798.1| Auloceromyia sp. CB0435 28S ribosomal RNA gene, p... 58 2e-05
211gb|DQ168797.1| Solva sp. CB0434 28S ribosomal RNA gene, partial ... 58 2e-05
212gb|DQ168795.1| Parhadrestia atava voucher CB0432 28S ribosomal R... 58 2e-05
213gb|DQ168794.1| Nemotelus sp. CB0430 28S ribosomal RNA gene, part... 58 2e-05
214gb|DQ168793.1| Euparyphus sp. CB0429 28S ribosomal RNA gene, par... 58 2e-05
215gb|DQ168792.1| Adoxomyia regularis voucher CB0428 28S ribosomal ... 58 2e-05
216gb|DQ168791.1| Cf. Euryneura sp. CB0427 28S ribosomal RNA gene, ... 58 2e-05
217gb|DQ168790.1| Cyphomyia erecta voucher CB0426 28S ribosomal RNA... 58 2e-05
218gb|DQ168789.1| Neoberis brasiliana voucher CB0424 28S ribosomal ... 58 2e-05
219gb|DQ168788.1| Hermetia melanderi voucher CB0423 28S ribosomal R... 58 2e-05
220gb|DQ168787.1| Euryneura propinqua voucher CB0422 28S ribosomal ... 58 2e-05
221gb|DQ168786.1| Nigritomyia loewii voucher CB0421 28S ribosomal R... 58 2e-05
222gb|DQ168785.1| Adoxomyia sp. CB0419 28S ribosomal RNA gene, part... 58 2e-05
223gb|DQ168784.1| Octarthria sp. CB0415 28S ribosomal RNA gene, par... 58 2e-05
224gb|DQ168783.1| Lecomyia sp. CB0413 28S ribosomal RNA gene, parti... 58 2e-05
225gb|DQ168782.1| Octarthria flavpalpis voucher CB0412 28S ribosoma... 58 2e-05
226gb|DQ168781.1| Chrysochlorina sp. CB0410 28S ribosomal RNA gene,... 58 2e-05
227gb|DQ168780.1| Ptecticus sp. CB0409 28S ribosomal RNA gene, part... 58 2e-05
228gb|DQ168779.1| Cyanauges ruficornis voucher CB0407 28S ribosomal... 58 2e-05
229gb|DQ168778.1| Raphiocera ornata voucher CB0406 28S ribosomal RN... 58 2e-05
230gb|DQ168777.1| Clitellaria ephippium voucher CB0405 28S ribosoma... 58 2e-05
231gb|DQ168776.1| Nigritomyia consobrina voucher CB0404 28S ribosom... 58 2e-05
232gb|DQ168775.1| Lagenosoma sp. CB0403 28S ribosomal RNA gene, par... 58 2e-05
233gb|DQ168774.1| Alopecuroceras coloratum voucher CB0402 28S ribos... 58 2e-05
234gb|DQ168773.1| Ampsalis terminalis voucher CB0401 28S ribosomal ... 58 2e-05
235gb|DQ168772.1| Ruba opponens voucher CB0331 28S ribosomal RNA ge... 58 2e-05
236gb|DQ168771.1| Leucoptilum sp. CB0326 28S ribosomal RNA gene, pa... 58 2e-05
237gb|DQ168770.1| Chordonota inermis voucher CB0324 28S ribosomal R... 58 2e-05
238gb|DQ168769.1| Dicyphoma schaefferi voucher CB0323 28S ribosomal... 58 2e-05
239gb|DQ168768.1| Dieuryneura stigma voucher CB0322 28S ribosomal R... 58 2e-05
240gb|DQ168767.1| Stratiomys laticeps voucher CB0319 28S ribosomal ... 58 2e-05
241gb|DQ168765.1| Diaphorostylus nasica voucher CB0317 28S ribosoma... 58 2e-05
242gb|DQ168764.1| Adoxomyia rustica voucher CB0316 28S ribosomal RN... 58 2e-05
243gb|DQ168763.1| Abavus sp. CB0314 28S ribosomal RNA gene, partial... 58 2e-05
244gb|DQ168762.1| Chiromyza sp. CB0313 28S ribosomal RNA gene, part... 58 2e-05
245gb|DQ168761.1| Acropeltates sp. CB0311 28S ribosomal RNA gene, p... 58 2e-05
246gb|DQ168760.1| Sargus thoracicus voucher CB0305 28S ribosomal RN... 58 2e-05
247gb|DQ168759.1| Artemita aurata voucher CB0303 28S ribosomal RNA ... 58 2e-05
248gb|DQ168758.1| Histiodroma sp. CB0301 28S ribosomal RNA gene, pa... 58 2e-05
249gb|DQ168757.1| Heteracanthia sp. CB0226 28S ribosomal RNA gene, ... 58 2e-05
250gb|DQ168756.1| Oplachantha sp. CB0225 28S ribosomal RNA gene, pa... 58 2e-05
251gb|DQ168755.1| Platylobium zurstrasseni voucher CB0224 28S ribos... 58 2e-05
252gb|DQ168754.1| Hermetia illucens voucher CB0222 28S ribosomal RN... 58 2e-05
253gb|DQ168753.1| Merosargus pictipes voucher CB0221 28S ribosomal ... 58 2e-05
254gb|DQ168752.1| Cyphomyia pulchella voucher CB0212 28S ribosomal ... 58 2e-05
255gb|DQ168751.1| Ditylometopa elegans voucher CB0210 28S ribosomal... 58 2e-05
256gb|DQ168750.1| Cyphomyia cyanea voucher CB0203 28S ribosomal RNA... 58 2e-05
257gb|DQ168749.1| Cyphomyia nr. androgyna CB0201 voucher CB0201 28S... 58 2e-05
258gb|DQ168748.1| Hedriodiscus binotatus voucher CB0139 28S ribosom... 58 2e-05
259gb|DQ168747.1| Odontomyia occidentalis voucher CB0138 28S riboso... 58 2e-05
260gb|DQ168746.1| Euparyphus pardalinus voucher CB0137 28S ribosoma... 58 2e-05
261gb|DQ168745.1| Myxosargus knowltoni voucher CB0133 28S ribosomal... 58 2e-05
262gb|DQ168744.1| Proegmenomyia metallica voucher CB0122 28S riboso... 58 2e-05
263gb|DQ168743.1| Cyphomyia n. sp. 1 CAB-2005 28S ribosomal RNA gen... 58 2e-05
264gb|DQ168742.1| Abasanistus rubricornis voucher CB0117 28S riboso... 58 2e-05
265gb|DQ168741.1| Labocerina atrata voucher CB0116 28S ribosomal RN... 58 2e-05
266gb|DQ168740.1| Pseudocyphomyia mimetica voucher CB0114 28S ribos... 58 2e-05
267gb|DQ168739.1| Cyphomyia dispar voucher CB0109 28S ribosomal RNA... 58 2e-05
268gb|DQ168738.1| Cyphomyia n. sp. 1 CAB-2005 28S ribosomal RNA gen... 58 2e-05
269gb|DQ168737.1| Cyphomyia altifrons voucher CB0105 28S ribosomal ... 58 2e-05
270gb|DQ168736.1| Cyphomyia souzalopesi voucher CB0102 28S ribosoma... 58 2e-05
271gb|AY863411.1| Pycnophyes kielensis 28S ribosomal RNA gene, part... 58 2e-05
272gb|AY863410.1| Gordius sp. NP 2005a 5.8S ribosomal RNA gene, par... 58 2e-05
273gb|AY550243.1| Amanita bisporigera intergenic spacer 2, partial ... 58 2e-05
274gb|AY049860.1| Urobatis jamaicensis internal transcribed spacer ... 58 2e-05
275gb|AY049857.1| Squatina californica internal transcribed spacer ... 58 2e-05
276gb|AY049854.1| Scyliorhinus torazame internal transcribed spacer... 58 2e-05
277gb|AY049851.1| Rhinobatos productus 28S ribosomal RNA gene, part... 58 2e-05
278gb|AY049848.1| Pristiophorus cirratus internal transcribed space... 58 2e-05
279gb|AY049845.1| Potamotrygon hystrix internal transcribed spacer ... 58 2e-05
280gb|AY049842.1| Orectolobus ornatus internal transcribed spacer 2... 58 2e-05
281gb|AY049839.1| Mitsukurina owstoni internal transcribed spacer 2... 58 2e-05
282gb|AY049837.1| Heterodontus francisci internal transcribed space... 58 2e-05
283gb|AY049834.1| Hemiscyllium ocellatum 28S ribosomal RNA gene, pa... 58 2e-05
284gb|AY049832.1| Galeocerdo cuvier internal transcribed spacer 2, ... 58 2e-05
285gb|AY049829.1| Deania sp. JM-2001 internal transcribed spacer 2,... 58 2e-05
286gb|AY049826.1| Dalatias licha internal transcribed spacer 2, and... 58 2e-05
287gb|AY049824.1| Chlamydoselachus anguineus 28S ribosomal RNA gene... 58 2e-05
288gb|AY049821.1| Centroscymnus owstonii 28S ribosomal RNA gene, pa... 58 2e-05
289gb|AY049818.1| Centroscyllium fabricii internal transcribed spac... 58 2e-05
290gb|AY049815.1| Carcharias taurus internal transcribed spacer 2, ... 58 2e-05
291gb|AY049812.1| Callorhinchus milii internal transcribed spacer 2... 58 2e-05
292gb|AY049809.1| Apristurus profundorum internal transcribed space... 58 2e-05
293gb|AY049806.1| Alopias pelagicus internal transcribed spacer 2, ... 58 2e-05
294gb|AY210845.1| Xiphinema rivesi 28S ribosomal RNA gene, partial ... 58 2e-05
295gb|AY210844.1| Triops sp. JMM-2003 28S ribosomal RNA gene, parti... 58 2e-05
296gb|AY210843.1| Tenebrio sp. JMM-2003 5.8S ribosomal RNA gene, co... 58 2e-05
297gb|AY210840.1| Priapulus caudatus 5.8S ribosomal RNA and 28S rib... 58 2e-05
298gb|AY210836.1| Peripatus sp. Per2 28S ribosomal RNA gene, partia... 58 2e-05
299gb|AY210835.1| Panulirus argus 28S ribosomal RNA gene, partial s... 58 2e-05
300gb|AY210830.1| Pandinus imperator 5.8S ribosomal RNA gene, compl... 58 2e-05
301gb|AY210828.1| Orthoporus sp. JMM-2003b 28S ribosomal RNA gene, ... 58 2e-05
302gb|AY210826.1| Milnesium sp. JMM-2003 28S ribosomal RNA gene, pa... 58 2e-05
303gb|AY210825.1| Lithobius sp. JMM-2003b 28S ribosomal RNA gene, p... 58 2e-05
304gb|AY210822.1| Hanseniella sp. JMM-2003 28S ribosomal RNA gene, ... 58 2e-05
305gb|AY210819.1| Gromphadorhina laevigata 28S ribosomal RNA gene, ... 58 2e-05
306gb|AY210817.1| Gordius aquaticus 5.8S ribosomal RNA gene, comple... 58 2e-05
307gb|AY210815.1| Cyprididae sp. JMM-2003 28S ribosomal RNA gene, p... 58 2e-05
308gb|AY210813.1| Cyclopidae sp. JMM-2003 28S ribosomal RNA gene, p... 58 2e-05
309gb|AY210812.1| Cormocephalus hartmeyeri 28S ribosomal RNA gene, ... 58 2e-05
310gb|AY210810.1| Ctenolepisma longicaudata 5.8S ribosomal RNA gene... 58 2e-05
311gb|AY210809.1| Colossendreis sp. Col 28S ribosomal RNA gene, par... 58 2e-05
312gb|AY210807.1| Callipallene sp. JMM-2003 5.8S ribosomal RNA gene... 58 2e-05
313gb|AY210806.1| Ascaris lumbricoides 5.8S ribosomal RNA and 28S r... 58 2e-05
314gb|AY210805.1| Artemia sp. JMM-2003 28S ribosomal RNA gene, part... 58 2e-05
315gb|AY210804.1| Argulus sp. JMM-2003 28S ribosomal RNA gene, part... 58 2e-05
316gb|AY210803.1| Aphonopelma hentzi 5.8S ribosomal RNA gene, compl... 58 2e-05
317gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, parti... 58 2e-05
318gb|AF389274.1| Osyris lanceolata 26S ribosomal RNA gene, partial... 58 2e-05
319gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, parti... 58 2e-05
320gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial se... 58 2e-05
321gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, part... 58 2e-05
322gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene,... 58 2e-05
323gb|AF389269.1| Ranunculus keniensis 26S ribosomal RNA gene, part... 58 2e-05
324gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, part... 58 2e-05
325gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, parti... 58 2e-05
326gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial s... 58 2e-05
327gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, parti... 58 2e-05
328gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 58 2e-05
329gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial ... 58 2e-05
330gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial s... 58 2e-05
331gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, parti... 58 2e-05
332gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gen... 58 2e-05
333gb|AF389259.1| Nelumbo lutea 26S ribosomal RNA gene, partial seq... 58 2e-05
334gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial ... 58 2e-05
335gb|AF389257.1| Menispermum canadense 26S ribosomal RNA gene, par... 58 2e-05
336gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial... 58 2e-05
337gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, ... 58 2e-05
338gb|AF389254.1| Decaisnea fargesii 26S ribosomal RNA gene, partia... 58 2e-05
339gb|AF389253.1| Akebia quinata 26S ribosomal RNA gene, partial se... 58 2e-05
340gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, part... 58 2e-05
341gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 58 2e-05
342gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial ... 58 2e-05
343gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial ... 58 2e-05
344gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 58 2e-05
345gb|AF389246.1| Circaeaster agrestis 26S ribosomal RNA gene, part... 58 2e-05
346gb|AF389245.1| Kingdonia uniflora 26S ribosomal RNA gene, partia... 58 2e-05
347gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 58 2e-05
348gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partia... 58 2e-05
349gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, p... 58 2e-05
350gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial... 58 2e-05
351gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene... 58 2e-05
352gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, part... 58 2e-05
