ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart12c03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds 985 0.0
2gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA... 924 0.0
3dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds 335 1e-88
4dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 335 1e-88
5dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 335 1e-88
6ref|XM_464995.1| Oryza sativa (japonica cultivar-group), mRNA 315 9e-83
7ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group... 315 9e-83
8dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 313 4e-82
9dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
10dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
11dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
12gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal p... 278 2e-71
13gb|BT016390.1| Zea mays clone Contig223 mRNA sequence 266 8e-68
14gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, part... 159 1e-35
15gb|AY109383.1| Zea mays CL7224_1 mRNA sequence 155 2e-34
16gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 149 1e-32
17ref|NM_119633.2| Arabidopsis thaliana structural constituent of ... 147 5e-32
18gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ri... 147 5e-32
19emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Co... 147 5e-32
20gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ri... 145 2e-31
21emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-spe... 139 1e-29
22gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds 137 5e-29
23emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Co... 137 5e-29
24emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene 131 3e-27
25gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein... 131 3e-27
26gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, c... 131 3e-27
27gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA... 131 3e-27
28gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 129 1e-26
29gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare... 129 1e-26
30gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare str... 129 1e-26
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
32dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
33gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 129 1e-26
34emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa... 129 1e-26
35gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRN... 123 7e-25
36gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, par... 121 3e-24
37emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal prot... 121 3e-24
38dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds 119 1e-23
39gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal prot... 117 4e-23
40gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BA... 113 7e-22
41gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 111 3e-21
42gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA,... 105 2e-19
43gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein... 94 6e-16
44gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein... 94 6e-16
45gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, c... 94 6e-16
46dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
47dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
48dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
49dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS... 84 6e-13
50gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete s... 82 2e-12
51gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete seq... 82 2e-12
52dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-p... 78 4e-11
53gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal prot... 76 1e-10
54gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA... 76 1e-10
55gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence 74 6e-10
56ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
57ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
58ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
59emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 74 6e-10
60emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 74 6e-10
61emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 74 6e-10
62ref|NM_111356.3| Arabidopsis thaliana structural constituent of ... 72 2e-09
63gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 2e-09
64gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 2e-09
65emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
66gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete s... 72 2e-09
67dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds 72 2e-09
68gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence 68 4e-08
69ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 4... 64 6e-07
70emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
71ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosom... 60 9e-06
72emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical prot... 60 9e-06
73gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRN... 60 9e-06
74gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA se... 58 3e-05
75gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds 58 3e-05
76dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, ... 56 1e-04
77gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 5e-04
78gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosom... 54 5e-04
79gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 54 5e-04
80gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 5e-04
81gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 5e-04
82ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 5e-04
83ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 5e-04
84ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 5e-04
85ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 5e-04
86ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 5e-04
87ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 5e-04
88ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 5e-04
89ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 5e-04
90ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 5e-04
91gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosom... 54 5e-04
92ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA 54 5e-04
93ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 5e-04
94ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 5e-04
95ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 5e-04
96ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 5e-04
97ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 5e-04
98emb|Z83368.1|MMRPS3A M.musculus RPS3a gene 54 5e-04
99gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 5e-04
100dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 54 5e-04
101dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct i... 54 5e-04
102dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
103dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
104dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
105dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RI... 54 5e-04
106dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
107dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
108dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 5e-04
109dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
110dbj|AK167562.1| Mus musculus 11 days pregnant adult female place... 54 5e-04
111dbj|AK167512.1| Mus musculus 11 days pregnant adult female place... 54 5e-04
112dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 54 5e-04
113dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 54 5e-04
114dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length en... 54 5e-04
115dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 54 5e-04
116dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells ... 54 5e-04
117dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells ... 54 5e-04
118gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 5e-04
119dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIK... 54 5e-04
120gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, com... 54 5e-04
121dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minu... 54 5e-04
122emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chr... 54 5e-04
123emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chro... 54 5e-04
124ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
125ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
126ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
127ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
128ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
129ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
130ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
131ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
132ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
133ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
134ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
135ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.002
136ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
137ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
138ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
139ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
140ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
141ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
142ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
143ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
144ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
145ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
146ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
147ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
148ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
149ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
150ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
151ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
152ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
153ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
154ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
155gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 52 0.002
156emb|X68555.1|ACKRPA A.californica KRP-A gene 52 0.002
157gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds 52 0.002
158gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cD... 50 0.008
159ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a)... 50 0.008
160gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like pro... 50 0.008
161emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for rib... 50 0.008
162gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal ... 48 0.033
163gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal ... 48 0.033
164gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal ... 48 0.033
165ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
166ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
167ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
168ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
169ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
170ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
171ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.033
172ref|XM_519223.1| PREDICTED: Pan troglodytes similar to ribosomal... 46 0.13
173ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA 46 0.13
174ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribo... 46 0.13
175gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, comple... 46 0.13
176ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
177gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
178gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
179gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNI... 46 0.13
180gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNI... 46 0.13
181gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNI... 46 0.13
182gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNI... 46 0.13
183emb|BX039677.1|CNS092S1 Single read from an extremity of a full-... 46 0.13
184gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
185emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clo... 46 0.13
186gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, comple... 46 0.13
187gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clon... 46 0.13
188ref|XR_001455.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.13
189ref|XR_001456.1| PREDICTED: Homo sapiens similar to ribosomal pr... 46 0.13
190ref|XR_001449.1| PREDICTED: Homo sapiens similar to ribosomal pr... 46 0.13
191dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-1570... 46 0.13
192gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein ... 46 0.13
193gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
194gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
195gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
196gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
197gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
198gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
199gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
200gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
201dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, ... 46 0.13
202gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q... 46 0.13
203ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA 46 0.13
204emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene 46 0.13
205dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein... 46 0.13
206gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, comple... 46 0.13
207gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
208gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
209gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.13
210emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chro... 46 0.13
211gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein... 46 0.13
212emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal pro... 46 0.13
213gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation... 46 0.13
214gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ri... 46 0.13
215ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 44 0.52
216ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
217ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
218ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
219ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
220ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
221ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
222ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
223ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
224ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
225ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
226ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
227ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
228ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
229ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
230ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
231ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
232ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
233ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
234emb|BX546465.7| Mouse DNA sequence from clone RP23-167N13 on chr... 44 0.52
235gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, com... 42 2.1
236gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500,... 42 2.1
237gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, comp... 42 2.1
238ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 2.1
239ref|XM_950881.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.1
240ref|XM_327890.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.1
241ref|XM_677047.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 2.1
242ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S... 42 2.1
243ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA 42 2.1
244emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, comple... 42 2.1
245gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA ... 42 2.1
246ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mRNA 42 2.1
247gb|BC080969.1| Xenopus tropicalis rps3a protein, mRNA (cDNA clon... 42 2.1
248emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-... 42 2.1
249emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 42 2.1
250emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 42 2.1
251emb|BX294022.1|NCB11C21 Neurospora crassa DNA linkage group V BA... 42 2.1
252ref|XM_938933.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 2.1
253ref|XM_943962.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 2.1
254ref|XM_929221.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 2.1
255ref|XM_933511.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 2.1
256gb|AC020898.6| Homo sapiens chromosome 5 clone CTC-451P13, compl... 42 2.1
257gb|DQ066297.1| Ixodes scapularis isolate is-all-378 40S ribosoma... 42 2.1
258gb|AF379639.1|AF379639 Heliothis virescens ribosomal protein S3a... 42 2.1
259ref|NM_065509.3| Caenorhabditis elegans Ribosomal Protein, Small... 42 2.1
260ref|XM_392119.2| PREDICTED: Apis mellifera similar to Phosphatid... 42 2.1
261gb|AF429977.1| Spodoptera frugiperda ribosomal protein S3A mRNA,... 42 2.1
262gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 2.1
263gb|AF056328.1|AF056328 Oryzias latipes V-Fos transformation effe... 42 2.1
264emb|CR760859.2| Xenopus tropicalis finished cDNA, clone TTpA010n05 42 2.1
265gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, com... 42 2.1
266gb|M77234.1|HUMRPSA3A Human ribosomal protein S3a mRNA, complete... 42 2.1
267ref|XM_475184.1| Oryza sativa (japonica cultivar-group), predic... 40 8.2
268gb|DQ214672.1| Taeniopygia guttata clone 0058P0017B06 ribosomal ... 40 8.2
269gb|DQ214670.1| Taeniopygia guttata clone 0058P0030H07 ribosomal ... 40 8.2
270ref|XM_526720.1| PREDICTED: Pan troglodytes similar to Rps3a-pro... 40 8.2
271ref|XM_473036.1| Oryza sativa (japonica cultivar-group), predic... 40 8.2
272gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, co... 40 8.2
273gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 8.2
274ref|XM_585925.2| PREDICTED: Bos taurus similar to ribosomal prot... 40 8.2
275ref|XM_873635.1| PREDICTED: Bos taurus similar to ribosomal prot... 40 8.2
276ref|XM_864544.1| PREDICTED: Bos taurus similar to ribosomal prot... 40 8.2
277ref|XM_873439.1| PREDICTED: Bos taurus similar to ribosomal prot... 40 8.2
278ref|XM_873338.1| PREDICTED: Bos taurus similar to ribosomal prot... 40 8.2
279ref|XM_612939.2| PREDICTED: Bos taurus similar to catenin (cadhe... 40 8.2
280gb|AC105773.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
281gb|AC119954.12| Mus musculus chromosome 1, clone RP24-450P2, com... 40 8.2
282gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosom... 40 8.2
283gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome... 40 8.2
284gb|AC160529.6| Mus musculus chromosome 1, clone RP24-141F19, com... 40 8.2
285gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 40 8.2
286ref|XR_003208.1| PREDICTED: Mus musculus similar to 40S ribosoma... 40 8.2
287ref|XM_534535.2| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
288ref|XM_855228.1| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
289ref|XM_855188.1| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
290ref|XM_858394.1| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
291gb|AC126433.3| Mus musculus BAC clone RP24-468I23 from chromosom... 40 8.2
292ref|XM_844866.1| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
293ref|XM_855146.1| PREDICTED: Canis familiaris similar to ribosoma... 40 8.2
294gb|AC109612.22| Mus musculus strain C57BL/6J clone rp23-37i3 map... 40 8.2
295gb|AC148981.7| Mus musculus BAC clone RP23-201L15 from chromosom... 40 8.2
296ref|XM_505043.1| Yarrowia lipolytica CLIB122, YALI0F05676g predi... 40 8.2
297ref|XM_778340.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.2
298emb|Z12611.1|STPROINI S.tuberosum proteinase inhibitor I 40 8.2
299gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.2
300gb|AC104783.3| Homo sapiens BAC clone RP11-36G9 from 4, complete... 40 8.2
301dbj|AB226271.1| Aspergillus oryzae cDNA, contig sequence: AoEST3131 40 8.2
302dbj|AB223962.1| Aspergillus oryzae cDNA, contig sequence: AoEST0803 40 8.2
303ref|XM_944481.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
304ref|XM_944478.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
305ref|XM_944477.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
306ref|XM_940145.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
307ref|XM_944469.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
308ref|XM_944466.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
309ref|XM_944462.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
310ref|XM_933260.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
311ref|XM_933257.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
312ref|XM_016713.7| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
313ref|XM_933251.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
314ref|XM_933249.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
315ref|XM_933244.1| PREDICTED: Homo sapiens similar to ribosomal pr... 40 8.2
316gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 8.2
317dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
318dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
319gb|AC068724.7|AC068724 Homo sapiens chromosome 15 clone RP11-473... 40 8.2
320gb|AE004471.1| Pseudomonas aeruginosa PAO1, section 32 of 529 of... 40 8.2
321dbj|AK208628.1| Mus musculus cDNA, clone:Y2G0112D21, strand:plus... 40 8.2
322dbj|AK208520.1| Mus musculus cDNA, clone:Y2G0111M05, strand:minu... 40 8.2
323dbj|AK207259.1| Mus musculus cDNA, clone:Y2G0107H03, strand:minu... 40 8.2
324dbj|AK200497.1| Mus musculus cDNA, clone:Y1G0134L23, strand:plus... 40 8.2
325dbj|AK190515.1| Mus musculus cDNA, clone:Y1G0102P22, strand:plus... 40 8.2
326emb|AJ563455.1|CGI563455 Crassostrea gigas partial mRNA for ribo... 40 8.2
327dbj|AK109382.2| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
328dbj|AK069136.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
329emb|AJ249414.1|MMU249414 Mus musculus partial PI3Kgamma gene for... 40 8.2
330dbj|AB092486.1| Gallus gallus gene for iron-responsive element-b... 40 8.2
331emb|AL845344.4|CNS08CB6 Oryza sativa chromosome 12, . BAC OSJNBb... 40 8.2
332emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4,... 40 8.2
333gb|AC150681.2| Mus musculus BAC clone RP24-490A22 from 7, comple... 40 8.2
334emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 8.2

>gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds
          Length = 820

 Score =  985 bits (497), Expect = 0.0
 Identities = 542/557 (97%)
 Strand = Plus / Plus

                                                                       
Query: 43  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 90

                                                                       
Query: 103 atctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaagaagcag 162
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 91  atctccaaggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagcag 150

                                                                       
Query: 163 tggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgtg 222
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 151 tggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg 210

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           |||||||| |||||||||||||||||||||||||| ||||||||| ||||||| ||||||
Sbjct: 211 tccaggacgcagggtaccaagattgcctcagagggtctgaagcacagggtgttcgaagta 270

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 330

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 331 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactgac 390

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 391 aagctcaggtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaag 450

                                                                       
Query: 463 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 522
           ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 451 accactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaac 510

                                                                       
Query: 523 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatg 582
           ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 511 caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatg 570

                            
Query: 583 gttgagatcatggtcaa 599
           |||||||||||||||||
Sbjct: 571 gttgagatcatggtcaa 587



to top

>gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA, partial sequence
          Length = 885

 Score =  924 bits (466), Expect = 0.0
 Identities = 535/558 (95%), Gaps = 1/558 (0%)
 Strand = Plus / Plus

                                                                       
Query: 43  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 91

                                                                       
Query: 103 atctccaagggg-aggaagggtagcaagaagaaggccgtggatccgttcaccaagaagca 161
           |||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 92  atctccaagggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagca 151

                                                                       
Query: 162 gtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgt 221
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 152 gtggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgt 211

                                                                       
Query: 222 gtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagt 281
           ||||||||| |||||||||||||||| ||||||||| |||||||||  |||||| |||||
Sbjct: 212 gtccaggacgcagggtaccaagattgnctcagagggtctgaagcacanggtgttcgaagt 271

                                                                       
Query: 282 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 341
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 331

                                                                       
Query: 342 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactga 401
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 332 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactga 391

                                                                       
Query: 402 caagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaa 461
           |||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 392 caagctcaagtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaa 451

                                                                       
Query: 462 gaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaa 521
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 452 gaccactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaa 511

                                                                       
Query: 522 ccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagat 581
           |||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 512 ccaggtgaagcgcacttgctatgcccaagcnagtcagatcagacagatccgccgcaagat 571

                             
Query: 582 ggttgagatcatggtcaa 599
           || ||||||  |||||||
Sbjct: 572 ggntgagatattggtcaa 589



to top

>dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds
          Length = 1065

 Score =  335 bits (169), Expect = 1e-88
 Identities = 439/529 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 84  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 143

                                                                       
Query: 127 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 186
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 144 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 203

                                                                       
Query: 187 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 246
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 204 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 263

                                                                       
Query: 247 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 306
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 264 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 323

                                                                       
Query: 307 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 366
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 324 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 383

                                                                       
Query: 367 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 426
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 384 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 443

                                                                       
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 486
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 444 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 503

                                                                       
Query: 487 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 546
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 504 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 563

                                                            
Query: 547 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| ||||||||||||||||| || || ||||||||||| |||||||
Sbjct: 564 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 612



to top

>dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-D02, full
           insert sequence
          Length = 1032

 Score =  335 bits (169), Expect = 1e-88
 Identities = 439/529 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 60  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 119

                                                                       
Query: 127 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 186
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 120 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 179

                                                                       
Query: 187 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 246
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 180 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 239

                                                                       
Query: 247 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 306
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 240 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 299

                                                                       
Query: 307 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 366
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 300 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 359

                                                                       
Query: 367 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 426
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 360 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 419

                                                                       
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 486
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 420 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 479

                                                                       
Query: 487 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 546
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 480 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 539

                                                            
Query: 547 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| ||||||||||||||||| || || ||||||||||| |||||||
Sbjct: 540 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 588



to top

>dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013H23, full
           insert sequence
          Length = 1097

 Score =  335 bits (169), Expect = 1e-88
 Identities = 439/529 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 61  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 120

                                                                       
Query: 127 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 186
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 121 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 180

                                                                       
Query: 187 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 246
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 181 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 240

                                                                       
Query: 247 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 306
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 241 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 300

                                                                       
Query: 307 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 366
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 301 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 360

                                                                       
Query: 367 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 426
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 361 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 420

                                                                       
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 486
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 421 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 480

                                                                       
Query: 487 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 546
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 481 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 540

                                                            
Query: 547 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| ||||||||||||||||| || || ||||||||||| |||||||
Sbjct: 541 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 589



to top

>ref|XM_464995.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1063

 Score =  315 bits (159), Expect = 9e-83
 Identities = 429/519 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 34  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 93

                                                                       
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 196
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 94  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153

                                                                       
Query: 197 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 256
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213

                                                                       
Query: 257 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 316
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273

                                                                       
Query: 317 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 376
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333

                                                                       
Query: 377 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 436
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393

                                                                       
Query: 437 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 496
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453

                                                                       
Query: 497 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 556
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513

                                                  
Query: 557 agatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| | |||||||||||||||||||||||||||||||
Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatgg 552



to top

>ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1115_D03.49
           mRNA
          Length = 1171

 Score =  315 bits (159), Expect = 9e-83
 Identities = 429/519 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 196
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 197 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 256
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 257 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 316
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 317 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 376
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 377 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 436
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 437 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 496
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 497 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 556
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                  
Query: 557 agatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| | |||||||||||||||||||||||||||||||
Sbjct: 550 agatccggcagatccgccggaagatggttgagatcatgg 588



to top

>dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C03, full
           insert sequence
          Length = 942

 Score =  313 bits (158), Expect = 4e-82
 Identities = 413/498 (82%)
 Strand = Plus / Plus

                                                                       
Query: 98  agcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaaga 157
           |||||||||||||||||| ||||||   |||||||||| |||| ||||| ||  | ||||
Sbjct: 1   agcgcatctccaaggggaagaagggatccaagaagaagaccgtcgatccctttgctaaga 60

                                                                       
Query: 158 agcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccc 217
           || | |||||||| |||||||| |||  | | ||||     || ||| ||||||||||||
Sbjct: 61  aggactggtatgatatcaaggccccgtcggtgttcaatgtgcggaacatcggcaagaccc 120

                                                                       
Query: 218 tcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttg 277
           |||||||||||||||||||||| |||||||| || |||||||| |||||  | |||||||
Sbjct: 121 tcgtgtccaggacacagggtacaaagattgcttctgagggcctaaagcatagagtgtttg 180

                                                                       
Query: 278 aagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactcc 337
           | || ||  |||||||||| |||||||||||||| ||||| ||||||||||||||||| |
Sbjct: 181 aggtctccttagctgatctccagaacgatgaggatcaggcgtacaggaagatcagacttc 240

                                                                       
Query: 338 gtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcacca 397
           ||||||||||||||||||||| ||| || ||||| ||||| |||||||||   || || |
Sbjct: 241 gtgctgaggatgtgcaagggaagaacgtgctcaccaacttttggggcatgtcgtttacta 300

                                                                       
Query: 398 ctgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatg 457
           | || |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||
Sbjct: 301 ccgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatg 360

                                                                       
Query: 458 tgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcc 517
           | || ||||| |||   |||||||| ||  ||||    || |||||||||||| | || |
Sbjct: 361 tcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggc 420

                                                                       
Query: 518 caaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccgga 577
           | |||||||| ||| | ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 421 ctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacagattcgtcgca 480

                             
Query: 578 agatggttgagatcatgg 595
           |||||||||| |||||||
Sbjct: 481 agatggttgaaatcatgg 498



to top

>dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M05, full
           insert sequence
          Length = 1063

 Score =  307 bits (155), Expect = 2e-80
 Identities = 428/519 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| || ||||||||| || | ||||||||||| |||||||| |||||||||||| 
Sbjct: 34  ccatggccgtgggcaagaacgagaggatctccaagggcaggaagggcagcaagaagaaga 93

                                                                       
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 196
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 94  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153

                                                                       
Query: 197 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 256
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213

                                                                       
Query: 257 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 316
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273

                                                                       
Query: 317 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 376
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333

                                                                       
Query: 377 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 436
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393

                                                                       
Query: 437 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 496
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453

                                                                       
Query: 497 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 556
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513

                                                  
Query: 557 agatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| | |||||||||||||||||||||||||||||||
Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatgg 552



to top

>dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C03, full
           insert sequence
          Length = 1171

 Score =  307 bits (155), Expect = 2e-80
 Identities = 428/519 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 196
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 197 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 256
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 257 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 316
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 317 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 376
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 377 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 436
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 437 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 496
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 497 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 556
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                  
Query: 557 agatcagacagatccgccggaagatggttgagatcatgg 595
           ||||| | ||||||| |||||||||||||||||||||||
Sbjct: 550 agatccggcagatcctccggaagatggttgagatcatgg 588



to top

>dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079A13, full
           insert sequence
          Length = 1118

 Score =  305 bits (154), Expect = 9e-80
 Identities = 436/530 (82%)
 Strand = Plus / Plus

                                                                       
Query: 67  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
           |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 92  gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 151

                                                                       
Query: 127 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 186
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 152 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcg 211

                                                                       
Query: 187 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 246
            | |||| |    | |||||||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 212 gtgttcaacgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagatt 271

                                                                       
Query: 247 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 306
           || ||||||||||| |||||||| |||||||| || ||  | ||||||||||||||||||
Sbjct: 272 gcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgat 331

                                                                       
Query: 307 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 366
           ||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  ||||| 
Sbjct: 332 gaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgtt 391

                                                                       
Query: 367 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 426
           || ||||||||||||||||||  |||||| || ||||||||||| ||  | || | ||| 
Sbjct: 392 cttacaaacttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaa 451

                                                                       
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 486
           |||||||| || || ||||||||||| |||||  |||||||||| || |||||||| || 
Sbjct: 452 tggcagacgctaatagaggctcatgtggatgtagagaccactgataactacatgctgcgt 511

                                                                       
Query: 487 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 546
            | ||   | ||||||||||||||||  | ||||| || ||||| || || |||||||||
Sbjct: 512 ctcttctgcgttggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgct 571

                                                             
Query: 547 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggt 596
           |||||||| |||||  |||||||||| || |||||||| |||| ||||||
Sbjct: 572 caagcaagccagattcgacagatccgtcgcaagatggtggagaccatggt 621



to top

>gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal protein (RSPSP94) mRNA,
           complete cds
          Length = 1027

 Score =  278 bits (140), Expect = 2e-71
 Identities = 427/520 (82%), Gaps = 2/520 (0%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 31  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 90

                                                                       
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 196
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 91  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 150

                                                                       
Query: 197 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 256
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 151 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 210

                                                                       
Query: 257 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 316
           | || ||||| || || |||||||| ||  | || ||||||| ||| || ||||| ||||
Sbjct: 211 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcggaatgacgaggatcagg 270

                                                                       
Query: 317 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 376
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 271 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 330

                                                                       
Query: 377 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 436
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 331 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 390

                                                                       
Query: 437 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 496
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 391 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 450

                                                                       
Query: 497 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 556
           |||| ||||||||| | |||||||| ||||| ||||| || || || |||| ||  || |
Sbjct: 451 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctc-aggtagcc 509

                                                   
Query: 557 agatcagacagat-ccgccggaagatggttgagatcatgg 595
           ||||| | ||||| ||||||||||||||||||||||||||
Sbjct: 510 agatccggcagatcccgccggaagatggttgagatcatgg 549



to top

>gb|BT016390.1| Zea mays clone Contig223 mRNA sequence
          Length = 1104

 Score =  266 bits (134), Expect = 8e-68
 Identities = 431/530 (81%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 129
           ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| |||||
Sbjct: 65  gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 124

