Clone Name	bart12a05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DQ154923.1| Hordeum vulgare RAB7 (RAB7) gene, exons 1 through...	375	e-100
2	dbj|AK105140.1| Oryza sativa (japonica cultivar-group) cDNA clon...	341	1e-90
3	gb|AY829438.1| Pennisetum glaucum Rab7 mRNA, complete cds	228	1e-56
4	ref|XM_475776.1| Oryza sativa (japonica cultivar-group), predic...	226	6e-56
5	gb|U40219.1|PCU40219 Pennisetum ciliare possible apospory-associ...	202	9e-49
6	gb|AY108223.1| Zea mays PCO119199 mRNA sequence	196	5e-47
7	dbj|AK111495.1| Oryza sativa (japonica cultivar-group) cDNA clon...	192	8e-46
8	ref|NM_188576.1| Oryza sativa (japonica cultivar-group), predic...	180	3e-42
9	ref|XM_475712.1| Oryza sativa (japonica cultivar-group), predic...	180	3e-42
10	dbj|AK112031.1| Oryza sativa (japonica cultivar-group) cDNA clon...	180	3e-42
11	dbj|AK111896.1| Oryza sativa (japonica cultivar-group) cDNA clon...	180	3e-42
12	dbj|AK070320.1| Oryza sativa (japonica cultivar-group) cDNA clon...	180	3e-42
13	dbj|AK059958.1| Oryza sativa (japonica cultivar-group) cDNA clon...	180	3e-42
14	gb|AY226827.1| Oryza sativa (indica cultivar-group) small GTP bi...	165	2e-37
15	gb|AY109438.1| Zea mays CL8348_1 mRNA sequence	161	3e-36
16	gb|AF467541.1| Zea mays putative aldehyde dehydrogenase MIS1 (mi...	137	4e-29
17	gb|DQ154924.1| Triticum turgidum RAB7 (RAB7) gene, exons 1, 2 an...	135	2e-28
18	ref|XM_791270.1| PREDICTED: Strongylocentrotus purpuratus rab7 G...	125	2e-25
19	gb|BC102415.1| Bos taurus similar to Ras-related protein Rab-7, ...	125	2e-25
20	ref|NM_001035081.1| Bos taurus similar to Ras-related protein Ra...	125	2e-25
21	ref|XM_526302.1| PREDICTED: Pan troglodytes similar to Ras-relat...	123	6e-25
22	ref|NM_004637.5| Homo sapiens RAB7, member RAS oncogene family (...	123	6e-25
23	gb|U44104.1|HSU44104 Homo sapiens small GTP binding protein Rab7...	123	6e-25
24	emb|X93499.1|HSRAB7 H.sapiens mRNA for RAB7 protein	123	6e-25
25	gb|BC008721.2| Homo sapiens RAB7, member RAS oncogene family, mR...	123	6e-25
26	gb|AF498942.1| Homo sapiens small GTP binding protein RAB7 (RAB7...	123	6e-25
27	dbj|AK000826.1| Homo sapiens cDNA FLJ20819 fis, clone ADSE00511	123	6e-25
28	gb|BC013728.1| Homo sapiens RAB7, member RAS oncogene family, mR...	123	6e-25
29	gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome...	119	1e-23
30	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	119	1e-23
31	emb|CR859246.1| Pongo pygmaeus mRNA; cDNA DKFZp459E131 (from clo...	115	2e-22
32	gb|AF050175.1|AF050175 Homo sapiens Rab7 (Rab7) gene, complete cds	115	2e-22
33	emb|BX537775.1|HSM805862 Homo sapiens mRNA; cDNA DKFZp779L0164 (...	115	2e-22
34	ref|XM_414359.1| PREDICTED: Gallus gallus similar to Ras-related...	107	4e-20
35	emb|CR406454.1| Gallus gallus finished cDNA, clone ChEST950l22	107	4e-20
36	ref|NM_191744.1| Oryza sativa (japonica cultivar-group), predic...	105	1e-19
37	gb|U13170.1|CRU13170 Chlamydomonas reinhardtii YptC5 (yptC5) gen...	105	1e-19
38	gb|AY871298.1| Gekko japonicus GekBS079P mRNA, complete cds	105	1e-19
39	ref|NM_001005591.1| Danio rerio zgc:100918 (zgc:100918), mRNA	103	6e-19
40	gb|BC082296.1| Danio rerio zgc:100918, mRNA (cDNA clone MGC:1009...	103	6e-19
41	ref|XM_307368.2| Anopheles gambiae str. PEST ENSANGP00000013739 ...	101	2e-18
42	ref|XM_321482.2| Anopheles gambiae str. PEST ENSANGP00000018151 ...	98	4e-17
43	emb|CR698058.1|CNS0G1KM Tetraodon nigroviridis full-length cDNA	94	6e-16
44	gb|U82219.1|PAU82219 Prunus armeniaca Rab7 GTP binding protein m...	92	2e-15
45	gb|AF050174.1|AF050174 Oryctolagus cuniculus Rab7 (Rab7) mRNA, c...	82	2e-12
46	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	80	8e-12
47	ref|NM_001003316.1| Canis familiaris RAB7, member RAS oncogene f...	80	8e-12
48	dbj|AP002867.1| Oryza sativa (japonica cultivar-group) genomic D...	80	8e-12
49	dbj|AP003338.3| Oryza sativa (japonica cultivar-group) genomic D...	80	8e-12
50	gb|L14930.1|SOYRAB7P Glycine max (Rab7p) mRNA, complete cds	80	8e-12
51	gb|M35522.1|DOGRAB7A C.familiaris GTP-binding protein (rab7) mRN...	80	8e-12
52	gb|BC060401.1| Xenopus laevis hypothetical protein MGC68523, mRN...	78	3e-11
53	dbj|AK094449.1| Homo sapiens cDNA FLJ37130 fis, clone BRACE20230...	78	3e-11
54	gb|AC023598.30| Homo sapiens 3 BAC RP11-221E20 (Roswell Park Can...	78	3e-11
55	ref|NM_112768.1| Arabidopsis thaliana GTP binding AT3G18820 mRNA...	76	1e-10
56	gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome...	76	1e-10
57	gb|AY059072.1| Arabidopsis thaliana putative GTP binding protein...	76	1e-10
58	gb|AY035137.1| Arabidopsis thaliana putative GTP binding protein...	76	1e-10
59	gb|AY084266.1| Arabidopsis thaliana clone 101693 mRNA, complete ...	76	1e-10
60	dbj|AB071846.1| Arabidopsis thaliana mRNA for AtRab71, complete cds	76	1e-10
61	emb|Z73940.1|LJRAB7A L.japonicus mRNA for small GTP-binding prot...	74	5e-10
62	gb|L29274.1|TOBNTRAG Nicotiana tabacum SR1 Nt-rab7a mRNA, comple...	74	5e-10
63	gb|BC077884.1| Xenopus laevis RAB7, member RAS oncogene family, ...	72	2e-09
64	emb|Z73942.1|LJRAB7C L.japonicus mRNA for small GTP-binding prot...	72	2e-09
65	emb|Z73941.1|LJRAB7B L.japonicus mRNA for small GTP-binding prot...	72	2e-09
66	dbj|AP003434.2| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-09
67	emb|X65650.1|PSGTPBP P.sativum mRNA rab for ras-related GTP-bind...	70	8e-09
68	ref|NM_001008025.1| Xenopus tropicalis MGC79525 protein (MGC7952...	70	8e-09
69	gb|BC080905.1| Xenopus tropicalis MGC79525 protein, mRNA (cDNA c...	70	8e-09
70	emb|CR926163.1| Xenopus tropicalis finished cDNA, clone TNeu128d01	70	8e-09
71	gb|U87142.1|MCU87142 Mesembryanthemum crystallinum Nt-rab7a homo...	70	8e-09
72	gb|BC072717.1| Danio rerio zgc:91909, mRNA (cDNA clone MGC:91909...	68	3e-08
73	ref|NM_001002178.1| Danio rerio zgc:91909 (zgc:91909), mRNA	68	3e-08
74	ref|NM_112480.2| Arabidopsis thaliana GTP binding AT3G16100 mRNA...	66	1e-07
75	gb|BT006376.1| Arabidopsis thaliana At3g16100 gene, complete cds	66	1e-07
76	dbj|AB071848.1| Arabidopsis thaliana mRNA for AtRab73, complete cds	66	1e-07
77	emb|BX824542.1|CNS0A5QW Arabidopsis thaliana Full-length cDNA Co...	64	5e-07
78	gb|DQ235201.1| Solanum tuberosum clone 171F12 unknown mRNA	62	2e-06
79	gb|DQ222491.1| Solanum tuberosum clone 099C08 unknown mRNA	62	2e-06
80	gb|BT024015.1| Zea mays clone EL01N0311D12 mRNA sequence	62	2e-06
81	gb|AY324138.1| Babesia bovis Rab7 mRNA, complete cds	60	8e-06
82	dbj|AP003408.3| Oryza sativa (japonica cultivar-group) genomic D...	60	8e-06
83	gb|BC086793.1| Mus musculus RAB7, member RAS oncogene family, mR...	58	3e-05
84	gb|AY432204.1| Aedes aegypti ASAP ID: 43000 Rab protein 7 mRNA s...	58	3e-05
85	gb|BC072470.1| Rattus norvegicus RAB7, member RAS oncogene famil...	58	3e-05
86	gb|BC004597.1| Mus musculus RAB7, member RAS oncogene family, mR...	58	3e-05
87	ref|NM_009005.1| Mus musculus RAB7, member RAS oncogene family (...	58	3e-05
88	emb|CT010352.1| Mus musculus full open reading frame cDNA clone ...	58	3e-05
89	emb|X89650.1|MMRAB7 M.musculus mRNA for Rab7 protein	58	3e-05
90	emb|X12535.1|RNRASP23 Rat mRNA for ras-related protein p23	58	3e-05
91	gb|AC153857.7| Mus musculus 6 BAC RP23-158G17 (Roswell Park Canc...	58	3e-05
92	gb|DQ056142.1| Coprinellus disseminatus strain C345.1 putative G...	58	3e-05
93	ref|NM_023950.3| Rattus norvegicus RAB7, member RAS oncogene fam...	58	3e-05
94	dbj|AK057671.1| Mus musculus cDNA fis, clone TRACH2000981, highl...	58	3e-05
95	dbj|AK135659.1| Mus musculus in vitro fertilized eggs cDNA, RIKE...	58	3e-05
96	dbj|AK151078.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	58	3e-05
97	dbj|AK148117.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-len...	58	3e-05
98	dbj|AK139914.1| Mus musculus 2 cells egg cDNA, RIKEN full-length...	58	3e-05
99	dbj|AK152666.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	58	3e-05
100	dbj|AK158971.1| Mus musculus visual cortex cDNA, RIKEN full-leng...	58	3e-05
101	dbj|AK159928.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	58	3e-05
102	dbj|AK154234.1| Mus musculus NOD-derived CD11c +ve dendritic cel...	58	3e-05
103	dbj|AK159507.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	58	3e-05
104	gb|AF286535.1|AF286535 Rattus norvegicus GTP-binding protein RAB...	58	3e-05
105	dbj|AK005004.1| Mus musculus adult male liver cDNA, RIKEN full-l...	58	3e-05
106	gb|AC153872.2| Mus musculus 6 BAC RP23-226O20 (Roswell Park Canc...	58	3e-05
107	dbj|AB158428.1| Rattus norvegicus Rab7 mRNA for RAB7, complete c...	58	3e-05
108	dbj|AB158427.1| Rattus norvegicus Rab7 mRNA for RAB7, complete c...	58	3e-05
109	gb|AY084691.1| Arabidopsis thaliana clone 115178 mRNA, complete ...	58	3e-05
110	gb|L29276.1|TOBNTRAI Nicotiana tabacum SR1 Nt-rab7c mRNA, comple...	58	3e-05
111	ref|XM_816526.1| Trypanosoma cruzi strain CL Brener rab7 GTP bin...	56	1e-04
112	emb|BX823072.1|CNS0A63E Arabidopsis thaliana Full-length cDNA Co...	56	1e-04
113	dbj|AB026654.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	56	1e-04
114	ref|XM_585448.2| PREDICTED: Bos taurus similar to RAB14, member ...	54	5e-04
115	emb|X84220.1|GGRAB2 G.gallus mRNA for RAB2	54	5e-04
116	ref|NM_205228.1| Gallus gallus RAB2, member RAS oncogene family ...	54	5e-04
117	gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	54	5e-04
118	gb|AF407337.1| Lentinula edodes Ras-related protein Rab7 (Rab7) ...	54	5e-04
119	gb|BC103315.1| Bos taurus cDNA clone IMAGE:8119982, partial cds	54	5e-04
120	gb|AF146042.1|AF146042 Trypanosoma cruzi GTP-binding protein (RA...	54	5e-04
121	ref|NM_208759.1| Eremothecium gossypii ACR003Cp (ACR003C), mRNA	54	5e-04
122	ref|XM_413757.1| PREDICTED: Gallus gallus similar to GTPase Rab8...	52	0.002
123	ref|XM_862742.1| PREDICTED: Canis familiaris similar to RAB14, m...	52	0.002
124	ref|XM_532048.2| PREDICTED: Canis familiaris similar to RAB14, m...	52	0.002
125	ref|XM_725728.1| Plasmodium yoelii yoelii str. 17XNL small GTPas...	52	0.002
126	emb|BX950805.1| Gallus gallus finished cDNA, clone ChEST779e6	52	0.002
127	ref|XM_346351.2| PREDICTED: Rattus norvegicus similar to RAB9B, ...	52	0.002
128	ref|XM_549902.1| Oryza sativa (japonica cultivar-group), mRNA	50	0.008
129	gb|BC107383.1| Mus musculus RAB9B, member RAS oncogene family, m...	50	0.008
130	ref|NM_176971.1| Mus musculus RAB9B, member RAS oncogene family ...	50	0.008
131	ref|XM_385317.1| Gibberella zeae PH-1 chromosome 3 RAB7_NEUCR Pr...	50	0.008
132	ref|XM_802548.1| Trypanosoma cruzi strain CL Brener small GTP-bi...	50	0.008
133	ref|XM_737768.1| Plasmodium chabaudi chabaudi ras family GTP-ase...	50	0.008
134	gb|AF079459.1| Drosophila melanogaster small ras-like GTPase (ra...	50	0.008
135	ref|NM_079748.2| Drosophila melanogaster Rab-protein 7 CG5915-RA...	50	0.008
136	dbj|AK161867.1| Mus musculus adult male medulla oblongata cDNA, ...	50	0.008
137	gb|AY060236.1| Drosophila melanogaster GH03685 full length cDNA	50	0.008
138	dbj|AK049693.1| Mus musculus 12 days embryo spinal cord cDNA, RI...	50	0.008
139	dbj|AK034442.1| Mus musculus adult male diencephalon cDNA, RIKEN...	50	0.008
140	gb|AC007929.8|AC007929 Drosophila melanogaster, chromosome 3R, r...	50	0.008
141	gb|AC008202.4|AC008202 Drosophila melanogaster, chromosome 3R, r...	50	0.008
142	gb|AF263363.1|AF263363 Drosophila melanogaster small ras-like GT...	50	0.008
143	dbj|AK203105.1| Mus musculus cDNA, clone:Y1G0143M20, strand:plus...	50	0.008
144	dbj|AK197221.1| Mus musculus cDNA, clone:Y1G0124G13, strand:plus...	50	0.008
145	dbj|AK190348.1| Mus musculus cDNA, clone:Y1G0102H14, strand:plus...	50	0.008
146	dbj|AK179526.1| Mus musculus cDNA, clone:Y0G0110L24, strand:plus...	50	0.008
147	gb|AE003745.4| Drosophila melanogaster chromosome 3R, section 83...	50	0.008
148	gb|L08131.1|VVCPTVD Volvox carteri GTP-binding protein (yptV5) g...	50	0.008
149	dbj|AB035672.1| Drosophila melanogaster mRNA for Rab7 protein, c...	50	0.008
150	emb|AL672008.8| Mouse DNA sequence from clone RP23-389M3 on chro...	50	0.008
151	ref|NM_102121.2| Arabidopsis thaliana RAB7; GTP binding AT1G2274...	48	0.030
152	ref|XM_874394.1| PREDICTED: Bos taurus similar to RAB37, member ...	48	0.030
153	ref|XM_864786.1| PREDICTED: Bos taurus similar to RAB37, member ...	48	0.030
154	ref|XM_420182.1| PREDICTED: Gallus gallus similar to RAB9B, memb...	48	0.030
155	ref|NM_001007161.1| Danio rerio RAB1A, member RAS oncogene famil...	48	0.030
156	emb|CR933447.1| Paramecium tetraurelia, Small GTPase rab, putati...	48	0.030
157	ref|XM_804642.1| Trypanosoma cruzi strain CL Brener ras-related ...	48	0.030
158	emb|CR722542.2|CNS0GKGK Tetraodon nigroviridis full-length cDNA	48	0.030
159	ref|XM_757697.1| Theileria parva strain Muguga chromosome 3 smal...	48	0.030
160	emb|CR693235.2|CNS0FXUN Tetraodon nigroviridis full-length cDNA	48	0.030
161	emb|CR673531.2|CNS0FIO1 Tetraodon nigroviridis full-length cDNA	48	0.030
162	emb|CR670292.2|CNS0FG62 Tetraodon nigroviridis full-length cDNA	48	0.030
163	emb|Y09821.1|ATY09821 A.thaliana mRNA for GTP-binding protein	48	0.030
164	emb|AL139262.1|LMRAB7 Leishmania major LmRab7, previously lmEST0...	48	0.030
165	ref|XM_682020.1| PREDICTED: Danio rerio similar to Ras-related p...	48	0.030
166	ref|XM_704148.1| PREDICTED: Danio rerio similar to RAB1A, member...	48	0.030
167	ref|XM_684089.1| PREDICTED: Danio rerio similar to RAB1A, member...	48	0.030
168	gb|BT024589.1| Arabidopsis thaliana At1g22740 mRNA, complete cds	48	0.030
169	emb|AL114549.1|CNS01BQ5 Botrytis cinerea strain T4 cDNA library	48	0.030
170	emb|AL111144.1|CNS0193L Botrytis cinerea strain T4 cDNA library	48	0.030
171	emb|BX823067.1|CNS0A5YM Arabidopsis thaliana Full-length cDNA Co...	48	0.030
172	gb|BC062857.1| Danio rerio RAB1A, member RAS oncogene family, mR...	48	0.030
173	gb|BC050239.1| Danio rerio RAB1A, member RAS oncogene family, mR...	48	0.030
174	gb|L14928.1|VIRRAB7P Vigna aconitifolia (Rab7p) mRNA, complete cds	48	0.030
175	dbj|AB071850.1| Arabidopsis thaliana mRNA for AtRab75, complete cds	48	0.030
176	ref|NM_185154.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.12
177	ref|XM_519779.1| PREDICTED: Pan troglodytes similar to RAB2, mem...	46	0.12
178	ref|NM_053589.1| Rattus norvegicus RAB14, member RAS oncogene fa...	46	0.12
179	ref|NM_002865.1| Homo sapiens RAB2, member RAS oncogene family (...	46	0.12
180	gb|BT019695.1| Homo sapiens RAB2, member RAS oncogene family mRN...	46	0.12
181	gb|BT019694.1| Synthetic construct Homo sapiens RAB2, member RAS...	46	0.12
182	gb|BT019693.1| Synthetic construct Homo sapiens RAB2, member RAS...	46	0.12
183	ref|XM_585141.2| PREDICTED: Bos taurus similar to RAB2, member R...	46	0.12
184	gb|BC056648.1| Mus musculus RAB14, member RAS oncogene family, m...	46	0.12
185	gb|BC025139.1| Mus musculus RAB14, member RAS oncogene family, m...	46	0.12
186	gb|BC009085.1| Mus musculus RAB14, member RAS oncogene family, m...	46	0.12
187	gb|BC008929.2| Homo sapiens RAB2, member RAS oncogene family, mR...	46	0.12
188	ref|NM_026697.3| Mus musculus RAB14, member RAS oncogene family ...	46	0.12
189	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	46	0.12
190	ref|XM_538124.2| PREDICTED: Canis familiaris similar to Ras-rela...	46	0.12
191	ref|XM_538000.2| PREDICTED: Canis familiaris similar to RAB2, me...	46	0.12
192	ref|XM_850496.1| PREDICTED: Canis familiaris rab11 GTP-binding p...	46	0.12
193	gb|AY442922.1| Fucus distichus clone P8 putative Rab7 GTPase mRN...	46	0.12
194	gb|BC044974.1| Xenopus laevis RAB4A, member RAS oncogene family,...	46	0.12
195	ref|XM_724537.1| Plasmodium yoelii yoelii str. 17XNL Rab7 GTPase...	46	0.12
196	ref|XM_791939.1| PREDICTED: Strongylocentrotus purpuratus simila...	46	0.12
197	emb|AJ968960.1| Mus musculus mRNA for RAB14 protein variant, str...	46	0.12
198	emb|AJ968959.1| Mus musculus mRNA for RAB14 protein, strain SAMR...	46	0.12
199	emb|AJ968956.1| Mus musculus mRNA for RAB14 protein variant, str...	46	0.12
200	emb|AJ968955.1| Mus musculus mRNA for RAB14 protein, strain SAMP...	46	0.12
201	emb|X12953.1|HSRAB2 Human rab2 mRNA, YPT1-related and member of ...	46	0.12
202	emb|CR860575.1| Pongo pygmaeus mRNA; cDNA DKFZp459F037 (from clo...	46	0.12
203	emb|CR605346.1| full-length cDNA clone CS0DI077YH13 of Placenta ...	46	0.12
204	gb|AF498930.1| Homo sapiens small GTP binding protein RAB2A (RAB...	46	0.12
205	dbj|AK135751.1| Mus musculus in vitro fertilized eggs cDNA, RIKE...	46	0.12
206	dbj|AK133963.1| Mus musculus 8 days embryo whole body cDNA, RIKE...	46	0.12
207	gb|AF474147.1| Leishmania braziliensis Rab7-like protein mRNA, c...	46	0.12
208	ref|XM_696269.1| PREDICTED: Danio rerio similar to Rab8b-prov pr...	46	0.12
209	dbj|AK165812.1| Mus musculus 16 days neonate male diencephalon c...	46	0.12
210	dbj|AK168867.1| Mus musculus 17 days pregnant adult female amnio...	46	0.12
211	dbj|AK160859.1| Mus musculus adult male brain cDNA, RIKEN full-l...	46	0.12
212	dbj|AK168551.1| Mus musculus 17 days pregnant adult female amnio...	46	0.12
213	dbj|AK169396.1| Mus musculus 17 days pregnant adult female amnio...	46	0.12
214	dbj|AB169319.1| Macaca fascicularis testis cDNA, clone: QtsA-190...	46	0.12
215	dbj|AB169768.1| Macaca fascicularis brain cDNA, clone: QtrA-1201...	46	0.12
216	dbj|AK013410.1| Mus musculus 10, 11 days embryo whole body cDNA,...	46	0.12
217	dbj|AK002704.1| Mus musculus adult male kidney cDNA, RIKEN full-...	46	0.12
218	dbj|AK083451.1| Mus musculus 9 days embryo whole body cDNA, RIKE...	46	0.12
219	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.12
220	ref|NM_001003318.1| Canis familiaris RAB2, member RAS oncogene f...	46	0.12
221	gb|AC093018.4| Oryza sativa chromosome 3 BAC OSJNBb0081B07 genom...	46	0.12
222	dbj|AK179960.1| Mus musculus cDNA, clone:Y0G0112G03, strand:plus...	46	0.12
223	gb|AY888662.1| Synthetic construct Homo sapiens clone FLH010119....	46	0.12
224	gb|AY891306.1| Synthetic construct Homo sapiens clone FLH010115....	46	0.12
225	gb|AY891305.1| Synthetic construct Homo sapiens clone FLH010114....	46	0.12
226	dbj|AK067508.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.12
227	dbj|AK061336.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.12
228	gb|AF116243.1|AF116243 Gossypium hirsutum RAS-related GTP-bindin...	46	0.12
229	emb|AL773523.4| Mouse DNA sequence from clone RP23-186B18 on chr...	46	0.12
230	gb|M28213.1|HUMRAB2A Homo sapiens GTP-binding protein (RAB2) mRN...	46	0.12
231	gb|M83680.1|RATRAB14X Sprague-Dawley (clone LRB13) RAB14 mRNA, c...	46	0.12
232	gb|M35521.1|DOGRAB2A C.familiaris GTP-binding protein (rab2) mRN...	46	0.12
233	ref|NM_117040.2| Arabidopsis thaliana GTP binding AT4G09720 tran...	44	0.47
234	ref|XM_529084.1| PREDICTED: Pan troglodytes similar to Ras-relat...	44	0.47
235	ref|XM_510426.1| PREDICTED: Pan troglodytes similar to Ras-relat...	44	0.47
236	ref|NM_001030328.2| Xenopus tropicalis RAB5A protein (RAB5A), mRNA	44	0.47
237	gb|AY725788.1| Oncometopia nigricans putative Rab7 mRNA, complet...	44	0.47
238	gb|AY190723.1| Pagrus major RAP2B-like protein mRNA, complete cds	44	0.47
239	gb|BC076054.1| Danio rerio zgc:92523, mRNA (cDNA clone MGC:92523...	44	0.47
240	ref|XM_589286.2| PREDICTED: Bos taurus similar to olfactory rece...	44	0.47
241	ref|XM_867247.1| PREDICTED: Bos taurus similar to Ras-related pr...	44	0.47
242	ref|XM_870595.1| PREDICTED: Bos taurus similar to VPS10 domain-c...	44	0.47
243	ref|NM_023635.2| Mus musculus RAB27A, member RAS oncogene family...	44	0.47
244	gb|BT013145.1| Lycopersicon esculentum clone 134140R, mRNA sequence	44	0.47
245	ref|NM_016370.1| Homo sapiens RAB9B, member RAS oncogene family ...	44	0.47
246	gb|AY558420.1| Saccharomyces cerevisiae clone FLH111470.01X YNL0...	44	0.47
247	emb|AL032621.1|CEY45F3A Caenorhabditis elegans YAC Y45F3A, compl...	44	0.47