353gb|AY456160.1| Heterotropus senex clone Het28Sh-z 28S ribosomal ... 58 2e-05
354gb|AY456159.1| Bombylius major clone Boma28Sh-z 28S ribosomal RN... 58 2e-05
355gb|AY456157.1| Mydas sp. NCSU-99072196 clone Myd28Sh-z 28S ribos... 58 2e-05
356gb|AY456156.1| Eulonchus sp. NCSU-96120223 clone Eusp28Sq-z 28S ... 58 2e-05
357gb|AY456155.1| Neorhynchocephalus volaticus clone Nem28Sh-z 28S ... 58 2e-05
358gb|AY456153.1| Xylomya parens clone Mac28Sh-z 28S ribosomal RNA ... 58 2e-05
359gb|AY456152.1| Tipula paterifera clone Tpa28Sh-z 28S ribosomal R... 58 2e-05
360gb|AY456151.1| Sylvicola alternatus clone Syv28Sh-z 28S ribosoma... 58 2e-05
361gb|BC032050.1| Mus musculus cDNA clone IMAGE:3486529 58 2e-05
362gb|AY189151.1| Pittosporum tobira 26S large subunit ribosomal RN... 58 2e-05
363gb|AY189150.1| Petroselinum crispum 26S large subunit ribosomal ... 58 2e-05
364gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosom... 58 2e-05
365gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA ... 58 2e-05
366gb|AY189114.1| Trachymene coerulea 26S large subunit ribosomal R... 58 2e-05
367gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribos... 58 2e-05
368gb|AY189111.1| Tetrapanax papyriferus 26S large subunit ribosoma... 58 2e-05
369gb|AY189110.1| Spananthe paniculata 26S large subunit ribosomal ... 58 2e-05
370gb|AY189109.1| Sollya heterophylla 26S large subunit ribosomal R... 58 2e-05
371gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal... 58 2e-05
372gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA ... 58 2e-05
373gb|AY189106.1| Rhytidosporum alpinum 26S large subunit ribosomal... 58 2e-05
374gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosom... 58 2e-05
375gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosom... 58 2e-05
376gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal ... 58 2e-05
377gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal ... 58 2e-05
378gb|AY189101.1| Platysace lanceolata 26S large subunit ribosomal ... 58 2e-05
379gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal ... 58 2e-05
380gb|AY189098.1| Panax quinquefolius 26S large subunit ribosomal R... 58 2e-05
381gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosom... 58 2e-05
382gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA g... 58 2e-05
383gb|AY189095.1| Myodocarpus involucratus 26S large subunit riboso... 58 2e-05
384gb|AY189094.1| Munroidendron racemosum 26S large subunit ribosom... 58 2e-05
385gb|AY189093.1| Mulinum sp. Hufford s.n. 26S large subunit riboso... 58 2e-05
386gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA ... 58 2e-05
387gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA ... 58 2e-05
388gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal R... 58 2e-05
389gb|AY189089.1| Mulinum albovaginatum 26S large subunit ribosomal... 58 2e-05
390gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribos... 58 2e-05
391gb|AY189087.1| Micropleura renifolia 26S large subunit ribosomal... 58 2e-05
392gb|AY189086.1| Meryta sinclairii 26S large subunit ribosomal RNA... 58 2e-05
393gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosoma... 58 2e-05
394gb|AY189084.1| Marianthus ringens 26S large subunit ribosomal RN... 58 2e-05
395gb|AY189083.1| Mackinlaya macrosciadia 26S large subunit ribosom... 58 2e-05
396gb|AY189082.1| Mackinlaya confusa 26S large subunit ribosomal RN... 58 2e-05
397gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal R... 58 2e-05
398gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA ... 58 2e-05
399gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal R... 58 2e-05
400gb|AY189078.1| Hydrocotyle verticillata 26S large subunit riboso... 58 2e-05
401gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal R... 58 2e-05
402gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit riboso... 58 2e-05
403gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA g... 58 2e-05
404gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosom... 58 2e-05
405gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene... 58 2e-05
406gb|AY189072.1| Gymnophyton polycephalum 26S large subunit riboso... 58 2e-05
407gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA... 58 2e-05
408gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosoma... 58 2e-05
409gb|AY189069.1| Fatsia japonica 26S large subunit ribosomal RNA g... 58 2e-05
410gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal R... 58 2e-05
411gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal... 58 2e-05
412gb|AY189066.1| Endressia castellana 26S large subunit ribosomal ... 58 2e-05
413gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit rib... 58 2e-05
414gb|AY189064.1| Donnellsmithia cordata 26S large subunit ribosoma... 58 2e-05
415gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal... 58 2e-05
416gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribos... 58 2e-05
417gb|AY189061.1| Dichosciadium ranunculaceum 26S large subunit rib... 58 2e-05
418gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal ... 58 2e-05
419gb|AY189059.1| Delarbrea collina 26S large subunit ribosomal RNA... 58 2e-05
420gb|AY189058.1| Daucus carota 26S large subunit ribosomal RNA gen... 58 2e-05
421gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA ... 58 2e-05
422gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RN... 58 2e-05
423gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosoma... 58 2e-05
424gb|AY189054.1| Centella erecta 26S large subunit ribosomal RNA g... 58 2e-05
425gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RN... 58 2e-05
426gb|AY189052.1| Bowlesia tropaeolifolia 26S large subunit ribosom... 58 2e-05
427gb|AY189051.1| Bowlesia incana 26S large subunit ribosomal RNA g... 58 2e-05
428gb|AY189050.1| Bolax gummifera 26S large subunit ribosomal RNA g... 58 2e-05
429gb|AY189049.1| Bolax caespitosa 26S large subunit ribosomal RNA ... 58 2e-05
430gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal R... 58 2e-05
431gb|AY189047.1| Azorella trifoliolata 26S large subunit ribosomal... 58 2e-05
432gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA g... 58 2e-05
433gb|AY189045.1| Azorella monantha 26S large subunit ribosomal RNA... 58 2e-05
434gb|AY189044.1| Azorella macquariensis 26S large subunit ribosoma... 58 2e-05
435gb|AY189043.1| Azorella lycopodioides 26S large subunit ribosoma... 58 2e-05
436gb|AY189041.1| Astrotricha pterocarpa 26S large subunit ribosoma... 58 2e-05
437gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA g... 58 2e-05
438gb|AY189039.1| Arthrophyllum mackeei 26S large subunit ribosomal... 58 2e-05
439gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosom... 58 2e-05
440gb|AY189037.1| Arctopus echinatus 26S large subunit ribosomal RN... 58 2e-05
441gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA ge... 58 2e-05
442gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA ... 58 2e-05
443gb|AY189033.1| Apiopetalum velutinum 26S large subunit ribosomal... 58 2e-05
444gb|AY189032.1| Anginon rugosum 26S large subunit ribosomal RNA g... 58 2e-05
445gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA g... 58 2e-05
446gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal... 58 2e-05
447gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal R... 58 2e-05
448gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA g... 58 2e-05
449gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, parti... 58 2e-05
450gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial ... 58 2e-05
451gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, pa... 58 2e-05
452gb|AY727983.1| Galax urceolata 26S ribosomal RNA gene, partial s... 58 2e-05
453gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, par... 58 2e-05
454gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial ... 58 2e-05
455gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial ... 58 2e-05
456gb|AY727979.1| Symplocos pendula 26S ribosomal RNA gene, partial... 58 2e-05
457gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, par... 58 2e-05
458gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, parti... 58 2e-05
459gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partia... 58 2e-05
460gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial... 58 2e-05
461gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, parti... 58 2e-05
462gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, pa... 58 2e-05
463gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, p... 58 2e-05
464gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, part... 58 2e-05
465gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, p... 58 2e-05
466gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, parti... 58 2e-05
467gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA ... 58 2e-05
468gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, par... 58 2e-05
469gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial... 58 2e-05
470gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partia... 58 2e-05
471gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial ... 58 2e-05
472gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, parti... 58 2e-05
473gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partia... 58 2e-05
474gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial ... 58 2e-05
475gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial s... 58 2e-05
476gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial se... 58 2e-05
477gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial... 58 2e-05
478gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial s... 58 2e-05
479gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, part... 58 2e-05
480gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, part... 58 2e-05
481gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, par... 58 2e-05
482gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial se... 58 2e-05
483gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial ... 58 2e-05
484gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, par... 58 2e-05
485gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, par... 58 2e-05
486gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, par... 58 2e-05
487gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, part... 58 2e-05
488gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, parti... 58 2e-05
489gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial ... 58 2e-05
490gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial s... 58 2e-05
491gb|AY727944.1| Cobaea scandens 26S ribosomal RNA gene, partial s... 58 2e-05
492gb|AY727943.1| Cantua buxifolia 26S ribosomal RNA gene, partial ... 58 2e-05
493gb|AY727942.1| Acanthogilia gloriosa 26S ribosomal RNA gene, par... 58 2e-05
494gb|AY727941.1| Polemonium pauciflorum 26S ribosomal RNA gene, pa... 58 2e-05
495gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, pa... 58 2e-05
496gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, par... 58 2e-05
497gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, parti... 58 2e-05
498gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, par... 58 2e-05
499gb|AY727936.1| Impatiens auricoma 26S ribosomal RNA gene, partia... 58 2e-05
500gb|AY727935.1| Pentamerista neotropica 26S ribosomal RNA gene, p... 58 2e-05