                                                                       
Query: 130 aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 189
           || ||| |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 125 aaaaagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 184

                                                                       
Query: 190 ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 249
           ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 185 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 244

                                                                       
Query: 250 tcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgag 309
           || ||||| ||||||||| | || ||||| || |  |||||||||||||||  ||| |||
Sbjct: 245 tctgagggtctgaagcacagagtctttgaggtttgcctagctgatcttcagggcgacgag 304

                                                                       
Query: 310 gaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctc 369
           || || || |||||||| ||||| ||||||||||| |||||||| || | |||||| |||
Sbjct: 305 gatcaagcttacaggaaaatcaggctccgtgctgaagatgtgcagggcaggaatgtgctc 364

                                                                       
Query: 370 acaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtgg 429
           |||||||| ||||| ||| |||| |||||||| || || || || || |||| |||||||
Sbjct: 365 acaaacttttggggtatgaattttaccactgataaactgagatccctagtgaagaagtgg 424

                                                                       
Query: 430 cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 489
           |||||  | || || || ||||| ||||| ||||| || ||||| |||||| | ||  ||
Sbjct: 425 cagacattaatcgaagcccatgttgatgtcaagacaaccgacaactacatgttgcgtttg 484

                                                                       
Query: 490 tttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 549
           ||   ||| |||||||||||||| ||||||||||| |||||| | || ||||||||||| 
Sbjct: 485 ttctgcatcggcttcaccaagaggcgcccaaaccaagtcaagagaacctgctatgctcag 544

                                                             
Query: 550 gcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaa 599
           |||   |||||| | ||||||||||| |||||||||||||| ||| ||||
Sbjct: 545 gcatcccagatccgtcagatccgccgaaagatggttgagattatgatcaa 594



to top

>gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, partial cds
          Length = 879

 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                       
Query: 289 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 348
           ||||||||||||||||||||||| |  ||||||||||||||| ||||  | |||||||||
Sbjct: 145 gctgatcttcagaacgatgaggatcgtgcctacaggaagatccgactgagagctgaggat 204

                                                                       
Query: 349 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 408
           |||||||| | |||||||||||||||||||||||| ||||| || || || |||||||| 
Sbjct: 205 gtgcaaggaaagaatgtcctcacaaacttctggggaatggactttacaacagacaagctg 264

                                                                   
Query: 409 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||| | ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 265 aggtctttggtgcgcaagtggcagacattgattgaggctcatgtggatgttaagac 320



to top

>gb|AY109383.1| Zea mays CL7224_1 mRNA sequence
          Length = 1236

 Score =  155 bits (78), Expect = 2e-34
 Identities = 219/266 (82%)
 Strand = Plus / Minus

                                                                       
Query: 334 ctccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttc 393
           ||||||||||| ||||||||||| | |||||| ||||||||||| ||||| ||| |||| 
Sbjct: 866 ctccgtgctgaagatgtgcaaggcaggaatgtgctcacaaacttttggggtatgaatttt 807

                                                                       
Query: 394 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 453
           |||||||| || || || || || |||| ||||||||||||  | || || || ||||| 
Sbjct: 806 accactgataaactgagatccctagtgaagaagtggcagacattaatcgaagcccatgtt 747

                                                                       
Query: 454 gatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagaga 513
           ||||| ||||| || ||||| |||||| | ||  ||||   ||| |||||||||||||| 
Sbjct: 746 gatgtcaagacaaccgacaactacatgttgcgtttgttctgcatcggcttcaccaagagg 687

                                                                       
Query: 514 cgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgc 573
           |||||||||||||||||| | || ||||||||||| |||   |||||| | |||||||||
Sbjct: 686 cgcccaaaccaggtcaagagaacctgctatgctcaggcatcccagatccgtcagatccgc 627

                                     
Query: 574 cggaagatggttgagatcatggtcaa 599
           || |||||||||||||| ||| ||||
Sbjct: 626 cgtaagatggttgagattatgatcaa 601



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 160/198 (80%)
 Strand = Plus / Minus

                                                                        
Query: 70   gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 129
            ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| |||||
Sbjct: 1130 gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 1071

                                                                        
Query: 130  aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 189
                || |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 1070 nnncagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 1011

                                                                        
Query: 190  ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 249
            ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 1010 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 951

                              
Query: 250  tcagagggcctgaagcac 267
            || ||||| |||||||||
Sbjct: 950  tctgagggtctgaagcac 933



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score =  149 bits (75), Expect = 1e-32
 Identities = 84/87 (96%)
 Strand = Plus / Minus

                                                                         
Query: 431   agaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgt 490
             |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 46711 agaccctcattgaggctcatgtggatgtgaagacaactgacaattacatgctccgcatgt 46652

                                        
Query: 491   ttgccattggcttcaccaagagacgcc 517
             ||||||||||||||||||||| |||||
Sbjct: 46651 ttgccattggcttcaccaagaaacgcc 46625



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 429   gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
             |||||||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 46885 gcagaccctcattgaggctcatgtggatgtgaagacaactgacaactacatg 46834



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 433   accctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
             |||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 47052 accctcattgaggctcatgtggatgtgaagacaactgacaactacatg 47005



to top

>ref|NM_119633.2| Arabidopsis thaliana structural constituent of ribosome AT4G34670
           mRNA, complete cds
          Length = 1093

 Score =  147 bits (74), Expect = 5e-32
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 134
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 135 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 193
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 194 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 253
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 254 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 313
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 314 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 373
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 374 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 433
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 434 ccctcattgaggctcatgtcgatgtgaagaccac 467
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



to top

>gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670; T4L20.250) mRNA, complete cds
          Length = 1094

 Score =  147 bits (74), Expect = 5e-32
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 134
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 135 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 193
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 194 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 253
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 254 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 313
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 314 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 373
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 374 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 433
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 434 ccctcattgaggctcatgtcgatgtgaagaccac 467
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



to top

>emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH6ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score =  147 bits (74), Expect = 5e-32
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 134
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 60  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 119

                                                                       
Query: 135 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 193
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 120 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 178

                                                                       
Query: 194 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 253
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 179 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 238

                                                                       
Query: 254 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 313
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 239 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 298

                                                                       
Query: 314 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 373
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 299 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 358

                                                                       
Query: 374 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 433
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 359 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 418

                                             
Query: 434 ccctcattgaggctcatgtcgatgtgaagaccac 467
           |  | ||||| || |||||||||||||| |||||
Sbjct: 419 ctttgattgaagcccatgtcgatgtgaaaaccac 452



to top

>gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670) mRNA, complete cds
          Length = 581

 Score =  145 bits (73), Expect = 2e-31
 Identities = 315/393 (80%), Gaps = 2/393 (0%)
 Strand = Plus / Minus

                                                                       
Query: 76  accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 135
           |||||||| ||||| ||||||||| | || || ||||| ||||| ||  | |||||||||
Sbjct: 581 accatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaag 522

                                                                       
Query: 136 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcac 194
           || || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||||
Sbjct: 521 gctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcac 463

                                                                       
Query: 195 cagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcaga 254
            | | | || || || ||||| || || |||||||| |||||||||||||||||||| ||
Sbjct: 462 gaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctga 403

                                                                       
Query: 255 gggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacca 314
           ||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  |
Sbjct: 402 gggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataa 343

                                                                       
Query: 315 ggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaa 374
            ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  |
Sbjct: 342 tgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccca 283

                                                                       
Query: 375 cttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagac 434
            |||||||| ||||||||||| || |||||||| |||||  | |||| ||||||||||||
Sbjct: 282 gttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagac 223

                                            
Query: 435 cctcattgaggctcatgtcgatgtgaagaccac 467
             | ||||| || |||||||||||||| |||||
Sbjct: 222 tttgattgaagcccatgtcgatgtgaaaaccac 190



to top

>emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-specific ribosomal protein
          Length = 906

 Score =  139 bits (70), Expect = 1e-29
 Identities = 312/390 (80%), Gaps = 2/390 (0%)
 Strand = Plus / Plus

                                                                       
Query: 79  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 138
           ||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||||| 
Sbjct: 1   atggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaaggct 60

                                                                       
Query: 139 gtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcaccag 197
           || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||| | 
Sbjct: 61  gttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcacgaa 119

                                                                       
Query: 198 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 257
           | | || || || ||||| || || |||||||| |||||||||||||||||||| |||||
Sbjct: 120 caggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctgaggg 179

                                                                       
Query: 258 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggc 317
            ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  | ||
Sbjct: 180 actgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataatgc 239

                                                                       
Query: 318 ctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaactt 377
           ||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  | ||
Sbjct: 240 ctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgacccagtt 299

                                                                       
Query: 378 ctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccct 437
           |||||| ||||||||||| || |||||||| |||||  | |||| ||||||||||||  |
Sbjct: 300 ctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagacttt 359

                                         
Query: 438 cattgaggctcatgtcgatgtgaagaccac 467
            ||||| || |||||||||||||| |||||
Sbjct: 360 gattgaagcccatgtcgatgtgaaaaccac 389



to top

>gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds
          Length = 786

 Score =  137 bits (69), Expect = 5e-29
 Identities = 210/257 (81%)
 Strand = Plus / Plus

                                                                       
Query: 202 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 261
           ||||| ||||||||||| ||  | ||||| |||||||| |||||||| || || || || 
Sbjct: 124 aacgttggcaagaccctggtcactaggactcagggtactaagattgcttcggaaggacta 183

                                                                       
Query: 262 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 321
           |||||| | || ||||||||   | | |||||||||||||| |||||||| ||  | | |
Sbjct: 184 aagcacagagtatttgaagtcagtttggctgatcttcagaaggatgaggatcaatctttc 243

                                                                       
Query: 322 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 381
           ||||||||| |  |  | || || ||||||||||||| ||||||||||||||||||||||
Sbjct: 244 aggaagatccgcttgagggcagaagatgtgcaagggaagaatgtcctcacaaacttctgg 303

                                                                       
Query: 382 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 441
           || ||||||||||| || |||||| | |||||||| || | ||||||||||||  | |||
Sbjct: 304 ggaatggatttcacaacagacaagttgaggtctctggtaaagaagtggcagacattgatt 363

                            
Query: 442 gaggctcatgtcgatgt 458
           ||||||||||| |||||
Sbjct: 364 gaggctcatgtggatgt 380



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 79  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 138
           ||||| ||||||||||||||| | || || ||||| | ||| ||  | ||||||||||| 
Sbjct: 1   atggctgtcggcaagaacaagaggatttcaaagggaaagaaaggaggaaagaagaaggcg 60

                                                    
Query: 139 gtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           | |||||||| | | |||||| | ||||||||||| |||||
Sbjct: 61  gcggatccgtacgcaaagaaggactggtatgacataaaggc 101



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 556 cagatcagacagatccgccggaagatggttgagatcatg 594
           |||||| | |||||||| ||||| |||||||||||||||
Sbjct: 478 cagatccgtcagatccgtcggaaaatggttgagatcatg 516



to top

>emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 836

 Score =  137 bits (69), Expect = 5e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           |||||||| |||||||||||||||||||| ||||| ||||| ||| |||||||||| || 
Sbjct: 52  tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 111

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||| || || ||||||||  | ||||||||||||||| | ||  | |||
Sbjct: 112 tctcttgctgatctacaaaatgatgaggataatgcctacaggaagatccgtcttagagct 171

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||||||  | ||  | |||||||| ||||||||||| || |||
Sbjct: 172 gaagatgttcagggaaggaatgtgttgacccagttctggggtatggatttcacaaccgac 231

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           ||||| |||||  | |||| ||||||||||||  | ||||| || |||||||||||||| 
Sbjct: 232 aagctaaggtcattggtgaagaagtggcagactttgattgaagcccatgtcgatgtgaaa 291

                
Query: 463 accac 467
           |||||
Sbjct: 292 accac 296



to top

>emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene
          Length = 1050