248	gb|BC098667.1| Rattus norvegicus RAB27A, member RAS oncogene fam...	44	0.47
249	ref|XM_810366.1| Trypanosoma cruzi strain CL Brener ras-related ...	44	0.47
250	gb|BC008173.1| Mus musculus RAB27A, member RAS oncogene family, ...	44	0.47
251	ref|XM_673071.1| Plasmodium berghei strain ANKA GTP-binding prot...	44	0.47
252	ref|XM_662824.1| Cryptosporidium hominis TU502 Rab11b (Chro.7048...	44	0.47
253	ref|NM_017317.2| Rattus norvegicus RAB27A, member RAS oncogene f...	44	0.47
254	emb|AL139228.1| Human DNA sequence from clone RP4-540A13 on chro...	44	0.47
255	ref|XM_786497.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.47
256	ref|XM_792167.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.47
257	emb|Z71369.1|SCYNL093W S.cerevisiae chromosome XIV reading frame...	44	0.47
258	ref|XM_778631.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.47
259	emb|X85811.1|SCTRNAORF S.cerevisiae tRNA-Leu, and ORF's N2212, N...	44	0.47
260	emb|X76175.1|SCYPT53 S.cerevisiae YPT53 gene	44	0.47
261	emb|CR457076.1| Homo sapiens full open reading frame cDNA clone ...	44	0.47
262	gb|BC070069.1| Homo sapiens cDNA clone IMAGE:5261286, containing...	44	0.47
263	ref|NM_001003449.1| Danio rerio zgc:92523 (zgc:92523), mRNA	44	0.47
264	emb|CR861121.1| Pongo pygmaeus mRNA; cDNA DKFZp459C0214 (from cl...	44	0.47
265	gb|AF498953.1| Homo sapiens small GTP binding protein RAB27A (RA...	44	0.47
266	gb|AF458981.1| Saccharomyces cerevisiae strain YJM627, partial g...	44	0.47
267	gb|AF458980.1| Saccharomyces cerevisiae strain YJM270, partial g...	44	0.47
268	gb|AF458979.1| Saccharomyces cerevisiae strain YJM269, partial g...	44	0.47
269	gb|AF458978.1| Saccharomyces cerevisiae strain YJM1129, partial ...	44	0.47
270	gb|AF458977.1| Saccharomyces cerevisiae strain W303, partial genome	44	0.47
271	gb|AF458976.1| Saccharomyces cerevisiae strain SK1, partial genome	44	0.47
272	gb|AF458975.1| Saccharomyces cerevisiae strain YJM789, partial g...	44	0.47
273	gb|AF458974.1| Saccharomyces cerevisiae strain YJM421, partial g...	44	0.47
274	gb|AF458973.1| Saccharomyces cerevisiae strain YJM339, partial g...	44	0.47
275	gb|AF458972.1| Saccharomyces cerevisiae strain YJM326, partial g...	44	0.47
276	gb|AF458971.1| Saccharomyces cerevisiae strain YJM320, partial g...	44	0.47
277	gb|AF458970.1| Saccharomyces cerevisiae strain YJM280, partial g...	44	0.47
278	gb|AF458969.1| Saccharomyces cerevisiae strain S96, partial genome	44	0.47
279	emb|CR541693.1| Homo sapiens full open reading frame cDNA clone ...	44	0.47
280	emb|CR536496.1| Homo sapiens full open reading frame cDNA clone ...	44	0.47
281	ref|NM_004580.3| Homo sapiens RAB27A, member RAS oncogene family...	44	0.47
282	ref|NM_183235.1| Homo sapiens RAB27A, member RAS oncogene family...	44	0.47
283	ref|NM_183234.1| Homo sapiens RAB27A, member RAS oncogene family...	44	0.47
284	ref|NM_183236.1| Homo sapiens RAB27A, member RAS oncogene family...	44	0.47
285	dbj|AK010373.1| Mus musculus ES cells cDNA, RIKEN full-length en...	44	0.47
286	gb|AF304376.1|AF304376 Mus musculus RAB27A (Rab27a) mRNA, comple...	44	0.47
287	ref|NM_066927.2| Caenorhabditis elegans RAB family member (rab-3...	44	0.47
288	dbj|AK030529.1| Mus musculus adult male pituitary gland cDNA, RI...	44	0.47
289	gb|BC093758.1| Homo sapiens RAB9B, member RAS oncogene family, m...	44	0.47
290	gb|BC093756.1| Homo sapiens RAB9B, member RAS oncogene family, m...	44	0.47
291	emb|AL929331.15| Zebrafish DNA sequence from clone DKEY-16O9, co...	44	0.47
292	dbj|AB012247.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	44	0.47
293	dbj|AB120511.1| Mus musculus mRNA for Rab27A, complete cds	44	0.47
294	gb|AY894103.1| Synthetic construct Homo sapiens clone FLH131060....	44	0.47
295	gb|AY894102.1| Synthetic construct Homo sapiens clone FLH131027....	44	0.47
296	gb|BC009656.1| Mus musculus RAB27A, member RAS oncogene family, ...	44	0.47
297	emb|AL772154.4| Zebrafish DNA sequence from clone CH211-101N13 i...	44	0.47
298	gb|AF125393.1|AF125393 Homo sapiens Rab27 isoform mRNA, complete...	44	0.47
299	gb|U38654.3|HSU38654 Homo sapiens Rab27a mRNA, complete cds	44	0.47
300	emb|CR761238.2| Xenopus tropicalis finished cDNA, clone TEgg117g03	44	0.47
301	gb|U57094.1|HSU57094 Human small GTP-binding protein mRNA, compl...	44	0.47
302	gb|BC041336.1| Homo sapiens cDNA clone IMAGE:5274429, containing...	44	0.47
303	ref|XM_667300.1| Plasmodium berghei strain ANKA GTPase (PB301392...	44	0.47
304	gb|BC107680.1| Homo sapiens RAB27A, member RAS oncogene family, ...	44	0.47
305	emb|CT032304.1| Platynereis dumerilii EST IB0AAA41AE10EM1	44	0.47
306	gb|DQ115393.1| Saccharomyces cerevisiae Pol1p (POL1) gene, parti...	44	0.47
307	gb|DQ154914.1| Triticum turgidum B genome RAB7 (RAB7) and delta-...	44	0.47
308	gb|DQ154913.1| Aegilops tauschii RAB7 (RAB7) and delta-1-pyrroli...	44	0.47
309	gb|DQ154912.1| Triticum monococcum RAB7 (RAB7) and delta-1-pyrro...	44	0.47
310	gb|DQ154911.1| Triticum aestivum D genome RAB7 (RAB7) and delta-...	44	0.47
311	gb|DQ154910.1| Triticum aestivum B genome RAB7 (RAB7) and delta-...	44	0.47
312	gb|M38390.1|DYGORA1 Discopyge ommata GTP-binding protein (ora1) ...	44	0.47
313	dbj|D17352.1|RATRAMP25 Rat mRNA for low Mr GTP-binding protein, ...	44	0.47
314	dbj|AB046693.1| Mus musculus mRNA for Rab27A, complete cds	44	0.47
315	dbj|AB071851.1| Arabidopsis thaliana mRNA for AtRab76, complete cds	44	0.47
316	dbj|AB036693.1| Homo sapiens mRNA for RAB9-like protein, complet...	44	0.47
317	ref|XM_515233.1| PREDICTED: Pan troglodytes similar to Rab-like ...	42	1.9
318	ref|NM_001031504.1| Gallus gallus RAB8A, member RAS oncogene fam...	42	1.9
319	ref|XM_515749.1| PREDICTED: Pan troglodytes similar to RAB, memb...	42	1.9
320	gb|BT020037.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
321	gb|BT020036.1| Synthetic construct Homo sapiens RAB, member of R...	42	1.9
322	gb|AC139562.8| Mus musculus chromosome 5, clone RP24-180G11, com...	42	1.9
323	gb|BC014879.2| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
324	gb|BC056466.1| Mus musculus RAB35, member RAS oncogene family, m...	42	1.9
325	gb|BC030941.1| Mus musculus RAB35, member RAS oncogene family, m...	42	1.9
326	ref|XM_361669.1| Magnaporthe grisea 70-15 hypothetical protein (...	42	1.9
327	ref|XM_458811.1| Debaryomyces hansenii CBS767 hypothetical prote...	42	1.9
328	ref|XM_865487.1| PREDICTED: Bos taurus similar to Ras-related pr...	42	1.9
329	ref|XM_876116.1| PREDICTED: Bos taurus similar to Ras-related pr...	42	1.9
330	ref|XM_323012.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.9
331	ref|XM_956394.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.9
332	ref|NM_031091.2| Rattus norvegicus RAB3B, member RAS oncogene fa...	42	1.9
333	ref|NM_001003789.1| Homo sapiens RAB, member of RAS oncogene fam...	42	1.9
334	ref|NM_007081.2| Homo sapiens RAB, member of RAS oncogene family...	42	1.9
335	ref|NM_016322.2| Homo sapiens RAB14, member RAS oncogene family ...	42	1.9
336	gb|AY553875.1| Homo sapiens F protein-binding protein 1 mRNA, co...	42	1.9
337	gb|BC040495.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
338	gb|BC030376.1| Mus musculus RAB, member of RAS oncogene family-l...	42	1.9
339	gb|AC122401.3| Mus musculus chromosome 15 clone RP24-107E24, com...	42	1.9
340	gb|BC064551.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
341	ref|XM_756565.1| Ustilago maydis 521 hypothetical protein (UM055...	42	1.9
342	gb|BC013790.1| Mus musculus RAB15, member RAS oncogene family, m...	42	1.9
343	emb|Z73943.1|LJRAB7D L.japonicus mRNA for small GTP-binding prot...	42	1.9
344	emb|CR717350.2|CNS0GGGC Tetraodon nigroviridis full-length cDNA	42	1.9
345	gb|BC024281.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
346	ref|XM_669927.1| Plasmodium berghei strain ANKA ras family GTP-a...	42	1.9
347	gb|BC020495.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
348	gb|BC114760.1| Bos taurus cDNA clone MGC:137938 IMAGE:8087670, c...	42	1.9
349	gb|BC013057.1| Homo sapiens cDNA clone IMAGE:3859070, containing...	42	1.9
350	gb|BC075856.1| Homo sapiens RAB, member of RAS oncogene family-l...	42	1.9
351	ref|XM_775670.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.9
352	ref|XM_505628.1| Yarrowia lipolytica CLIB122, YALI0F19602g predi...	42	1.9
353	emb|AL137068.10| Human DNA sequence from clone RP11-165P4 on chr...	42	1.9
354	gb|AC159539.6| Mus musculus chromosome 5, clone RP23-228F6, comp...	42	1.9
355	ref|XM_970057.1| PREDICTED: Tribolium castaneum similar to CG332...	42	1.9
356	emb|Y14019.1|RNY14019 Rattus norvegicus mRNA for Rab3B protein	42	1.9
357	emb|X98540.1|FSGTP1 F.sylvatica mRNA for GTP1 protein	42	1.9
358	emb|CR457394.1| Homo sapiens full open reading frame cDNA clone ...	42	1.9
359	emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS...	42	1.9
360	gb|BC094954.1| Rattus norvegicus RAB15, member RAS onocogene fam...	42	1.9
361	emb|AL162081.1|HSM802619 Homo sapiens mRNA; cDNA DKFZp762K0911 (...	42	1.9
362	emb|AJ851430.1| Gallus gallus mRNA for hypothetical protein, clo...	42	1.9
363	emb|AJ292320.1|OSA292320 Oryza sativa mRNA for RAB5A protein	42	1.9
364	gb|AC159892.2| Mus musculus BAC clone RP23-313P23 from chromosom...	42	1.9
365	emb|CR859599.1| Pongo pygmaeus mRNA; cDNA DKFZp459L034 (from clo...	42	1.9
366	emb|CR860991.1| Pongo pygmaeus mRNA; cDNA DKFZp459L0118 (from cl...	42	1.9
367	gb|AY029301.1| Oryza sativa small GTP-binding protein (rab5A) mR...	42	1.9
368	gb|AF443871.1| Homo sapiens Ras-like GTP-binding protein (RAB27A...	42	1.9
369	emb|CR624145.1| full-length cDNA clone CS0DJ007YD24 of T cells (...	42	1.9
370	emb|CR621508.1| full-length cDNA clone CS0DE009YB19 of Placenta ...	42	1.9
371	emb|CR617149.1| full-length cDNA clone CS0DF010YB13 of Fetal bra...	42	1.9
372	emb|CR606162.1| full-length cDNA clone CS0DI041YB10 of Placenta ...	42	1.9
373	dbj|AK090889.1| Homo sapiens cDNA FLJ33570 fis, clone BRAMY20103...	42	1.9
374	dbj|AK023524.1| Homo sapiens cDNA FLJ13462 fis, clone PLACE10033...	42	1.9
375	gb|AF498949.1| Homo sapiens small GTP binding protein RAB14 (RAB...	42	1.9
376	gb|U60315.1|MCU60315 Molluscum contagiosum virus subtype 1, comp...	42	1.9
377	ref|XM_942580.1| PREDICTED: Homo sapiens similar to RAB, member ...	42	1.9
378	dbj|AK158768.1| Mus musculus visual cortex cDNA, RIKEN full-leng...	42	1.9
379	dbj|AK158637.1| Mus musculus visual cortex cDNA, RIKEN full-leng...	42	1.9
380	dbj|AK156576.1| Mus musculus activated spleen cDNA, RIKEN full-l...	42	1.9
381	gb|U86932.1|MCU86932 Molluscum contagiosum virus subtype 1 clone...	42	1.9
382	emb|BX930100.2| Gallus gallus finished cDNA, clone ChEST1021d13	42	1.9
383	gb|AC157513.2| Mus musculus BAC clone RP24-280G4 from chromosome...	42	1.9
384	dbj|AK051232.1| Mus musculus 12 days embryo spinal ganglion cDNA...	42	1.9
385	gb|AC002055.2| Homo sapiens Chromosome 22q13 Cosmid Clone n1g3, ...	42	1.9
386	ref|NM_198749.2| Rattus norvegicus RAB15, member RAS onocogene f...	42	1.9
387	ref|NG_001432.1| Mus musculus RAB7, member RAS oncogene family, ...	42	1.9
388	gb|AC148708.1| Macaca mulatta Major Histocompatibility Complex B...	42	1.9
389	gb|AC148671.1| Macaca mulatta Major Histocompatibility Complex B...	42	1.9
390	gb|AC148669.1| Macaca mulatta Major Histocompatibility Complex B...	42	1.9
391	dbj|AK004012.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	42	1.9
392	gb|AC018926.10|AC018926 Homo sapiens chromosome 15 clone RP11-13...	42	1.9
393	gb|AC011912.7|AC011912 Homo sapiens chromosome 15 clone RP11-547...	42	1.9
394	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
395	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
396	emb|BX931166.1| Gallus gallus finished cDNA, clone ChEST1022e3	42	1.9
397	emb|BX932054.1| Gallus gallus finished cDNA, clone ChEST417i18	42	1.9
398	ref|NM_026817.1| Mus musculus RAB, member of RAS oncogene family...	42	1.9
399	ref|XM_579727.1| PREDICTED: Rattus norvegicus RAB15, member RAS ...	42	1.9
400	gb|AC164651.3| Ornithorhynchus anatinus BAC clone OABb-375A1 fro...	42	1.9
401	gb|BC060562.1| Rattus norvegicus RAB3B, member RAS oncogene fami...	42	1.9
402	gb|AY891089.1| Synthetic construct Homo sapiens clone FLH007781....	42	1.9
403	gb|AY893955.1| Synthetic construct Homo sapiens clone FLH131030....	42	1.9
404	gb|AY893954.1| Synthetic construct Homo sapiens clone FLH131029....	42	1.9
405	gb|AF203689.1|AF203689 Homo sapiens GTPase Rab14 mRNA, complete cds	42	1.9
406	gb|AF112206.1|AF112206 Homo sapiens ras-related protein rab-14 m...	42	1.9
407	gb|AF154837.1|HSRAB27A3 Homo sapiens Ras-like GTP-binding protei...	42	1.9
408	dbj|AK066784.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.9
409	gb|BC027769.1| Mus musculus RAB15, member RAS oncogene family, m...	42	1.9
410	gb|AF152463.1|AF152463 Homo sapiens RAB14 protein (RAB14) mRNA, ...	42	1.9
411	gb|BC006081.1| Homo sapiens RAB14, member RAS oncogene family, m...	42	1.9
412	dbj|AK061116.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.9
413	dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
414	gb|U68184.1|U68184 Rattus norvegicus GTP-binding protein (Rab3B)...	42	1.9
415	gb|AF095352.1|AF095352 Homo sapiens RAB-like protein 2B (RABL2B)...	42	1.9
416	gb|AF095351.1|AF095351 Homo sapiens RAB-like protein 2A (RABL2A)...	42	1.9
417	gb|AF095350.1|AF095350 Homo sapiens RAB-like protein 2A (RABL2A)...	42	1.9
418	emb|CR456554.1| Homo sapiens RABL2B full length open reading fra...	42	1.9
419	dbj|AP006311.2| Homo sapiens genomic DNA, chromosome Un clone:CM...	42	1.9
420	emb|AL078621.19|HSA395L14 Human DNA sequence from clone RP11-395...	42	1.9
421	gb|BC083624.1| Rattus norvegicus RAB, member of RAS oncogene fam...	42	1.9
422	dbj|AK113641.1| Ciona intestinalis cDNA, clone:cicl002a09, full ...	42	1.9
423	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	42	1.9
424	ref|NM_007082.2| Homo sapiens RAB, member of RAS oncogene family...	42	1.9
425	ref|NM_013412.1| Homo sapiens RAB, member of RAS oncogene family...	42	1.9
426	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	42	1.9
427	emb|AL590443.1|CNS07EGA chromosome III of strain GB-M1 of Enceph...	42	1.9
428	ref|NM_001013221.1| Rattus norvegicus RAB, member of RAS oncogen...	42	1.9
429	emb|AL713905.6|CNS07YQ5 Oryza sativa chromosome 12, . BAC OJ1584...	42	1.9
430	gb|AF010319.1|AF010319 Trypanosoma cruzi putative GTP-binding pr...	42	1.9
431	ref|NM_134050.2| Mus musculus RAB15, member RAS oncogene family ...	42	1.9
432	ref|NM_198163.1| Mus musculus RAB35, member RAS oncogene family ...	42	1.9
433	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	42	1.9
434	emb|Y13361.1|MMRAB7PSE Mus musculus Rab7 pseudogene	42	1.9
435	gb|M83679.1|RATRAB15X Sprague-Dawley (clone LRB9) RAB15 mRNA, co...	42	1.9
436	ref|NM_115341.1| Arabidopsis thaliana ARA6; GTP binding AT3G5484...	40	7.3
437	ref|XM_522469.1| PREDICTED: Pan troglodytes similar to Ras-relat...	40	7.3
438	ref|XM_479797.1| Oryza sativa (japonica cultivar-group), mRNA	40	7.3
439	gb|BC021901.1| Homo sapiens RAB21, member RAS oncogene family, m...	40	7.3
440	gb|AY622689.1| Marsupenaeus japonicus Rab (Rab) mRNA, partial cds	40	7.3
441	ref|XM_881629.1| PREDICTED: Bos taurus similar to Ras-related pr...	40	7.3
442	ref|XM_868411.1| PREDICTED: Bos taurus similar to Ras-related pr...	40	7.3
443	ref|XM_419573.1| PREDICTED: Gallus gallus similar to RAB4A, memb...	40	7.3
444	gb|BC045374.1| Danio rerio RAB14, member RAS oncogene family, mR...	40	7.3
445	ref|XM_677249.1| Aspergillus nidulans FGSC A4 hypothetical prote...	40	7.3
446	gb|BC114066.1| Bos taurus RAB26, member RAS oncogene family, mRN...	40	7.3
447	ref|NM_014999.1| Homo sapiens RAB21, member RAS oncogene family ...	40	7.3
448	gb|AY365246.1| Cucumis sativus putative GTP-binding protein (Rab...	40	7.3
449	gb|AC146547.2| Gasterosteus aculeatus clone CH213-33E5, complete...	40	7.3
450	emb|CR974470.7| L.saxatilis DNA sequence from clone CH317-148L22...	40	7.3
451	ref|XM_754544.1| Ustilago maydis 521 hypothetical protein (UM034...	40	7.3
452	ref|XM_822689.1| Trypanosoma brucei TREU927 Ras-related protein ...	40	7.3
453	emb|CT030528.1| Xenopus tropicalis finished cDNA, clone TNeu135g14	40	7.3
454	ref|XM_744819.1| Aspergillus fumigatus Af293 hypothetical protei...	40	7.3
455	ref|XM_390141.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...	40	7.3
456	gb|AY337265.1| Leishmania donovani Rab5 mRNA, complete cds	40	7.3
457	gb|BC016841.1| Homo sapiens RAB34, member RAS oncogene family, m...	40	7.3
458	gb|AC137267.2| Genomic sequence for Oryza sativa, Nipponbare str...	40	7.3
459	emb|Y07811.1|GGRAB5CLP G.gallus mRNA for rab5C-like protein	40	7.3
460	gb|BC092475.1| Homo sapiens RAB21, member RAS oncogene family, m...	40	7.3
461	emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete ...	40	7.3
462	emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on ch...	40	7.3
463	emb|AL161515.2|ATCHRIV27 Arabidopsis thaliana DNA chromosome 4, ...	40	7.3
464	emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B...	40	7.3
465	emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BA...	40	7.3
466	emb|AJ277106.1|HSA277106 Homo sapiens mRNA for GTP-binding prote...	40	7.3
467	gb|BT007997.1| Synthetic construct Homo sapiens RAB34, member RA...	40	7.3
468	gb|BT006702.1| Homo sapiens RAB34, member RAS oncogene family mR...	40	7.3
469	gb|BC066904.1| Homo sapiens RAB34, member RAS oncogene family, m...	40	7.3
470	ref|NM_204525.1| Gallus gallus RAB5C, member RAS oncogene family...	40	7.3
471	gb|AY128482.1| Drosophila melanogaster RE61267 full insert cDNA	40	7.3
472	dbj|D42087.1|HUMHA0793A Homo sapiens KIAA0118 mRNA, partial cds	40	7.3
473	gb|AC104610.13| Drosophila melanogaster 3L BAC RP98-35J16 (Roswe...	40	7.3
474	emb|CR622817.1| full-length cDNA clone CS0DI033YF23 of Placenta ...	40	7.3
475	emb|CR620011.1| full-length cDNA clone CS0DK001YG05 of HeLa cell...	40	7.3
476	emb|CR614283.1| full-length cDNA clone CS0DC027YN21 of Neuroblas...	40	7.3
477	emb|CR613380.1| full-length cDNA clone CS0DM007YA23 of Fetal liv...	40	7.3
478	emb|CR612854.1| full-length cDNA clone CS0DL007YP05 of B cells (...	40	7.3
479	emb|CR612137.1| full-length cDNA clone CS0DI056YJ19 of Placenta ...	40	7.3
480	emb|CR604873.1| full-length cDNA clone CS0DC014YK06 of Neuroblas...	40	7.3
481	emb|CR600820.1| full-length cDNA clone CS0DI027YE17 of Placenta ...	40	7.3
482	emb|CR600765.1| full-length cDNA clone CS0DH002YG23 of T cells (...	40	7.3
483	dbj|AK074689.1| Homo sapiens cDNA FLJ90208 fis, clone MAMMA10020...	40	7.3
484	emb|CR596043.1| full-length cDNA clone CS0DC015YJ13 of Neuroblas...	40	7.3
485	dbj|AK027312.1| Homo sapiens cDNA FLJ14406 fis, clone HEMBA10042...	40	7.3
486	ref|NM_132753.1| Drosophila melanogaster CG9514-RA (CG9514), mRNA	40	7.3
487	gb|AC116604.1| Genomic sequence for Oryza sativa, Nipponbare str...	40	7.3
488	ref|XM_696501.1| PREDICTED: Danio rerio hypothetical protein LOC...	40	7.3
489	ref|XM_697422.1| PREDICTED: Danio rerio hypothetical protein LOC...	40	7.3
490	emb|CR524370.1| Gallus gallus finished cDNA, clone ChEST125o2	40	7.3
491	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	40	7.3
492	gb|BC009109.1|BC009109 Homo sapiens, KIAA0118 protein, clone IMA...	40	7.3
493	emb|AL112649.1|CNS01A9D Botrytis cinerea strain T4 cDNA library	40	7.3
494	emb|AL112270.1|CNS019YU Botrytis cinerea strain T4 cDNA library	40	7.3
495	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
496	gb|AC006247.12|AC006247 Drosophila melanogaster, chromosome 2R, ...	40	7.3
497	gb|AF327350.1| Homo sapiens Ras-related GTP-binding protein RAB3...	40	7.3
498	gb|AC022344.2|AC022344 Drosophila melanogaster, chromosome X, re...	40	7.3
499	gb|AF322067.1|AF322067 Homo sapiens RAB39 (RAB39) mRNA, complete...	40	7.3
500	ref|NM_201495.1| Danio rerio RAB14, member RAS oncogene family (...	40	7.3