>gb|AY677177.1| Hordeum vulgare UDP-D-glucuronate decarboxylase (UXS1) mRNA,
           complete cds
          Length = 1433

 Score =  559 bits (282), Expect = e-156
 Identities = 301/306 (98%), Gaps = 1/306 (0%)
 Strand = Plus / Plus

                                                                       
Query: 62  tccgattcaaacgcgcag-cttcctcgtgtccgaactaagccccaatcccaccaccgccg 120
           |||||||||||||||||| ||||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1   tccgattcaaacgcgcaggcttccccgtgtccggagtaagccccaatcccaccaccgccg 60

                                                                       
Query: 121 ccgctggtgctcggcgcgatggcgcagaaggacgccaccaatggcaacggcgccaccacg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ccgctggtgctcggcgcgatggcgcagaaggacgccaccaatggcaacggcgccaccacg 120

                                                                       
Query: 181 cgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaacatgcgg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaacatgcgg 180

                                                                       
Query: 241 atcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagctcatggag 300
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 181 atcctggtcaccggcggagctggcttcatcggctcgcacctcgtcgacaagctcatggag 240

                                                                       
Query: 301 aacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaagacaacctg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 aacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaagacaacctg 300

                 
Query: 361 aagaag 366
           ||||||
Sbjct: 301 aagaag 306



to top

>dbj|AB079064.1| Oryza sativa (japonica cultivar-group) UXS-3 mRNA for
           UDP-glucuronic acid decarboxylase, complete cds
          Length = 1053

 Score =  272 bits (137), Expect = 7e-70
 Identities = 179/193 (92%)
 Strand = Plus / Plus

                                                                       
Query: 174 caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaa 233
           |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||| ||
Sbjct: 42  caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccaggcgaa 101

                                                                       
Query: 234 catgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagct 293
           | || ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 102 cctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtcgacaagct 161

                                                                       
Query: 294 catggagaacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaaga 353
           |||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 162 catggagaacgagaagcacgaggtcattgtcgcagacaactttttcactggttcaaaaga 221

                        
Query: 354 caacctgaagaag 366
           |||||||||||||
Sbjct: 222 caacctgaagaag 234



to top

>dbj|AK100908.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132F05, full
           insert sequence
          Length = 1811

 Score =  272 bits (137), Expect = 7e-70
 Identities = 179/193 (92%)
 Strand = Plus / Plus

                                                                       
Query: 174 caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaa 233
           |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||| ||
Sbjct: 530 caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccaggcgaa 589

                                                                       
Query: 234 catgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagct 293
           | || ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 590 cctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtcgacaagct 649

                                                                       
Query: 294 catggagaacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaaga 353
           |||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 650 catggagaacgagaagcacgaggtcattgtcgcagacaactttttcactggttcaaaaga 709

                        
Query: 354 caacctgaagaag 366
           |||||||||||||
Sbjct: 710 caacctgaagaag 722



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 126 ggtgctcggcgcgatggcgcagaaggacgcca 157
           |||||||| || ||||||||||||||| ||||
Sbjct: 476 ggtgctcgacgggatggcgcagaaggaggcca 507



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  cggtctaatccgattcaaac 73
           ||||||||||||||||||||
Sbjct: 399 cggtctaatccgattcaaac 418



to top

>dbj|AK060031.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-H02, full
           insert sequence
          Length = 1411

 Score =  272 bits (137), Expect = 7e-70
 Identities = 179/193 (92%)
 Strand = Plus / Plus

                                                                       
Query: 174 caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaa 233
           |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||| ||
Sbjct: 141 caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccaggcgaa 200

                                                                       
Query: 234 catgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagct 293
           | || ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 201 cctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtcgacaagct 260

                                                                       
Query: 294 catggagaacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaaga 353
           |||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 261 catggagaacgagaagcacgaggtcattgtcgcagacaactttttcactggttcaaaaga 320

                        
Query: 354 caacctgaagaag 366
           |||||||||||||
Sbjct: 321 caacctgaagaag 333



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 126 ggtgctcggcgcgatggcgcagaaggacgcca 157
           |||||||| || ||||||||||||||| ||||
Sbjct: 87  ggtgctcgacgggatggcgcagaaggaggcca 118



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 54 cggtctaatccgattcaaac 73
          ||||||||||||||||||||
Sbjct: 10 cggtctaatccgattcaaac 29



to top

>emb|AJ295156.1|PCO295156 Phragmites communis mRNA for d-TDP-glucose dehydratase (tgp gene)
          Length = 1562

 Score =  266 bits (134), Expect = 5e-68
 Identities = 173/186 (93%)
 Strand = Plus / Plus

                                                                       
Query: 181 cgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaacatgcgg 240
           ||||||||||| |||||||| ||  ||||||||||||||||||||||||| ||| |||||
Sbjct: 287 cgcccgccgccgacgccctcgccgctccgcttctccaagttcttccaggcgaacctgcgg 346

                                                                       
Query: 241 atcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagctcatggag 300
           |||||||||||||| || || ||||||||||||||||||| |||||||||||||||||||
Sbjct: 347 atcctggtcaccggtggggcgggcttcatcggctcgcacctcgtcgacaagctcatggag 406

                                                                       
Query: 301 aacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaagacaacctg 360
           ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 407 aacgagaagcacgaggtcattgttgctgataactttttcactggttcaaaagacaacttg 466

                 
Query: 361 aagaag 366
           ||||||
Sbjct: 467 aagaag 472



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                         
Query: 56  gtctaatccgattcaaacgcgcagcttcctcgtgtccgaactaagc 101
           |||||||||||||||||| ||| | |||| ||||||||| ||||||
Sbjct: 147 gtctaatccgattcaaac-cgccggttccccgtgtccgagctaagc 191



to top

>gb|AY104952.1| Zea mays PCO092342 mRNA sequence
          Length = 1825

 Score =  252 bits (127), Expect = 7e-64
 Identities = 175/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 176 ccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccaggccaaca 235
           |||| ||||||||||| || ||||| ||| ||||||||||||||||||| ||||| ||| 
Sbjct: 526 ccacccgcccgccgccgaccccctcgcccctccgcttctccaagttctttcaggctaacc 585

                                                                       
Query: 236 tgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtcgacaagctca 295
           |||||||||||||||| || || || ||||||||||||||||||| ||| ||||||||||
Sbjct: 586 tgcggatcctggtcactggtggggcgggcttcatcggctcgcacctcgtagacaagctca 645

                                                                       
Query: 296 tggagaacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaaagaca 355
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 646 tggagaacgagaagcacgaggtcattgttgctgataactttttcactggttcaaaagaca 705

                      
Query: 356 acctgaagaag 366
           |||||||||||
Sbjct: 706 acctgaagaag 716



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  135 bits (68), Expect = 1e-28
 Identities = 86/92 (93%)
 Strand = Plus / Plus

                                                                           
Query: 226     caggccaacatgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtc 285
               ||||| ||| || ||||||| |||||||||||||||||||||||||||||||||| ||||
Sbjct: 9409350 caggcgaacctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtc 9409409

                                               
Query: 286     gacaagctcatggagaacgagaagaacgaggt 317
               |||||||||||||||||||||||| |||||||
Sbjct: 9409410 gacaagctcatggagaacgagaagcacgaggt 9409441



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                    
Query: 314     aggtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
               |||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 9410107 aggtcattgtcgcagacaactttttcactggttcaaaagacaacctgaagaag 9410159



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 174     caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccagg 229
               |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||
Sbjct: 9409200 caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccagg 9409255



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                                
Query: 6        acgtgagctgggtt-agaccgtcgtgagacag 36
                |||||||||||||| ||| |||||||||||||
Sbjct: 31511598 acgtgagctgggttcagaacgtcgtgagacag 31511629



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                                
Query: 6        acgtgagctgggtt-agaccgtcgtgagacag 36
                |||||||||||||| ||| |||||||||||||
Sbjct: 31510466 acgtgagctgggttcagaacgtcgtgagacag 31510497



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 126     ggtgctcggcgcgatggcgcagaaggacgcca 157
               |||||||| || ||||||||||||||| ||||
Sbjct: 9409146 ggtgctcgacgggatggcgcagaaggaggcca 9409177



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 54      cggtctaatccgattcaaac 73
               ||||||||||||||||||||
Sbjct: 9408865 cggtctaatccgattcaaac 9408884



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  135 bits (68), Expect = 1e-28
 Identities = 86/92 (93%)
 Strand = Plus / Plus

                                                                          
Query: 226    caggccaacatgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtc 285
              ||||| ||| || ||||||| |||||||||||||||||||||||||||||||||| ||||
Sbjct: 106750 caggcgaacctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtc 106809

                                              
Query: 286    gacaagctcatggagaacgagaagaacgaggt 317
              |||||||||||||||||||||||| |||||||
Sbjct: 106810 gacaagctcatggagaacgagaagcacgaggt 106841



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                   
Query: 314    aggtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
              |||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 107507 aggtcattgtcgcagacaactttttcactggttcaaaagacaacctgaagaag 107559



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                      
Query: 174    caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccagg 229
              |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||
Sbjct: 106600 caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccagg 106655



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 126    ggtgctcggcgcgatggcgcagaaggacgcca 157
              |||||||| || ||||||||||||||| ||||
Sbjct: 106546 ggtgctcgacgggatggcgcagaaggaggcca 106577



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     cggtctaatccgattcaaac 73
              ||||||||||||||||||||
Sbjct: 106265 cggtctaatccgattcaaac 106284



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  135 bits (68), Expect = 1e-28
 Identities = 86/92 (93%)
 Strand = Plus / Plus

                                                                           
Query: 226     caggccaacatgcggatcctggtcaccggcggagctggcttcatcggctcgcaccccgtc 285
               ||||| ||| || ||||||| |||||||||||||||||||||||||||||||||| ||||
Sbjct: 9407471 caggcgaacctgaggatcctcgtcaccggcggagctggcttcatcggctcgcacctcgtc 9407530

                                               
Query: 286     gacaagctcatggagaacgagaagaacgaggt 317
               |||||||||||||||||||||||| |||||||
Sbjct: 9407531 gacaagctcatggagaacgagaagcacgaggt 9407562



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                    
Query: 314     aggtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
               |||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 9408228 aggtcattgtcgcagacaactttttcactggttcaaaagacaacctgaagaag 9408280



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                       
Query: 174     caccacgcgcccgccgcccacgccctcccccatccgcttctccaagttcttccagg 229
               |||||| ||||||||||| |||||||| ||  |||| |||||||||||||||||||
Sbjct: 9407321 caccacccgcccgccgccgacgccctcgccgctccggttctccaagttcttccagg 9407376



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                                
Query: 6        acgtgagctgggtt-agaccgtcgtgagacag 36
                |||||||||||||| ||| |||||||||||||
Sbjct: 31602114 acgtgagctgggttcagaacgtcgtgagacag 31602145



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                                
Query: 6        acgtgagctgggtt-agaccgtcgtgagacag 36
                |||||||||||||| ||| |||||||||||||
Sbjct: 31600982 acgtgagctgggttcagaacgtcgtgagacag 31601013