 Score =  131 bits (66), Expect = 3e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 264
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 265 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 324
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 325 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 384
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 385 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 445 gctcatgtcgatgtgaagaccactgacaattaca 478
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 74  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 133
           |||||||||| ||||| ||||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 134 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 548
           |||||||||||||||  | ||||| || ||| | ||||||||||||||
Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575



to top

>gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein mRNA, complete
           cds
          Length = 1020

 Score =  131 bits (66), Expect = 3e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 227 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 286
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 192 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 251

                                                                       
Query: 287 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 346
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 252 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 311

                                                                       
Query: 347 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 406
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 312 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 371

                                                                     
Query: 407 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 372 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 429



to top

>gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, complete cds
          Length = 996

 Score =  131 bits (66), Expect = 3e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 227 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 286
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 170 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 229

                                                                       
Query: 287 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 346
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 230 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 289

                                                                       
Query: 347 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 406
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 290 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 349

                                                                     
Query: 407 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 350 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 407



to top

>gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA, complete cds
          Length = 1050

 Score =  131 bits (66), Expect = 3e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 264
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 265 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 324
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 325 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 384
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 385 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 445 gctcatgtcgatgtgaagaccactgacaattaca 478
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 74  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 133
           |||||||||| ||||| ||||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 134 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 548
           |||||||||||||||  | ||||| || ||| | ||||||||||||||
Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 242     agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
               ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 5244369 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5244428

                                                                           
Query: 302     acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
               |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 5244429 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5244488

                                    
Query: 362     atgtcctcacaaacttctggg 382
               | || ||||| ||||| ||||
Sbjct: 5244489 acgtgctcaccaacttttggg 5244509



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                           
Query: 403     aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
               |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 5244600 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5244659

                                                                           
Query: 463     accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 522
               ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 5244660 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5244719

                                                            
Query: 523     caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 567
               ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 5244720 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5244764



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 206     tcggcaagaccctcgtgtccaggacacagggtac 239
               ||||||||||||||||||||||||||||||||||
Sbjct: 5243526 tcggcaagaccctcgtgtccaggacacagggtac 5243559



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                           
Query: 67      gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
               |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 5243269 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5243328

                        
Query: 127     aagaagaag 135
               |||||||||
Sbjct: 5243329 aagaagaag 5243337



to top

>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3
             clone OSJNBa0021H20, complete sequence
          Length = 133079

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                         
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 67771 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 67830

                                                                         
Query: 302   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 67831 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 67890

                                  
Query: 362   atgtcctcacaaacttctggg 382
             | || ||||| ||||| ||||
Sbjct: 67891 acgtgctcaccaacttttggg 67911



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                         
Query: 403   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 68002 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 68061

                                                                         
Query: 463   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 522
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 68062 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 68121

                                                          
Query: 523   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 567
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 68122 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 68166



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 206   tcggcaagaccctcgtgtccaggacacagggtac 239
             ||||||||||||||||||||||||||||||||||
Sbjct: 66928 tcggcaagaccctcgtgtccaggacacagggtac 66961



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                         
Query: 67    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
             |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 66671 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 66730

                      
Query: 127   aagaagaag 135
             |||||||||
Sbjct: 66731 aagaagaag 66739



to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 12149 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 12090

                                                                         
Query: 302   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 12089 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 12030

                                  
Query: 362   atgtcctcacaaacttctggg 382
             | || ||||| ||||| ||||
Sbjct: 12029 acgtgctcaccaacttttggg 12009



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                         
Query: 403   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 11918 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 11859

                                                                         
Query: 463   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 522
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 11858 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 11799

                                                          
Query: 523   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 567
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 11798 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 11754



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                               
Query: 206   tcggcaagaccctcgtgtccaggacacagggtac 239
             ||||||||||||||||||||||||||||||||||
Sbjct: 12992 tcggcaagaccctcgtgtccaggacacagggtac 12959



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                         
Query: 67    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
             |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 13249 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 13190

                      
Query: 127   aagaagaag 135
             |||||||||
Sbjct: 13189 aagaagaag 13181



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                            
Query: 242      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
                ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 12316009 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12315950

                                                                            
Query: 302      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
                |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 12315949 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12315890

                                     
Query: 362      atgtcctcacaaacttctggg 382
                |||| || |||||||||||||
Sbjct: 12315889 atgttcttacaaacttctggg 12315869



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                            
Query: 381      gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 440
                |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 12315798 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12315739

                                                                            
Query: 441      tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 500
                 ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 12315738 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12315679

                                                                            
Query: 501      cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
                ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 12315678 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12315619



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                            
Query: 67       gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
                |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 12318599 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 12318540

                         
Query: 127      aagaagaag 135
                |||||||||
Sbjct: 12318539 aagaagaag 12318531



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 202      aacgtcggcaagaccctcgtgtccaggacacaggg 236
                |||||||| ||||| ||||||||||||||||||||
Sbjct: 12318352 aacgtcgggaagacgctcgtgtccaggacacaggg 12318318



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 36       ctccacccgccgcagcgccgccac 59
                ||||||||||||| ||||||||||
Sbjct: 18425138 ctccacccgccgccgcgccgccac 18425115



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 565      cagatccgccggaagatggttgagatcatggt 596
                |||||||| || |||||||| |||||||||||
Sbjct: 12315503 cagatccgtcgcaagatggtggagatcatggt 12315472



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 242     agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
               ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 5243584 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5243643

                                                                           
Query: 302     acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
               |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 5243644 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5243703

                                    
Query: 362     atgtcctcacaaacttctggg 382
               | || ||||| ||||| ||||
Sbjct: 5243704 acgtgctcaccaacttttggg 5243724



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                           
Query: 403     aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
               |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 5243815 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5243874

                                                                           
Query: 463     accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 522
               ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 5243875 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5243934

                                                            
Query: 523     caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 567
               ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 5243935 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5243979



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 206     tcggcaagaccctcgtgtccaggacacagggtac 239
               ||||||||||||||||||||||||||||||||||
Sbjct: 5242741 tcggcaagaccctcgtgtccaggacacagggtac 5242774



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                           
Query: 67      gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
               |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 5242484 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5242543

                        
Query: 127     aagaagaag 135
               |||||||||
Sbjct: 5242544 aagaagaag 5242552



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                            
Query: 242      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
                ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 12270379 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12270320

                                                                            
Query: 302      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
                |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 12270319 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12270260

                                     
Query: 362      atgtcctcacaaacttctggg 382
                |||| || |||||||||||||
Sbjct: 12270259 atgttcttacaaacttctggg 12270239



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                            
Query: 381      gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 440
                |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 12270168 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12270109

                                                                            
Query: 441      tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 500
                 ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 12270108 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12270049

                                                                            
Query: 501      cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
                ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 12270048 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12269989



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                            
Query: 67       gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
                |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 12272969 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 12272910

                         
Query: 127      aagaagaag 135
                |||||||||
Sbjct: 12272909 aagaagaag 12272901



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 202      aacgtcggcaagaccctcgtgtccaggacacaggg 236
                |||||||| ||||| ||||||||||||||||||||
Sbjct: 12272722 aacgtcgggaagacgctcgtgtccaggacacaggg 12272688



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 36       ctccacccgccgcagcgccgccac 59
                ||||||||||||| ||||||||||
Sbjct: 18351364 ctccacccgccgccgcgccgccac 18351341



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 565      cagatccgccggaagatggttgagatcatggt 596
                |||||||| || |||||||| |||||||||||
Sbjct: 12269873 cagatccgtcgcaagatggtggagatcatggt 12269842



to top

>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 163702

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
             ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 30374 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 30315

                                                                         
Query: 302   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
             |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 30314 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 30255

                                  
Query: 362   atgtcctcacaaacttctggg 382
             |||| || |||||||||||||
Sbjct: 30254 atgttcttacaaacttctggg 30234



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                         
Query: 381   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 440
             |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 30163 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 30104

                                                                         
Query: 441   tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 500
              ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 30103 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 30044

                                                                         
Query: 501   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
             ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 30043 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 29984



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                         
Query: 67    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 126
             |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 32964 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 32905

                      
Query: 127   aagaagaag 135
             |||||||||
Sbjct: 32904 aagaagaag 32896



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 202   aacgtcggcaagaccctcgtgtccaggacacaggg 236
             |||||||| ||||| ||||||||||||||||||||
Sbjct: 32717 aacgtcgggaagacgctcgtgtccaggacacaggg 32683



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 565   cagatccgccggaagatggttgagatcatggt 596
             |||||||| || |||||||| |||||||||||
Sbjct: 29868 cagatccgtcgcaagatggtggagatcatggt 29837



to top

>gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRNA, partial cds
          Length = 571

 Score =  123 bits (62), Expect = 7e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 304 gatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaat 363
           |||||||||||  ||| |||||||||| |  |  | ||||| ||||| || || | ||||
Sbjct: 67  gatgaggaccactccttcaggaagatccgtttgagagctgaagatgttcagggaaagaat 126

                                                                       
Query: 364 gtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgagg 423
           || |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||||
Sbjct: 127 gttctcacaaacttctggggcatggatttcaccaccgacaagctgagatctctcgtgagg 186

                                                             
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaa 473
           || |||||| | || |||||||||||||| ||||| ||||| || |||||
Sbjct: 187 aaatggcagtcactaattgaggctcatgttgatgtcaagactaccgacaa 236



to top

>gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 342

 Score =  121 bits (61), Expect = 3e-24
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                       
Query: 531 gcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagat 590
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3   gcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgagat 62

                    
Query: 591 catggtcaa 599
           |||||||||
Sbjct: 63  catggtcaa 71



to top

>emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal protein S3a (rs3a gene)
          Length = 1026

 Score =  121 bits (61), Expect = 3e-24
 Identities = 193/237 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 gaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgt 419
           |||||||||||| ||||| |  || |||||||||||||||||||||||||||||| | ||
Sbjct: 332 gaatgtcctcaccaacttttatggtatggatttcaccactgacaagctcaggtctttggt 391

                                                                       
Query: 420 gaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacat 479
             | || ||||| || |||||||| |||||||| ||||| ||||||||||| ||||| | 
Sbjct: 392 ccgtaaatggcaaactctcattgaagctcatgtggatgttaagaccactgataattatac 451

                                                                       
Query: 480 gctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttg 539
             |  | |||||   ||||||||| ||||||||||||   ||||| || ||| | || ||
Sbjct: 452 cttgagaatgttctgcattggctttaccaagagacgcagtaaccaagtgaagagaacctg 511

                                                                    
Query: 540 ctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggt 596
            ||||||||| | || |||||||||||||||||| ||||||||   |||||||||||
Sbjct: 512 ttatgctcaatccagccagatcagacagatccgcaggaagatgagggagatcatggt 568



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                       
Query: 74  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 133
           |||||||||||||||||||||||||| | || |||||||| | ||||||  |||||||||
Sbjct: 46  caaccatggcggtcggcaagaacaagagaatttccaagggaaagaagggaggcaagaaga 105

                                                         
Query: 134 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           | ||||  ||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 106 aagccgccgatcccttttccaagaaggattggtatgatatcaaggc 151



to top

>dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds
          Length = 1050

 Score =  119 bits (60), Expect = 1e-23
 Identities = 282/356 (79%)
 Strand = Plus / Plus

                                                                       
Query: 232 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 291
           ||||||||||||||||| || || || || || ||||| ||||| || || |  || |||
Sbjct: 175 cagggtaccaagattgcttctgaaggactcaaacaccgagtgttcgaggtttgccttgct 234

                                                                       
Query: 292 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 351
           || ||||||   |||||||||||||| || ||||||||  | ||  | || |||||||||
Sbjct: 235 gaccttcagggagatgaggaccaggcttataggaagattcgcctgagagcagaggatgtg 294

                                                                       
Query: 352 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 411
           ||||||| |||||| || ||||||||||  || ||||| ||||| ||||||||| | |||
Sbjct: 295 caagggaagaatgtgcttacaaacttctatggaatggacttcacaactgacaagttgagg 354