---

>gb|DQ154923.1| Hordeum vulgare RAB7 (RAB7) gene, exons 1 through 6 and partial cds;
            and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH)
            gene, complete cds
          Length = 13878

 Score =  375 bits (189), Expect = e-100
 Identities = 189/189 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1    gacacacacaactgctgccgcaaaggcaccggtggtggagcagataggggcgggacaagg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2017 gacacacacaactgctgccgcaaaggcaccggtggtggagcagataggggcgggacaagg 1958

                                                                        
Query: 61   agttgacgggagggaagagcgccagggatccatccatcgcccaccggccaccgccccgtc 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1957 agttgacgggagggaagagcgccagggatccatccatcgcccaccggccaccgccccgtc 1898

                                                                        
Query: 121  cgcccggccatggcgatggcgccgaggaggcggacgctgctcaaggtcatcgtcctcggc 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1897 cgcccggccatggcgatggcgccgaggaggcggacgctgctcaaggtcatcgtcctcggc 1838

                     
Query: 181  gacagcggg 189
            |||||||||
Sbjct: 1837 gacagcggg 1829



 Score =  297 bits (150), Expect = 2e-77
 Identities = 150/150 (100%)
 Strand = Plus / Minus

                                                                        
Query: 314  agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 373
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1008 agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 949

                                                                        
Query: 374  gagccgactgctgcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgctcg 433
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 948  gagccgactgctgcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgctcg 889

                                          
Query: 434  gtacctggcacgacgagttcatcaaccaag 463
            ||||||||||||||||||||||||||||||
Sbjct: 888  gtacctggcacgacgagttcatcaaccaag 859



 Score =  198 bits (100), Expect = 1e-47
 Identities = 100/100 (100%)
 Strand = Plus / Minus

                                                                        
Query: 216  gtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcac 275
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1251 gtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcac 1192

                                                    
Query: 276  caaggaggtcctcatcgaggacaggctcgtcaccttgcag 315
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1191 caaggaggtcctcatcgaggacaggctcgtcaccttgcag 1152



 Score =  155 bits (78), Expect = 2e-34
 Identities = 78/78 (100%)
 Strand = Plus / Minus

                                                                       
Query: 463 gctggcccatcagacccgaagcagtttcccttcattttggtcgggaacaaggtcgatctg 522
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 gctggcccatcagacccgaagcagtttcccttcattttggtcgggaacaaggtcgatctg 355

                             
Query: 523 gactctgggagcagacga 540
           ||||||||||||||||||
Sbjct: 354 gactctgggagcagacga 337



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                            
Query: 188  gggtcgggaagacgtcgctgatgaaccagtat 219
            ||||||||||||||||||||||||||||||||
Sbjct: 1728 gggtcgggaagacgtcgctgatgaaccagtat 1697

---

>dbj|AK105140.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-102-H02, full
           insert sequence
          Length = 840

 Score =  341 bits (172), Expect = 1e-90
 Identities = 307/352 (87%)
 Strand = Plus / Plus

                                                                       
Query: 146 ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgc 205
           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 34  ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggggtggggaagacgtccc 93

                                                                       
Query: 206 tgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccg 265
           |||||||||| || ||||||||||| || |||||||||||||||||||| ||||||||||
Sbjct: 94  tgatgaaccaatacgtgaacaagaagtttagccagcagtacaaggcgacgatcggcgccg 153

                                                                       
Query: 266 acttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggata 325
           | ||| ||||||||||||| ||||| || |||||||| |||||||||||||| ||||| |
Sbjct: 154 atttcgtcaccaaggaggttctcattgaagacaggcttgtcaccttgcagatctgggaca 213

                                                                       
Query: 326 cggcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgct 385
           ||||||| ||||||||||| ||||| ||||| ||||| |||||||| || || || ||||
Sbjct: 214 cggcaggacaggagaggtttcagagtctcggtgtggcgttctacagaggtgcagattgct 273

                                                                       
Query: 386 gcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgctcggtacctggcacg 445
           |  |||| |||||||| |||||||| |||||| | |||||| | |||   |||||||| |
Sbjct: 274 gtatgctagtctacgatgtcaatgctaaaagatctttcaatgcactcaacacctggcatg 333

                                                               
Query: 446 acgagttcatcaaccaagctggcccatcagacccgaagcagtttcccttcat 497
           | |||||| ||| ||||||| |||||||||| || || || |||||||||||
Sbjct: 334 atgagttcctcacccaagctagcccatcagatcccaaacattttcccttcat 385

---

>gb|AY829438.1| Pennisetum glaucum Rab7 mRNA, complete cds
          Length = 1090

 Score =  228 bits (115), Expect = 1e-56
 Identities = 199/227 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 89  ctcaaggtcatcatcctcggcgacagcggggtcggcaagacctcgctgatgaaccagtac 148

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           |||||||| || |||||| | ||||||||||| |||||||||||||| ||||||||||||
Sbjct: 149 gtgaacaaaaagttcagcaaccagtacaaggccaccatcggcgccgatttcctcaccaag 208

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           |||||||  ||||| ||| | ||| |||||||||||||||||||||||||||| || |||
Sbjct: 209 gaggtccagatcgacgaccgcctcttcaccttgcagatatgggatacggcaggacaagag 268

                                                          
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctg 386
            |||| ||||| || || ||||| || ||  ||||||| ||||||||
Sbjct: 269 cggtttcagagtcttggtgtggcattttatcggggagctgactgctg 315

---

>ref|XM_475776.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 594

 Score =  226 bits (114), Expect = 6e-56
 Identities = 237/278 (85%)
 Strand = Plus / Plus

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| || |||||||||||||||||||| ||||||||||| ||| ||||||||
Sbjct: 61  gtgaacaagaagtttagccagcagtacaaggcgacgatcggcgccgatttcgtcaccaag 120

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| ||||| || |||||||| |||||||||||||| ||||| |||||||| ||||||
Sbjct: 121 gaggttctcattgaagacaggcttgtcaccttgcagatctgggacacggcaggacaggag 180

                                                                       
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggtctac 399
           ||||| ||||| ||||| ||||| |||||||| || || || |||||  |||| ||||||
Sbjct: 181 aggtttcagagtctcggtgtggcgttctacagaggtgcagattgctgtatgctagtctac 240

                                                                       
Query: 400 gacgtcaatgccaaaagaaccttcaatacgctcggtacctggcacgacgagttcatcaac 459
           || |||||||| |||||| | |||||| | |||   |||||||| || |||||| ||| |
Sbjct: 241 gatgtcaatgctaaaagatctttcaatgcactcaacacctggcatgatgagttcctcacc 300

                                                 
Query: 460 caagctggcccatcagacccgaagcagtttcccttcat 497
           |||||| |||||||||| || || || |||||||||||
Sbjct: 301 caagctagcccatcagatcccaaacattttcccttcat 338



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 43/43 (100%)
 Strand = Plus / Plus

                                                      
Query: 146 ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcgg 188
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14  ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcgg 56

---

>gb|U40219.1|PCU40219 Pennisetum ciliare possible apospory-associated protein mRNA,
           complete cds
          Length = 941

 Score =  202 bits (102), Expect = 9e-49
 Identities = 177/202 (87%)
 Strand = Plus / Plus

                                                                       
Query: 149 ggcggacgctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctga 208
           |||| ||||| |||||||||||| |||||||||||||||||||||||||||| |||||||
Sbjct: 107 ggcgcacgctcctcaaggtcatcatcctcggcgacagcggggtcgggaagacttcgctga 166

                                                                       
Query: 209 tgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgact 268
           ||||||| ||||| |||||||| |||||| | ||||||||||| || ||||| ||||| |
Sbjct: 167 tgaaccaatatgtaaacaagaagttcagcaatcagtacaaggctacaatcggggccgatt 226

                                                                       
Query: 269 tcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacgg 328
           |||||||||||||||| |   |||||||||||||| ||||  | |||||||||||||| |
Sbjct: 227 tcctcaccaaggaggtgcagttcgaggacaggctcttcactcttcagatatgggatactg 286

                                 
Query: 329 cagggcaggagaggttccagag 350
           | || ||||||||||| |||||
Sbjct: 287 ctggacaggagaggtttcagag 308

---

>gb|AY108223.1| Zea mays PCO119199 mRNA sequence
          Length = 1158

 Score =  196 bits (99), Expect = 5e-47
 Identities = 195/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 164 ctcaaggtcatcatcctcggcgacagcggggtcggcaagacctcgctgatgaaccagtac 223

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || ||||| |  |||||| | ||||||||||| ||||||||||| || ||||||||||||
Sbjct: 224 gtcaacaacaggttcagcaaccagtacaaggccaccatcggcgcggatttcctcaccaag 283

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           |||||||  ||||| ||| | ||| ||||  |||||||||||||||||||||| ||||||
Sbjct: 284 gaggtccagatcgacgaccgcctcttcacactgcagatatgggatacggcaggacaggag 343

                                                          
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctg 386
            |||| || || || || ||||| || || |||||||| ||||||||
Sbjct: 344 cggtttcaaagtcttggtgtggcattttataggggagctgactgctg 390

---

>dbj|AK111495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E15, full
           insert sequence
          Length = 994

 Score =  192 bits (97), Expect = 8e-46
 Identities = 262/317 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 148 ctcaaggtcatcgtcctcggcgacagcggggtggggaagacgtcgcttatgaaccaatat 207

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||  ||||||| || |||||||||||||| || || || || || || ||| ||||||||
Sbjct: 208 gttcacaagaagtttagccagcagtacaaagctacaattggtgcggatttcgtcaccaag 267

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||||||||| || || |||||||| ||  ||||||| ||||| || || |||||||||
Sbjct: 268 gaggtcctcattgaagataggctcgtgactctgcagatctgggacactgcggggcaggag 327

                                                                       
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggtctac 399
           ||||||||||| || || || || || ||||| ||||| || || || ||||| ||||| 
Sbjct: 328 aggttccagagtcttggtgttgcgttttacagaggagcagattgttgtgtgctcgtctat 387

                                                                       
Query: 400 gacgtcaatgccaaaagaaccttcaatacgctcggtacctggcacgacgagttcatcaac 459
           ||||||||| | || ||  | ||  | ||||||   || ||||| || |||||| |||||
Sbjct: 388 gacgtcaattctaacaggtcatttgacacgctcaacacatggcatgatgagttcctcaac 447

                            
Query: 460 caagctggcccatcaga 476
           |||||| ||||||||||
Sbjct: 448 caagctagcccatcaga 464

---

>ref|NM_188576.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 654

 Score =  180 bits (91), Expect = 3e-42
 Identities = 193/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 25  ctcaaggtcatcatcctcggtgacagcggggtcgggaagacgtctctgatgaaccagtac 84

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | |||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 85  gtgaacaagaagttcagcaatcagtacaaagcgacgatcggcgcggatttcctgaccaag 144

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |  ||||| ||| ||||| |||| |||||||| ||||| || || || ||||||
Sbjct: 145 gaggtgcagatcgacgaccggctcttcacattgcagatttgggacacagcgggacaggag 204

                                                          
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctg 386
            | || ||||| || || ||||| || ||| ||||||| ||||||||
Sbjct: 205 cgatttcagagtcttggtgtggcattttaccggggagctgactgctg 251

---

>ref|XM_475712.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 621

 Score =  180 bits (91), Expect = 3e-42
 Identities = 166/191 (86%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||| |||
Sbjct: 25  ctcaaggtcatcatcctcggcgacagcggggttgggaagacgtccctgatgaaccaatat 84

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | ||||||||||| || || ||||| || ||||||||||||
Sbjct: 85  gtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcaccaag 144

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |   ||||||| |||||| |||| ||||| ||||||||||| || || ||||| 
Sbjct: 145 gaggttcagttcgaggataggctcttcactttgcaaatatgggatactgctggccaggaa 204

                      
Query: 340 aggttccagag 350
           ||||| |||||
Sbjct: 205 aggtttcagag 215

---

>dbj|AK112031.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-A09, full
           insert sequence
          Length = 1045

 Score =  180 bits (91), Expect = 3e-42
 Identities = 166/191 (86%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||| |||
Sbjct: 153 ctcaaggtcatcatcctcggcgacagcggggttgggaagacgtccctgatgaaccaatat 212

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | ||||||||||| || || ||||| || ||||||||||||
Sbjct: 213 gtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcaccaag 272

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |   ||||||| |||||| |||| ||||| ||||||||||| || || ||||| 
Sbjct: 273 gaggttcagttcgaggataggctcttcactttgcaaatatgggatactgctggccaggaa 332

                      
Query: 340 aggttccagag 350
           ||||| |||||
Sbjct: 333 aggtttcagag 343

---

>dbj|AK111896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021E23, full
           insert sequence
          Length = 1046

 Score =  180 bits (91), Expect = 3e-42
 Identities = 166/191 (86%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||| |||
Sbjct: 154 ctcaaggtcatcatcctcggcgacagcggggttgggaagacgtccctgatgaaccaatat 213

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | ||||||||||| || || ||||| || ||||||||||||
Sbjct: 214 gtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcaccaag 273

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |   ||||||| |||||| |||| ||||| ||||||||||| || || ||||| 
Sbjct: 274 gaggttcagttcgaggataggctcttcactttgcaaatatgggatactgctggccaggaa 333

                      
Query: 340 aggttccagag 350
           ||||| |||||
Sbjct: 334 aggtttcagag 344

---

>dbj|AK070320.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023052D24, full
           insert sequence
          Length = 1188

 Score =  180 bits (91), Expect = 3e-42
 Identities = 193/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 144 ctcaaggtcatcatcctcggtgacagcggggtcgggaagacgtctctgatgaaccagtac 203

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | |||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 204 gtgaacaagaagttcagcaatcagtacaaagcgacgatcggcgcggatttcctgaccaag 263

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |  ||||| ||| ||||| |||| |||||||| ||||| || || || ||||||
Sbjct: 264 gaggtgcagatcgacgaccggctcttcacattgcagatttgggacacagcgggacaggag 323

                                                          
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctg 386
            | || ||||| || || ||||| || ||| ||||||| ||||||||
Sbjct: 324 cgatttcagagtcttggtgtggcattttaccggggagctgactgctg 370

---

>dbj|AK059958.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-E06, full
           insert sequence
          Length = 1178

 Score =  180 bits (91), Expect = 3e-42
 Identities = 193/227 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 132 ctcaaggtcatcatcctcggtgacagcggggtcgggaagacgtctctgatgaaccagtac 191

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | |||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 192 gtgaacaagaagttcagcaatcagtacaaagcgacgatcggcgcggatttcctgaccaag 251

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |  ||||| ||| ||||| |||| |||||||| ||||| || || || ||||||
Sbjct: 252 gaggtgcagatcgacgaccggctcttcacattgcagatttgggacacagcgggacaggag 311

                                                          
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctg 386
            | || ||||| || || ||||| || ||| ||||||| ||||||||
Sbjct: 312 cgatttcagagtcttggtgtggcattttaccggggagctgactgctg 358

---

>gb|AY226827.1| Oryza sativa (indica cultivar-group) small GTP binding protein
           (Rab7) mRNA, complete cds
          Length = 1018

 Score =  165 bits (83), Expect = 2e-37
 Identities = 164/191 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||||||||  ||||| ||||||||||| ||||||||||| |||
Sbjct: 90  ctcaaggtcatcatcctcggcgacacgggggttgggaagacgtccctgatgaaccaatat 149

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||||||||| |||||| | ||||||||||| || || ||||| || ||||||||||||
Sbjct: 150 gtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcaccaag 209

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           ||||| |   ||||||| |||||| |||| ||||| ||||||||||| || || ||||| 
Sbjct: 210 gaggttcagttcgaggataggctcttcactttgcaaatatgggatactgctggccaggaa 269

                      
Query: 340 aggttccagag 350
           ||||| |||||
Sbjct: 270 aggtttcagag 280

---

>gb|AY109438.1| Zea mays CL8348_1 mRNA sequence
          Length = 1232

 Score =  161 bits (81), Expect = 3e-36
 Identities = 186/221 (84%)
 Strand = Plus / Minus