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 126     ggtgctcggcgcgatggcgcagaaggacgcca 157
               |||||||| || ||||||||||||||| ||||
Sbjct: 9407267 ggtgctcgacgggatggcgcagaaggaggcca 9407298



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 54      cggtctaatccgattcaaac 73
               ||||||||||||||||||||
Sbjct: 9406986 cggtctaatccgattcaaac 9407005



to top

>ref|NM_114511.2| Arabidopsis thaliana UXS5; catalytic AT3G46440 (UXS5) transcript
           variant AT3G46440.1 mRNA, complete cds
          Length = 1374

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 231 ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 290

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 291 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 341



to top

>ref|NM_001035743.1| Arabidopsis thaliana UXS5; catalytic AT3G46440 (UXS5) transcript
           variant AT3G46440.2 mRNA, complete cds
          Length = 1464

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 321 ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 380

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 381 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 431



to top

>gb|AY096586.1| Arabidopsis thaliana putative dTDP-glucose 4-6-dehydratases
           (At3g46440) mRNA, complete cds
          Length = 1057

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 106 ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 165

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 166 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 216



to top

>gb|AY072098.1| Arabidopsis thaliana putative dTDP-glucose 4-6-dehydratase
           (At3g46440) mRNA, complete cds
          Length = 1356

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 231 ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 290

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 291 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 341



to top

>emb|BX823718.1|CNS0A7QP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS6ZC01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1114

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 55  ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 114

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 115 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 165



to top

>emb|BX824968.1|CNS0A6QT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH86ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1211

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| || || ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 130 ggagctggattcattggttctcaccttgttgataagctgatggaaaacgaaaagaatgag 189

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 190 gtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 240



to top

>gb|AY087118.1| Arabidopsis thaliana clone 31901 mRNA, complete sequence
          Length = 1281

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||| ||||| ||||| ||||  || || ||||| ||||| ||||| ||||| |||
Sbjct: 167 ggagctggattcattggctctcaccttgttgataagctgatggaaaacgaaaagaatgag 226

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           || ||||||||||| |||| |||||| |||||||| ||||| || ||||||
Sbjct: 227 gtgattgttgctgataactatttcaccggttcaaaggacaatctcaagaag 277



to top

>gb|BC034457.1| Mus musculus, clone IMAGE:3674229, mRNA
          Length = 1577

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 36/36 (100%)
 Strand = Plus / Minus

                                               
Query: 1   agggaacgtgagctgggttagaccgtcgtgagacag 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 452 agggaacgtgagctgggttagaccgtcgtgagacag 417



to top

>gb|BC020372.1| Mus musculus, clone IMAGE:3499050, mRNA
          Length = 1618

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 36/36 (100%)
 Strand = Plus / Minus

                                               
Query: 1   agggaacgtgagctgggttagaccgtcgtgagacag 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 492 agggaacgtgagctgggttagaccgtcgtgagacag 457



to top

>dbj|AK155129.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630203D16
           product:unclassifiable, full insert sequence
          Length = 5045

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 1   agggaacgtgagctgggttagaccgtcgtgagacag 36
           ||||||||||||||||||||||||||||||||||||
Sbjct: 733 agggaacgtgagctgggttagaccgtcgtgagacag 768



to top

>gb|AY619951.1| Nicotiana tabacum putative UDP-glucuronate decarboxylase 2 mRNA,
           complete cds
          Length = 1519

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 295 atggagaacgagaagaacgaggtcattgttgctgacaactttttcactggttcaaa 350
           |||||||| |||||||| ||||| |||||||  |||||||||||||||||||||||
Sbjct: 360 atggagaatgagaagaatgaggttattgttgtcgacaactttttcactggttcaaa 415



to top

>ref|NM_125319.2| Arabidopsis thaliana UXS3 (UDP-GLUCURONIC ACID DECARBOXYLASE);
           catalytic AT5G59290 (UXS3) mRNA, complete cds
          Length = 1459

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||||||||| || || |||   || || ||||| ||||| || |||||||| |||
Sbjct: 255 ggagctggcttcattggttctcacttggttgataagcttatggaaaatgagaagaatgag 314

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           ||  |||||||||| |||| ||||||||| |||||||| ||||| ||||||
Sbjct: 315 gtggttgttgctgataactatttcactggctcaaaagaaaacctcaagaag 365



to top

>emb|BX832416.1|CNS0A12Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH71ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1303

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||||||||| || || |||   || || ||||| ||||| || |||||||| |||
Sbjct: 181 ggagctggcttcattggttctcacttggttgataagcttatggaaaatgagaagaatgag 240

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           ||  |||||||||| |||| ||||||||| |||||||| ||||| ||||||
Sbjct: 241 gtggttgttgctgataactatttcactggctcaaaagaaaacctcaagaag 291



to top

>gb|AY088443.1| Arabidopsis thaliana clone 6701 mRNA, complete sequence
          Length = 1418

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||||||||| || || |||   || || ||||| ||||| || |||||||| |||
Sbjct: 255 ggagctggcttcattggttctcacttggttgataagcttatggaaaatgagaagaatgag 314

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           ||  |||||||||| |||| ||||||||| |||||||| ||||| ||||||
Sbjct: 315 gtggttgttgctgataactatttcactggctcaaaagaaaacctcaagaag 365



to top

>gb|AF387789.1| Arabidopsis thaliana UDP-glucuronic acid decarboxylase (UXS3) mRNA,
           complete cds
          Length = 1029

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 92/111 (82%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggagctggcttcatcggctcgcaccccgtcgacaagctcatggagaacgagaagaacgag 315
           |||||||||||||| || || |||   || || ||||| ||||| || |||||||| |||
Sbjct: 109 ggagctggcttcattggttctcacttggttgataagcttatggaaaatgagaagaatgag 168

                                                              
Query: 316 gtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
           ||  |||||||||| |||| ||||||||| |||||||| ||||| ||||||
Sbjct: 169 gtggttgttgctgataactatttcactggctcaaaagaaaacctcaagaag 219



to top

>gb|DQ283529.1| Rana japonica 28S ribosomal RNA gene, partial sequence
          Length = 709

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 1   agggaacgtgagctgggttagaccgtcgtgagac 34
           ||||||||||||||||||||||||||||||||||
Sbjct: 676 agggaacgtgagctgggttagaccgtcgtgagac 709



to top

>gb|DQ283504.1| Platymantis pelewensis 28S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 1   agggaacgtgagctgggttagaccgtcgtgagac 34
           ||||||||||||||||||||||||||||||||||
Sbjct: 680 agggaacgtgagctgggttagaccgtcgtgagac 713



to top

>emb|AL133298.1|ATF18L15 Arabidopsis thaliana DNA chromosome 3, BAC clone F18L15
          Length = 100328

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 314   aggtcattgttgctgacaactttttcactggttcaaaagacaacctgaagaag 366
             |||| ||||||||||| |||| ||||||||||||||| |||||||| ||||||
Sbjct: 76955 aggtgattgttgctgataactatttcactggttcaaaggacaaccttaagaag 76903



to top

>gb|AF355468.1|AF355468 Saccharopolyspora spinosa DTDP-glucose 4,6-dehydratase (gdh) and
           DTDP-4-dehydrorhamnose reductase (kre) genes, complete
           cds
          Length = 2311

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 235 atgcggatcctggtcaccggcggagctggcttcatcggctcgcac 279
           |||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 88  atgcggattctggtcaccggcggagccggtttcatcggctcgcac 132



to top

>gb|AY144409.1| Nemestrinus sp. SLW-2002 28S ribosomal RNA gene, partial sequence
          Length = 1689

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 1    agggaacgtgagctgggttagaccgtcgtgagacag 36
            |||||||||||||||| |||||||||||||||||||
Sbjct: 1256 agggaacgtgagctggtttagaccgtcgtgagacag 1291



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                              
Query: 234     catgcggatcctggtcaccggcggagctggcttcatcggctcgcacc 280
               |||||| || ||||| ||||||||||| |||||||||||||||||||
Sbjct: 2330208 catgcgcatactggttaccggcggagcgggcttcatcggctcgcacc 2330162



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Minus

                                               
Query: 6       acgtgagctgggtt-agaccgtcgtgagacag 36
               |||||||||||||| ||| |||||||||||||
Sbjct: 1568314 acgtgagctgggttcagaacgtcgtgagacag 1568283



to top

>gb|DQ283485.1| Phrynobatrachus auritus 28S ribosomal RNA gene, partial sequence
          Length = 707

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 1   agggaacgtgagctgggttagaccgtcgtgagac 34
           |||||||||||||||| |||||||||||||||||
Sbjct: 674 agggaacgtgagctggtttagaccgtcgtgagac 707



to top

>gb|M38363.1|SPYRRGQ S.marinus 23S rRNA gene, introns
          Length = 2158

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 37/38 (97%), Gaps = 1/38 (2%)
 Strand = Plus / Plus

                                                  
Query: 2    gggaacgtgagctgggtt-agaccgtcgtgagacagca 38
            |||||||||||||||||| |||||||||||||||||||
Sbjct: 1378 gggaacgtgagctgggtttagaccgtcgtgagacagca 1415



to top

>gb|M86623.1|SPYRGGA S.marinus 23S ribosomal RNA, partial cds
          Length = 2828

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 37/38 (97%), Gaps = 1/38 (2%)
 Strand = Plus / Plus

                                                  
Query: 2    gggaacgtgagctgggtt-agaccgtcgtgagacagca 38
            |||||||||||||||||| |||||||||||||||||||
Sbjct: 1378 gggaacgtgagctgggtttagaccgtcgtgagacagca 1415



to top

>gb|AY652587.1| Trichoplax sp. H8 28S ribosomal RNA gene, partial sequence
          Length = 3195

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3007 agggaacgtgagctgggtttagaccgtcgtgagacag 3043



to top

>gb|AY652586.1| Trichoplax sp. H7 28S ribosomal RNA gene, partial sequence
          Length = 3198

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3008 agggaacgtgagctgggtttagaccgtcgtgagacag 3044



to top

>gb|AY652585.1| Trichoplax sp. H4 28S ribosomal RNA gene, partial sequence
          Length = 3177

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3005 agggaacgtgagctgggtttagaccgtcgtgagacag 3041



to top

>gb|AY652584.1| Trichoplax sp. H2 28S ribosomal RNA gene, partial sequence
          Length = 3165

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2976 agggaacgtgagctgggtttagaccgtcgtgagacag 3012



to top

>gb|AY652583.1| Trichoplax sp. H1 28S ribosomal RNA gene, partial sequence
          Length = 3179

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2987 agggaacgtgagctgggtttagaccgtcgtgagacag 3023



to top

>gb|AF291874.1| Amblyomma americanum 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, internal transcribed
            spacer 2, and 28S ribosomal RNA gene, complete sequence
          Length = 10482

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 8262 agggaacgtgagctgggtttagaccgtcgtgagacag 8298



to top

>gb|AY839834.1| Phellinus igniarius strain ASI26002 25S ribosomal RNA gene, partial
            sequence
          Length = 3120

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2929 agggaacgtgagctgggtttagaccgtcgtgagacag 2965



to top

>gb|AY839833.1| Inonotus linteus 25S ribosomal RNA gene, partial sequence
          Length = 3550

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3359 agggaacgtgagctgggtttagaccgtcgtgagacag 3395



to top

>gb|AY839832.1| Inonotus linteus strain ASI26099 25S ribosomal RNA gene, partial
            sequence
          Length = 3555