                                                                       
Query: 412 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 471
           ||||| ||  | ||||||||||| || ||||| |||||||| ||||||||||| ||||| 
Sbjct: 355 tctctggtacgcaagtggcagacactgattgaagctcatgtagatgtgaagacaactgat 414

                                                                       
Query: 472 aattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaag 531
           | ||| |  || || ||||||  |||||| || ||||||| |||  |||| |||   |||
Sbjct: 415 agttatactctgcgaatgttttgcattggatttaccaagaaacgtgcaaatcagcagaag 474

                                                                   
Query: 532 cgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttga 587
            | || |||||||| ||| | || |||||| | ||||| ||||| |||||||||||
Sbjct: 475 agaacctgctatgcccaatctagccagatccggcagattcgccgtaagatggttga 530



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 73  gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 132
           ||||||||||| ||||||||||||||| | ||||| ||||| | ||||||  ||||||||
Sbjct: 16  gcaaccatggctgtcggcaagaacaagaggatctcgaagggaaagaagggaggcaagaag 75

                
Query: 133 aaggc 137
           |||||
Sbjct: 76  aaggc 80



to top

>gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal protein S3a-like mRNA,
           complete cds
          Length = 1118

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 202 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 261
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 210 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagagggccta 269

                                                                       
Query: 262 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 321
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 270 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 329

                                                                       
Query: 322 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 381
           ||||| ||| |  |  | || || ||||||||||||| |||||| ||||||||||||   
Sbjct: 330 aggaaaatccgtttgagagcagaagatgtgcaagggaggaatgttctcacaaacttccat 389

                                                                       
Query: 382 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 441
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 390 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 449

                                  
Query: 442 gaggctcatgtcgatgtgaagac 464
           ||||| ||||| ||||| |||||
Sbjct: 450 gaggcccatgttgatgtcaagac 472



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 137
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 86  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 145

                                                     
Query: 138 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
            | |||||| |   | |||||| | ||||| |||||||||||
Sbjct: 146 ggcggatccttatgcaaagaaggactggtacgacatcaaggc 187



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 565 cagatccgccggaagatggttgagat 590
           ||||||||| ||||||||||||||||
Sbjct: 573 cagatccgcaggaagatggttgagat 598



to top

>gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BAC 519K7 hardness locus region
          Length = 12998

 Score =  113 bits (57), Expect = 7e-22
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                        
Query: 429  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 488
            |||||||||||||||||||||||  ||||| ||||| |||||||| ||||||||||||||
Sbjct: 3401 gcagaccctcattgaggctcatgcagatgtcaagacaactgacaactacatgctccgcat 3460

                                         
Query: 489  gtttgccattggcttcaccaagagacgcc 517
            |||| ||| |||||||||||||| |||||
Sbjct: 3461 gtttcccactggcttcaccaagaaacgcc 3489



to top

>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus
              region
          Length = 160897

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                          
Query: 430    cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 489
              |||||||||| |||||||||||  ||||| ||||| ||||||||||||||||| ||||||
Sbjct: 128530 cagaccctcagtgaggctcatgcagatgtcaagacaactgacaattacatgcttcgcatg 128471

                                          
Query: 490    tttgccattggcttcaccaagagacgcc 517
              ||||||||||||||||| |||| |||||
Sbjct: 128470 tttgccattggcttcacaaagaaacgcc 128443



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                  
Query: 429    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
              ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 128702 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 128651



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 429    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
              |||||||| |||||| |||||||| ||||| ||||| |||||||||||||||
Sbjct: 128814 gcagacccacattgaagctcatgtagatgtcaagacaactgacaattacatg 128763



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 429    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
              ||||| |||||||||| ||||||| ||||| ||||| |||||||||||||||
Sbjct: 128758 gcagaacctcattgagactcatgtagatgtcaagacaactgacaattacatg 128707



to top

>gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA, complete cds
          Length = 899

 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 cagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaaggg 357
           |||||||||||||||||||| | | | |||||||  ||  | || ||||||||||| || 
Sbjct: 238 cagaacgatgaggaccaggctttccgcaagatcaagctgagggcggaggatgtgcagggc 297

                                                                       
Query: 358 atgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctctt 417
           | ||| || ||||| ||||||||||||||||| |||||||| ||||||||  ||||||| 
Sbjct: 298 aagaacgtgctcaccaacttctggggcatggacttcaccacggacaagctgcggtctctg 357

                                                                
Query: 418 gtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactga 470
           ||| | ||||||||||   | ||  ||||||| ||||||||||||||||||||
Sbjct: 358 gtgcgcaagtggcagagtttgatccaggctcacgtcgatgtgaagaccactga 410



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| ||||| ||| | |||||||| |||||||| | ||||||  ||||||||||  
Sbjct: 20  ccatggccgtcggaaaggataagcgcatttccaagggcaagaagggcggcaagaagaaaa 79

                                                         
Query: 137 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc 182
             || ||||||||| |||||||| | ||||||||||||||||||||
Sbjct: 80  ttgtcgatccgttctccaagaaggactggtatgacatcaaggcgcc 125



to top

>gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein mRNA, complete
           cds
          Length = 1045

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 261
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 197 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 256

                                                                       
Query: 262 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 321
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 257 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 316

                                                                       
Query: 322 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 381
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 317 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 376

                                                                       
Query: 382 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 441
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 377 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 436

                                  
Query: 442 gaggctcatgtcgatgtgaagac 464
           ||||| ||||| ||||| |||||
Sbjct: 437 gaggcccatgttgatgtaaagac 459



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 137
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 73  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 132

                                                     
Query: 138 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 133 ggcggatccttacgcaaagaaggactggtacgacatcaaggc 174



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 565 cagatccgccggaagatggttgagat 590
           ||||||||| ||||||||||||||||
Sbjct: 560 cagatccgcaggaagatggttgagat 585



to top

>gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein mRNA, complete
           cds
          Length = 1038

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 261
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 181 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 240

                                                                       
Query: 262 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 321
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 241 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 300

                                                                       
Query: 322 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 381
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 301 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 360

                                                                       
Query: 382 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 441
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 361 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 420

                                  
Query: 442 gaggctcatgtcgatgtgaagac 464
           ||||| ||||| ||||| |||||
Sbjct: 421 gaggcccatgttgatgtaaagac 443



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 565 cagatccgccggaagatggttgagat 590
           ||||||||| ||||||||||||||||
Sbjct: 544 cagatccgcaggaagatggttgagat 569



to top

>gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, complete cds
          Length = 998

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 202 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 261
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 157 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 216

                                                                       
Query: 262 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 321
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 217 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 276

                                                                       
Query: 322 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 381
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 277 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 336

                                                                       
Query: 382 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 441
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 337 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 396

                                  
Query: 442 gaggctcatgtcgatgtgaagac 464
           ||||| ||||| ||||| |||||
Sbjct: 397 gaggcccatgttgatgtaaagac 419



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 137
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 33  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 92

                                                     
Query: 138 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 93  ggcggatccttacgcaaagaaggactggtacgacatcaaggc 134



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 565 cagatccgccggaagatggttgagat 590
           ||||||||| ||||||||||||||||
Sbjct: 520 cagatccgcaggaagatggttgagat 545



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                            
Query: 242      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
                ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 10823785 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 10823726

                                                                            
Query: 302      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
                | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 10823725 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 10823666

                                     
Query: 362      atgtcctcacaaacttctggg 382
                |||||||||| || |||||||
Sbjct: 10823665 atgtcctcacgaatttctggg 10823645



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 77       ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 135
                ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 10824694 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 10824636



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                            
Query: 439      attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 498
                ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 10823493 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 10823434

                                                   
Query: 499      ggcttcaccaagagacgcccaaaccaggtcaagcg 533
                || ||||||||| | |||||||| ||||| |||||
Sbjct: 10823433 ggtttcaccaagcgccgcccaaatcaggtgaagcg 10823399



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                            
Query: 152      ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 211
                |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 10824487 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 10824428

                                                
Query: 212      agaccctcgtgtccaggacacagggtaccaag 243
                |||||||||| |||||||| ||||| ||||||
Sbjct: 10824427 agaccctcgtctccaggacccaggggaccaag 10824396



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                              
Query: 566      agatccgccggaagatggttgagatcatgg 595
                ||||||||||||||||||||||||||||||
Sbjct: 10823258 agatccgccggaagatggttgagatcatgg 10823229



to top

>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1756_H07
          Length = 217205

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                         
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
             ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 29984 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 29925

                                                                         
Query: 302   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
             | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 29924 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 29865

                                  
Query: 362   atgtcctcacaaacttctggg 382
             |||||||||| || |||||||
Sbjct: 29864 atgtcctcacgaatttctggg 29844



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 77    ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 135
             ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 30893 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 30835



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                         
Query: 439   attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 498
             ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 29692 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 29633

                                                
Query: 499   ggcttcaccaagagacgcccaaaccaggtcaagcg 533
             || ||||||||| | |||||||| ||||| |||||
Sbjct: 29632 ggtttcaccaagcgccgcccaaatcaggtgaagcg 29598



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                         
Query: 152   ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 211
             |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 30686 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 30627

                                             
Query: 212   agaccctcgtgtccaggacacagggtaccaag 243
             |||||||||| |||||||| ||||| ||||||
Sbjct: 30626 agaccctcgtctccaggacccaggggaccaag 30595



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                           
Query: 566   agatccgccggaagatggttgagatcatgg 595
             ||||||||||||||||||||||||||||||
Sbjct: 29457 agatccgccggaagatggttgagatcatgg 29428



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1115_D03
          Length = 169378

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                          
Query: 242    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
              ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 163266 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 163207

                                                                          
Query: 302    acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 361
              | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 163206 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 163147

                                   
Query: 362    atgtcctcacaaacttctggg 382
              |||||||||| || |||||||
Sbjct: 163146 atgtcctcacgaatttctggg 163126



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 77     ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 135
              ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 164175 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 164117



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                          
Query: 439    attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 498
              ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 162974 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 162915

                                                 
Query: 499    ggcttcaccaagagacgcccaaaccaggtcaagcg 533
              || ||||||||| | |||||||| ||||| |||||
Sbjct: 162914 ggtttcaccaagcgccgcccaaatcaggtgaagcg 162880



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                          
Query: 152    ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 211
              |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 163968 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 163909

                                              
Query: 212    agaccctcgtgtccaggacacagggtaccaag 243
              |||||||||| |||||||| ||||| ||||||
Sbjct: 163908 agaccctcgtctccaggacccaggggaccaag 163877



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                            
Query: 566    agatccgccggaagatggttgagatcatgg 595
              ||||||||||||||||||||||||||||||
Sbjct: 162739 agatccgccggaagatggttgagatcatgg 162710



to top

>dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS1 gene
          Length = 10603

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 67/74 (90%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 429  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 488
            ||||||||||| |||||||||||  ||||| ||||| |||||||||| ||||||| ||||
Sbjct: 4956 gcagaccctcagtgaggctcatgcagatgtcaagacaactgacaatt-catgctctgcat 4898

                          
Query: 489  gtttgccattggct 502
            ||||||||||||||
Sbjct: 4897 gtttgccattggct 4884



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 429  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
            ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 5127 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 5076



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 429  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 480
            |||||||||||||||| ||||||| ||||| ||||| |||||||| ||||||
Sbjct: 5183 gcagaccctcattgagcctcatgtagatgtcaagacaactgacaaatacatg 5132



to top

>gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete sequence
          Length = 145314

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Plus

                                                                         
Query: 385   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 48503 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 48562

                                                                         
Query: 445   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 504
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 48563 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 48622

                                                                  
Query: 505   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 557
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 48623 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 48675



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 78    catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 134
             |||||||||||| ||||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 47391 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 47447



to top

>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence
          Length = 108644

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                         
Query: 385   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 42408 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 42349

                                                                         
Query: 445   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 504
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 42348 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 42289

                                                                  
Query: 505   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 557
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 42288 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 42236



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 78    catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 134
             |||||||||||| ||||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 43520 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 43464



to top

>dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-phase specific
           ribosomal protein cyc07, complete cds
          Length = 980

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 385 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
           |||||||||||| | ||||||||  | ||||| ||  |||| |||||||| |||||||| 
Sbjct: 367 atggatttcacctccgacaagctgcgatctctcgtacggaaatggcagactctcattgaa 426