                                                                        
Query: 157  ctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccag 216
            ||||||||||||||| |||||||||| || ||||| |||||||||||  |||||||||| 
Sbjct: 1132 ctgctcaaggtcatcatcctcggcgatagtggggttgggaagacgtccttgatgaaccaa 1073

                                                                        
Query: 217  tatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcacc 276
            |||||||||||||| |||||| | ||||||||||| || || || || || |||||||||
Sbjct: 1072 tatgtgaacaagaagttcagcaaccagtacaaggctacgattggggcggatttcctcacc 1013

                                                                        
Query: 277  aaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcag 336
            |||||||| |   |||||||||||||| ||||  |||| |||||||| || || || |||
Sbjct: 1012 aaggaggtgcagttcgaggacaggctcttcactctgcaaatatgggacactgctggtcag 953

                                                     
Query: 337  gagaggttccagagcctcggcgtggccttctacaggggagc 377
            || ||||| ||||| || ||||| || |||||| |||||||
Sbjct: 952  gaaaggtttcagagtcttggcgttgcattctaccggggagc 912

---

>gb|AF467541.1| Zea mays putative aldehyde dehydrogenase MIS1 (mis1) gene, complete
           cds
          Length = 11504

 Score =  137 bits (69), Expect = 4e-29
 Identities = 132/153 (86%)
 Strand = Plus / Minus

                                                                       
Query: 311 tgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctaca 370
           ||||||||||||| ||||| || ||||||||||||||||| || |||||||| |||||||
Sbjct: 657 tgcagatatgggacacggcgggacaggagaggttccagagtcttggcgtggcgttctaca 598

                                                                       
Query: 371 ggggagccgactgctgcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgc 430
           |||| ||||| ||||| |||||||| || || ||||||| ||| |||| ||| |||||||
Sbjct: 597 ggggtgccgattgctgtgtgctggtttatgatgtcaatgtcaagagaagctttaatacgc 538

                                            
Query: 431 tcggtacctggcacgacgagttcatcaaccaag 463
           ||| ||||||||| || |||||| |||| ||||
Sbjct: 537 tcgatacctggcatgatgagttcctcaatcaag 505



 Score =  119 bits (60), Expect = 1e-23
 Identities = 87/96 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           |||| |||||| ||||||||||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 883 gtgagcaagaagttcagccagcagtacaaggcgacgatcggtgccgatttcctcaccaag 824

                                               
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcag 315
           ||||| ||||| |  |||||||||||||||||||||
Sbjct: 823 gaggtgctcattggcgacaggctcgtcaccttgcag 788



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 44/44 (100%)
 Strand = Plus / Minus

                                                        
Query: 146  ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1372 ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 1329



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 188  gggtcgggaagacgtcgctgatgaaccagtat 219
            ||||||| ||||||||||||||||| ||||||
Sbjct: 1190 gggtcggcaagacgtcgctgatgaatcagtat 1159



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 487 tttcccttcattttggtcgggaacaag 513
           ||||| |||||||||||||||||||||
Sbjct: 111 tttccgttcattttggtcgggaacaag 85

---

>gb|DQ154924.1| Triticum turgidum RAB7 (RAB7) gene, exons 1, 2 and partial cds; and
           delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH)
           gene, complete cds
          Length = 9338

 Score =  135 bits (68), Expect = 2e-28
 Identities = 68/68 (100%)
 Strand = Plus / Minus

                                                                       
Query: 122 gcccggccatggcgatggcgccgaggaggcggacgctgctcaaggtcatcgtcctcggcg 181
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 385 gcccggccatggcgatggcgccgaggaggcggacgctgctcaaggtcatcgtcctcggcg 326

                   
Query: 182 acagcggg 189
           ||||||||
Sbjct: 325 acagcggg 318



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 188 gggtcgggaagacgtcgctgatgaaccagtat 219
           ||||||| ||||||||||||||||||||||||
Sbjct: 206 gggtcggcaagacgtcgctgatgaaccagtat 175



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 26  gcaccggtggtggagcagataggggcggga 55
           |||| |||||||||| ||||||||||||||
Sbjct: 510 gcactggtggtggagtagataggggcggga 481

---

>ref|XM_791270.1| PREDICTED: Strongylocentrotus purpuratus rab7 GTPase homolog SUrab7
           (rab7), mRNA
          Length = 835

 Score =  125 bits (63), Expect = 2e-25
 Identities = 201/247 (81%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||| ||| |||| || ||||| || || || ||||| || |||||||||||||||
Sbjct: 166 ctcaaggttatcatccttggtgacagtggtgttggcaagacttcactgatgaaccagtat 225

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || |||||||| |||||| | |||||||| || ||||| ||||| || ||||| || || 
Sbjct: 226 gtcaacaagaagttcagcaatcagtacaaagcaaccattggcgcagatttcctaacaaaa 285

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           || ||| |  | || |||||  | |||||  |||||||||||||||| || || || |||
Sbjct: 286 gaagtcatggttgatgacagatttgtcacaatgcagatatgggataccgctggtcaagag 345

                                                                       
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggtctac 399
           ||||| |||||| | |||||||||||||||||||| || ||||||||||| || ||||  
Sbjct: 346 aggtttcagagcttgggcgtggccttctacaggggggcagactgctgcgtactagtcttt 405

                  
Query: 400 gacgtca 406
           |||||||
Sbjct: 406 gacgtca 412

---

>gb|BC102415.1| Bos taurus similar to Ras-related protein Rab-7, mRNA (cDNA clone
           MGC:127597 IMAGE:7949686), complete cds
          Length = 1288

 Score =  125 bits (63), Expect = 2e-25
 Identities = 177/215 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||| ||||||||||| || ||  | |||||||| 
Sbjct: 138 gtcgggaagacctcactcatgaaccagtacgtgaacaagaagtttagtaaccagtacaaa 197

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || ||||| ||||||||||| || ||||||||  |  | || ||||| || || |||
Sbjct: 198 gccacaatcggggccgacttcctgacgaaggaggtgatggtggatgacagactagtgacc 257

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||| ||||| ||||| || |||||| ||||||||  ||| |||||||||||||||
Sbjct: 258 atgcagatttgggacacggcgggacaggagcggttccagtccctgggcgtggccttctac 317

                                              
Query: 370 aggggagccgactgctgcgtgctggtctacgacgt 404
           || || |||||||||||||| ||||| | ||||||
Sbjct: 318 agaggcgccgactgctgcgtcctggtgttcgacgt 352

---

>ref|NM_001035081.1| Bos taurus similar to Ras-related protein Rab-7 (MGC127597), mRNA
          Length = 1288

 Score =  125 bits (63), Expect = 2e-25
 Identities = 177/215 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||| ||||||||||| || ||  | |||||||| 
Sbjct: 138 gtcgggaagacctcactcatgaaccagtacgtgaacaagaagtttagtaaccagtacaaa 197

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || ||||| ||||||||||| || ||||||||  |  | || ||||| || || |||
Sbjct: 198 gccacaatcggggccgacttcctgacgaaggaggtgatggtggatgacagactagtgacc 257

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||| ||||| ||||| || |||||| ||||||||  ||| |||||||||||||||
Sbjct: 258 atgcagatttgggacacggcgggacaggagcggttccagtccctgggcgtggccttctac 317

                                              
Query: 370 aggggagccgactgctgcgtgctggtctacgacgt 404
           || || |||||||||||||| ||||| | ||||||
Sbjct: 318 agaggcgccgactgctgcgtcctggtgttcgacgt 352

---

>ref|XM_526302.1| PREDICTED: Pan troglodytes similar to Ras-related protein Rab-7
           (LOC470919), mRNA
          Length = 624

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 55  gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 114

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 115 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 174

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 175 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 234

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 235 agaggtgcagactgctgcgttctggt 260

---

>ref|NM_004637.5| Homo sapiens RAB7, member RAS oncogene family (RAB7), mRNA
          Length = 2240

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 287 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 346

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 347 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 406

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 407 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 466

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 467 agaggtgcagactgctgcgttctggt 492

---

>gb|U44104.1|HSU44104 Homo sapiens small GTP binding protein Rab7 mRNA, complete cds
          Length = 624

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 55  gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 114

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 115 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctggtcaca 174

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 175 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 234

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 235 agaggtgcagactgctgcgttctggt 260

---

>emb|X93499.1|HSRAB7 H.sapiens mRNA for RAB7 protein
          Length = 2264

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 657 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 716

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 717 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 776

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 777 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 836

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 837 agaggtgcagactgctgcgttctggt 862

---

>gb|BC008721.2| Homo sapiens RAB7, member RAS oncogene family, mRNA (cDNA clone
           MGC:8453 IMAGE:2821435), complete cds
          Length = 1489

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 230 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 289

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 290 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 349

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 350 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 409

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 410 agaggtgcagactgctgcgttctggt 435

---

>gb|AF498942.1| Homo sapiens small GTP binding protein RAB7 (RAB7) mRNA, complete
           cds
          Length = 624

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 55  gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 114

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 115 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 174

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 175 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 234

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 235 agaggtgcagactgctgcgttctggt 260

---

>dbj|AK000826.1| Homo sapiens cDNA FLJ20819 fis, clone ADSE00511
          Length = 2190

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 230 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 289

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 290 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 349

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 350 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 409

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 410 agaggtgcagactgctgcgttctggt 435

---

>gb|BC013728.1| Homo sapiens RAB7, member RAS oncogene family, mRNA (cDNA clone
           MGC:17256 IMAGE:3882701), complete cds
          Length = 1358

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 70  gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 129

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 130 gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 189

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 190 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 249

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 250 agaggtgcagactgctgcgttctggt 275

---

>gb|AC097112.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01,
              complete sequence
          Length = 147704

 Score =  119 bits (60), Expect = 1e-23
 Identities = 87/96 (90%)
 Strand = Plus / Plus

                                                                          
Query: 220    gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
              ||||||||||| || |||||||||||||||||||| ||||||||||| ||| ||||||||
Sbjct: 103031 gtgaacaagaagtttagccagcagtacaaggcgacgatcggcgccgatttcgtcaccaag 103090

                                                  
Query: 280    gaggtcctcatcgaggacaggctcgtcaccttgcag 315
              ||||| ||||| || |||||||| ||||||||||||
Sbjct: 103091 gaggttctcattgaagacaggcttgtcaccttgcag 103126



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                          
Query: 146    ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
              ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102551 ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 102594



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                          
Query: 314    agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 373
              |||| ||||| |||||||| ||||||||||| ||||| ||||| ||||| |||||||| |
Sbjct: 103240 agatctgggacacggcaggacaggagaggtttcagagtctcggtgtggcgttctacagag 103299

                                                                          
Query: 374    gagccgactgctgcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgctcg 433
              | || || |||||  |||| |||||||| |||||||| |||||| | |||||| | ||| 
Sbjct: 103300 gtgcagattgctgtatgctagtctacgatgtcaatgctaaaagatctttcaatgcactca 103359

                                            
Query: 434    gtacctggcacgacgagttcatcaaccaag 463
                |||||||| || |||||| ||| |||||
Sbjct: 103360 acacctggcatgatgagttcctcacccaag 103389



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 146    ggaggcggacgctgctcaaggtcatcgtcctcggcgacag 185
              ||||| |||||||||| ||||||||||||||||| |||||
Sbjct: 100175 ggaggaggacgctgctaaaggtcatcgtcctcggtgacag 100214



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 188    gggtcgggaagacgtcgctgatgaaccagtat 219
              |||| ||||||||||| |||||||||||||||
Sbjct: 102762 gggtggggaagacgtccctgatgaaccagtat 102793



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 220    gtgaacaagaaattcagccagcagtacaaggc 251
              ||||||| ||| || |||||||||||||||||
Sbjct: 101214 gtgaacacgaagtttagccagcagtacaaggc 101245

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  119 bits (60), Expect = 1e-23
 Identities = 87/96 (90%)
 Strand = Plus / Plus

                                                                            
Query: 220      gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
                ||||||||||| || |||||||||||||||||||| ||||||||||| ||| ||||||||
Sbjct: 26458340 gtgaacaagaagtttagccagcagtacaaggcgacgatcggcgccgatttcgtcaccaag 26458399

                                                    
Query: 280      gaggtcctcatcgaggacaggctcgtcaccttgcag 315
                ||||| ||||| || |||||||| ||||||||||||
Sbjct: 26458400 gaggttctcattgaagacaggcttgtcaccttgcag 26458435



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                            
Query: 146      ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
                ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26457860 ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 26457903



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                            
Query: 314      agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 373
                |||| ||||| |||||||| ||||||||||| ||||| ||||| ||||| |||||||| |
Sbjct: 26458549 agatctgggacacggcaggacaggagaggtttcagagtctcggtgtggcgttctacagag 26458608

                                                                            
Query: 374      gagccgactgctgcgtgctggtctacgacgtcaatgccaaaagaaccttcaatacgctcg 433
                | || || |||||  |||| |||||||| |||||||| |||||| | |||||| | ||| 
Sbjct: 26458609 gtgcagattgctgtatgctagtctacgatgtcaatgctaaaagatctttcaatgcactca 26458668

                                              
Query: 434      gtacctggcacgacgagttcatcaaccaag 463
                  |||||||| || |||||| ||| |||||
Sbjct: 26458669 acacctggcatgatgagttcctcacccaag 26458698



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                            
Query: 217      tatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcacc 276
                |||||||||||||| |||||| | ||||||||||| || || ||||| || |||||||||
Sbjct: 25420682 tatgtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcacc 25420741

                                                      
Query: 277      aaggaggtcctcatcgaggacaggctcgtcaccttgca 314
                |||||||| |   ||||||| |||||| |||| |||||
Sbjct: 25420742 aaggaggttcagttcgaggataggctcttcactttgca 25420779



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 146      ggaggcggacgctgctcaaggtcatcgtcctcggcgacag 185
                ||||| |||||||||| ||||||||||||||||| |||||
Sbjct: 26455484 ggaggaggacgctgctaaaggtcatcgtcctcggtgacag 26455523



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 160      ctcaaggtcatcgtcctcggcgacagcggg 189
                |||||||||||| |||||||||||||||||
Sbjct: 25420395 ctcaaggtcatcatcctcggcgacagcggg 25420424



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 188      gggtcgggaagacgtcgctgatgaaccagtat 219
                |||| ||||||||||| |||||||||||||||
Sbjct: 26458071 gggtggggaagacgtccctgatgaaccagtat 26458102



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 188      gggtcgggaagacgtcgctgatgaaccagtat 219
                |||| ||||||||||| |||||||||||||||
Sbjct: 25420525 gggttgggaagacgtccctgatgaaccagtat 25420556



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                         
Query: 310      ttgcagatatgggatacggcagggcaggagaggttccagag 350
                ||||||||||||||||| || || ||||| ||||| |||||
Sbjct: 25421736 ttgcagatatgggatactgctggccaggaaaggtttcagag 25421776



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 220      gtgaacaagaaattcagccagcagtacaaggc 251
                ||||||| ||| || |||||||||||||||||
Sbjct: 26456523 gtgaacacgaagtttagccagcagtacaaggc 26456554

---

>emb|CR859246.1| Pongo pygmaeus mRNA; cDNA DKFZp459E131 (from clone DKFZp459E131)
          Length = 2251

 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 264 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 323

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || || ||||||||  |  | || |||||||| ||||| 
Sbjct: 324 gccacaataggagctgactttctgacaaaggaggtgatggtggatgacaggctagtcaca 383

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 384 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 443

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 444 agaggtgcagactgctgcgttctggt 469

---

>gb|AF050175.1|AF050175 Homo sapiens Rab7 (Rab7) gene, complete cds
          Length = 624

 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 55  gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 114

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || | |||||||||  |  | || |||||||| ||||| 
Sbjct: 115 gccacaataggagctgactttctgatcaaggaggtgatggtggatgacaggctagtcacg 174

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 175 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 234

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 235 agaggtgcagactgctgcgttctggt 260

---

>emb|BX537775.1|HSM805862 Homo sapiens mRNA; cDNA DKFZp779L0164 (from clone DKFZp779L0164);
           complete cds
          Length = 1809

 Score =  115 bits (58), Expect = 2e-22
 Identities = 169/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||| ||||||||| |||||||||||| | |||||||| 
Sbjct: 3   gtcgggaagacatcactcatgaaccggtatgtgaataagaaattcagcaatcagtacaaa 62

                                                                       
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcacc 309
           || || || || || ||||| || |||||||||||  |  | || |||||||| ||||| 
Sbjct: 63  gccacaataggagctgactttctgaccaaggaggtgatggtggatgacaggctagtcaca 122

                                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctac 369
            ||||||||||||| || ||||| |||||  ||||||||   ||||| ||||||||||||
Sbjct: 123 atgcagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctac 182

                                     
Query: 370 aggggagccgactgctgcgtgctggt 395
           || || || ||||||||||| |||||
Sbjct: 183 agaggtgcagactgctgcgttctggt 208

---

>ref|XM_414359.1| PREDICTED: Gallus gallus similar to Ras-related protein Rab-7
           (LOC416016), mRNA
          Length = 1969

 Score =  107 bits (54), Expect = 4e-20
 Identities = 186/230 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 gtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaac 225
           |||||| ||||||| |||   ||||| |||||||| || || ||||||||||||||||||
Sbjct: 133 gtcatcatcctcggagactctggggtggggaagacatcactcatgaaccagtatgtgaac 192

                                                                       
Query: 226 aagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtc 285
           |||||||| ||  | ||||||||||| || || || || |||||||| || || ||||||
Sbjct: 193 aagaaatttagtaaccagtacaaggctacgataggtgcagacttcctgacaaaagaggtc 252

                                                                       
Query: 286 ctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttc 345
            |  | || |||||||| || ||  |||||||||||||||| ||||| || ||  | |||
Sbjct: 253 atggtggatgacaggctagtgacaatgcagatatgggatacagcaggccaagaacgattc 312

                                                             
Query: 346 cagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggt 395
           |||   || || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 313 cagtctctgggagttgccttctacaggggagcagactgctgtgtgctggt 362

---

>emb|CR406454.1| Gallus gallus finished cDNA, clone ChEST950l22
          Length = 818

 Score =  107 bits (54), Expect = 4e-20
 Identities = 186/230 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 gtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaac 225
           |||||| ||||||| |||   ||||| |||||||| || || ||||||||||||||||||
Sbjct: 133 gtcatcatcctcggagactctggggtggggaagacatcactcatgaaccagtatgtgaac 192

                                                                       
Query: 226 aagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtc 285
           |||||||| ||  | ||||||||||| || || || || |||||||| || || ||||||
Sbjct: 193 aagaaatttagtaaccagtacaaggctacgataggtgcagacttcctgacaaaagaggtc 252

                                                                       
Query: 286 ctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttc 345
            |  | || |||||||| || ||  |||||||||||||||| ||||| || ||  | |||
Sbjct: 253 atggtggatgacaggctagtgacaatgcagatatgggatacagcaggccaagaacgattc 312

                                                             
Query: 346 cagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggt 395
           |||   || || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 313 cagtctctgggagttgccttctacaggggagcagactgctgtgtgctggt 362

---

>ref|NM_191744.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 597

 Score =  105 bits (53), Expect = 1e-19
 Identities = 203/253 (80%)
 Strand = Plus / Plus

                                                                       
Query: 224 acaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggagg 283
           ||||||| || |||||||||||||| || || || || || || ||| ||||||||||||
Sbjct: 65  acaagaagtttagccagcagtacaaagctacaattggtgcggatttcgtcaccaaggagg 124

                                                                       
Query: 284 tcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggt 343
           ||||||| || || |||||||| ||  ||||||| ||||| || || |||||||||||||
Sbjct: 125 tcctcattgaagataggctcgtgactctgcagatctgggacactgcggggcaggagaggt 184

                                                                       
Query: 344 tccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggtctacgacg 403
           ||||||| || || || || || ||||| ||||| || || || ||||| ||||| ||||
Sbjct: 185 tccagagtcttggtgttgcgttttacagaggagcagattgttgtgtgctcgtctatgacg 244

                                                                       
Query: 404 tcaatgccaaaagaaccttcaatacgctcggtacctggcacgacgagttcatcaaccaag 463
           ||||| | || ||  | ||  | ||||||   || ||||| || |||||| |||||||||
Sbjct: 245 tcaattctaacaggtcatttgacacgctcaacacatggcatgatgagttcctcaaccaag 304

                        
Query: 464 ctggcccatcaga 476
           || ||||||||||
Sbjct: 305 ctagcccatcaga 317



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 160 ctcaaggtcatcgtcctcggcgacagcgg 188
           |||||||||||||||||||||||||||||
Sbjct: 28  ctcaaggtcatcgtcctcggcgacagcgg 56

---

>gb|U13170.1|CRU13170 Chlamydomonas reinhardtii YptC5 (yptC5) gene, complete cds
          Length = 2990

 Score =  105 bits (53), Expect = 1e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                        
Query: 190  gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
            ||||||||||||||||||||||||||||||||  | ||||| |||| | || ||||||||
Sbjct: 1172 gtcgggaagacgtcgctgatgaaccagtatgttcagaagaagttcaccaaggagtacaag 1231

                                             
Query: 250  gcgaccatcggcgccgacttcctcaccaaggag 282
            || || ||||| |||||||||||||||||||||
Sbjct: 1232 gccacaatcggtgccgacttcctcaccaaggag 1264

---

>gb|AY871298.1| Gekko japonicus GekBS079P mRNA, complete cds
          Length = 1656

 Score =  105 bits (53), Expect = 1e-19
 Identities = 192/237 (81%), Gaps = 1/237 (0%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctga-tgaaccagta 218
           ||||| |||||| ||||||| |||   ||||| |||||||| || || | ||||||||||
Sbjct: 161 ctcaaagtcatcatcctcggagactcgggggtggggaagacatctctcaatgaaccagta 220

                                                                       
Query: 219 tgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaa 278
           |||||||||||| |||||  | |||||||| || || || || || ||||||||||| ||
Sbjct: 221 tgtgaacaagaagttcagtaaccagtacaaagctacaataggagcagacttcctcacaaa 280

                                                                       
Query: 279 ggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcagga 338
           ||| ||  |  | || || ||||| |||||  |||||||||||||||||||||| |||||
Sbjct: 281 ggaagtgatggtggatgataggctagtcacaatgcagatatgggatacggcaggacagga 340

                                                                    
Query: 339 gaggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggt 395
             |||| |||   || || || ||||||||||| ||||| |||||||||||||||||
Sbjct: 341 acggtttcagtctctgggagttgccttctacagaggagcggactgctgcgtgctggt 397