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3364 agggaacgtgagctgggtttagaccgtcgtgagacag 3400



to top

>gb|AY839831.1| Inonotus linteus strain ASI26081 25S ribosomal RNA gene, partial
            sequence
          Length = 3562

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3367 agggaacgtgagctgggtttagaccgtcgtgagacag 3403



to top

>gb|AY603697.1| Trichoplax adhaerens 28S ribosomal RNA gene, partial sequence
          Length = 3152

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2967 agggaacgtgagctgggtttagaccgtcgtgagacag 3003



to top

>gb|AY822609.1| Prorocentrum micans large subunit ribosomal RNA gene, complete
            sequence
          Length = 3332

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2916 agggaacgtgagctgggtttagaccgtcgtgagacag 2952



to top

>gb|AY822610.1| Prorocentrum donghaiense large subunit ribosomal RNA gene, complete
            sequence
          Length = 3376

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2957 agggaacgtgagctgggtttagaccgtcgtgagacag 2993



to top

>gb|DQ266429.1| Metschnikowia sp. SUB 05-213.1 small subunit ribosomal RNA gene,
            partial sequence; internal transcribed spacer 1, 5.8S
            ribosomal RNA gene, internal transcribed spacer 2, and
            large subunit ribosomal RNA gene, complete sequence; and
            intergenic spacer, partial sequence
          Length = 4779

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4455 agggaacgtgagctgggtttagaccgtcgtgagacag 4491



to top

>gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            internal transcribed spacer 2, and 28S ribosomal RNA
            gene, complete sequence; and intergenic spacer and
            external transcribed spacer regions
          Length = 9015

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 6955 agggaacgtgagctgggtttagaccgtcgtgagacag 6991



to top

>gb|AY145423.1|AY145422S2 Vampyroteuthis infernalis 28S ribosomal RNA gene, partial sequence
          Length = 1722

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1545 agggaacgtgagctgggtttagaccgtcgtgagacag 1581



to top

>gb|AY145421.1| Solemya velum 28S ribosomal RNA gene, partial sequence
          Length = 3405

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3227 agggaacgtgagctgggtttagaccgtcgtgagacag 3263



to top

>gb|AY145419.1| Nuculana pernula 28S ribosomal RNA gene, partial sequence
          Length = 3382

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3187 agggaacgtgagctgggtttagaccgtcgtgagacag 3223



to top

>gb|AY145418.1| Nordotis discus 28S ribosomal RNA gene, partial sequence
          Length = 3430

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3229 agggaacgtgagctgggtttagaccgtcgtgagacag 3265



to top

>gb|AY145417.1| Nautilus pompilius 28S ribosomal RNA gene, partial sequence
          Length = 3389

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3190 agggaacgtgagctgggtttagaccgtcgtgagacag 3226



to top

>gb|AY145416.1|AY145415S2 Loligo pealei 28S ribosomal RNA gene, partial sequence
          Length = 1107

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 899 agggaacgtgagctgggtttagaccgtcgtgagacag 935



to top

>gb|AY145414.1| Leptochiton asellus 28S ribosomal RNA gene, partial sequence
          Length = 3383

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3188 agggaacgtgagctgggtttagaccgtcgtgagacag 3224



to top

>gb|AY145413.1| Lepetodrilus elevatus 28S ribosomal RNA gene, partial sequence
          Length = 3408

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3226 agggaacgtgagctgggtttagaccgtcgtgagacag 3262



to top

>gb|AY145412.1| Ischnochiton comptus 28S ribosomal RNA gene, partial sequence
          Length = 3402

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3207 agggaacgtgagctgggtttagaccgtcgtgagacag 3243



to top

>gb|AY145411.1| Ilyanassa obsoleta 28S ribosomal RNA gene, partial sequence
          Length = 3415

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3220 agggaacgtgagctgggtttagaccgtcgtgagacag 3256



to top

>gb|AY145410.1| Histioteuthis sp. YJP-2002 28S ribosomal RNA gene, partial sequence
          Length = 3604

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3409 agggaacgtgagctgggtttagaccgtcgtgagacag 3445



to top

>gb|AY145408.1| Haminoea solitaria 28S ribosomal RNA gene, partial sequence
          Length = 3417

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3222 agggaacgtgagctgggtttagaccgtcgtgagacag 3258



to top

>gb|AY145407.1| Graneledone pacifica 28S ribosomal RNA gene, partial sequence
          Length = 4773

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4461 agggaacgtgagctgggtttagaccgtcgtgagacag 4497



to top

>gb|AY145406.1| Gibbula magnus 28S ribosomal RNA gene, partial sequence
          Length = 3423

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3228 agggaacgtgagctgggtttagaccgtcgtgagacag 3264



to top

>gb|AY145404.1| Deroceras reticulatum 28S ribosomal RNA gene, partial sequence
          Length = 3478

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3280 agggaacgtgagctgggtttagaccgtcgtgagacag 3316



to top

>gb|AY145403.1| Dentalium octangulatum 28S ribosomal RNA gene, partial sequence
          Length = 3635

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3436 agggaacgtgagctgggtttagaccgtcgtgagacag 3472



to top

>gb|AY145402.1| Cryptoplax japonica 28S ribosomal RNA gene, partial sequence
          Length = 3387

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3195 agggaacgtgagctgggtttagaccgtcgtgagacag 3231



to top

>gb|AY145401.1| Antalis entalis 28S ribosomal RNA gene, partial sequence
          Length = 2992

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2802 agggaacgtgagctgggtttagaccgtcgtgagacag 2838



to top

>gb|AY145400.1| Crassostrea virginica 28S ribosomal RNA gene, partial sequence
          Length = 3466

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3269 agggaacgtgagctgggtttagaccgtcgtgagacag 3305



to top

>gb|AY145399.1| Chaetopterus variopedatus 28S ribosomal RNA gene, partial sequence
          Length = 3357

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3162 agggaacgtgagctgggtttagaccgtcgtgagacag 3198



to top

>gb|AY145398.1| Chaetopleura apiculata 28S ribosomal RNA gene, partial sequence
          Length = 3410

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3215 agggaacgtgagctgggtttagaccgtcgtgagacag 3251



to top

>gb|AY145396.1| Cerebratulus lacteus 28S ribosomal RNA gene, partial sequence
          Length = 3415

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3220 agggaacgtgagctgggtttagaccgtcgtgagacag 3256



to top

>gb|AY145395.1| Boonea seminuda 28S ribosomal RNA gene, partial sequence
          Length = 3414

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3219 agggaacgtgagctgggtttagaccgtcgtgagacag 3255



to top

>gb|AY145394.1|AY145393S2 Benthoctopus yaquinae 28S ribosomal RNA gene, partial sequence
          Length = 1191

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 879 agggaacgtgagctgggtttagaccgtcgtgagacag 915



to top

>gb|AY145392.1| Arion silvaticus 28S ribosomal RNA gene, partial sequence
          Length = 3454

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3259 agggaacgtgagctgggtttagaccgtcgtgagacag 3295



to top

>gb|AY145391.1| Argopecten irradians 28S ribosomal RNA gene, partial sequence
          Length = 3403

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3210 agggaacgtgagctgggtttagaccgtcgtgagacag 3246



to top

>gb|AY145390.1| Arctica islandica 28S ribosomal RNA gene, partial sequence
          Length = 3429

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3233 agggaacgtgagctgggtttagaccgtcgtgagacag 3269



to top

>gb|AY145389.1| Abraliopsis sp. YJP-2002 28S ribosomal RNA gene, partial sequence
          Length = 4328

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4120 agggaacgtgagctgggtttagaccgtcgtgagacag 4156



to top

>gb|AY145388.1| Antalis entalis 28S ribosomal RNA gene, partial sequence
          Length = 3647

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3461 agggaacgtgagctgggtttagaccgtcgtgagacag 3497



to top

>gb|DQ202352.1| Oxyethira rossi 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3869

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3446 agggaacgtgagctgggtttagaccgtcgtgagacag 3482



to top

>gb|DQ202351.1| Merope tuber 28S large subunit ribosomal RNA gene, partial sequence
          Length = 3736

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3334 agggaacgtgagctgggtttagaccgtcgtgagacag 3370



to top

>gb|AC159424.1| Trypanosoma brucei chromosome 6 clone RPCI93-26F19, complete sequence
          Length = 101897

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 1     agggaacgtgagctggg-ttagaccgtcgtgagacag 36
             ||||||||||||||||| |||||||||||||||||||
Sbjct: 50983 agggaacgtgagctgggtttagaccgtcgtgagacag 50947



to top

>gb|AC159415.1| Trypanosoma brucei chromosome 7 clone RPCI93-25D22, complete sequence
          Length = 62014

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 58827 agggaacgtgagctgggtttagaccgtcgtgagacag 58863



to top

>gb|AC159414.1| Trypanosoma brucei chromosome 3 clone RPCI93-25B21, complete sequence
          Length = 145863

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 119924 agggaacgtgagctgggtttagaccgtcgtgagacag 119888



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 101562 agggaacgtgagctgggtttagaccgtcgtgagacag 101526



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 1     agggaacgtgagctggg-ttagaccgtcgtgagacag 36
             ||||||||||||||||| |||||||||||||||||||
Sbjct: 83207 agggaacgtgagctgggtttagaccgtcgtgagacag 83171



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 1     agggaacgtgagctggg-ttagaccgtcgtgagacag 36
             ||||||||||||||||| |||||||||||||||||||
Sbjct: 64833 agggaacgtgagctgggtttagaccgtcgtgagacag 64797



to top

>gb|AC159412.1| Trypanosoma brucei chromosome 7 clone RPCI93-21H15, complete sequence
          Length = 159636

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 148372 agggaacgtgagctgggtttagaccgtcgtgagacag 148336



to top

>gb|AY732227.1| Serpula vermicularis 28S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3138 agggaacgtgagctgggtttagaccgtcgtgagacag 3174



to top

>gb|AY732226.1| Sabellaria cementarium 28S ribosomal RNA gene, partial sequence
          Length = 3292

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3103 agggaacgtgagctgggtttagaccgtcgtgagacag 3139



to top

>gb|AY732225.1| Schizobranchia insignis 28S ribosomal RNA gene, partial sequence
          Length = 3310

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3121 agggaacgtgagctgggtttagaccgtcgtgagacag 3157



to top

>gb|AC012647.18| Trypanosoma brucei chromosome 2 clone RPCI93-27H14, complete sequence
          Length = 118437

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 90044 agggaacgtgagctgggtttagaccgtcgtgagacag 90080



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 71705 agggaacgtgagctgggtttagaccgtcgtgagacag 71741



to top

>gb|AC008031.6| Trypanosoma brucei chromosome 2 clone RPCI93-25N14, complete sequence
          Length = 151499

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 121689 agggaacgtgagctgggtttagaccgtcgtgagacag 121653



to top

>gb|DQ002502.1| Tetraplatia volitans 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3276

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3081 agggaacgtgagctgggtttagaccgtcgtgagacag 3117



to top

>gb|AY616164.1| Besnoitia tarandi large subunit ribosomal RNA gene, partial sequence
          Length = 3153

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2979 agggaacgtgagctgggtttagaccgtcgtgagacag 3015



to top

>gb|AE014843.1| Plasmodium falciparum 3D7 chromosome 11 section 8 of 8 of the complete
              sequence
          Length = 271546