                                      
Query: 445 gctcatgtcgatgtgaagaccactgac 471
           || ||||||||||||||||||||||||
Sbjct: 427 gcccatgtcgatgtgaagaccactgac 453



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 137
           |||||| || || |||||||||||| | || ||||| | |||||||| |||||| |||| 
Sbjct: 60  catggctgttggaaagaacaagcgcctttcgaagggcaagaagggtatcaagaaaaaggt 119

                                                         
Query: 138 cgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccg 183
           ||| ||||||||| |||  ||| | ||||| || ||||| ||||||
Sbjct: 120 cgtcgatccgttctccagaaaggactggtacgatatcaaagcgccg 165



to top

>gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal protein S3a-like
           protein mRNA, complete cds
          Length = 1059

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 229 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 288
           ||||||||||| |||||||| ||||| ||||||||||| || ||||||||||| ||  | 
Sbjct: 182 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgtttgaagtgtcattg 241

                                                                       
Query: 289 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 348
           |||||||||||||| || || || ||  ||| |||||||||  | ||  | ||||| |||
Sbjct: 242 gctgatcttcagaatgacgaagatcactccttcaggaagattcgtcttagagctgaagat 301

                                                                       
Query: 349 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 408
           || ||||| |  |||||| | |||||||||   || ||||| |||||||| || ||  | 
Sbjct: 302 gtccaaggaagaaatgtcttgacaaacttccatggtatggacttcaccacagataaattg 361

                                                                       
Query: 409 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 468
           ||||| ||||| | ||| |||||  |  | |||||||||||||| ||||| ||||| |||
Sbjct: 362 aggtcacttgtaaagaaatggcaatcattgattgaggctcatgttgatgttaagacaact 421

             
Query: 469 ga 470
           ||
Sbjct: 422 ga 423



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 137
           |||||| ||||| ||||||||||| || ||||| || | ||||||  | |||||||||||
Sbjct: 31  catggccgtcggtaagaacaagcgaatttccaaaggcaagaagggaggaaagaagaaggc 90



to top

>gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA, complete cds
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 232 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 291
           |||||||| |||||||| || |||||  |||| || ||||||||||| || ||| | |||
Sbjct: 223 cagggtactaagattgcttccgagggattgaaacatcgggtgtttgaggtgtctttggct 282

                                                                       
Query: 292 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 351
           ||||| ||||| ||||| || ||  ||||||| |||||| |  |  | ||||| || || 
Sbjct: 283 gatctccagaatgatgaagatcattcctacagaaagatccggttgagagctgaagacgtt 342

                                                                       
Query: 352 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 411
           ||||||| ||||||  | || || |||||||| |||||| | ||||| || |||||||||
Sbjct: 343 caagggaagaatgttttgaccaatttctggggtatggatgttaccacagataagctcagg 402

                                                                       
Query: 412 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 471
           || ||||||| ||| |||||| |  | || || || ||||||||||| ||||| || |||
Sbjct: 403 tcgcttgtgaagaaatggcagtctttgatcgaagcacatgtcgatgttaagacaaccgac 462

             
Query: 472 aa 473
           ||
Sbjct: 463 aa 464



to top

>gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence
          Length = 1229

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 495 cattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaag 554
           |||||| || |||||||| |||||||||||||||||| | || ||||||||||| |||  
Sbjct: 603 cattggttttaccaagaggcgcccaaaccaggtcaagagaacctgctatgctcaggcatc 544

                                                        
Query: 555 tcagatcagacagatccgccggaagatggttgagatcatggtcaa 599
            |||||  | ||||| ||||| |||||||||||||| ||| ||||
Sbjct: 543 ccagattcggcagattcgccgcaagatggttgagattatgatcaa 499



to top

>ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 1 (LOC575056), mRNA
          Length = 1003

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 257
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189

                                                                
Query: 258 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 310
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 568 atccgccggaagatggttgagatcatgg 595
           |||||| |||||||| ||||||||||||
Sbjct: 497 atccgcaggaagatgattgagatcatgg 524



to top

>ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 2 (LOC575056), mRNA
          Length = 749

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 257
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189

                                                                
Query: 258 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 310
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 568 atccgccggaagatggttgagatcatgg 595
           |||||| |||||||| ||||||||||||
Sbjct: 497 atccgcaggaagatgattgagatcatgg 524



to top

>ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S3a (V-fos transformation effector protein)
           (LOC585229), partial mRNA
          Length = 327

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 257
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 96  ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 155

                                                                
Query: 258 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 310
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 156 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 208



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 242  agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
            |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 4117 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 4176

                                         
Query: 302  acgatgaggaccaggcctacaggaagatc 330
            | ||||||||  | |||||||||||||||
Sbjct: 4177 atgatgaggataatgcctacaggaagatc 4205



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 385  atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
            ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 4330 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 4389

                                   
Query: 445  gctcatgtcgatgtgaagaccac 467
            || |||||||||||||| |||||
Sbjct: 4390 gcccatgtcgatgtgaaaaccac 4412



to top

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                          
Query: 242    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
              |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 195038 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 195097

                                           
Query: 302    acgatgaggaccaggcctacaggaagatc 330
              | ||||||||  | |||||||||||||||
Sbjct: 195098 atgatgaggataatgcctacaggaagatc 195126



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                          
Query: 385    atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
              ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 195251 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 195310

                                     
Query: 445    gctcatgtcgatgtgaagaccac 467
              || |||||||||||||| |||||
Sbjct: 195311 gcccatgtcgatgtgaaaaccac 195333



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 301
             |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 85349 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 85408

                                          
Query: 302   acgatgaggaccaggcctacaggaagatc 330
             | ||||||||  | |||||||||||||||
Sbjct: 85409 atgatgaggataatgcctacaggaagatc 85437



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 385   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 444
             ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 85562 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 85621

                                    
Query: 445   gctcatgtcgatgtgaagaccac 467
             || |||||||||||||| |||||
Sbjct: 85622 gcccatgtcgatgtgaaaaccac 85644



to top

>ref|NM_111356.3| Arabidopsis thaliana structural constituent of ribosome AT3G04840
           mRNA, complete cds
          Length = 1004

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 463 accactgacaattaca 478
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 137 ccgtggatccgttcaccaagaa 158
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



to top

>gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840) mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 145 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 204

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 205 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 264

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 265 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 324

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 325 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 384

                           
Query: 463 accactgacaattaca 478
           ||||| |||| |||||
Sbjct: 385 accaccgacagttaca 400



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 423 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 482

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 483 ccgtcagatccgcaggaagatg 504



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 79  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 138
           ||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||| 
Sbjct: 1   atggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaaggct 60

                               
Query: 139 gtggatccgttcaccaagaa 158
           || ||||| ||| |||||||
Sbjct: 61  gttgatcctttctccaagaa 80



to top

>gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840; T9J14.21) mRNA, complete cds
          Length = 1000

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 202 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 261

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 262 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 321

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 322 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 381

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 382 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 441

                           
Query: 463 accactgacaattaca 478
           ||||| |||| |||||
Sbjct: 442 accaccgacagttaca 457



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 480 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 539

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 540 ccgtcagatccgcaggaagatg 561



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 56  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 115

                                 
Query: 137 ccgtggatccgttcaccaagaa 158
           | || ||||| ||| |||||||
Sbjct: 116 ctgttgatcctttctccaagaa 137



to top

>emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 927

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 135 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 194

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 195 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 254

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 255 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 314

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 315 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 374

                           
Query: 463 accactgacaattaca 478
           ||||| |||| |||||
Sbjct: 375 accaccgacagttaca 390



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 413 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 472

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 473 ccgtcagatccgcaggaagatg 494



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 94  aacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcacc 153
           |||||| | ||||| ||||| ||||||||  | ||||||||||| || ||||| ||| ||
Sbjct: 6   aacaagagaatctctaagggtaggaagggaggaaagaagaaggctgttgatcctttctcc 65

                
Query: 154 aagaa 158
           |||||
Sbjct: 66  aagaa 70



to top

>gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete sequence
          Length = 1001

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 223 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 282
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 283 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 342
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 343 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 402
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 403 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 462
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 463 accactgacaattaca 478
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 77  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 136
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 137 ccgtggatccgttcaccaagaa 158
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



to top

>dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                       
Query: 373 aacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcag 432
           ||||||||||| ||||| ||||| || || ||| | ||||||||||||||||||||||| 
Sbjct: 366 aacttctggggtatggacttcactacagataagttgaggtctcttgtgaggaagtggcaa 425

                                                   
Query: 433 accctcattgaggctcatgtcgatgtgaagaccactgaca 472
            || | || || |||||||| ||||| ||||| |||||||
Sbjct: 426 tccttgatagaagctcatgttgatgttaagacaactgaca 465



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 74  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 133
           |||||||||| ||||| ||||||||| | || || ||||| | ||| ||  | |||||||
Sbjct: 67  caaccatggccgtcggtaagaacaagaggatatcgaagggtaagaaaggaggaaagaaga 126

                                                         
Query: 134 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           |||| | |||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 127 aggcagcggatccatttgccaagaaggattggtatgatatcaaggc 172



to top

>gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence
          Length = 1053

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 229 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 288
           ||||||||||| |||||||| ||||| ||||||||||| || ||||| ||||| ||  | 
Sbjct: 222 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgttcgaagtgtcattg 281

                         
Query: 289 gctgatcttcagaa 302
           ||||||||||||||
Sbjct: 282 gctgatcttcagaa 295



to top

>ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein
           s3ae-a (s1-a) (CNB04880) partial mRNA
          Length = 826

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 76  accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 135
           |||||||| ||||||||||||||| |  | || ||||| | |||||| |  |||||||||
Sbjct: 10  accatggctgtcggcaagaacaagaggctttcaaagggaaagaagggaattaagaagaag 69

                                                       
Query: 136 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           | ||| || || ||||||| |||| ||||||| |||||||||||
Sbjct: 70  gtcgtcgaccccttcaccaggaaggagtggtacgacatcaaggc 113



to top

>emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 716

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 376 ttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagacc 435
           |||||||||||||| |||||||| || || || |||||  | || | |||||||||||| 
Sbjct: 68  ttctggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagact 127

                                                      
Query: 436 ctcattgaggctcatgtcgatgtgaagaccactgacaattaca 478
            | |||||||||||||| ||||| || ||||| |||| |||||
Sbjct: 128 ttgattgaggctcatgttgatgttaaaaccaccgacagttaca 170



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 501 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 560
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 193 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 252

                                 
Query: 561 cagacagatccgccggaagatg 582
           | | ||||||||| ||||||||
Sbjct: 253 ccgtcagatccgcaggaagatg 274



to top

>ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC422477),
           mRNA
          Length = 1423

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 76  accatggcggtcggcaagaacaagcgcatctccaaggg 113
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 661 accatggcggtcggcaagaacaagcgcctcaccaaggg 698



to top

>emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical protein, clone 13j13
          Length = 107

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 76  accatggcggtcggcaagaacaagcgcatctccaaggg 113
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgcctcaccaaggg 60



to top

>gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRNA, complete cds
          Length = 858

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 76  accatggcggtcggcaagaacaagcgcatctccaaggg 113
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 4   accatggcggtcggcaagaacaagcgcctcaccaaggg 41



to top

>gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA sequence
          Length = 157

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 73  gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 132
           |||| |||||| ||||| |||||||||||| |||| ||||| | |||||||| |||||||
Sbjct: 69  gcaatcatggctgtcggaaagaacaagcgcctctcaaagggaaagaagggtatcaagaag 128

            
Query: 133 a 133
           |
Sbjct: 129 a 129



to top

>gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds
          Length = 759

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 394 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 453
           ||||| ||||| |||||| | ||||| | ||| |||||||| || ||||||||  |||||
Sbjct: 313 accacagacaaactcagggcacttgtaaagaaatggcagactctgattgaggccaatgtc 372

                            
Query: 454 gatgtgaagaccactga 470
           ||||||||||| |||||
Sbjct: 373 gatgtgaagacaactga 389



to top

>dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, complete cds
          Length = 4798