---

>ref|NM_001005591.1| Danio rerio zgc:100918 (zgc:100918), mRNA
          Length = 2037

 Score =  103 bits (52), Expect = 6e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 ctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgcc 264
           ||||||||||||||||| |||||||| |||||| | ||||| || || ||||||||||| 
Sbjct: 273 ctgatgaaccagtatgtcaacaagaagttcagcaatcagtataaagccaccatcggcgca 332

                                                                       
Query: 265 gacttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggat 324
           ||||| || |||||||||||  |  | || ||||| || || ||  ||||||| ||||||
Sbjct: 333 gactttcttaccaaggaggtgatggtggacgacagactggtgacgatgcagatctgggat 392

                                                                       
Query: 325 acggcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgc 384
           |||||||| |||||| | ||||||   ||||| ||||| || ||| | || |||||||||
Sbjct: 393 acggcaggacaggagcgtttccagtctctcggggtggcgttttaccgtggtgccgactgc 452

                               
Query: 385 tgcgtgctggtctacgacgt 404
           || || ||||| ||||||||
Sbjct: 453 tgtgttctggtgtacgacgt 472

---

>gb|BC082296.1| Danio rerio zgc:100918, mRNA (cDNA clone MGC:100918 IMAGE:7144910),
           complete cds
          Length = 2037

 Score =  103 bits (52), Expect = 6e-19
 Identities = 163/200 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 ctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgcc 264
           ||||||||||||||||| |||||||| |||||| | ||||| || || ||||||||||| 
Sbjct: 273 ctgatgaaccagtatgtcaacaagaagttcagcaatcagtataaagccaccatcggcgca 332

                                                                       
Query: 265 gacttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggat 324
           ||||| || |||||||||||  |  | || ||||| || || ||  ||||||| ||||||
Sbjct: 333 gactttcttaccaaggaggtgatggtggacgacagactggtgacgatgcagatctgggat 392

                                                                       
Query: 325 acggcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgc 384
           |||||||| |||||| | ||||||   ||||| ||||| || ||| | || |||||||||
Sbjct: 393 acggcaggacaggagcgtttccagtctctcggggtggcgttttaccgtggtgccgactgc 452

                               
Query: 385 tgcgtgctggtctacgacgt 404
           || || ||||| ||||||||
Sbjct: 453 tgtgttctggtgtacgacgt 472

---

>ref|XM_307368.2| Anopheles gambiae str. PEST ENSANGP00000013739
           (ENSANGG00000011250), partial mRNA
          Length = 624

 Score =  101 bits (51), Expect = 2e-18
 Identities = 168/207 (81%)
 Strand = Plus / Plus

                                                                       
Query: 163 aaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtg 222
           ||||| ||||| |||||||||||| | || || ||||||||||||||||| ||||| |||
Sbjct: 28  aaggtgatcgtgctcggcgacagcagcgtgggcaagacgtcgctgatgaatcagtacgtg 87

                                                                       
Query: 223 aacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggag 282
           ||||||   |||    | |||||||||||||| ||||| || ||||||||||| ||||||
Sbjct: 88  aacaagcgcttctcgaaccagtacaaggcgacgatcggggctgacttcctcacgaaggag 147

                                                                       
Query: 283 gtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagagg 342
           ||| | ||||| ||  || | || ||  ||||||| ||||||||||| || |||||| ||
Sbjct: 148 gtcgtgatcgatgagcgggtggtaacgatgcagatctgggatacggctggccaggagcgg 207

                                      
Query: 343 ttccagagcctcggcgtggccttctac 369
           ||||||   |||||||| || ||||||
Sbjct: 208 ttccagtcgctcggcgtagcgttctac 234

---

>ref|XM_321482.2| Anopheles gambiae str. PEST ENSANGP00000018151
           (ENSANGG00000015662), partial mRNA
          Length = 624

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 151/185 (81%)
 Strand = Plus / Plus

                                                                       
Query: 163 aaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtg 222
           ||||| ||||| |||||||||||| | || || |||||||| |||||||||||||| || 
Sbjct: 28  aaggtgatcgtgctcggcgacagcagcgtaggcaagacgtcactgatgaaccagtacgtt 87

                                                                       
Query: 223 aacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggag 282
           ||||||   |||    | |||||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 88  aacaagcgcttctcgaaccagtacaaggcgacgatcggggccgacttcctcacgaaggag 147

                                                                       
Query: 283 gtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagagg 342
           ||| | ||||| ||  || | || ||  ||||||| ||||||||||| || |||||| ||
Sbjct: 148 gtcgtgatcgatgagcgggtggtaacgatgcagatctgggatacggctggccaggagcgg 207

                
Query: 343 ttcca 347
           |||||
Sbjct: 208 ttcca 212

---

>emb|CR698058.1|CNS0G1KM Tetraodon nigroviridis full-length cDNA
          Length = 2015

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 197/247 (79%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           ||||| |||||| ||||||| |||  ||| || || ||||| || |||||||| ||||||
Sbjct: 285 ctcaaagtcatcatcctcggagactccggagttggcaagacctccctgatgaatcagtat 344

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           ||||| ||||| |||||| | ||||| || || || || || ||||| ||||| || || 
Sbjct: 345 gtgaataagaagttcagcaaccagtataaagccacaataggggccgatttcctgacaaaa 404

                                                                       
Query: 280 gaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggag 339
           || ||| |  | || ||||| || |||||  ||||||| |||||||||||||| ||||||
Sbjct: 405 gaagtcatggtggatgacagacttgtcacaatgcagatttgggatacggcaggtcaggag 464

                                                                       
Query: 340 aggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggtctac 399
            ||||||||  | | |||||||| |||||| | || || ||||||||||| ||||| | |
Sbjct: 465 cggttccagtccttaggcgtggctttctaccgcggggcggactgctgcgtcctggtgttc 524

                  
Query: 400 gacgtca 406
           |||||||
Sbjct: 525 gacgtca 531

---

>gb|U82219.1|PAU82219 Prunus armeniaca Rab7 GTP binding protein mRNA, complete cds
          Length = 987

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                       
Query: 163 aaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtg 222
           ||||||||  |||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 122 aaggtcattatcctcggcgacagcggggtcgggaagacatcgctgatgaatcagtatgtg 181

             
Query: 223 aa 224
           ||
Sbjct: 182 aa 183

---

>gb|AF050174.1|AF050174 Oryctolagus cuniculus Rab7 (Rab7) mRNA, complete cds
          Length = 624

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 158/197 (80%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||| |||||||||||||||||  | |||||||| || || || || || |||
Sbjct: 73  atgaaccagtacgtgaacaagaaattcagtaaccagtacaaagccacaataggagcagac 132

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || || |||||||||||  |  | || |||||||| || ||  ||||||| ||||| || 
Sbjct: 133 tttctgaccaaggaggtgatggtggatgacaggctagttacgatgcagatctgggacaca 192

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           ||||| |||||  ||||||||   ||| | |||||||||||||| || || |||||||||
Sbjct: 193 gcaggacaggaacggttccagtctctcagtgtggccttctacagaggtgcagactgctgc 252

                            
Query: 388 gtgctggtctacgacgt 404
           || ||||| | ||||||
Sbjct: 253 gttctggtattcgacgt 269

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                          
Query: 146    ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
              ||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 796260 ggaggcggacgctgctcaaggtcatcgtcctaggcgacagcggg 796303



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                           
Query: 220     gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
               ||||||||||| |||||| | |||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 7043465 gtgaacaagaagttcagcaatcagtacaaagcgacgatcggcgcggatttcctgaccaag 7043524

                                                   
Query: 280     gaggtcctcatcgaggacaggctcgtcaccttgcag 315
               ||||| |  ||||| ||| ||||| |||| ||||||
Sbjct: 7043525 gaggtgcagatcgacgaccggctcttcacattgcag 7043560



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                              
Query: 160      ctcaaggtcatcgtcctcggcgacagcggg 189
                ||||||||||||||||||||||||||||||
Sbjct: 29728176 ctcaaggtcatcgtcctcggcgacagcggg 29728147



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                            
Query: 224      acaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggagg 283
                ||||||| || |||||||||||||| || || || || || || ||| ||||||||||||
Sbjct: 29727592 acaagaagtttagccagcagtacaaagctacaattggtgcggatttcgtcaccaaggagg 29727533

                                      
Query: 284      tcctcatcgaggacaggctcgt 305
                ||||||| || || ||||||||
Sbjct: 29727532 tcctcattgaagataggctcgt 29727511



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                            
Query: 314      agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 373
                |||| ||||| || || |||||||||||||||||||| || || || || || ||||| |
Sbjct: 29727406 agatctgggacactgcggggcaggagaggttccagagtcttggtgttgcgttttacagag 29727347

                                                   
Query: 374      gagccgactgctgcgtgctggtctacgacgtcaat 408
                |||| || || || ||||| ||||| |||||||||
Sbjct: 29727346 gagcagattgttgtgtgctcgtctatgacgtcaat 29727312



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                              
Query: 188     gggtcgggaagacgtcgctgatgaaccagta 218
               |||||||||||||||| ||||||||||||||
Sbjct: 7043308 gggtcgggaagacgtctctgatgaaccagta 7043338



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 188      gggtcgggaagacgtcgctgatgaaccagtat 219
                |||| |||||||||||||| ||||||||||||
Sbjct: 29727987 gggtggggaagacgtcgcttatgaaccagtat 29727956



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 160     ctcaaggtcatcgtcctcggcgacagcggg 189
               |||||||||||| ||||||| |||||||||
Sbjct: 7043154 ctcaaggtcatcatcctcggtgacagcggg 7043183

---

>ref|NM_001003316.1| Canis familiaris RAB7, member RAS oncogene family (RAB7), mRNA
          Length = 811

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 151/188 (80%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           |||||||||||||||||||||||||||||  | |||||||| || || || || || |||
Sbjct: 92  atgaaccagtatgtgaacaagaaattcagtaatcagtacaaagctacaataggagcagac 151

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || || || ||||||||  |  | || ||||| || || ||  ||||||| ||||| || 
Sbjct: 152 tttctgacaaaggaggtgatggtggatgacagactagttacaatgcagatctgggacaca 211

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           ||||| |||||  ||||||||  ||| || |||||||||||||| || || |||||||||
Sbjct: 212 gcaggccaggaacggttccagtcccttggtgtggccttctacagaggtgcagactgctgc 271

                   
Query: 388 gtgctggt 395
           || |||||
Sbjct: 272 gttctggt 279

---

>dbj|AP002867.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0463F06
          Length = 144322

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                         
Query: 146   ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
             ||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 18934 ggaggcggacgctgctcaaggtcatcgtcctaggcgacagcggg 18977

---

>dbj|AP003338.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1212_B09
          Length = 130728

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 43/44 (97%)
 Strand = Plus / Plus

                                                         
Query: 146   ggaggcggacgctgctcaaggtcatcgtcctcggcgacagcggg 189
             ||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 73460 ggaggcggacgctgctcaaggtcatcgtcctaggcgacagcggg 73503

---

>gb|L14930.1|SOYRAB7P Glycine max (Rab7p) mRNA, complete cds
          Length = 1166

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           ||||||||||||| || ||||||||||||||||| |||||||| ||| ||||||| || |
Sbjct: 264 tgctcaaggtcattgttctcggcgacagcggggttgggaagacctcgttgatgaatcaat 323

                                                   
Query: 218 atgtgaacaagaaattcagccagcagtacaaggcgaccat 257
           | ||| ||||||| || || ||||| || ||||| |||||
Sbjct: 324 acgtgcacaagaagtttagtcagcaatataaggctaccat 363

---

>gb|M35522.1|DOGRAB7A C.familiaris GTP-binding protein (rab7) mRNA, complete cds
          Length = 811

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 151/188 (80%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           |||||||||||||||||||||||||||||  | |||||||| || || || || || |||
Sbjct: 92  atgaaccagtatgtgaacaagaaattcagtaatcagtacaaagctacaataggagcagac 151

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || || || ||||||||  |  | || ||||| || || ||  ||||||| ||||| || 
Sbjct: 152 tttctgacaaaggaggtgatggtggatgacagactagttacaatgcagatctgggacaca 211

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           ||||| |||||  ||||||||  ||| || |||||||||||||| || || |||||||||
Sbjct: 212 gcaggccaggaacggttccagtcccttggtgtggccttctacagaggtgcagactgctgc 271

                   
Query: 388 gtgctggt 395
           || |||||
Sbjct: 272 gttctggt 279

---

>gb|BC060401.1| Xenopus laevis hypothetical protein MGC68523, mRNA (cDNA clone
           MGC:68523 IMAGE:4030853), complete cds
          Length = 1470

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 198/251 (78%)
 Strand = Plus / Plus

                                                                       
Query: 156 gctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaacca 215
           |||||| ||||||||| ||||||| ||    ||||| || ||||| || || ||||||||
Sbjct: 197 gctgctgaaggtcatcatcctcggggattctggggttggcaagacctctctcatgaacca 256

                                                                       
Query: 216 gtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcac 275
           ||||||||| ||||| |||| | | |||||||| || || || || || || || |||||
Sbjct: 257 gtatgtgaataagaagttcaccaaccagtacaaagccactataggggcagattttctcac 316

                                                                       
Query: 276 caaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggca 335
            ||||||||  |  | || |||||  | |||||  ||||||| ||||| || || |||||
Sbjct: 317 taaggaggtgatggtggatgacagattggtcacaatgcagatctgggacacagctgggca 376

                                                                       
Query: 336 ggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgcgtgctggt 395
           ||| ||||||||   ||| || || || |||||| | || ||||||||||||||| ||||
Sbjct: 377 ggaaaggttccaatccctgggggtcgctttctaccgaggggccgactgctgcgtgttggt 436

                      
Query: 396 ctacgacgtca 406
           |||||||||||
Sbjct: 437 ctacgacgtca 447

---

>dbj|AK094449.1| Homo sapiens cDNA FLJ37130 fis, clone BRACE2023069, weakly similar
           to RAS-RELATED PROTEIN RAB-7
          Length = 1911

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 190 gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 240 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 299

                                              
Query: 250 gcgaccatcggcgccgacttcctcaccaaggaggt 284
           || || || || || ||||| || |||||||||||
Sbjct: 300 gccacaataggagctgactttctgaccaaggaggt 334

---

>gb|AC023598.30| Homo sapiens 3 BAC RP11-221E20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 66685

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                         
Query: 190   gtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
             ||||||||||| || || ||||||||||||||||| |||||||||||| | |||||||| 
Sbjct: 58955 gtcgggaagacatcactcatgaaccagtatgtgaataagaaattcagcaatcagtacaaa 58896

                                                
Query: 250   gcgaccatcggcgccgacttcctcaccaaggaggt 284
             || || || || || ||||| || |||||||||||
Sbjct: 58895 gccacaataggagctgactttctgaccaaggaggt 58861



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 313   cagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacagg 372
             ||||||||||| || ||||| |||||  ||||||||   ||||| |||||||||||||| 
Sbjct: 50530 cagatatgggacacagcaggacaggaacggttccagtctctcggtgtggccttctacaga 50471

                                    
Query: 373   ggagccgactgctgcgtgctggt 395
             || || ||||||||||| |||||
Sbjct: 50470 ggtgcagactgctgcgttctggt 50448

---

>ref|NM_112768.1| Arabidopsis thaliana GTP binding AT3G18820 mRNA, complete cds
          Length = 1027

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| || |||||||| || || || ||  ||||||| ||||||
Sbjct: 190 ctcaaggtcatcatcctcggtgatagcggggtgggaaaaacctctttgatgaatcagtat 249

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || || || || |||||| | ||||||||||| ||||| || ||||||||| | ||||||
Sbjct: 250 gttaataaaaagttcagcaaccagtacaaggcaaccattggagccgacttcttgaccaag 309

             
Query: 280 ga 281
           ||
Sbjct: 310 ga 311

---

>gb|AC130603.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1130G10,
             complete sequence
          Length = 143073

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                         
Query: 217   tatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcacc 276
             |||||||||||||| |||||| | ||||||||||| || || ||||| || |||||||||
Sbjct: 61043 tatgtgaacaagaagttcagcaaccagtacaaggctacgattggcgcggatttcctcacc 61102

                                                   
Query: 277   aaggaggtcctcatcgaggacaggctcgtcaccttgca 314
             |||||||| |   ||||||| |||||| |||| |||||
Sbjct: 61103 aaggaggttcagttcgaggataggctcttcactttgca 61140



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 160   ctcaaggtcatcgtcctcggcgacagcggg 189
             |||||||||||| |||||||||||||||||
Sbjct: 60756 ctcaaggtcatcatcctcggcgacagcggg 60785



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 188   gggtcgggaagacgtcgctgatgaaccagtat 219
             |||| ||||||||||| |||||||||||||||
Sbjct: 60886 gggttgggaagacgtccctgatgaaccagtat 60917



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 310   ttgcagatatgggatacggcagggcaggagaggttccagag 350
             ||||||||||||||||| || || ||||| ||||| |||||
Sbjct: 62097 ttgcagatatgggatactgctggccaggaaaggtttcagag 62137

---

>gb|AY059072.1| Arabidopsis thaliana putative GTP binding protein (At3g18820) mRNA,
           complete cds
          Length = 652

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| || |||||||| || || || ||  ||||||| ||||||
Sbjct: 25  ctcaaggtcatcatcctcggtgatagcggggtgggaaaaacctctttgatgaatcagtat 84

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || || || || |||||| | ||||||||||| ||||| || ||||||||| | ||||||
Sbjct: 85  gttaataaaaagttcagcaaccagtacaaggcaaccattggagccgacttcttgaccaag 144

             
Query: 280 ga 281
           ||
Sbjct: 145 ga 146

---

>gb|AY035137.1| Arabidopsis thaliana putative GTP binding protein (At3g18820) mRNA,
           complete cds
          Length = 857

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| || |||||||| || || || ||  ||||||| ||||||
Sbjct: 112 ctcaaggtcatcatcctcggtgatagcggggtgggaaaaacctctttgatgaatcagtat 171

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || || || || |||||| | ||||||||||| ||||| || ||||||||| | ||||||
Sbjct: 172 gttaataaaaagttcagcaaccagtacaaggcaaccattggagccgacttcttgaccaag 231

             
Query: 280 ga 281
           ||
Sbjct: 232 ga 233

---

>gb|AY084266.1| Arabidopsis thaliana clone 101693 mRNA, complete sequence
          Length = 1022

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| || |||||||| || || || ||  ||||||| ||||||
Sbjct: 184 ctcaaggtcatcatcctcggtgatagcggggtgggaaaaacctctttgatgaatcagtat 243

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || || || || |||||| | ||||||||||| ||||| || ||||||||| | ||||||
Sbjct: 244 gttaataaaaagttcagcaaccagtacaaggcaaccattggagccgacttcttgaccaag 303

             
Query: 280 ga 281
           ||
Sbjct: 304 ga 305

---

>dbj|AB071846.1| Arabidopsis thaliana mRNA for AtRab71, complete cds
          Length = 621

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Plus

                                                                       
Query: 160 ctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtat 219
           |||||||||||| ||||||| || |||||||| || || || ||  ||||||| ||||||
Sbjct: 25  ctcaaggtcatcatcctcggtgatagcggggtgggaaaaacctctttgatgaatcagtat 84

                                                                       
Query: 220 gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
           || || || || |||||| | ||||||||||| ||||| || ||||||||| | ||||||
Sbjct: 85  gttaataaaaagttcagcaaccagtacaaggcaaccattggagccgacttcttgaccaag 144

             
Query: 280 ga 281
           ||
Sbjct: 145 ga 146

---

>emb|Z73940.1|LJRAB7A L.japonicus mRNA for small GTP-binding protein, RAB7A
          Length = 930

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           |||||||||||||||| ||||||||||||||||| || ||||| ||| ||||||| || |
Sbjct: 58  tgctcaaggtcatcgttctcggcgacagcggggttggaaagacctcgttgatgaatcaat 117

                
Query: 218 atgtg 222
           |||||
Sbjct: 118 atgtg 122

---

>gb|L29274.1|TOBNTRAG Nicotiana tabacum SR1 Nt-rab7a mRNA, complete cds
          Length = 989

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 148 aggcggacgctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctg 207
           ||||||| ||| |||||||||||  |||| ||||| |||||||| || ||||| || |||
Sbjct: 110 aggcggatgcttctcaaggtcataatcctaggcgatagcggggtgggaaagacatctctg 169

                            
Query: 208 atgaaccagtatgtgaa 224
           |||||||||||||||||
Sbjct: 170 atgaaccagtatgtgaa 186



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 310 ttgcagatatgggatacggcagggcaggagaggttccagagcct 353
           |||||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 272 ttgcagatatgggatacggctgggcaggaaaggttccaaagcct 315

---

>gb|BC077884.1| Xenopus laevis RAB7, member RAS oncogene family, mRNA (cDNA clone
           MGC:80674 IMAGE:5511069), complete cds
          Length = 2153

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 311 tgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctaca 370
           ||||||||||||| || || |||||||||||||||||    || || || || |||||||
Sbjct: 283 tgcagatatgggacacagctgggcaggagaggttccaatcgcttggggtcgctttctaca 342

                                               
Query: 371 ggggagccgactgctgcgtgctggtctacgacgtca 406
           | || ||||||||||||||| |||||||||| ||||
Sbjct: 343 gaggggccgactgctgcgtgttggtctacgatgtca 378

---

>emb|Z73942.1|LJRAB7C L.japonicus mRNA for small GTP-binding protein, RAB7C
          Length = 1022

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 150/188 (79%)
 Strand = Plus / Plus

                                                                       
Query: 166 gtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaac 225
           |||||| | ||||| ||||||||||| |||||||| ||  |||||||||| |||||||| 
Sbjct: 118 gtcatcattctcggtgacagcggggttgggaagacttctttgatgaaccaatatgtgaat 177

                                                                       
Query: 226 aagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtc 285
           | ||| || ||| | ||||||||||| ||||| || ||||| ||| | ||||| || || 
Sbjct: 178 aggaagtttagcaatcagtacaaggctaccattggagccgatttcttaaccaaagaagtg 237

                                                                       
Query: 286 ctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttc 345
           |   | || || |||||  ||||||||||||| |||||||| || || ||||| || |||
Sbjct: 238 cagtttgaagataggcttttcaccttgcagatttgggatacagctggccaggaaagattc 297