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 165787 agggaacgtgagctgggtttagaccgtcgtgagacag 165823



to top

>gb|BT016244.1| Zea mays clone Contig77 mRNA sequence
          Length = 1121

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 640 agggaacgtgagctgggtttagaccgtcgtgagacag 676



to top

>gb|AY440168.1| Armigeres subalbatus ASAP ID: 43995 questionable:
           senescence-associated protein mRNA sequence
          Length = 366

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 276 agggaacgtgagctgggtttagaccgtcgtgagacag 312



to top

>gb|AY433294.1| Aedes aegypti ASAP ID: 42873 conserved unknown mRNA sequence
          Length = 630

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 343 agggaacgtgagctgggkttagaccgtcgtgagacag 379



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1059445 agggaacgtgagctgggtttagaccgtcgtgagacag 1059481



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1048315 agggaacgtgagctgggtttagaccgtcgtgagacag 1048351



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1035300 agggaacgtgagctgggtttagaccgtcgtgagacag 1035336



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1020667 agggaacgtgagctgggtttagaccgtcgtgagacag 1020703



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1008634 agggaacgtgagctgggtttagaccgtcgtgagacag 1008670



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 996731 agggaacgtgagctgggtttagaccgtcgtgagacag 996767



to top

>gb|AF115465.1| Leishmania donovani 28S ribosomal RNA subunit beta gene, partial
           sequence; 28S ribosomal RNA subunits delta, zeta, and
           epsilon genes, complete sequence
          Length = 2389

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 244 agggaacgtgagctgggtttagaccgtcgtgagacag 280



to top

>gb|AF345632.1| Leishmania hoogstraali large subunit 24S beta ribosomal RNA gene
           and ribosomal intergenic spacer region, partial sequence
          Length = 2745

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 244 agggaacgtgagctgggtttagaccgtcgtgagacag 280



to top

>gb|AY260899.1| Cyprinus carpio 28S ribosomal RNA gene, partial sequence and 3'
          external transcribed spacer, complete sequence
          Length = 1999

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                               
Query: 1  agggaacgtgagctgggtt-agaccgtcgtgagacag 36
          ||||||||||||||||||| |||||||||||||||||
Sbjct: 24 agggaacgtgagctgggtttagaccgtcgtgagacag 60



to top

>gb|AF356652.1| Filobasidiella neoformans var. neoformans 5S ribosomal RNA, 17S
            ribosomal RNA genes, internal transcribed spacer 1, 5.8S
            ribosomal RNA gene, internal transcribed spacer 2, and
            25S ribosomal RNA gene, complete sequence
          Length = 8275

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 7830 agggaacgtgagctgggtttagaccgtcgtgagacag 7866



to top

>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence
          Length = 2205233

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                    
Query: 1       agggaacgtgagctgggtt-agaccgtcgtgagacag 36
               ||||||||||||||||||| |||||||||||||||||
Sbjct: 1958226 agggaacgtgagctgggtttagaccgtcgtgagacag 1958262



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 1     agggaacgtgagctggg-ttagaccgtcgtgagacag 36
             ||||||||||||||||| |||||||||||||||||||
Sbjct: 50983 agggaacgtgagctgggtttagaccgtcgtgagacag 50947



to top

>gb|CP000066.1| Trypanosoma brucei chromosome 3, complete sequence
          Length = 1653225

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 964999 agggaacgtgagctgggtttagaccgtcgtgagacag 965035



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 946625 agggaacgtgagctgggtttagaccgtcgtgagacag 946661



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 928270 agggaacgtgagctgggtttagaccgtcgtgagacag 928306



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 909908 agggaacgtgagctgggtttagaccgtcgtgagacag 909944



to top

>gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence
          Length = 1193948

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctgggtt-agaccgtcgtgagacag 36
              ||||||||||||||||||| |||||||||||||||||
Sbjct: 377008 agggaacgtgagctgggtttagaccgtcgtgagacag 377044



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 279837 agggaacgtgagctgggtttagaccgtcgtgagacag 279801



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 261498 agggaacgtgagctgggtttagaccgtcgtgagacag 261462



to top

>gb|AF184038.1| Drosophila stonei 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1708

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1208 agggaacgtgagctgggtttagaccgtcgtgagacag 1244



to top

>gb|AF184037.1| Drosophila pseudoobscura 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 1703

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1201 agggaacgtgagctgggtttagaccgtcgtgagacag 1237



to top

>gb|AF184036.1| Drosophila novamexicana 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184033.1| Drosophila pachea 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1698

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AF184032.1| Drosophila canalinea 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1700

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AF184031.1| Drosophila mercatorum 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184030.1| Drosophila hexastigma 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1700

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AF184029.1| Drosophila buzzatii 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1702

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1200 agggaacgtgagctgggtttagaccgtcgtgagacag 1236



to top

>gb|AF184027.1| Drosophila immigrans 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184026.1| Drosophila tripunctata 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184025.1| Drosophila cardini 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184023.1| Drosophila guttifera 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1700

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AF184022.1| Drosophila quinaria 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184021.1| Drosophila putrida 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1702

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184020.1| Drosophila orientacea 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1702

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184019.1| Drosophila neotestacea 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF184018.1| Drosophila testacea 28S large subunit ribosomal RNA gene, partial
            sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF183984.1| Drosophila aracataca 28S ribosomal RNA gene, partial sequence
          Length = 1699

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1197 agggaacgtgagctgggtttagaccgtcgtgagacag 1233



to top

>gb|AF183983.1| Drosophila lacertosa 28S ribosomal RNA gene, partial sequence
          Length = 1701

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1199 agggaacgtgagctgggtttagaccgtcgtgagacag 1235



to top

>gb|AF183982.1| Drosophila wassermani 28S ribosomal RNA gene, partial sequence
          Length = 1697

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AF183981.1| Drosophila acanthoptera 28S ribosomal RNA gene, partial sequence
          Length = 1698

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1198 agggaacgtgagctgggtttagaccgtcgtgagacag 1234



to top

>gb|AY546686.1| Polychytrium aggregatum isolate AFTOL-ID 24 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 3188

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3014 agggaacgtgagctgggtttagaccgtcgtgagacag 3050



to top

>gb|AY546687.1| Monoblepharella sp. M15 isolate AFTOL-ID 25 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 3156

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3034 agggaacgtgagctgggtttagaccgtcgtgagacag 3070



to top

>gb|AY546688.1| Cladochytrium replicatum isolate AFTOL-ID 27 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 3068

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2982 agggaacgtgagctgggtttagaccgtcgtgagacag 3018



to top

>gb|AY546689.1| Coemansia reversa isolate AFTOL-ID 140 28S large subunit ribosomal
            RNA gene, partial sequence
          Length = 4657

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4495 agggaacgtgagctgggtttagaccgtcgtgagacag 4531



to top

>gb|AY546690.1| Piptocephalis corymbifera isolate AFTOL-ID 145 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 3270

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3104 agggaacgtgagctgggtttagaccgtcgtgagacag 3140



to top

>gb|AY546691.1| Conidiobolus coronatus isolate AFTOL-ID 137 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 3042

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2888 agggaacgtgagctgggtttagaccgtcgtgagacag 2924



to top

>gb|AY546693.1| Batrachochytrium dendrobatidis isolate AFTOL-ID 21 28S large subunit
            ribosomal RNA gene, partial sequence
          Length = 2943

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2822 agggaacgtgagctgggtttagaccgtcgtgagacag 2858



to top

>gb|AY552525.1| Allomyces arbuscula isolate AFTOL-ID 300 28S large subunit ribosomal
            RNA gene, partial sequence
          Length = 3134

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3003 agggaacgtgagctgggtttagaccgtcgtgagacag 3039



to top

>gb|AY248755.1| Mus musculus 28S ribosomal RNA-like mRNA, partial sequence
          Length = 671

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 66  agggaacgtgagctgggattagaccgtcgtgagacag 102



to top

>gb|AC133464.11| Mus musculus chromosome 16, clone RP24-459O21, complete sequence
          Length = 142742

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 45852 agggaacgtgagctgggtttagaccgtcgtgagacag 45888



to top

>gb|AY643504.1| Philasterides dicentrarchi 26S ribosomal RNA gene, partial sequence
          Length = 582

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 337 agggaacgtgagctgggtttagaccgtcgtgagacag 301



to top

>gb|AY580057.1| Xiphinema brevicollum 28S ribosomal RNA gene, 28S-18S intergenic
            spacer, 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, and internal
            transcribed spacer 2, complete sequence
          Length = 7878

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3278 agggaacgtgagctgggtttagaccgtcgtgagacag 3314



to top

>gb|AY580056.1| Xiphinema americanum 28S ribosomal RNA gene, 28S-18S intergenic
            spacer, 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, and internal
            transcribed spacer 2, complete sequence
          Length = 8796

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3275 agggaacgtgagctgggtttagaccgtcgtgagacag 3311



to top

>gb|AY580055.1| Longidorus macrosoma 28S ribosomal RNA gene, 28S-18S intergenic
            spacer, 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, and internal
            transcribed spacer 2, complete sequence
          Length = 9503

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3312 agggaacgtgagctgggtttagaccgtcgtgagacag 3348



to top

>gb|AY604482.1| Caenorhabditis sp. PS1010 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3383

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2940 agggaacgtgagctgggtttagaccgtcgtgagacag 2976



to top

>gb|AY604481.1| Caenorhabditis briggsae strain PB800 28S large subunit ribosomal RNA
            gene, partial sequence
          Length = 3385

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2943 agggaacgtgagctgggtttagaccgtcgtgagacag 2979



to top

>gb|AY602176.1| Oscheius myriophila strain DF5020 28S large subunit ribosomal RNA
            gene, partial sequence
          Length = 3370

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2927 agggaacgtgagctgggtttagaccgtcgtgagacag 2963



to top

>gb|AY602175.1| Caenorhabditis sp. CB5161 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3393

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2951 agggaacgtgagctgggtttagaccgtcgtgagacag 2987



to top

>gb|AY602174.1| Caenorhabditis remanei strain EM464 28S large subunit ribosomal RNA
            gene, partial sequence
          Length = 3384

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2942 agggaacgtgagctgggtttagaccgtcgtgagacag 2978



to top

>gb|AY602173.1| Caenorhabditis japonica strain SB339 28S large subunit ribosomal RNA
            gene, partial sequence
          Length = 3396

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2954 agggaacgtgagctgggtttagaccgtcgtgagacag 2990



to top

>gb|AY602172.1| Caenorhabditis drosophilae strain DF5077 28S large subunit ribosomal
            RNA gene, partial sequence
          Length = 3400

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2956 agggaacgtgagctgggtttagaccgtcgtgagacag 2992



to top

>gb|AY602171.1| Caenorhabditis sp. DF5070 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3397

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2957 agggaacgtgagctgggtttagaccgtcgtgagacag 2993



to top

>gb|AY602170.1| Caenorhabditis sp. SB341 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3401

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2956 agggaacgtgagctgggtttagaccgtcgtgagacag 2992



to top

>gb|AY602169.1| Prodontorhabditis wirthi strain DF5074 28S large subunit ribosomal
            RNA gene, partial sequence
          Length = 3387

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2948 agggaacgtgagctgggtttagaccgtcgtgagacag 2984



to top

>gb|AY602168.1| Protorhabditis sp. DF5055 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3355

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2915 agggaacgtgagctgggtttagaccgtcgtgagacag 2951



to top

>gb|AY602167.1| Caenorhabditis plicata strain SB355 28S large subunit ribosomal RNA
            gene, partial sequence
          Length = 3393

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2949 agggaacgtgagctgggtttagaccgtcgtgagacag 2985



to top

>gb|DQ493955.1| Magnaporthe grisea 70-15 clone 61J04 telomere region, partial sequence
          Length = 34460