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                        
Query: 409  aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 468
            |||||||||||||||||||||||  || | || || |||||||| ||||| ||||| |||
Sbjct: 3458 aggtctcttgtgaggaagtggcaatccttgatagaagctcatgttgatgttaagacaact 3517

                
Query: 469  gaca 472
            ||||
Sbjct: 3518 gaca 3521



to top

>gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:117914
           IMAGE:2599128), complete cds
          Length = 870

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 12  accatggcggtcggcaagaacaagcgc 38



to top

>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete
             sequence
          Length = 196911

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             |||||||||||||||||||||||||||
Sbjct: 22654 accatggcggtcggcaagaacaagcgc 22628



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             |||||||||||||||||||||||||||
Sbjct: 81045 accatggcggtcggcaagaacaagcgc 81019



to top

>gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102469
           IMAGE:5319512), complete cds
          Length = 869

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 14  accatggcggtcggcaagaacaagcgc 40



to top

>gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102070
           IMAGE:6820218), complete cds
          Length = 861

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 3   accatggcggtcggcaagaacaagcgc 29



to top

>ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 4 (LOC613340), mRNA
          Length = 872

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 1 (LOC613340), mRNA
          Length = 910

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 32  accatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 3 (LOC613340), mRNA
          Length = 587

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 2 (LOC613340), mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 6
           (LOC613460), mRNA
          Length = 918

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 5
           (LOC613460), mRNA
          Length = 862

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 2
           (LOC613460), mRNA
          Length = 876

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 4
           (LOC613460), mRNA
          Length = 584

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 3
           (LOC613460), mRNA
          Length = 714

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosome 3, complete sequence
          Length = 192136

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             |||||||||||||||||||||||||||
Sbjct: 21193 accatggcggtcggcaagaacaagcgc 21219



to top

>ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC674452), mRNA
          Length = 889

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC668144), mRNA
          Length = 889

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC544977), mRNA
          Length = 895

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC668799), mRNA
          Length = 847

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC677290), mRNA
          Length = 853

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>emb|Z83368.1|MMRPS3A M.musculus RPS3a gene
          Length = 5695

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 842 accatggcggtcggcaagaacaagcgc 868



to top

>gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102071
           IMAGE:6824188), complete cds
          Length = 872

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 10  accatggcggtcggcaagaacaagcgc 36



to top

>dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730048K19 product:ribosomal protein S3a, full
           insert sequence
          Length = 871

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720473N01 product:ribosomal protein S3a, full
           insert sequence
          Length = 864

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830044H24 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015K17 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015H22 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length
           enriched library, clone:C820015M15 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030B03 product:ribosomal
           protein S3a, full insert sequence
          Length = 864

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830007K16 product:ribosomal
           protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0005O17 product:40S ribosomal protein
           S3a homolog [Mus musculus], full insert sequence
          Length = 865

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830165N20 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK167562.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530022H01
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK167512.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530018C11
           product:ribosomal protein S3a, full insert sequence
          Length = 870

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420030N20 product:ribosomal protein S3a,
           full insert sequence
          Length = 869

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730070G06 product:ribosomal protein S3a, full
           insert sequence
          Length = 868

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410029J05 product:ribosomal protein S3a, full
           insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E09 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004H05
           product:ribosomal protein S3a, full insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920016J02
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:49186
           IMAGE:5025347), complete cds
          Length = 877

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700038N16 product:ribosomal
           protein S3a, full insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence
          Length = 164201

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             |||||||||||||||||||||||||||
Sbjct: 92495 accatggcggtcggcaagaacaagcgc 92469



to top

>dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000029722, based on BLAT search
          Length = 282

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||||||
Sbjct: 9   accatggcggtcggcaagaacaagcgc 35



to top

>emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chromosome 14, complete
             sequence
          Length = 142749

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             |||||||||||||||||||||||||||
Sbjct: 34612 accatggcggtcggcaagaacaagcgc 34586



to top

>emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chromosome 2, complete
              sequence
          Length = 208363

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 76     accatggcggtcggcaagaacaagcgc 102
              |||||||||||||||||||||||||||
Sbjct: 155043 accatggcggtcggcaagaacaagcgc 155017



to top

>ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 13 (RPS3A), mRNA
          Length = 1051

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 12 (RPS3A), mRNA
          Length = 1051

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 11 (RPS3A), mRNA
          Length = 852

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 51  ccatggcggtcggcaagaacaagcgc 76



to top

>ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 10 (RPS3A), mRNA
          Length = 1065

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 9 (RPS3A), mRNA
          Length = 1056

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 8 (RPS3A), mRNA
          Length = 982

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 7 (RPS3A), mRNA
          Length = 912

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 6 (RPS3A), mRNA
          Length = 876

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 20  ccatggcggtcggcaagaacaagcgc 45



to top

>ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 1 (RPS3A), mRNA
          Length = 1106

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 62  ccatggcggtcggcaagaacaagcgc 87



to top

>ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 4 (RPS3A), mRNA
          Length = 769

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 17  ccatggcggtcggcaagaacaagcgc 42



to top

>ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 3 (RPS3A), mRNA
          Length = 774

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 2 (RPS3A), mRNA
          Length = 553

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC609500), mRNA
          Length = 875

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC609500), mRNA
          Length = 857

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC609500), mRNA
          Length = 866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC609500), mRNA
          Length = 1072

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC609500), mRNA
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC609500), mRNA
          Length = 1069

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC609500), mRNA
          Length = 760

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 16  ccatggcggtcggcaagaacaagcgc 41



to top

>ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 12 (LOC608454), mRNA
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 11 (LOC608454), mRNA
          Length = 875

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 10 (LOC608454), mRNA
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 9 (LOC608454), mRNA
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 8 (LOC608454), mRNA
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC608454), mRNA
          Length = 882

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC608454), mRNA
          Length = 1042

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 10  ccatggcggtcggcaagaacaagcgc 35



to top

>ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC608454), mRNA
          Length = 1047

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 15  ccatggcggtcggcaagaacaagcgc 40



to top

>ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608454), mRNA
          Length = 1080

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC608454), mRNA
          Length = 1058

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 26  ccatggcggtcggcaagaacaagcgc 51



to top

>ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC608454), mRNA
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608454), mRNA
          Length = 759

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 381   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 440
             ||||||||| |||||||| || || || |||||  | || | ||||||||||||  | ||
Sbjct: 74315 gggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttgat 74256

                                                   
Query: 441   tgaggctcatgtcgatgtgaagaccactgacaattaca 478
             |||||||||||| ||||| || ||||| |||| |||||
Sbjct: 74255 tgaggctcatgttgatgttaaaaccaccgacagttaca 74218



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 501   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 549
             |||||||||||||||  | |||||||||||| | |||||||| ||||||
Sbjct: 74195 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaa 74147



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 242   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttca 299
             ||||||||||||| ||| |||| ||| | || ||||| || ||||| |||||||||||
Sbjct: 74563 agattgcctcagaaggcttgaaacacagagtttttgaggtttctcttgctgatcttca 74506



to top

>emb|X68555.1|ACKRPA A.californica KRP-A gene
          Length = 849

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgt 458
           |||||||||| | ||| | |||| |||||||||||| || ||||||||  |||| |||||
Sbjct: 330 tgacaagctctgctctatggtgaagaagtggcagactcttattgaggccaatgttgatgt 389

                 
Query: 459 gaagac 464
           ||||||
Sbjct: 390 gaagac 395



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 289 gctgatcttcagaacgatgagg 310
           ||||||||||||||||||||||
Sbjct: 223 gctgatcttcagaacgatgagg 244



to top

>gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds
          Length = 893

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 229 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 288
           |||||||| || |||||||| ||||||||  ||||| || | ||||||||||| ||||| 
Sbjct: 162 acacagggcacaaagattgcgtcagagggtttgaagtacagagtgtttgaagtgtctctg 221

                 
Query: 289 gctgat 294
           ||||||
Sbjct: 222 gctgat 227



to top

>gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cDNA clone MGC:72868
           IMAGE:6887884), complete cds
          Length = 896

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 375 aagtggcagaccatgattgaagctcatgttgatgtgaagac 415



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||| ||||||||||||
Sbjct: 27  accatggcggtcgggaagaacaagcgc 53



to top

>ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a), mRNA
          Length = 880

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||| ||||||||||||
Sbjct: 22  accatggcggtcgggaagaacaagcgc 48



to top

>gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like protein mRNA, partial
           cds
          Length = 489

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 423 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccac 467
           ||||||||||||||| || ||||| ||||| || |||||||||||
Sbjct: 36  gaagtggcagaccctgatcgaggcccatgtggacgtgaagaccac 80



to top

>emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for ribosomal protein S3a
          Length = 880

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||| ||||||||||||
Sbjct: 22  accatggcggtcgggaagaacaagcgc 48



to top

>gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 922

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggg 113
           |||||||||||| |||||||||||| || |||||||
Sbjct: 43  catggcggtcgggaagaacaagcgcctcaccaaggg 78



to top

>gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 893

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggg 113
           |||||||||||| |||||||||||| || |||||||
Sbjct: 40  catggcggtcgggaagaacaagcgcctcaccaaggg 75



to top

>gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 630

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 78  catggcggtcggcaagaacaagcgcatctccaaggg 113
           |||||||||||| |||||||||||| || |||||||
Sbjct: 24  catggcggtcgggaagaacaagcgcctcaccaaggg 59



to top

>ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 8
          (LOC613769), mRNA
          Length = 900

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 49 accatggcggtcggcaagaacaag 72



to top

>ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 7
          (LOC613769), mRNA
          Length = 879

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 6
          (LOC613769), mRNA
          Length = 884

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 5
          (LOC613769), mRNA
          Length = 871

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 20 accatggcggtcggcaagaacaag 43



to top

>ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 4
          (LOC613769), mRNA
          Length = 890

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 3
          (LOC613769), mRNA
          Length = 878

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 2
          (LOC613769), mRNA
          Length = 876

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                  
Query: 76 accatggcggtcggcaagaacaag 99
          ||||||||||||||||||||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_519223.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3a; 40S
           ribosomal protein S3a; v-fos transformation effector
           protein 1 (LOC463560), mRNA
          Length = 649

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 5   accatggcggttggcaagaacaagcgc 31



to top

>ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA
          Length = 865

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||| ||||||
Sbjct: 24  accatggcggtcggcaagaataagcgc 50



to top

>ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC607868),
           mRNA
          Length = 1106

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 80  tggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||||||
Sbjct: 75  tggcggtcggcaagaacaagcgc 97



to top

>gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, complete sequence
          Length = 156195

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             ||||||||||| |||||||||||||||
Sbjct: 74343 accatggcggttggcaagaacaagcgc 74317



to top

>ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC670633), mRNA
          Length = 893

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 33  accatggcggttggcaagaacaagcgc 59



to top

>gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:3160242),
            **** WARNING: chimeric clone ****
          Length = 2436

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 76   accatggcggtcggcaagaacaagcgc 102
            ||||||||||| |||||||||||||||
Sbjct: 1578 accatggcggttggcaagaacaagcgc 1604



to top

>gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone
           IMAGE:5022252), **** WARNING: chimeric clone ****
          Length = 1551

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 670 accatggcggttggcaagaacaagcgc 696



to top

>gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNING: chimeric clone
           ****
          Length = 1415

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 555 accatggcggttggcaagaacaagcgc 581



to top

>gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNING: chimeric clone
            ****
          Length = 2186

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 76   accatggcggtcggcaagaacaagcgc 102
            ||||||||||| |||||||||||||||
Sbjct: 1325 accatggcggttggcaagaacaagcgc 1351



to top

>gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNING: chimeric clone
            ****
          Length = 2268

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 76   accatggcggtcggcaagaacaagcgc 102
            ||||||||||| |||||||||||||||
Sbjct: 1407 accatggcggttggcaagaacaagcgc 1433



to top

>gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNING: chimeric clone
           ****
          Length = 1553