                   
Query: 346 cagagcct 353
           || |||||
Sbjct: 298 caaagcct 305

---

>emb|Z73941.1|LJRAB7B L.japonicus mRNA for small GTP-binding protein, RAB7B
          Length = 1010

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           ||||||||||||| ||||||||||| |||||||| || ||||| ||| ||||||| || |
Sbjct: 157 tgctcaaggtcattgtcctcggcgatagcggggtgggaaagacctcgttgatgaatcaat 216

                       
Query: 218 atgtgaacaaga 229
           ||||| ||||||
Sbjct: 217 atgtgcacaaga 228

---

>dbj|AP003434.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0452F10
          Length = 145120

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                         
Query: 220   gtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaag 279
             ||||||||||| |||||| | |||||||| ||||| |||||||| || ||||| ||||||
Sbjct: 31045 gtgaacaagaagttcagcaatcagtacaaagcgacgatcggcgcggatttcctgaccaag 31104

                                                 
Query: 280   gaggtcctcatcgaggacaggctcgtcaccttgcag 315
             ||||| |  ||||| ||| ||||| |||| ||||||
Sbjct: 31105 gaggtgcagatcgacgaccggctcttcacattgcag 31140



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 188   gggtcgggaagacgtcgctgatgaaccagta 218
             |||||||||||||||| ||||||||||||||
Sbjct: 30888 gggtcgggaagacgtctctgatgaaccagta 30918



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 160   ctcaaggtcatcgtcctcggcgacagcggg 189
             |||||||||||| ||||||| |||||||||
Sbjct: 30734 ctcaaggtcatcatcctcggtgacagcggg 30763

---

>emb|X65650.1|PSGTPBP P.sativum mRNA rab for ras-related GTP-binding protein
          Length = 915

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 163 aaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtg 222
           ||||||||| | ||||| |||||||| || |||||||||||  |||||||||| ||||||
Sbjct: 99  aaggtcatcattctcggtgacagcggtgtggggaagacgtctttgatgaaccaatatgtg 158

                                              
Query: 223 aacaagaaattcagccagcagtacaaggcgaccat 257
           || ||||| || ||  | ||||||||||| |||||
Sbjct: 159 aataagaagtttagtaatcagtacaaggcaaccat 193

---

>ref|NM_001008025.1| Xenopus tropicalis MGC79525 protein (MGC79525), mRNA
          Length = 2202

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 158/199 (79%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||| ||||| |||| | | |||||||| || || || || || || 
Sbjct: 187 atgaaccagtatgtgaataagaagttcaccaaccagtacaaagccactattggggcagat 246

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || ||||| ||||||||  |  | || |||||  | |||||  ||||||||||||| || 
Sbjct: 247 tttctcactaaggaggtgatggtggatgacagattggtcacaatgcagatatgggacaca 306

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           || || || || ||||||||   |||||| || || |||||| | || ||||||||||||
Sbjct: 307 gctggacaagaaaggttccaatccctcggggtagctttctaccgaggggccgactgctgc 366

                              
Query: 388 gtgctggtctacgacgtca 406
           ||||||||||| |||||||
Sbjct: 367 gtgctggtctatgacgtca 385

---

>gb|BC080905.1| Xenopus tropicalis MGC79525 protein, mRNA (cDNA clone MGC:79525
           IMAGE:6977707), complete cds
          Length = 2202

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 158/199 (79%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||| ||||| |||| | | |||||||| || || || || || || 
Sbjct: 187 atgaaccagtatgtgaataagaagttcaccaaccagtacaaagccactattggggcagat 246

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || ||||| ||||||||  |  | || |||||  | |||||  ||||||||||||| || 
Sbjct: 247 tttctcactaaggaggtgatggtggatgacagattggtcacaatgcagatatgggacaca 306

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           || || || || ||||||||   |||||| || || |||||| | || ||||||||||||
Sbjct: 307 gctggacaagaaaggttccaatccctcggggtagctttctaccgaggggccgactgctgc 366

                              
Query: 388 gtgctggtctacgacgtca 406
           ||||||||||| |||||||
Sbjct: 367 gtgctggtctatgacgtca 385

---

>emb|CR926163.1| Xenopus tropicalis finished cDNA, clone TNeu128d01
          Length = 2144

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 158/199 (79%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||| ||||| |||| | | |||||||| || || || || || || 
Sbjct: 162 atgaaccagtatgtgaataagaagttcaccaaccagtacaaagccactattggggcagat 221

                                                                       
Query: 268 ttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacg 327
           || ||||| ||||||||  |  | || |||||  | |||||  ||||||||||||| || 
Sbjct: 222 tttctcactaaggaggtgatggtggatgacagattggtcacaatgcagatatgggacaca 281

                                                                       
Query: 328 gcagggcaggagaggttccagagcctcggcgtggccttctacaggggagccgactgctgc 387
           || || || || ||||||||   |||||| || || |||||| | || ||||||||||||
Sbjct: 282 gctggacaagaaaggttccaatccctcggggtagctttctaccgaggggccgactgctgc 341

                              
Query: 388 gtgctggtctacgacgtca 406
           ||||||||||| |||||||
Sbjct: 342 gtgctggtctatgacgtca 360

---

>gb|U87142.1|MCU87142 Mesembryanthemum crystallinum Nt-rab7a homolog mRNA, complete cds
          Length = 999

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 149/187 (79%)
 Strand = Plus / Plus

                                                                       
Query: 167 tcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaaca 226
           ||||| ||||||| || |||||||| |||||||| ||||| |||||||| | |||||| |
Sbjct: 119 tcatcatcctcggtgatagcggggttgggaagacatcgcttatgaaccaatttgtgaata 178

                                                                       
Query: 227 agaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcc 286
           |||| |||||  | |||||||| || || || || || || ||||| ||||| ||  |||
Sbjct: 179 agaagttcagtaatcagtacaaagcaacaattggagctgatttcctgaccaaagaactcc 238

                                                                       
Query: 287 tcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttcc 346
              | || || |||||  |||| |||||||| |||||||| || || ||||||||||| |
Sbjct: 239 agtttgaagataggcttttcacattgcagatctgggatacagccggacaggagaggtttc 298

                  
Query: 347 agagcct 353
           |||||||
Sbjct: 299 agagcct 305

---

>gb|BC072717.1| Danio rerio zgc:91909, mRNA (cDNA clone MGC:91909 IMAGE:7039965),
           complete cds
          Length = 1235

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 169/214 (78%)
 Strand = Plus / Plus

                                                                       
Query: 193 gggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcg 252
           |||||||| ||  ||||||||||||||||||| || || |||||  | ||||| ||||| 
Sbjct: 189 gggaagacctctttgatgaaccagtatgtgaataataagttcagtaatcagtataaggcc 248

                                                                       
Query: 253 accatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttg 312
           ||||| || || ||||| || || ||||||||  |  | || ||||| || || ||| ||
Sbjct: 249 accattggtgcagactttctgacaaaggaggtgatggtggacgacagactggtgaccatg 308

                                                                       
Query: 313 cagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacagg 372
           ||||| ||||| || || || |||||| |||| |||   || ||||||||||||||||| 
Sbjct: 309 cagatttgggacacagccggtcaggagcggtttcagtctctgggcgtggccttctacaga 368

                                             
Query: 373 ggagccgactgctgcgtgctggtctacgacgtca 406
           || || ||||| || |||||||| ||||| ||||
Sbjct: 369 ggggcggactgttgtgtgctggtgtacgatgtca 402

---

>ref|NM_001002178.1| Danio rerio zgc:91909 (zgc:91909), mRNA
          Length = 1235

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 169/214 (78%)
 Strand = Plus / Plus

                                                                       
Query: 193 gggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcg 252
           |||||||| ||  ||||||||||||||||||| || || |||||  | ||||| ||||| 
Sbjct: 189 gggaagacctctttgatgaaccagtatgtgaataataagttcagtaatcagtataaggcc 248

                                                                       
Query: 253 accatcggcgccgacttcctcaccaaggaggtcctcatcgaggacaggctcgtcaccttg 312
           ||||| || || ||||| || || ||||||||  |  | || ||||| || || ||| ||
Sbjct: 249 accattggtgcagactttctgacaaaggaggtgatggtggacgacagactggtgaccatg 308

                                                                       
Query: 313 cagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacagg 372
           ||||| ||||| || || || |||||| |||| |||   || ||||||||||||||||| 
Sbjct: 309 cagatttgggacacagccggtcaggagcggtttcagtctctgggcgtggccttctacaga 368

                                             
Query: 373 ggagccgactgctgcgtgctggtctacgacgtca 406
           || || ||||| || |||||||| ||||| ||||
Sbjct: 369 ggggcggactgttgtgtgctggtgtacgatgtca 402

---

>ref|NM_112480.2| Arabidopsis thaliana GTP binding AT3G16100 mRNA, complete cds
          Length = 940

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 138/173 (79%)
 Strand = Plus / Plus

                                                                       
Query: 175 ctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattc 234
           ||||| ||||| ||||| |||||||||||  ||||||| |||| ||||||    ||||||
Sbjct: 138 ctcggagacagtggggttgggaagacgtccttgatgaatcagtttgtgaatcgaaaattc 197

                                                                       
Query: 235 agccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgag 294
           ||  | ||||| || || ||||| || || || ||| | ||||| |||||||  || || 
Sbjct: 198 agtaatcagtataaagctaccattggagctgatttcttgaccaaagaggtccaaattgat 257

                                                                
Query: 295 gacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttcca 347
           |||||  || |||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 258 gacagaatcttcactttgcagatttgggatactgcagggcaagagaggttcca 310

---

>gb|BT006376.1| Arabidopsis thaliana At3g16100 gene, complete cds
          Length = 621

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 138/173 (79%)
 Strand = Plus / Plus

                                                                       
Query: 175 ctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattc 234
           ||||| ||||| ||||| |||||||||||  ||||||| |||| ||||||    ||||||
Sbjct: 40  ctcggagacagtggggttgggaagacgtccttgatgaatcagtttgtgaatcgaaaattc 99

                                                                       
Query: 235 agccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgag 294
           ||  | ||||| || || ||||| || || || ||| | ||||| |||||||  || || 
Sbjct: 100 agtaatcagtataaagctaccattggagctgatttcttgaccaaagaggtccaaattgat 159

                                                                
Query: 295 gacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttcca 347
           |||||  || |||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 160 gacagaatcttcactttgcagatttgggatactgcagggcaagagaggttcca 212

---

>dbj|AB071848.1| Arabidopsis thaliana mRNA for AtRab73, complete cds
          Length = 621

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 138/173 (79%)
 Strand = Plus / Plus

                                                                       
Query: 175 ctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattc 234
           ||||| ||||| ||||| |||||||||||  ||||||| |||| ||||||    ||||||
Sbjct: 40  ctcggagacagtggggttgggaagacgtccttgatgaatcagtttgtgaatcgaaaattc 99

                                                                       
Query: 235 agccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgag 294
           ||  | ||||| || || ||||| || || || ||| | ||||| |||||||  || || 
Sbjct: 100 agtaatcagtataaagctaccattggagctgatttcttgaccaaagaggtccaaattgat 159

                                                                
Query: 295 gacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttcca 347
           |||||  || |||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 160 gacagaatcttcactttgcagatttgggatactgcagggcaagagaggttcca 212

---

>emb|BX824542.1|CNS0A5QW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH55ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 162 caaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgt 221
           |||||||||| ||| ||| || |||||||| || |||||  || ||||||| ||||||||
Sbjct: 130 caaggtcatcatccgcggtgatagcggggtgggaaagaccgcggtgatgaatcagtatgt 189

                                                                       
Query: 222 gaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaagga 281
           |||  || | |||||| | ||||||||||| ||||| || ||| ||||| | ||||||||
Sbjct: 190 gaatgaggagttcagcaaccagtacaaggcaaccattggagcccacttcttgaccaagga 249

---

>gb|DQ235201.1| Solanum tuberosum clone 171F12 unknown mRNA
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 gtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaac 225
           |||||| ||||||||||||| ||||| || ||||| ||| ||||||| || ||||| || 
Sbjct: 89  gtcatcatcctcggcgacagtggggttggaaagacttcgttgatgaatcaatatgtaaat 148

                                  
Query: 226 aagaaattcagccagcagtacaa 248
           ||||| |||||| | ||||||||
Sbjct: 149 aagaagttcagcaatcagtacaa 171

---

>gb|DQ222491.1| Solanum tuberosum clone 099C08 unknown mRNA
          Length = 967

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 gtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaac 225
           |||||| ||||||||||||| ||||| || ||||| ||| ||||||| || ||||| || 
Sbjct: 98  gtcatcatcctcggcgacagtggggttggaaagacttcgttgatgaatcaatatgtaaat 157

                                  
Query: 226 aagaaattcagccagcagtacaa 248
           ||||| |||||| | ||||||||
Sbjct: 158 aagaagttcagcaatcagtacaa 180

---

>gb|BT024015.1| Zea mays clone EL01N0311D12 mRNA sequence
          Length = 1605

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                       
Query: 222 gaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaagga 281
           ||||||||| |||||| | ||||||||||| || || || || || ||||||||||||||
Sbjct: 9   gaacaagaagttcagcaaccagtacaaggctacgattggggcggatttcctcaccaagga 68

                                      
Query: 282 ggtcctcatcgaggacaggctcgtcac 308
           ||| |   |||||||||||||| ||||
Sbjct: 69  ggtgcagttcgaggacaggctcttcac 95

---

>gb|AY324138.1| Babesia bovis Rab7 mRNA, complete cds
          Length = 698

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                             
Query: 184 agcggggtcgggaagacgtcgctgatgaaccagt 217
           ||||||||||||||||| ||||||||||||||||
Sbjct: 67  agcggggtcgggaagacctcgctgatgaaccagt 100

---

>dbj|AP003408.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1131B07
          Length = 109135

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                           
Query: 160   ctcaaggtcatcgtcctcggcgacagcggg 189
             ||||||||||||||||||||||||||||||
Sbjct: 57907 ctcaaggtcatcgtcctcggcgacagcggg 57878



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 224   acaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggagg 283
             ||||||| || |||||||||||||| || || || || || || ||| ||||||||||||
Sbjct: 57323 acaagaagtttagccagcagtacaaagctacaattggtgcggatttcgtcaccaaggagg 57264

                                   
Query: 284   tcctcatcgaggacaggctcgt 305
             ||||||| || || ||||||||
Sbjct: 57263 tcctcattgaagataggctcgt 57242



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                         
Query: 314   agatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacaggg 373
             |||| ||||| || || |||||||||||||||||||| || || || || || ||||| |
Sbjct: 57137 agatctgggacactgcggggcaggagaggttccagagtcttggtgttgcgttttacagag 57078

                                                
Query: 374   gagccgactgctgcgtgctggtctacgacgtcaat 408
             |||| || || || ||||| ||||| |||||||||
Sbjct: 57077 gagcagattgttgtgtgctcgtctatgacgtcaat 57043



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 188   gggtcgggaagacgtcgctgatgaaccagtat 219
             |||| |||||||||||||| ||||||||||||
Sbjct: 57718 gggtggggaagacgtcgcttatgaaccagtat 57687

---

>gb|BC086793.1| Mus musculus RAB7, member RAS oncogene family, mRNA (cDNA clone
           MGC:102153 IMAGE:6414012), complete cds
          Length = 2085

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 195 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 254

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 255 tttctgaccaaggaggt 271

---

>gb|AY432204.1| Aedes aegypti ASAP ID: 43000 Rab protein 7 mRNA sequence
          Length = 728

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 173 tcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgt 221
           |||| ||||||||| | ||||| ||||||||||| ||||||||||||||
Sbjct: 143 tccttggcgacagcagcgtcggcaagacgtcgctcatgaaccagtatgt 191

---

>gb|BC072470.1| Rattus norvegicus RAB7, member RAS oncogene family, mRNA (cDNA
           clone MGC:91396 IMAGE:7098657), complete cds
          Length = 2107

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 229 aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 288

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 289 ataggagcagactttctgaccaaggaggt 317

---

>gb|BC004597.1| Mus musculus RAB7, member RAS oncogene family, mRNA (cDNA clone
           MGC:6009 IMAGE:3584891), complete cds
          Length = 1716

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 197 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 256

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 257 tttctgaccaaggaggt 273

---

>ref|NM_009005.1| Mus musculus RAB7, member RAS oncogene family (Rab7), mRNA
          Length = 2089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 229 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 288

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 289 tttctgaccaaggaggt 305

---

>emb|CT010352.1| Mus musculus full open reading frame cDNA clone RZPDo836H1052D for
           gene Rab7, RAB7, member RAS oncogene family; complete
           cds, incl. stopcodon
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 73  atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 132

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 133 tttctgaccaaggaggt 149

---

>emb|X89650.1|MMRAB7 M.musculus mRNA for Rab7 protein
          Length = 2089

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 229 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 288

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 289 tttctgaccaaggaggt 305

---

>emb|X12535.1|RNRASP23 Rat mRNA for ras-related protein p23
          Length = 1269

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 102 aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 161

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 162 ataggagcagactttctgaccaaggaggt 190

---

>gb|AC153857.7| Mus musculus 6 BAC RP23-158G17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 215780

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 208   atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
             ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 68246 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 68187

                              
Query: 268   ttcctcaccaaggaggt 284
             || || |||||||||||
Sbjct: 68186 tttctgaccaaggaggt 68170

---

>gb|DQ056142.1| Coprinellus disseminatus strain C345.1 putative GTPase (RAB7.1),
            putative GTPase (RAB7.2), conserved hypothetical protein
            (UP14), putative sterol dehydrogenase (ERG26), putative
            transmembrane pheromone receptor (STE3.1), putative
            peptide pheromone (PHB1), peroxidase (PERO), conserved
            hypothetical protein (UP15), putative retroelement
            proteins, putative peptide pheromone (PHB2.1), putative
            transmembrane pheromone receptor (STE3.3), and putative
            peptide pheromone (PHB2.2) genes, complete cds
          Length = 41867

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 351  cctcggcgtggccttctacaggggagccgactgctgcgtgctggtctacgacgtcaa 407
            ||||||||| ||||||||| | || |||||||||||||| || |||| |||||||||
Sbjct: 3856 cctcggcgtcgccttctaccgcggcgccgactgctgcgtcctcgtcttcgacgtcaa 3800



 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 190  gtcgggaagacgtcgctgatgaaccagtatgtgaacaag 228
            ||||||||||| || ||||||||||| || |||||||||
Sbjct: 4165 gtcgggaagacatccctgatgaaccaatacgtgaacaag 4127

---

>ref|NM_023950.3| Rattus norvegicus RAB7, member RAS oncogene family (Rab7), mRNA
          Length = 2107

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 229 aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 288

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 289 ataggagcagactttctgaccaaggaggt 317

---

>dbj|AK057671.1| Mus musculus cDNA fis, clone TRACH2000981, highly similar to
           RAS-RELATED PROTEIN RAB-7
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 208 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 267

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 268 tttctgaccaaggaggt 284

---

>dbj|AK135659.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420401J08 product:RAB7, member
           RAS oncogene family, full insert sequence
          Length = 1880

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 329 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 388

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 389 tttctgaccaaggaggt 405

---

>dbj|AK151078.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830022K13 product:RAB7, member
           RAS oncogene family, full insert sequence
          Length = 1434

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 253 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 312

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 313 tttctgaccaaggaggt 329

---

>dbj|AK148117.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched
           library, clone:G370023B02 product:RAB7, member RAS
           oncogene family, full insert sequence
          Length = 2151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 272 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 331

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 332 tttctgaccaaggaggt 348

---

>dbj|AK139914.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020036L20 product:RAB7, member RAS oncogene
           family, full insert sequence
          Length = 1287

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 232 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 291

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 292 tttctgaccaaggaggt 308

---

>dbj|AK152666.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830082B22 product:RAB7, member
           RAS oncogene family, full insert sequence
          Length = 1657

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 476 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 535

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 536 tttctgaccaaggaggt 552

---

>dbj|AK158971.1| Mus musculus visual cortex cDNA, RIKEN full-length enriched
           library, clone:K530022D11 product:RAB7, member RAS
           oncogene family, full insert sequence
          Length = 2032

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 163 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 222

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 223 tttctgaccaaggaggt 239

---

>dbj|AK159928.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420038G12 product:RAB7, member RAS
           oncogene family, full insert sequence
          Length = 2049

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 180 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 239

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 240 tttctgaccaaggaggt 256

---

>dbj|AK154234.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630011F07
           product:RAB7, member RAS oncogene family, full insert
           sequence
          Length = 2129

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 260 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 319

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 320 tttctgaccaaggaggt 336

---

>dbj|AK159507.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420022F17 product:RAB7, member RAS
           oncogene family, full insert sequence
          Length = 1711

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 209 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 268

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 269 tttctgaccaaggaggt 285

---

>gb|AF286535.1|AF286535 Rattus norvegicus GTP-binding protein RAB7 (Rab7) mRNA, complete
           cds
          Length = 861

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 225 aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 284

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 285 ataggagcagactttctgaccaaggaggt 313

---

>dbj|AK005004.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched
           library, clone:1300014J11 product:RAB7, member RAS
           oncogene family, full insert sequence
          Length = 2118

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
           ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 241 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 300

                            
Query: 268 ttcctcaccaaggaggt 284
           || || |||||||||||
Sbjct: 301 tttctgaccaaggaggt 317

---

>gb|AC153872.2| Mus musculus 6 BAC RP23-226O20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 203418

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                          
Query: 208    atgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgac 267
              ||||||||||||||||||||||| |||||  | |||||||| || || || || || |||
Sbjct: 193785 atgaaccagtatgtgaacaagaagttcagtaaccagtacaaagccacaataggagcggac 193726

                               
Query: 268    ttcctcaccaaggaggt 284
              || || |||||||||||
Sbjct: 193725 tttctgaccaaggaggt 193709

---

>dbj|AB158428.1| Rattus norvegicus Rab7 mRNA for RAB7, complete cds, strain:LEC/Crj
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 61  aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 120

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 121 ataggagcagactttctgaccaaggaggt 149

---

>dbj|AB158427.1| Rattus norvegicus Rab7 mRNA for RAB7, complete cds,
           strain:F344/DuCrj
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 aagacgtcgctgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgacc 255
           ||||| ||||| ||||||||||||||||| ||||| |||||  | |||||||| || || 
Sbjct: 61  aagacatcgctcatgaaccagtatgtgaataagaagttcagtaaccagtacaaagccaca 120

                                        
Query: 256 atcggcgccgacttcctcaccaaggaggt 284
           || || || ||||| || |||||||||||
Sbjct: 121 ataggagcagactttctgaccaaggaggt 149