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 32147 agggaacgtgagctgggtttagaccgtcgtgagacag 32183



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 23819 agggaacgtgagctgggtttagaccgtcgtgagacag 23855



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                  
Query: 1     agggaacgtgagctgggtt-agaccgtcgtgagacag 36
             ||||||||||||||||||| |||||||||||||||||
Sbjct: 15493 agggaacgtgagctgggtttagaccgtcgtgagacag 15529



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1497 agggaacgtgagctgggtttagaccgtcgtgagacag 1533



to top

>gb|AY859618.1| Zelanion antipodus 28S ribosomal RNA gene, partial sequence
          Length = 883

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 544 agggaacgtgagctgggtttagaccgtcgtgagacag 580



to top

>gb|AY859614.1| Zootermopsis angusticollis internal transcribed spacer 1, partial
            sequence; 5.8S ribosomal RNA gene and internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4954

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4459 agggaacgtgagctgggtttagaccgtcgtgagacag 4495



to top

>gb|AY859612.1| Vespula pensylvanica internal transcribed spacer 2 and 28S ribosomal
            RNA gene, partial sequence
          Length = 4325

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3851 agggaacgtgagctgggtttagaccgtcgtgagacag 3887



to top

>gb|AY859609.1| Triacanthella sp. JM-2004 28S ribosomal RNA gene, partial sequence
          Length = 3823

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3338 agggaacgtgagctgggtttagaccgtcgtgagacag 3374



to top

>gb|AY859607.1| Sphaerotheriidae sp. JM-2004 28S ribosomal RNA gene, partial
           sequence
          Length = 486

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 312 agggaacgtgagctgggtttagaccgtcgtgagacag 348



to top

>gb|AY859603.1| Sminthurus viridis internal transcribed spacer 1, partial sequence;
            5.8S ribosomal RNA gene and internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 4605

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4117 agggaacgtgagctgggtttagaccgtcgtgagacag 4153



to top

>gb|AY859602.1| Siro rubens internal transcribed spacer 1, partial sequence; 5.8S
            ribosomal RNA gene and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 4435

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3991 agggaacgtgagctgggtttagaccgtcgtgagacag 4027



to top

>gb|AY859601.1| Scutigera coleoptrata 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4492

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4025 agggaacgtgagctgggtttagaccgtcgtgagacag 4061



to top

>gb|AY859599.1| Sacculinidae sp. JM-2004 internal transcribed spacer 2 and 28S
            ribosomal RNA gene, partial sequence
          Length = 3752

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3578 agggaacgtgagctgggtttagaccgtcgtgagacag 3614



to top

>gb|AY859597.1| Pycnophyes sp. Tjarno 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 3714

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3540 agggaacgtgagctgggtttagaccgtcgtgagacag 3576



to top

>gb|AY859595.1| Polyxenidae sp. JM-2004 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4298

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3837 agggaacgtgagctgggtttagaccgtcgtgagacag 3873



to top

>gb|AY859594.1| Paraphrynus sp. JM-2004 28S ribosomal RNA gene, partial sequence
          Length = 3785

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3325 agggaacgtgagctgggtttagaccgtcgtgagacag 3361



to top

>gb|AY859593.1| Parajapyx emeryanus 28S ribosomal RNA gene, partial sequence
          Length = 1470

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 1298 agggaacgtgagctgggtttagaccgtcgtgagacag 1334



to top

>gb|AY859588.1| Megabalanus californicus internal transcribed spacer 2 and 28S
            ribosomal RNA gene, partial sequence
          Length = 4036

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3617 agggaacgtgagctgggtttagaccgtcgtgagacag 3653



to top

>gb|AY859587.1| Mastigoproctus giganteus 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4103

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3649 agggaacgtgagctgggtttagaccgtcgtgagacag 3685



to top

>gb|AY859585.1| Mantis religiosa internal transcribed spacer 1, partial sequence;
            5.8S ribosomal RNA gene and internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 4723

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4244 agggaacgtgagctgggtttagaccgtcgtgagacag 4280



to top

>gb|AY859583.1| Leucorrhinia sp. JM-2004 internal transcribed spacer 1, partial
            sequence; 5.8S ribosomal RNA gene and internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4611

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4123 agggaacgtgagctgggtttagaccgtcgtgagacag 4159



to top

>gb|AY859582.1| Dermacentor sp. JM-2004 internal transcribed spacer 2 and 28S
            ribosomal RNA gene, partial sequence
          Length = 4456

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3995 agggaacgtgagctgggtttagaccgtcgtgagacag 4031



to top

>gb|AY859581.1| Homarus americanus internal transcribed spacer 2 and 28S ribosomal
            RNA gene, partial sequence
          Length = 4671

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4220 agggaacgtgagctgggtttagaccgtcgtgagacag 4256



to top

>gb|AY859574.1| Eulimnadia texana internal transcribed spacer 1, partial sequence;
            5.8S ribosomal RNA gene and internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 4355

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3903 agggaacgtgagctgggtttagaccgtcgtgagacag 3939



to top

>gb|AY859572.1| Eremobates sp. JM-2004 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4268

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3796 agggaacgtgagctgggtttagaccgtcgtgagacag 3832



to top

>gb|AY859569.1| Craterostigmus tasmanianus internal transcribed spacer 2 and 28S
            ribosomal RNA gene, partial sequence
          Length = 4384

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3930 agggaacgtgagctgggtttagaccgtcgtgagacag 3966



to top

>gb|AY859562.1| Cherokia georgiana 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 5155

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4639 agggaacgtgagctgggtttagaccgtcgtgagacag 4675



to top

>gb|AY859560.1| Campodeidae sp. JM-2004 internal transcribed spacer 2 and 28S
            ribosomal RNA gene, partial sequence
          Length = 3747

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3575 agggaacgtgagctgggtttagaccgtcgtgagacag 3611



to top

>gb|AY859557.1| Callibaetis ferrugineus internal transcribed spacer 1, partial
            sequence; 5.8S ribosomal RNA gene and internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4570

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4092 agggaacgtgagctgggtttagaccgtcgtgagacag 4128



to top

>gb|AY859556.1| Baculentulus tianmushanensis 28S ribosomal RNA gene, partial sequence
          Length = 2402

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2181 agggaacgtgagctgggtttagaccgtcgtgagacag 2217



to top

>gb|AY859550.1| Anoplodactylus portus 5.8S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4205

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3765 agggaacgtgagctgggtttagaccgtcgtgagacag 3801



to top

>gb|AY859549.1| Anaspides tasmaniae internal transcribed spacer 2 and 28S ribosomal
            RNA gene, partial sequence
          Length = 3997

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3555 agggaacgtgagctgggtttagaccgtcgtgagacag 3591



to top

>gb|AY859546.1| Gomphocerinae sp. JM-2004 internal transcribed spacer 1, partial
            sequence; 5.8S ribosomal RNA gene and internal
            transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 4990

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4503 agggaacgtgagctgggtttagaccgtcgtgagacag 4539



to top

>gb|AY859544.1| Acheta domesticus internal transcribed spacer 2 and 28S ribosomal RNA
            gene, partial sequence
          Length = 4372

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 4198 agggaacgtgagctgggtttagaccgtcgtgagacag 4234



to top

>gb|AY225102.1| Pseudopleuronectes americanus 28S ribosomal RNA gene, partial
           sequence
          Length = 399

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 311 agggaacgtgagctgggtttagaccgtcgtgagacag 347



to top

>gb|AY750699.1| Oligonychus coffeae 28S ribosomal RNA gene, partial sequence
          Length = 2857

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2669 agggaacgtgagctgggtttagaccgtcgtgagacag 2705



to top

>gb|AY750698.1| Panonychus ulmi 28S ribosomal RNA gene, partial sequence
          Length = 2890

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2701 agggaacgtgagctgggtttagaccgtcgtgagacag 2737



to top

>gb|AY750697.1| Panonychus citri 28S ribosomal RNA gene, partial sequence
          Length = 2905

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2716 agggaacgtgagctgggtttagaccgtcgtgagacag 2752



to top

>gb|AY750696.1| Petrobia harti 28S ribosomal RNA gene, partial sequence
          Length = 2904

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2715 agggaacgtgagctgggtttagaccgtcgtgagacag 2751



to top

>gb|AY750695.1| Tetranychus hydrangeae 28S ribosomal RNA gene, partial sequence
          Length = 2800

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2611 agggaacgtgagctgggtttagaccgtcgtgagacag 2647



to top

>gb|AY750694.1| Tetranychus piercei 28S ribosomal RNA gene, partial sequence
          Length = 2840

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2651 agggaacgtgagctgggtttagaccgtcgtgagacag 2687



to top

>gb|AY750693.1| Tetranychus urticae 28S ribosomal RNA gene, partial sequence
          Length = 2826

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2637 agggaacgtgagctgggtttagaccgtcgtgagacag 2673



to top

>gb|AY750692.1| Tetranychus truncatus 28S ribosomal RNA gene, partial sequence
          Length = 2838

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2649 agggaacgtgagctgggtttagaccgtcgtgagacag 2685



to top

>gb|AY750691.1| Tetranychus kanzawai 28S ribosomal RNA gene, partial sequence
          Length = 2839

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2650 agggaacgtgagctgggtttagaccgtcgtgagacag 2686



to top

>gb|DQ485344.1| Arachis hypogaea 25S ribosomal RNA gene, partial sequence
          Length = 464

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                               
Query: 1  agggaacgtgagctgggtt-agaccgtcgtgagacag 36
          ||||||||||||||||||| |||||||||||||||||
Sbjct: 36 agggaacgtgagctgggtttagaccgtcgtgagacag 72



to top

>gb|DQ226907.1| Boechera divaricarpa isolate SLW-D-B12 mRNA sequence
          Length = 293

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 207 agggaacgtgagctggggttagaccgtcgtgagacag 243



to top

>gb|AC125254.9| Mus musculus chromosome 9, clone RP24-156I15, complete sequence
          Length = 161503

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 107696 agggaacgtgagctgggattagaccgtcgtgagacag 107732



to top

>gb|AY267553.1| Therevid NCSU-0300013 28S ribosomal RNA gene, partial sequence
          Length = 1176

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 444 agggaacgtgagctgggtttagaccgtcgtgagacag 408



to top

>gb|AY267552.1| Hemigephyra sp. MEI124388 28S ribosomal RNA gene, partial sequence
          Length = 1135

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                
Query: 1   agggaacgtgagctggg-ttagaccgtcgtgagacag 36
           ||||||||||||||||| |||||||||||||||||||
Sbjct: 427 agggaacgtgagctgggtttagaccgtcgtgagacag 391



to top

>gb|AY267551.1| Therevid NCSU-0300008 28S ribosomal RNA gene, partial sequence
          Length = 1173

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 742 agggaacgtgagctgggtttagaccgtcgtgagacag 778



to top

>gb|AY267550.1| Actenomeros sp. NCSU-0300002 28S ribosomal RNA gene, partial
           sequence
          Length = 1040

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 708 agggaacgtgagctgggtttagaccgtcgtgagacag 744



to top

>gb|DQ158858.1| Bigelowiella natans nucleomorph chromosome 3, partial sequence
          Length = 98136

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                  
Query: 1     agggaacgtgagctggg-ttagaccgtcgtgagacag 36
             ||||||||||||||||| |||||||||||||||||||
Sbjct: 91229 agggaacgtgagctgggtttagaccgtcgtgagacag 91193