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 670 accatggcggttggcaagaacaagcgc 696



to top

>emb|BX039677.1|CNS092S1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 130 aagaaggccgtggatccgttcac 152
           |||||||||||||||||||||||
Sbjct: 80  aagaaggccgtggatccgttcac 102



to top

>gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3883
           IMAGE:2906117), complete cds
          Length = 891

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clone DKFZp469E172)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 38  accatggcggttggcaagaacaagcgc 64



to top

>gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, complete sequence
          Length = 183478

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             ||||||||||| |||||||||||||||
Sbjct: 36381 accatggcggttggcaagaacaagcgc 36407



to top

>gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clone MGC:127088
           IMAGE:7943245), complete cds
          Length = 899

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||| ||||||
Sbjct: 20  accatggcggtcggcaagaataagcgc 46



to top

>ref|XR_001455.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC641829), mRNA
          Length = 731

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 15  accatggcggttggcaagaacaagcgc 41



to top

>ref|XR_001456.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a
           (LOC649582), mRNA
          Length = 731

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 15  accatggcggttggcaagaacaagcgc 41



to top

>ref|XR_001449.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a
           (LOC644972), mRNA
          Length = 731

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 15  accatggcggttggcaagaacaagcgc 41



to top

>dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-15704, similar to human
           ribosomal protein S3A (RPS3A), mRNA, RefSeq: NM_001006.2
          Length = 915

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 55  accatggcggttggcaagaacaagcgc 81



to top

>gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein S3a mRNA, complete
           cds
          Length = 865

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||| ||||||
Sbjct: 24  accatggcggtcggcaagaataagcgc 50



to top

>gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:1626
           IMAGE:3544072), complete cds
          Length = 906

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 40  accatggcggttggcaagaacaagcgc 66



to top

>gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88598
           IMAGE:6285242), complete cds
          Length = 868

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:18002
           IMAGE:3922810), complete cds
          Length = 869

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29710
           IMAGE:5020904), complete cds
          Length = 921

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 61  accatggcggttggcaagaacaagcgc 87



to top

>gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29668
           IMAGE:5020581), complete cds
          Length = 925

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 61  accatggcggttggcaagaacaagcgc 87



to top

>gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3109
           IMAGE:3350750), complete cds
          Length = 866

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:16359
           IMAGE:3927639), complete cds
          Length = 869

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:15425
           IMAGE:4308955), complete cds
          Length = 873

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 12  accatggcggttggcaagaacaagcgc 38



to top

>dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, highly similar to
           40S ribosomal protein S3A
          Length = 861

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 21  accatggcggttggcaagaacaagcgc 47



to top

>gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q21.2-q31.1, complete sequence
          Length = 132072

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             ||||||||||| |||||||||||||||
Sbjct: 85736 accatggcggttggcaagaacaagcgc 85710



to top

>ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA
          Length = 930

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 49  accatggcggttggcaagaacaagcgc 75



to top

>emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene
          Length = 5107

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 118 accatggcggttggcaagaacaagcgc 144



to top

>dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein S3a, partial cds,
           clone: ORCS12387
          Length = 644

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||||||||| ||||||
Sbjct: 4   accatggcggtcggcaagaataagcgc 30



to top

>gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, complete sequence
          Length = 176092

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             ||||||||||| |||||||||||||||
Sbjct: 48107 accatggcggttggcaagaacaagcgc 48133



to top

>gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88192
           IMAGE:5809691), complete cds
          Length = 892

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 23  accatggcggttggcaagaacaagcgc 49



to top

>gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:4136755)
          Length = 890

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 12  accatggcggttggcaagaacaagcgc 38



to top

>gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:13266
           IMAGE:4079651), complete cds
          Length = 871

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 3   accatggcggttggcaagaacaagcgc 29



to top

>emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chromosome 2, complete
             sequence
          Length = 207718

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 76    accatggcggtcggcaagaacaagcgc 102
             ||||||||||| |||||||||||||||
Sbjct: 62194 accatggcggttggcaagaacaagcgc 62220



to top

>gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein (Fte-1), mRNA complete
           cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 34  accatggcggttggcaagaacaagcgc 60



to top

>emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal protein S3a
          Length = 5529

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 384 accatggcggttggcaagaacaagcgc 410



to top

>gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation effector protein (Fte-1)
           mRNA, complete cds
          Length = 860

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           |||||||||||||| ||||||||||||
Sbjct: 16  accatggcggtcgggaagaacaagcgc 42



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||||||||| | ||||| |||||||| || ||||||||
Sbjct: 364 aagtggcagaccatgattgaagctcatgttgacgtgaagac 404



to top

>gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ribosomal protein S3
           homologue mRNA, complete cds
          Length = 845

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 76  accatggcggtcggcaagaacaagcgc 102
           ||||||||||| |||||||||||||||
Sbjct: 4   accatggcggttggcaagaacaagcgc 30



to top

>ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC515006), mRNA
          Length = 531

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 79  atggcggtcggcaagaacaagc 100
           ||||||||||||||||||||||
Sbjct: 1   atggcggtcggcaagaacaagc 22



to top

>ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608684), mRNA
          Length = 875

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608684), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 21  ccatggtggtcggcaagaacaagcgc 46



to top

>ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC608684), mRNA
          Length = 717

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 7   ccatggtggtcggcaagaacaagcgc 32



to top

>ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC608684), mRNA
          Length = 579

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC607193), mRNA
          Length = 857

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC607193), mRNA
          Length = 866

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC607193), mRNA
          Length = 718

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 8   ccatggtggtcggcaagaacaagcgc 33



to top

>ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC607193), mRNA
          Length = 579

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC478437), mRNA
          Length = 891

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||||||||| |||||||||
Sbjct: 6   ccatggcggtcggcaaaaacaagcgc 31



to top

>ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC478437), mRNA
          Length = 755

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||||||||| |||||||||
Sbjct: 11  ccatggcggtcggcaaaaacaagcgc 36



to top

>ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608748), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||| |||||||||||||||
Sbjct: 27  ccatggcggtaggcaagaacaagcgc 52



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 424 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 464
           |||||||||||| | ||||| |||||||| ||||| |||||
Sbjct: 374 aagtggcagaccatgattgaagctcatgttgatgtaaagac 414



to top

>ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608748), mRNA
          Length = 720

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||| |||||||||||||||
Sbjct: 22  ccatggcggtaggcaagaacaagcgc 47



to top

>ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC608748), mRNA
          Length = 573

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||| |||||||||||||||
Sbjct: 16  ccatggcggtaggcaagaacaagcgc 41



to top

>ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC477063), mRNA
          Length = 579

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||||| |||||||||||||
Sbjct: 16  ccatggcggtcgacaagaacaagcgc 41



to top

>ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC477063), mRNA
          Length = 772

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 77  ccatggcggtcggcaagaacaagcgc 102
           |||||||||||| |||||||||||||
Sbjct: 3   ccatggcggtcgacaagaacaagcgc 28



to top

>ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC607824), mRNA
          Length = 844

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagac 464
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 79  atggcggtcggcaagaacaagcgc 102
           |||||||| |||||||||||||||
Sbjct: 8   atggcggttggcaagaacaagcgc 31



to top

>ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC607824), mRNA
          Length = 1060

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagac 464
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 79  atggcggtcggcaagaacaagcgc 102
           |||||||| |||||||||||||||
Sbjct: 8   atggcggttggcaagaacaagcgc 31



to top

>ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC607824), mRNA
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagac 464
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 337 tggcagaccatgattgaagctcatgttgatgtgaagac 374



to top

>emb|BX546465.7| Mouse DNA sequence from clone RP23-167N13 on chromosome 2, complete
             sequence
          Length = 81064

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 76    accatggcggtcggcaagaaca 97
             ||||||||||||||||||||||
Sbjct: 43557 accatggcggtcggcaagaaca 43536



to top

>gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, complete sequence
          Length = 167652

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 401    acaagctcaggtctcttgtgaggaagtgg 429
              |||||| ||||||||||| ||||||||||
Sbjct: 146589 acaagcccaggtctcttgagaggaagtgg 146617



to top

>gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500, complete sequence
          Length = 132678

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 213   gaccctcgtgtccaggacaca 233
             |||||||||||||||||||||
Sbjct: 26758 gaccctcgtgtccaggacaca 26738



to top

>gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, complete sequence
          Length = 244130

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 401    acaagctcaggtctcttgtgaggaagtgg 429
              |||||| ||||||||||| ||||||||||
Sbjct: 238451 acaagcccaggtctcttgagaggaagtgg 238479



to top

>ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D10395g)
           partial mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 127 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
           |||||||||| | | || || |||||||||||| | |||| ||||||||||||
Sbjct: 49  aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 101



to top

>ref|XM_950881.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial
           mRNA
          Length = 1014

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 108/137 (78%)
 Strand = Plus / Plus

                                                                       
Query: 391 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 450
           |||||| | ||||||||| | || |||||  | ||||||||||| |||||||||||  | 
Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615

                                                                       
Query: 451 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 510
            ||   || |||||||| ||| | ||| | |||||| | || ||||||| ||||||||||
Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675

                            
Query: 511 agacgcccaaaccaggt 527
            | ||||| ||||||||
Sbjct: 676 cgccgccctaaccaggt 692



to top

>ref|XM_327890.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial
           mRNA
          Length = 1014

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 108/137 (78%)
 Strand = Plus / Plus

                                                                       
Query: 391 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 450
           |||||| | ||||||||| | || |||||  | ||||||||||| |||||||||||  | 
Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615

                                                                       
Query: 451 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 510
            ||   || |||||||| ||| | ||| | |||||| | || ||||||| ||||||||||
Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675

                            
Query: 511 agacgcccaaaccaggt 527
            | ||||| ||||||||
Sbjct: 676 cgccgccctaaccaggt 692



to top

>ref|XM_677047.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8870.2), mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                       
Query: 91  aagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttc 150
           |||||||||||| | || ||||| | |||||||| |||||||| | | || ||||| |||
Sbjct: 13  aagaacaagcgcttgtcgaagggcaagaagggtatcaagaagaggactgttgatcccttc 72

                    
Query: 151 accaagaag 159
           |||| ||||
Sbjct: 73  accaggaag 81



to top

>ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S0.e.B, cytosolic
           (Afu5g05450) partial mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 501 cttcaccaagagacgcccaaaccag 525
           |||||||||||||||||| ||||||
Sbjct: 423 cttcaccaagagacgcccgaaccag 447



to top

>ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA
          Length = 1101

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 117  gaagggtagcaagaagaaggc 137
            |||||||||||||||||||||
Sbjct: 990  gaagggtagcaagaagaaggc 1010



to top

>emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, complete sequence
          Length = 29039

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 127   aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
             |||||||||||||||||||| ||| ||   ||| | ||||| |||||||||||
Sbjct: 23554 aagaagaaggccgtggatccattctcccgcaaggaatggtacgacatcaaggc 23606



to top

>gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA clone MGC:53968
           IMAGE:5570910), complete cds
          Length = 867

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 467
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 360 tggcagaccatgattgaagcccatgttgatgtgaagaccac 400



to top

>ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mRNA
          Length = 922

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 467
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396



to top

>gb|BC080969.1| Xenopus tropicalis rps3a protein, mRNA (cDNA clone MGC:79742
           IMAGE:6983416), complete cds
          Length = 922

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 427 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 467
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396



to top

>emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 132 gaaggccgtggatccgttcac 152
           |||||||||||||||||||||
Sbjct: 68  gaaggccgtggatccgttcac 88



to top

>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces
              hansenii
          Length = 1602771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 127    aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 179
              |||||||||| | | || || |||||||||||| | |||| ||||||||||||
Sbjct: 772733 aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 772681



to top

>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence
          Length = 992211

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 117    gaagggtagcaagaagaaggc 137
              |||||||||||||||||||||
Sbjct: 462782 gaagggtagcaagaagaaggc 462762


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,444,928
Number of Sequences: 3902068
Number of extensions: 4444928
Number of successful extensions: 81850
Number of sequences better than 10.0: 334
Number of HSP's better than 10.0 without gapping: 333
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 80675
Number of HSP's gapped (non-prelim): 1135
length of query: 599
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 576
effective length of database: 17,143,297,704
effective search space: 9874539477504
effective search space used: 9874539477504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top