---

>gb|AY084691.1| Arabidopsis thaliana clone 115178 mRNA, complete sequence
          Length = 896

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 137/173 (79%)
 Strand = Plus / Plus

                                                                       
Query: 175 ctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattc 234
           ||||| ||||| ||||| |||||||| ||  ||||||| |||| ||||||    ||||||
Sbjct: 142 ctcggagacagtggggttgggaagacatccttgatgaatcagtttgtgaatcgaaaattc 201

                                                                       
Query: 235 agccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgag 294
           ||  | ||||| || || ||||| || || || ||| | ||||| |||||||  || || 
Sbjct: 202 agtaatcagtataaagctaccattggagctgatttcttgaccaaagaggtccaaattgat 261

                                                                
Query: 295 gacaggctcgtcaccttgcagatatgggatacggcagggcaggagaggttcca 347
           |||||  || |||| |||||||| |||||||| |||||||| |||||||||||
Sbjct: 262 gacagaatcttcactttgcagatttgggatactgcagggcaagagaggttcca 314

---

>gb|L29276.1|TOBNTRAI Nicotiana tabacum SR1 Nt-rab7c mRNA, complete cds
          Length = 993

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 152/193 (78%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           ||||||| |||||||||||||||||||| ||||| || || || ||  ||||||| |  |
Sbjct: 60  tgctcaaagtcatcgtcctcggcgacagtggggttggtaaaacatcattgatgaatcgat 119

                                                                       
Query: 218 atgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccgacttcctcacca 277
           ||||  ||||||||||||| ||||| || || || || || || || || ||  | || |
Sbjct: 120 atgtacacaagaaattcagtcagcaatataaagctacaattggagctgattttgtgacaa 179

                                                                       
Query: 278 aggaggtcctcatcgaggacaggctcgtcaccttgcagatatgggatacggcagggcagg 337
           ||||| | |  || || ||||||||||| ||  | || ||||||||||| || |||||||
Sbjct: 180 aggagcttcaaattgatgacaggctcgtaactcttcaaatatgggatacagccgggcagg 239

                        
Query: 338 agaggttccagag 350
           ||||||| |||||
Sbjct: 240 agaggtttcagag 252

---

>ref|XM_816526.1| Trypanosoma cruzi strain CL Brener rab7 GTP binding protein
           (Tc00.1047053508461.270) partial mRNA
          Length = 666

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 178 ggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaatt 233
           |||||||| |||||||| ||||||||||| ||| | ||||||||||| || |||||
Sbjct: 40  ggcgacagtggggtcggtaagacgtcgcttatgcatcagtatgtgaataaaaaatt 95

---

>emb|BX823072.1|CNS0A63E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZH01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 807

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 tgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccg 265
           ||||||| |||||||| || || || |||||| | ||||||||||| ||||| || ||||
Sbjct: 19  tgatgaatcagtatgttaataaaaagttcagcaaccagtacaaggcaaccattggagccg 78

                           
Query: 266 acttcctcaccaagga 281
           ||||| | ||||||||
Sbjct: 79  acttcttgaccaagga 94

---

>dbj|AB026654.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MVE11
          Length = 75508

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   tgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccg 265
             ||||||| |||||||| || || || |||||| | ||||||||||| ||||| || ||||
Sbjct: 68862 tgatgaatcagtatgttaataaaaagttcagcaaccagtacaaggcaaccattggagccg 68921

                             
Query: 266   acttcctcaccaagga 281
             ||||| | ||||||||
Sbjct: 68922 acttcttgaccaagga 68937

---

>ref|XM_585448.2| PREDICTED: Bos taurus similar to RAB14, member RAS oncogene family
           (LOC539180), mRNA
          Length = 3131

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||||||||| ||||||||||||
Sbjct: 818 tgcagatctgggatacggcaggacaggagaggttc 852

---

>emb|X84220.1|GGRAB2 G.gallus mRNA for RAB2
          Length = 675

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 313 cagatatgggatacggcagggcaggag 339
           |||||||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggcaggag 198

---

>ref|NM_205228.1| Gallus gallus RAB2, member RAS oncogene family (RAB2), mRNA
          Length = 675

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 313 cagatatgggatacggcagggcaggag 339
           |||||||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggcaggag 198

---

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 234    cagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggt 284
              |||||||||||| ||||| || || |||||||||||| | |||||||||||
Sbjct: 360290 cagccagcagtataaggcaacaattggcgccgacttcttgaccaaggaggt 360240

---

>gb|AF407337.1| Lentinula edodes Ras-related protein Rab7 (Rab7) mRNA, complete cds
          Length = 817

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 ctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattc 234
           ||||| |||||||| ||||| ||||| || || |||||||| |||||||||||    || 
Sbjct: 70  ctcggtgacagcggtgtcggaaagacatctctcatgaaccaatatgtgaacaaacggttt 129

                                              
Query: 235 agccagcagtacaaggcgaccatcggcgccgactt 269
           ||| | ||||||||||| || ||||| ||||||||
Sbjct: 130 agcaaccagtacaaggccactatcggtgccgactt 164

---

>gb|BC103315.1| Bos taurus cDNA clone IMAGE:8119982, partial cds
          Length = 3001

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||||||||| ||||||||||||
Sbjct: 414 tgcagatctgggatacggcaggacaggagaggttc 448

---

>gb|AF146042.1|AF146042 Trypanosoma cruzi GTP-binding protein (RAB7) gene, complete cds
          Length = 823

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 178 ggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaa 224
           |||||||| |||||||| ||||||||||| ||| | |||||||||||
Sbjct: 76  ggcgacagtggggtcggtaagacgtcgcttatgcatcagtatgtgaa 122

---

>ref|NM_208759.1| Eremothecium gossypii ACR003Cp (ACR003C), mRNA
          Length = 627

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 234 cagccagcagtacaaggcgaccatcggcgccgacttcctcaccaaggaggt 284
           |||||||||||| ||||| || || |||||||||||| | |||||||||||
Sbjct: 99  cagccagcagtataaggcaacaattggcgccgacttcttgaccaaggaggt 149

---

>ref|XM_413757.1| PREDICTED: Gallus gallus similar to GTPase Rab8b (LOC415371), mRNA
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 313 cagatatgggatacggcagggcaggagaggttcc 346
           |||||||||||||| ||||| |||||||||||||
Sbjct: 247 cagatatgggatacagcaggccaggagaggttcc 280

---

>ref|XM_862742.1| PREDICTED: Canis familiaris similar to RAB14, member RAS oncogene
           family, transcript variant 2 (LOC474818), mRNA
          Length = 2901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||||| |||||||| |||||||||||||||||
Sbjct: 188 tgcagatttgggatacagcagggcaggagaggtt 221

---

>ref|XM_532048.2| PREDICTED: Canis familiaris similar to RAB14, member RAS oncogene
           family, transcript variant 1 (LOC474818), mRNA
          Length = 2673

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||||| |||||||| |||||||||||||||||
Sbjct: 188 tgcagatttgggatacagcagggcaggagaggtt 221

---

>ref|XM_725728.1| Plasmodium yoelii yoelii str. 17XNL small GTPase Rab11 (PY02876)
           partial mRNA
          Length = 573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 313 cagatatgggatacggcagggcagga 338
           ||||||||||||||||||||||||||
Sbjct: 70  cagatatgggatacggcagggcagga 95

---

>emb|BX950805.1| Gallus gallus finished cDNA, clone ChEST779e6
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 313 cagatatgggatacggcagggcaggagaggttcc 346
           |||||||||||||| ||||| |||||||||||||
Sbjct: 323 cagatatgggatacagcaggccaggagaggttcc 356

---

>ref|XM_346351.2| PREDICTED: Rattus norvegicus similar to RAB9B, member RAS oncogene
           family (LOC367915), mRNA
          Length = 888

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 364 ttctacaggggagccgactgctgcgtgctg 393
           |||||||||||||||||||||||| |||||
Sbjct: 268 ttctacaggggagccgactgctgcctgctg 297

---

>ref|XM_549902.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 453

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 146 ggaggcggacgctgctcaaggtcat 170
           |||||||||||||||||||||||||
Sbjct: 25  ggaggcggacgctgctcaaggtcat 1

---

>gb|BC107383.1| Mus musculus RAB9B, member RAS oncogene family, mRNA (cDNA clone
           MGC:130383 IMAGE:40057619), complete cds
          Length = 1707

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 364 ttctacaggggagccgactgctgcgtgct 392
           |||||||||||||||||||||||| ||||
Sbjct: 460 ttctacaggggagccgactgctgcctgct 488

---

>ref|NM_176971.1| Mus musculus RAB9B, member RAS oncogene family (Rab9b), mRNA
          Length = 3762

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 364 ttctacaggggagccgactgctgcgtgct 392
           |||||||||||||||||||||||| ||||
Sbjct: 489 ttctacaggggagccgactgctgcctgct 517

---

>ref|XM_385317.1| Gibberella zeae PH-1 chromosome 3 RAB7_NEUCR Probable Ras-related
           protein Rab7 (FG05141.1) partial mRNA
          Length = 618

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 351 cctcggcgtggccttctacaggggagccgactgctgcgtgctggtctacgacgtcaa 407
           |||||| || || |||||| | || |||||||||||||| || ||||||||||||||
Sbjct: 216 cctcggtgttgcgttctaccgaggcgccgactgctgcgttctagtctacgacgtcaa 272

---

>ref|XM_802548.1| Trypanosoma cruzi strain CL Brener small GTP-binding protein Rab11
           (Tc00.1047053506151.30) partial mRNA
          Length = 654

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 311 tgcagatatgggatacggcagggcaggag 339
           ||||||| |||||||||||||||||||||
Sbjct: 173 tgcagatttgggatacggcagggcaggag 201

---

>ref|XM_737768.1| Plasmodium chabaudi chabaudi ras family GTP-ase (PC000223.00.0)
           partial mRNA
          Length = 555

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 311 tgcagatatgggatacggcagggcaggag 339
           |||||||||||||||| ||||||||||||
Sbjct: 110 tgcagatatgggatacagcagggcaggag 138

---

>gb|AF079459.1| Drosophila melanogaster small ras-like GTPase (rab7) gene, complete
           cds
          Length = 1862

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 373 ggagccgactgctgcgtgctggtctacga 401
           |||||||||||||||||||| ||||||||
Sbjct: 669 ggagccgactgctgcgtgcttgtctacga 697

---

>ref|NM_079748.2| Drosophila melanogaster Rab-protein 7 CG5915-RA (Rab7), mRNA
          Length = 1605

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 373 ggagccgactgctgcgtgctggtctacga 401
           |||||||||||||||||||| ||||||||
Sbjct: 425 ggagccgactgctgcgtgcttgtctacga 453

---

>dbj|AK161867.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330500D17 product:RAS-related
           protein RAB-9L, full insert sequence
          Length = 3986

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 364 ttctacaggggagccgactgctgcgtgct 392
           |||||||||||||||||||||||| ||||
Sbjct: 705 ttctacaggggagccgactgctgcctgct 733

---

>gb|AY060236.1| Drosophila melanogaster GH03685 full length cDNA
          Length = 1513

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 373 ggagccgactgctgcgtgctggtctacga 401
           |||||||||||||||||||| ||||||||
Sbjct: 407 ggagccgactgctgcgtgcttgtctacga 435

---

>dbj|AK049693.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530039B21 product:RAS-RELATED
           PROTEIN RAB-9L (RAB9-LIKE PROTEIN) homolog [Homo
           sapiens], full insert sequence
          Length = 3788

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 364 ttctacaggggagccgactgctgcgtgct 392
           |||||||||||||||||||||||| ||||
Sbjct: 515 ttctacaggggagccgactgctgcctgct 543

---

>dbj|AK034442.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330195C02 product:RAS-RELATED
           PROTEIN RAB-9L (RAB9-LIKE PROTEIN) homolog [Homo
           sapiens], full insert sequence
          Length = 3762

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 364 ttctacaggggagccgactgctgcgtgct 392
           |||||||||||||||||||||||| ||||
Sbjct: 489 ttctacaggggagccgactgctgcctgct 517

---

>gb|AC007929.8|AC007929 Drosophila melanogaster, chromosome 3R, region 95A-95C, BAC clone
              BACR05C11, complete sequence
          Length = 171376

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 373    ggagccgactgctgcgtgctggtctacga 401
              |||||||||||||||||||| ||||||||
Sbjct: 159737 ggagccgactgctgcgtgcttgtctacga 159765

---

>gb|AC008202.4|AC008202 Drosophila melanogaster, chromosome 3R, region 95C-95D, BAC clone
             BACR15J11, complete sequence
          Length = 186159

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 373   ggagccgactgctgcgtgctggtctacga 401
             |||||||||||||||||||| ||||||||
Sbjct: 62741 ggagccgactgctgcgtgcttgtctacga 62769

---

>gb|AF263363.1|AF263363 Drosophila melanogaster small ras-like GTPase RAB7 (Rab7) mRNA,
           complete cds
          Length = 1495

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 373 ggagccgactgctgcgtgctggtctacga 401
           |||||||||||||||||||| ||||||||
Sbjct: 407 ggagccgactgctgcgtgcttgtctacga 435

---

>dbj|AK203105.1| Mus musculus cDNA, clone:Y1G0143M20, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070298, based on BLAT search
          Length = 174

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 208 atgaaccagtatgtgaacaagaaattcag 236
           ||||||||||||||||||||||| |||||
Sbjct: 118 atgaaccagtatgtgaacaagaagttcag 146

---

>dbj|AK197221.1| Mus musculus cDNA, clone:Y1G0124G13, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070298, based on BLAT search
          Length = 175

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 208 atgaaccagtatgtgaacaagaaattcag 236
           ||||||||||||||||||||||| |||||
Sbjct: 118 atgaaccagtatgtgaacaagaagttcag 146

---

>dbj|AK190348.1| Mus musculus cDNA, clone:Y1G0102H14, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070298, based on BLAT search
          Length = 174

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 208 atgaaccagtatgtgaacaagaaattcag 236
           ||||||||||||||||||||||| |||||
Sbjct: 118 atgaaccagtatgtgaacaagaagttcag 146

---

>dbj|AK179526.1| Mus musculus cDNA, clone:Y0G0110L24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070298, based on BLAT search
          Length = 174

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 208 atgaaccagtatgtgaacaagaaattcag 236
           ||||||||||||||||||||||| |||||
Sbjct: 118 atgaaccagtatgtgaacaagaagttcag 146

---

>gb|AE003745.4| Drosophila melanogaster chromosome 3R, section 83 of 118 of the complete
              sequence
          Length = 230236

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 373    ggagccgactgctgcgtgctggtctacga 401
              |||||||||||||||||||| ||||||||
Sbjct: 192629 ggagccgactgctgcgtgcttgtctacga 192657

---

>gb|L08131.1|VVCPTVD Volvox carteri GTP-binding protein (yptV5) gene, complete CDS
          Length = 3102

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 190  gtcgggaagacgtcgctgatgaaccagtatgtg 222
            ||||| ||||||||||| |||||||||||||||
Sbjct: 1007 gtcggcaagacgtcgcttatgaaccagtatgtg 1039

---

>dbj|AB035672.1| Drosophila melanogaster mRNA for Rab7 protein, complete cds
          Length = 1593

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 373 ggagccgactgctgcgtgctggtctacga 401
           |||||||||||||||||||| ||||||||
Sbjct: 413 ggagccgactgctgcgtgcttgtctacga 441

---

>emb|AL672008.8| Mouse DNA sequence from clone RP23-389M3 on chromosome X, complete
             sequence
          Length = 160571

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 364   ttctacaggggagccgactgctgcgtgct 392
             |||||||||||||||||||||||| ||||
Sbjct: 26080 ttctacaggggagccgactgctgcctgct 26052

---

>ref|NM_102121.2| Arabidopsis thaliana RAB7; GTP binding AT1G22740 (RAB7) mRNA,
           complete cds
          Length = 973

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 129/164 (78%)
 Strand = Plus / Plus

                                                                       
Query: 181 gacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccag 240
           ||||||||||| || || || ||| ||||||| || |||||||| || || || || || 
Sbjct: 193 gacagcggggttggcaaaacatcgttgatgaatcaatatgtgaataacaagtttagtcaa 252

                                                                       
Query: 241 cagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacagg 300
           |||||||| || || ||||| || || ||  |||| |||||| | |  || || ||||||
Sbjct: 253 cagtacaaagctacgatcggagctgattttgtcactaaggagcttcaaattgatgacagg 312

                                                       
Query: 301 ctcgtcaccttgcagatatgggatacggcagggcaggagaggtt 344
           || ||||| ||||| |||||||| || || ||||| ||||||||
Sbjct: 313 cttgtcacattgcaaatatgggacactgctgggcaagagaggtt 356

---

>ref|XM_874394.1| PREDICTED: Bos taurus similar to RAB37, member of RAS oncogene
           family, transcript variant 3 (LOC613954), mRNA
          Length = 1295

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 311 tgcagatatgggatacggcagggcaggagaggttcc 346
           ||||||| ||||| ||||||||||||||| ||||||
Sbjct: 221 tgcagatctgggacacggcagggcaggagcggttcc 256

---

>ref|XM_864786.1| PREDICTED: Bos taurus similar to RAB37, member of RAS oncogene
           family, transcript variant 1 (LOC613954), mRNA
          Length = 1380

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 311 tgcagatatgggatacggcagggcaggagaggttcc 346
           ||||||| ||||| ||||||||||||||| ||||||
Sbjct: 306 tgcagatctgggacacggcagggcaggagcggttcc 341

---

>ref|XM_420182.1| PREDICTED: Gallus gallus similar to RAB9B, member RAS oncogene family
            (LOC422187), mRNA
          Length = 2206

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 313  cagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacagg 372
            ||||| ||||| || |||||||||||||| ||| |||||||| |     |||| ||||||
Sbjct: 1024 cagatctgggacactgcagggcaggagagattcaagagcctccggacccccttttacagg 1083

                                
Query: 373  ggagccgactgctgcgtgct 392
            ||||| ||||||||| ||||
Sbjct: 1084 ggagctgactgctgcctgct 1103

---

>ref|NM_001007161.1| Danio rerio RAB1A, member RAS oncogene family (rab1a), mRNA
          Length = 1820

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 328 cagatctgggatacagcagggcaggagaggtt 359

---

>emb|CR933447.1| Paramecium tetraurelia, Small GTPase rab, putative, complete gene
          Length = 3001

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 310  ttgcagatatgggatacggcagggcaggagag 341
            ||||||||||||||||| ||||| ||||||||
Sbjct: 1449 ttgcagatatgggatactgcaggtcaggagag 1418

---

>ref|XM_804642.1| Trypanosoma cruzi strain CL Brener ras-related protein rab-2a
           (Tc00.1047053511711.80) partial mRNA
          Length = 624

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 311 tgcagatatgggatacggcagggcaggagaggttcc 346
           ||||||| ||||||||||| ||||||||||| ||||
Sbjct: 173 tgcagatttgggatacggcggggcaggagagtttcc 208

---

>emb|CR722542.2|CNS0GKGK Tetraodon nigroviridis full-length cDNA
          Length = 1493

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 264 cagatctgggatacagcagggcaggagaggtt 295

---

>ref|XM_757697.1| Theileria parva strain Muguga chromosome 3 small GTP-binding
           protein Rab7 (TP03_0666) partial mRNA
          Length = 579

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 311 tgcagatatgggatacggcagggcaggagaggttccagag 350
           |||||||||||||||| || || |||||| ||||||||||
Sbjct: 104 tgcagatatgggatacagctggtcaggagcggttccagag 143

---

>emb|CR693235.2|CNS0FXUN Tetraodon nigroviridis full-length cDNA
          Length = 1386

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 148 cagatctgggatacagcagggcaggagaggtt 179

---

>emb|CR673531.2|CNS0FIO1 Tetraodon nigroviridis full-length cDNA
          Length = 1498

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 260 cagatctgggatacagcagggcaggagaggtt 291

---

>emb|CR670292.2|CNS0FG62 Tetraodon nigroviridis full-length cDNA
          Length = 560

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 311 tgcagatatgggatacggcagggcaggagaggttcc 346
           ||||||| ||||| ||||| ||||||||||||||||
Sbjct: 162 tgcagatctgggacacggcggggcaggagaggttcc 197

---

>emb|Y09821.1|ATY09821 A.thaliana mRNA for GTP-binding protein
          Length = 957

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 129/164 (78%)
 Strand = Plus / Plus

                                                                       
Query: 181 gacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccag 240
           ||||||||||| || || || ||| ||||||| || |||||||| || || || || || 
Sbjct: 193 gacagcggggttggcaaaacatcgttgatgaatcaatatgtgaataacaagtttagtcaa 252

                                                                       
Query: 241 cagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacagg 300
           |||||||| || || ||||| || || ||  |||| |||||| | |  || || ||||||
Sbjct: 253 cagtacaaagctacgatcggagctgattttgtcactaaggagcttcaaattgatgacagg 312

                                                       
Query: 301 ctcgtcaccttgcagatatgggatacggcagggcaggagaggtt 344
           || ||||| ||||| |||||||| || || ||||| ||||||||
Sbjct: 313 cttgtcacattgcaaatatgggacactgctgggcaagagaggtt 356

---

>emb|AL139262.1|LMRAB7 Leishmania major LmRab7, previously lmEST0156 LmLV39cDNA Leishmania
           major cDNA clone Lm202 5' END, mRNA sequence
          Length = 1197

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           |||| ||| ||||| |||| || |||||||| ||||| ||||||||||| ||| | ||||
Sbjct: 174 tgctgaagatcatcatcctgggtgacagcggtgtcggcaagacgtcgctcatgcatcagt 233

                   
Query: 218 atgtgaac 225
           | ||||||
Sbjct: 234 acgtgaac 241

---

>ref|XM_682020.1| PREDICTED: Danio rerio similar to Ras-related protein Rab-7
           (LOC572889), partial mRNA
          Length = 1034

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 355 ggcgtggccttctacaggggagccgactgctgcgtgctggtctacgacgtca 406
           ||||||||||||||||| || || ||||| || |||||||| ||||| ||||
Sbjct: 40  ggcgtggccttctacagaggggcggactgttgtgtgctggtgtacgatgtca 91

---

>ref|XM_704148.1| PREDICTED: Danio rerio similar to RAB1A, member RAS oncogene
           family, transcript variant 2 (LOC567081), mRNA
          Length = 1658