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 6908 agggaacgtgagctgggtttagaccgtcgtgagacag 6944



to top

>gb|DQ158857.1| Bigelowiella natans nucleomorph chromosome 2, partial sequence
          Length = 134144

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 127234 agggaacgtgagctgggtttagaccgtcgtgagacag 127198



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 6910 agggaacgtgagctgggtttagaccgtcgtgagacag 6946



to top

>gb|DQ158856.1| Bigelowiella natans nucleomorph chromosome 1, partial sequence
          Length = 140590

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                   
Query: 1      agggaacgtgagctggg-ttagaccgtcgtgagacag 36
              ||||||||||||||||| |||||||||||||||||||
Sbjct: 133680 agggaacgtgagctgggtttagaccgtcgtgagacag 133644



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 6910 agggaacgtgagctgggtttagaccgtcgtgagacag 6946



to top

>gb|AY305327.1| Perkinsus andrewsi large subunit ribosomal RNA and 5S ribosomal RNA
            genes, complete sequence
          Length = 3773

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 3069 agggaacgtgagctgggtttagaccgtcgtgagacag 3105



to top

>gb|AY305326.1| Perkinsus andrewsi 5S ribosomal RNA, small subunit ribosomal RNA
            genes, internal transcribed spacer 1, 5.8S ribosomal RNA
            gene, internal transcribed spacer 2, and large subunit
            ribosomal RNA gene, complete sequence
          Length = 7714

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 7146 agggaacgtgagctgggtttagaccgtcgtgagacag 7182



to top

>gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2906 agggaacgtgagctgggtttagaccgtcgtgagacag 2942



to top

>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                 
Query: 1    agggaacgtgagctgggtt-agaccgtcgtgagacag 36
            ||||||||||||||||||| |||||||||||||||||
Sbjct: 2906 agggaacgtgagctgggtttagaccgtcgtgagacag 2942



to top

>gb|DQ168804.1| Nemotelus sp. CB0506 28S ribosomal RNA gene, partial sequence
          Length = 2523

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168802.1| Chloromyia formosa voucher CB0502 28S ribosomal RNA gene, partial
           sequence
          Length = 2524

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168800.1| Beridops sp. CB0437 28S ribosomal RNA gene, partial sequence
          Length = 2468

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168799.1| Chordonota sp. CB0436 28S ribosomal RNA gene, partial sequence
          Length = 2490

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168798.1| Auloceromyia sp. CB0435 28S ribosomal RNA gene, partial sequence
          Length = 2526

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168797.1| Solva sp. CB0434 28S ribosomal RNA gene, partial sequence
          Length = 2533

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 688 agggaacgtgagctgggtttagaccgtcgtgagacag 724



to top

>gb|DQ168795.1| Parhadrestia atava voucher CB0432 28S ribosomal RNA gene, partial
           sequence
          Length = 2435

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 672 agggaacgtgagctgggtttagaccgtcgtgagacag 708



to top

>gb|DQ168794.1| Nemotelus sp. CB0430 28S ribosomal RNA gene, partial sequence
          Length = 2545

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 675 agggaacgtgagctgggtttagaccgtcgtgagacag 711



to top

>gb|DQ168793.1| Euparyphus sp. CB0429 28S ribosomal RNA gene, partial sequence
          Length = 2479

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168792.1| Adoxomyia regularis voucher CB0428 28S ribosomal RNA gene, partial
           sequence
          Length = 2483

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 666 agggaacgtgagctgggtttagaccgtcgtgagacag 702



to top

>gb|DQ168791.1| Cf. Euryneura sp. CB0427 28S ribosomal RNA gene, partial sequence
          Length = 2541

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 689 agggaacgtgagctgggtttagaccgtcgtgagacag 725



to top

>gb|DQ168790.1| Cyphomyia erecta voucher CB0426 28S ribosomal RNA gene, partial
           sequence
          Length = 2511

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 679 agggaacgtgagctgggtttagaccgtcgtgagacag 715



to top

>gb|DQ168789.1| Neoberis brasiliana voucher CB0424 28S ribosomal RNA gene, partial
           sequence
          Length = 2406

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168788.1| Hermetia melanderi voucher CB0423 28S ribosomal RNA gene, partial
           sequence
          Length = 2415

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 668 agggaacgtgagctgggtttagaccgtcgtgagacag 704



to top

>gb|DQ168787.1| Euryneura propinqua voucher CB0422 28S ribosomal RNA gene, partial
           sequence
          Length = 2536

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 688 agggaacgtgagctgggtttagaccgtcgtgagacag 724



to top

>gb|DQ168786.1| Nigritomyia loewii voucher CB0421 28S ribosomal RNA gene, partial
           sequence
          Length = 2466

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 690 agggaacgtgagctgggtttagaccgtcgtgagacag 726



to top

>gb|DQ168785.1| Adoxomyia sp. CB0419 28S ribosomal RNA gene, partial sequence
          Length = 2458

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 690 agggaacgtgagctgggtttagaccgtcgtgagacag 726



to top

>gb|DQ168784.1| Octarthria sp. CB0415 28S ribosomal RNA gene, partial sequence
          Length = 2040

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 691 agggaacgtgagctgggtttagaccgtcgtgagacag 727



to top

>gb|DQ168783.1| Lecomyia sp. CB0413 28S ribosomal RNA gene, partial sequence
          Length = 2472

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 635 agggaacgtgagctgggtttagaccgtcgtgagacag 671



to top

>gb|DQ168782.1| Octarthria flavpalpis voucher CB0412 28S ribosomal RNA gene,
           partial sequence
          Length = 2033

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 682 agggaacgtgagctgggtttagaccgtcgtgagacag 718



to top

>gb|DQ168781.1| Chrysochlorina sp. CB0410 28S ribosomal RNA gene, partial sequence
          Length = 2468

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168780.1| Ptecticus sp. CB0409 28S ribosomal RNA gene, partial sequence
          Length = 2524

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 674 agggaacgtgagctgggtttagaccgtcgtgagacag 710



to top

>gb|DQ168779.1| Cyanauges ruficornis voucher CB0407 28S ribosomal RNA gene, partial
           sequence
          Length = 2492

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 712 agggaacgtgagctgggtttagaccgtcgtgagacag 748



to top

>gb|DQ168778.1| Raphiocera ornata voucher CB0406 28S ribosomal RNA gene, partial
           sequence
          Length = 2035

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168777.1| Clitellaria ephippium voucher CB0405 28S ribosomal RNA gene,
           partial sequence
          Length = 2041

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 689 agggaacgtgagctgggtttagaccgtcgtgagacag 725



to top

>gb|DQ168776.1| Nigritomyia consobrina voucher CB0404 28S ribosomal RNA gene,
           partial sequence
          Length = 2022

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 690 agggaacgtgagctgggtttagaccgtcgtgagacag 726



to top

>gb|DQ168775.1| Lagenosoma sp. CB0403 28S ribosomal RNA gene, partial sequence
          Length = 2473

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168774.1| Alopecuroceras coloratum voucher CB0402 28S ribosomal RNA gene,
           partial sequence
          Length = 2481

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 685 agggaacgtgagctgggtttagaccgtcgtgagacag 721



to top

>gb|DQ168773.1| Ampsalis terminalis voucher CB0401 28S ribosomal RNA gene, partial
           sequence
          Length = 2521

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168772.1| Ruba opponens voucher CB0331 28S ribosomal RNA gene, partial
           sequence
          Length = 2508

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 695 agggaacgtgagctgggtttagaccgtcgtgagacag 731



to top

>gb|DQ168771.1| Leucoptilum sp. CB0326 28S ribosomal RNA gene, partial sequence
          Length = 2480

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 675 agggaacgtgagctgggtttagaccgtcgtgagacag 711



to top

>gb|DQ168770.1| Chordonota inermis voucher CB0324 28S ribosomal RNA gene, partial
           sequence
          Length = 2486

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 672 agggaacgtgagctgggtttagaccgtcgtgagacag 708



to top

>gb|DQ168769.1| Dicyphoma schaefferi voucher CB0323 28S ribosomal RNA gene, partial
           sequence
          Length = 2469

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 668 agggaacgtgagctgggtttagaccgtcgtgagacag 704



to top

>gb|DQ168768.1| Dieuryneura stigma voucher CB0322 28S ribosomal RNA gene, partial
           sequence
          Length = 2509

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 686 agggaacgtgagctgggtttagaccgtcgtgagacag 722



to top

>gb|DQ168767.1| Stratiomys laticeps voucher CB0319 28S ribosomal RNA gene, partial
           sequence
          Length = 2447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 654 agggaacgtgagctgggtttagaccgtcgtgagacag 690



to top

>gb|DQ168765.1| Diaphorostylus nasica voucher CB0317 28S ribosomal RNA gene,
           partial sequence
          Length = 2519

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 688 agggaacgtgagctgggtttagaccgtcgtgagacag 724



to top

>gb|DQ168764.1| Adoxomyia rustica voucher CB0316 28S ribosomal RNA gene, partial
           sequence
          Length = 2530

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 689 agggaacgtgagctgggtttagaccgtcgtgagacag 725



to top

>gb|DQ168763.1| Abavus sp. CB0314 28S ribosomal RNA gene, partial sequence
          Length = 2462

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 693 agggaacgtgagctgggtttagaccgtcgtgagacag 729



to top

>gb|DQ168762.1| Chiromyza sp. CB0313 28S ribosomal RNA gene, partial sequence
          Length = 2390

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 696 agggaacgtgagctgggtttagaccgtcgtgagacag 732



to top

>gb|DQ168761.1| Acropeltates sp. CB0311 28S ribosomal RNA gene, partial sequence
          Length = 2507

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 696 agggaacgtgagctgggtttagaccgtcgtgagacag 732



to top

>gb|DQ168760.1| Sargus thoracicus voucher CB0305 28S ribosomal RNA gene, partial
           sequence
          Length = 2496

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 684 agggaacgtgagctgggtttagaccgtcgtgagacag 720



to top

>gb|DQ168759.1| Artemita aurata voucher CB0303 28S ribosomal RNA gene, partial
           sequence
          Length = 2538

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 683 agggaacgtgagctgggtttagaccgtcgtgagacag 719



to top

>gb|DQ168758.1| Histiodroma sp. CB0301 28S ribosomal RNA gene, partial sequence
          Length = 2485

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 687 agggaacgtgagctgggtttagaccgtcgtgagacag 723



to top

>gb|DQ168757.1| Heteracanthia sp. CB0226 28S ribosomal RNA gene, partial sequence
          Length = 2440

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 686 agggaacgtgagctgggtttagaccgtcgtgagacag 722



to top

>gb|DQ168756.1| Oplachantha sp. CB0225 28S ribosomal RNA gene, partial sequence
          Length = 2483

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 36/37 (97%), Gaps = 1/37 (2%)
 Strand = Plus / Plus

                                                
Query: 1   agggaacgtgagctgggtt-agaccgtcgtgagacag 36
           ||||||||||||||||||| |||||||||||||||||
Sbjct: 682 agggaacgtgagctgggtttagaccgtcgtgagacag 718


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,796,320
Number of Sequences: 3902068
Number of extensions: 2796320
Number of successful extensions: 75561
Number of sequences better than 10.0: 3212
Number of HSP's better than 10.0 without gapping: 138
Number of HSP's successfully gapped in prelim test: 3086
Number of HSP's that attempted gapping in prelim test: 68851
Number of HSP's gapped (non-prelim): 8201
length of query: 366
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 344
effective length of database: 17,147,199,772
effective search space: 5898636721568
effective search space used: 5898636721568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top