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 196 cagatctgggatacagcagggcaggagaggtt 227

---

>ref|XM_684089.1| PREDICTED: Danio rerio similar to RAB1A, member RAS oncogene
           family, transcript variant 1 (LOC567081), mRNA
          Length = 1802

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 340 cagatctgggatacagcagggcaggagaggtt 371

---

>gb|BT024589.1| Arabidopsis thaliana At1g22740 mRNA, complete cds
          Length = 612

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 129/164 (78%)
 Strand = Plus / Plus

                                                                       
Query: 181 gacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccag 240
           ||||||||||| || || || ||| ||||||| || |||||||| || || || || || 
Sbjct: 46  gacagcggggttggcaaaacatcgttgatgaatcaatatgtgaataacaagtttagtcaa 105

                                                                       
Query: 241 cagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacagg 300
           |||||||| || || ||||| || || ||  |||| |||||| | |  || || ||||||
Sbjct: 106 cagtacaaagctacgatcggagctgattttgtcactaaggagcttcaaattgatgacagg 165

                                                       
Query: 301 ctcgtcaccttgcagatatgggatacggcagggcaggagaggtt 344
           || ||||| ||||| |||||||| || || ||||| ||||||||
Sbjct: 166 cttgtcacattgcaaatatgggacactgctgggcaagagaggtt 209

---

>emb|AL114549.1|CNS01BQ5 Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 tcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaat 232
           |||||||||| ||||| || || ||||||    |||||||||| ||||| ||||||||||
Sbjct: 212 tcctcggcgatagcggtgtaggaaagacgagtttgatgaaccaatatgtcaacaagaaat 271

               
Query: 233 tcag 236
           ||||
Sbjct: 272 tcag 275

---

>emb|AL111144.1|CNS0193L Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 tcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaat 232
           |||||||||| ||||| || || ||||||    |||||||||| ||||| ||||||||||
Sbjct: 210 tcctcggcgatagcggtgtaggaaagacgagtttgatgaaccaatatgtcaacaagaaat 269

               
Query: 233 tcag 236
           ||||
Sbjct: 270 tcag 273

---

>emb|BX823067.1|CNS0A5YM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB86ZH01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 759

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 206 tgatgaaccagtatgtgaacaagaaattcagccagcagtacaaggcgaccatcggcgccg 265
           ||||||| |||||||| || || ||  ||||| | ||||||||||| ||||| || ||||
Sbjct: 18  tgatgaatcagtatgttaataaaaagatcagcaaccagtacaaggcaaccataggagccg 77

                           
Query: 266 acttcctcaccaagga 281
           ||||| | ||||||||
Sbjct: 78  acttcttgaccaagga 93

---

>gb|BC062857.1| Danio rerio RAB1A, member RAS oncogene family, mRNA (cDNA clone
           MGC:77818 IMAGE:7001559), complete cds
          Length = 1570

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 314 cagatctgggatacagcagggcaggagaggtt 345

---

>gb|BC050239.1| Danio rerio RAB1A, member RAS oncogene family, mRNA (cDNA clone
           MGC:55751 IMAGE:3816472), complete cds
          Length = 1820

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 313 cagatatgggatacggcagggcaggagaggtt 344
           ||||| |||||||| |||||||||||||||||
Sbjct: 328 cagatctgggatacagcagggcaggagaggtt 359

---

>gb|L14928.1|VIRRAB7P Vigna aconitifolia (Rab7p) mRNA, complete cds
          Length = 1086

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                       
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgctgatgaaccagt 217
           ||||||||||||| || |||||||| |  || || || ||||| ||| ||||||| || |
Sbjct: 199 tgctcaaggtcattgttctcggcgatacgggagtgggaaagacctcgttgatgaatcaat 258

                                                   
Query: 218 atgtgaacaagaaattcagccagcagtacaaggcgaccat 257
           | ||| ||||||| || || ||||| |||||||| |||||
Sbjct: 259 acgtgcacaagaagtttagtcagcaatacaaggctaccat 298

---

>dbj|AB071850.1| Arabidopsis thaliana mRNA for AtRab75, complete cds
          Length = 612

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 129/164 (78%)
 Strand = Plus / Plus

                                                                       
Query: 181 gacagcggggtcgggaagacgtcgctgatgaaccagtatgtgaacaagaaattcagccag 240
           ||||||||||| || || || ||| ||||||| || |||||||| || || || || || 
Sbjct: 46  gacagcggggttggcaaaacatcgttgatgaatcaatatgtgaataacaagtttagtcaa 105

                                                                       
Query: 241 cagtacaaggcgaccatcggcgccgacttcctcaccaaggaggtcctcatcgaggacagg 300
           |||||||| || || ||||| || || ||  |||| |||||| | |  || || ||||||
Sbjct: 106 cagtacaaagctacgatcggagctgattttgtcactaaggagcttcaaattgatgacagg 165

                                                       
Query: 301 ctcgtcaccttgcagatatgggatacggcagggcaggagaggtt 344
           || ||||| ||||| |||||||| || || ||||| ||||||||
Sbjct: 166 cttgtcacattgcaaatatgggacactgctgggcaagagaggtt 209

---

>ref|NM_185154.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 313 cagatatgggatacggcagggcaggagaggt 343
           |||||||||||||| || |||||||||||||
Sbjct: 325 cagatatgggatactgctgggcaggagaggt 355

---

>ref|XM_519779.1| PREDICTED: Pan troglodytes similar to RAB2, member RAS oncogene
           family; small GTP binding protein RAB2A (LOC464197),
           mRNA
          Length = 886

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 247 cagatatgggatacggcagggca 269

---

>ref|NM_053589.1| Rattus norvegicus RAB14, member RAS oncogene family (Rab14), mRNA
          Length = 774

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| ||||| ||||||||||||
Sbjct: 191 tgcagatttgggatacagcaggacaggagaggttc 225

---

>ref|NM_002865.1| Homo sapiens RAB2, member RAS oncogene family (RAB2), mRNA
          Length = 1148

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 380 cagatatgggatacggcagggca 402

---

>gb|BT019695.1| Homo sapiens RAB2, member RAS oncogene family mRNA, complete cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>gb|BT019694.1| Synthetic construct Homo sapiens RAB2, member RAS oncogene family
           mRNA, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>gb|BT019693.1| Synthetic construct Homo sapiens RAB2, member RAS oncogene family
           mRNA, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>ref|XM_585141.2| PREDICTED: Bos taurus similar to RAB2, member RAS oncogene family
           (LOC508373), mRNA
          Length = 486

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 166 cagatatgggatacggcagggca 188

---

>gb|BC056648.1| Mus musculus RAB14, member RAS oncogene family, mRNA (cDNA clone
           MGC:67920 IMAGE:5034519), complete cds
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 427 tgcagatttgggatacagcagggcaggagcggttc 461

---

>gb|BC025139.1| Mus musculus RAB14, member RAS oncogene family, mRNA (cDNA clone
           MGC:36272 IMAGE:3980228), complete cds
          Length = 1018

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 425 tgcagatttgggatacagcagggcaggagcggttc 459

---

>gb|BC009085.1| Mus musculus RAB14, member RAS oncogene family, mRNA (cDNA clone
           MGC:6512 IMAGE:2649852), complete cds
          Length = 1469

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 237 tgcagatttgggatacagcagggcaggagcggttc 271

---

>gb|BC008929.2| Homo sapiens RAB2, member RAS oncogene family, mRNA (cDNA clone
           MGC:1656 IMAGE:2966694), complete cds
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 360 cagatatgggatacggcagggca 382

---

>ref|NM_026697.3| Mus musculus RAB14, member RAS oncogene family (Rab14), mRNA
          Length = 3100

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 554 tgcagatttgggatacagcagggcaggagcggttc 588

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 313      cagatatgggatacggcagggcaggagaggt 343
                |||||||||||||| || |||||||||||||
Sbjct: 34290141 cagatatgggatactgctgggcaggagaggt 34290111



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 68       gggagggaagagcgccaggg 87
                ||||||||||||||||||||
Sbjct: 10606941 gggagggaagagcgccaggg 10606922



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 320     gggatacggcagggcaggagaggttccagagc 351
               ||||||| || |||||||||||||||| ||||
Sbjct: 4746394 gggatacagctgggcaggagaggttccggagc 4746425

---

>ref|XM_538124.2| PREDICTED: Canis familiaris similar to Ras-related protein Rab-9B
           (Rab-9L) (RAB9-like protein) (LOC481003), mRNA
          Length = 795

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 313 cagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctacagg 372
           ||||| |||||||| |||||||||||| | ||| |||||||  |     |||||||||||
Sbjct: 192 cagatctgggatactgcagggcaggagcgtttcaagagccttaggacacccttctacagg 251

                          
Query: 373 ggagccgactgctgc 387
           ||||| |||||||||
Sbjct: 252 ggagcagactgctgc 266

---

>ref|XM_538000.2| PREDICTED: Canis familiaris similar to RAB2, member RAS oncogene
           family (LOC480883), mRNA
          Length = 1017

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 346 cagatatgggatacggcagggca 368

---

>ref|XM_850496.1| PREDICTED: Canis familiaris rab11 GTP-binding protein (RAB11), mRNA
          Length = 651

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 313 cagatatgggatacggcagggcaggag 339
           ||||||||||| |||||||||||||||
Sbjct: 187 cagatatgggacacggcagggcaggag 213

---

>gb|AY442922.1| Fucus distichus clone P8 putative Rab7 GTPase mRNA, partial cds
          Length = 121

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 202 tcgctgatgaaccagtatgtgaacaag 228
           ||||||||||||||||| |||||||||
Sbjct: 2   tcgctgatgaaccagtacgtgaacaag 28

---

>gb|BC044974.1| Xenopus laevis RAB4A, member RAS oncogene family, mRNA (cDNA clone
           MGC:52945 IMAGE:4930282), complete cds
          Length = 1255

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 311 tgcagatatgggatacggcagggcaggagag 341
           ||||||| |||||||||||||| ||||||||
Sbjct: 252 tgcagatctgggatacggcaggacaggagag 282

---

>ref|XM_724537.1| Plasmodium yoelii yoelii str. 17XNL Rab7 GTPase (PY01824) partial
           mRNA
          Length = 699

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 311 tgcagatatgggatacggcagggcaggagaggttccagagcctcggcgtggccttctaca 370
           |||||||||||||||| ||||| |||||| | || || ||  | ||||||||||| || |
Sbjct: 149 tgcagatatgggatacagcaggacaggagcgctttcaaagtttaggcgtggccttttata 208

                  
Query: 371 ggggagc 377
           |||||||
Sbjct: 209 ggggagc 215

---

>ref|XM_791939.1| PREDICTED: Strongylocentrotus purpuratus similar to RAB34, member
           of RAS oncogene family (predicted) (LOC592413), partial
           mRNA
          Length = 727

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 319 tgggatacggcagggcaggagaggttc 345
           ||||| |||||||||||||||||||||
Sbjct: 304 tgggacacggcagggcaggagaggttc 330

---

>emb|AJ968960.1| Mus musculus mRNA for RAB14 protein variant, strain SAMR1/TA
          Length = 934

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 355 tgcagatttgggatacagcagggcaggagcggttc 389

---

>emb|AJ968959.1| Mus musculus mRNA for RAB14 protein, strain SAMR1/TA
          Length = 988

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 409 tgcagatttgggatacagcagggcaggagcggttc 443

---

>emb|AJ968956.1| Mus musculus mRNA for RAB14 protein variant, strain SAMP8/Ta
          Length = 934

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 355 tgcagatttgggatacagcagggcaggagcggttc 389

---

>emb|AJ968955.1| Mus musculus mRNA for RAB14 protein, strain SAMP8/Ta
          Length = 988

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 409 tgcagatttgggatacagcagggcaggagcggttc 443

---

>emb|X12953.1|HSRAB2 Human rab2 mRNA, YPT1-related and member of ras family
          Length = 1148

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 380 cagatatgggatacggcagggca 402

---

>emb|CR860575.1| Pongo pygmaeus mRNA; cDNA DKFZp459F037 (from clone DKFZp459F037)
          Length = 3231

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 424 cagatatgggatacggcagggca 446

---

>emb|CR605346.1| full-length cDNA clone CS0DI077YH13 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1612

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 177 cagatatgggatacggcagggca 199

---

>gb|AF498930.1| Homo sapiens small GTP binding protein RAB2A (RAB2A) mRNA, complete
           cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>dbj|AK135751.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
           enriched library, clone:7420410P04 product:RAB14, member
           RAS oncogene family, full insert sequence
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 443 tgcagatttgggatacagcagggcaggagcggttc 477

---

>dbj|AK133963.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730578E11 product:RAB14, member
           RAS oncogene family, full insert sequence
          Length = 3248

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 454 tgcagatttgggatacagcagggcaggagcggttc 488

---

>gb|AF474147.1| Leishmania braziliensis Rab7-like protein mRNA, complete cds
          Length = 816

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 156 gctgctcaaggtcatcgtcctcggcgacagcggggtcgggaagacgtcgct 206
           |||||| ||| ||||| || | ||||||||||| ||||| |||||||||||
Sbjct: 162 gctgctgaagatcatcatcttgggcgacagcggtgtcggcaagacgtcgct 212



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 244 tacaaggcgaccatcggcgccgactt 269
           |||||||||||||||||||| |||||
Sbjct: 250 tacaaggcgaccatcggcgctgactt 275

---

>ref|XM_696269.1| PREDICTED: Danio rerio similar to Rab8b-prov protein (LOC572544),
           partial mRNA
          Length = 225

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 311 tgcagatatgggatacggcagggcaggagag 341
           ||||||||||||| |||||||| ||||||||
Sbjct: 77  tgcagatatgggacacggcaggacaggagag 107

---

>dbj|AK165812.1| Mus musculus 16 days neonate male diencephalon cDNA, RIKEN
           full-length enriched library, clone:G630092I16
           product:RAB14, member RAS oncogene family, full insert
           sequence
          Length = 1609

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 401 tgcagatttgggatacagcagggcaggagcggttc 435

---

>dbj|AK168867.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920061O03
           product:RAB14, member RAS oncogene family, full insert
           sequence
          Length = 2552

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 423 tgcagatttgggatacagcagggcaggagcggttc 457

---

>dbj|AK160859.1| Mus musculus adult male brain cDNA, RIKEN full-length enriched
           library, clone:3632417C20 product:RAB14, member RAS
           oncogene family, full insert sequence
          Length = 3080

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 554 tgcagatttgggatacagcagggcaggagcggttc 588

---

>dbj|AK168551.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920034C15
           product:RAB14, member RAS oncogene family, full insert
           sequence
          Length = 2937

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 411 tgcagatttgggatacagcagggcaggagcggttc 445

---

>dbj|AK169396.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920194L09
           product:RAB14, member RAS oncogene family, full insert
           sequence
          Length = 2942

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 425 tgcagatttgggatacagcagggcaggagcggttc 459

---

>dbj|AB169319.1| Macaca fascicularis testis cDNA, clone: QtsA-19013, similar to
           human RAB2, member RAS oncogene family (RAB2), mRNA,
           RefSeq: NM_002865.1
          Length = 2110

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 394 cagatatgggatacggcagggca 416

---

>dbj|AB169768.1| Macaca fascicularis brain cDNA, clone: QtrA-12017, similar to human
           RAB2, member RAS oncogene family (RAB2), mRNA, RefSeq:
           NM_002865.1
          Length = 2126

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 397 cagatatgggatacggcagggca 419

---

>dbj|AK013410.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810475J17 product:RAB14, member
           RAS oncogene family, full insert sequence
          Length = 803

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 407 tgcagatttgggatacagcagggcaggagcggttc 441

---

>dbj|AK002704.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610030G24 product:RAB14, member RAS
           oncogene family, full insert sequence
          Length = 993

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| |||||||||||| |||||
Sbjct: 426 tgcagatttgggatacagcagggcaggagcggttc 460

---

>dbj|AK083451.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:D030017L14 product:RAB14, member
            RAS oncogene family, full insert sequence
          Length = 3719

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 311  tgcagatatgggatacggcagggcaggagaggttc 345
            ||||||| |||||||| |||||||||||| |||||
Sbjct: 1425 tgcagatttgggatacagcagggcaggagcggttc 1459

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 313      cagatatgggatacggcagggcaggagaggt 343
                |||||||||||||| || |||||||||||||
Sbjct: 34380613 cagatatgggatactgctgggcaggagaggt 34380583



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 68       gggagggaagagcgccaggg 87
                ||||||||||||||||||||
Sbjct: 10605042 gggagggaagagcgccaggg 10605023



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 320     gggatacggcagggcaggagaggttccagagc 351
               ||||||| || |||||||||||||||| ||||
Sbjct: 4746509 gggatacagctgggcaggagaggttccggagc 4746540

---

>ref|NM_001003318.1| Canis familiaris RAB2, member RAS oncogene family (RAB2), mRNA
          Length = 656

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 178 cagatatgggatacggcagggca 200

---

>gb|AC093018.4| Oryza sativa chromosome 3 BAC OSJNBb0081B07 genomic sequence, complete
             sequence
          Length = 143205

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 313   cagatatgggatacggcagggcaggagaggt 343
             |||||||||||||| || |||||||||||||
Sbjct: 44857 cagatatgggatactgctgggcaggagaggt 44887

---

>dbj|AK179960.1| Mus musculus cDNA, clone:Y0G0112G03, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000070298, based on BLAT search
          Length = 173

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 208 atgaaccagtatgtgaacaagaaattcagccagcagtacaag 249
           ||||||||||||||||| ||||| |||||  | |||||||||
Sbjct: 118 atgaaccagtatgtgaanaagaagttcagtaaccagtacaag 159

---

>gb|AY888662.1| Synthetic construct Homo sapiens clone FLH010119.01X RAB2 member
           RAS oncogene family (RAB2) mRNA, complete cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>gb|AY891306.1| Synthetic construct Homo sapiens clone FLH010115.01L RAB2 member
           RAS oncogene family (RAB2) mRNA, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>gb|AY891305.1| Synthetic construct Homo sapiens clone FLH010114.01L RAB2 member
           RAS oncogene family (RAB2) mRNA, partial cds
          Length = 639

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 172 cagatatgggatacggcagggca 194

---

>dbj|AK067508.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013110L21, full
            insert sequence
          Length = 3009

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 313  cagatatgggatacggcagggcaggagaggt 343
            |||||||||||||| || |||||||||||||
Sbjct: 2308 cagatatgggatactgctgggcaggagaggt 2338

---

>dbj|AK061336.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-B12, full
           insert sequence
          Length = 1217

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 313 cagatatgggatacggcagggcaggagaggt 343
           |||||||||||||| || |||||||||||||
Sbjct: 324 cagatatgggatactgctgggcaggagaggt 354

---

>gb|AF116243.1|AF116243 Gossypium hirsutum RAS-related GTP-binding protein (Rab7) mRNA,
           complete cds
          Length = 1049

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 310 ttgcagatatgggatacggcagggcaggagaggtt 344
           ||||||||||||||||| || |||||||| |||||
Sbjct: 254 ttgcagatatgggatactgctgggcaggaaaggtt 288

---

>emb|AL773523.4| Mouse DNA sequence from clone RP23-186B18 on chromosome 2, complete
             sequence
          Length = 198403

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 311   tgcagatatgggatacggcagggcaggagaggttc 345
             ||||||| |||||||| |||||||||||| |||||
Sbjct: 34076 tgcagatttgggatacagcagggcaggagcggttc 34042

---

>gb|M28213.1|HUMRAB2A Homo sapiens GTP-binding protein (RAB2) mRNA, complete cds
          Length = 706

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 212 cagatatgggatacggcagggca 234

---

>gb|M83680.1|RATRAB14X Sprague-Dawley (clone LRB13) RAB14 mRNA, complete cds
          Length = 774

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 311 tgcagatatgggatacggcagggcaggagaggttc 345
           ||||||| |||||||| ||||| ||||||||||||
Sbjct: 191 tgcagatttgggatacagcaggacaggagaggttc 225

---

>gb|M35521.1|DOGRAB2A C.familiaris GTP-binding protein (rab2) mRNA, complete cds
          Length = 656

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 313 cagatatgggatacggcagggca 335
           |||||||||||||||||||||||
Sbjct: 178 cagatatgggatacggcagggca 200

---

>ref|NM_117040.2| Arabidopsis thaliana GTP binding AT4G09720 transcript variant
           AT4G09720.1 mRNA, complete cds
          Length = 975

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 158 tgctcaaggtcatcgtcctcggcgacagcggggt 191
           ||||||||||||| |||||||| ||||| |||||
Sbjct: 153 tgctcaaggtcattgtcctcggtgacagtggggt 186

---

>ref|XM_529084.1| PREDICTED: Pan troglodytes similar to Ras-related protein Rab-9B
           (Rab-9L) (RAB9-like protein) (LOC473711), mRNA
          Length = 855

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 362 ccttctacaggggagccgactgctgc 387
           |||||||||||||||| |||||||||
Sbjct: 473 ccttctacaggggagcagactgctgc 498

---

>ref|XM_510426.1| PREDICTED: Pan troglodytes similar to Ras-related protein Rab-27A;
           GTP-binding protein Ram (LOC453455), mRNA
          Length = 781

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||| ||||||| || |||||||||||||||||
Sbjct: 236 tgcagttatgggacacagcagggcaggagaggtt 269

---

>ref|NM_001030328.2| Xenopus tropicalis RAB5A protein (RAB5A), mRNA
          Length = 1003

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 314 agatatgggatacggcagggcaggagaggt 343
           |||| ||||| |||||||||||||||||||
Sbjct: 427 agatctgggacacggcagggcaggagaggt 456

---

>gb|AY725788.1| Oncometopia nigricans putative Rab7 mRNA, complete cds
          Length = 621

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||||| ||||| ||||| ||||||||||||||
Sbjct: 176 tgcagatctgggacacggctgggcaggagaggtt 209

---

>gb|AY190723.1| Pagrus major RAP2B-like protein mRNA, complete cds
          Length = 692

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 500 tggtcgggaacaaggtcgatctggactctg 529
           ||||||||||||||||||| ||||| ||||
Sbjct: 428 tggtcgggaacaaggtcgacctggagtctg 457

---

>gb|BC076054.1| Danio rerio zgc:92523, mRNA (cDNA clone MGC:92523 IMAGE:7048106),
           complete cds
          Length = 1735

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 316 atatgggatacggcagggcaggagaggttc 345
           ||||||||||| ||||| ||||||||||||
Sbjct: 192 atatgggataccgcaggtcaggagaggttc 221

---

>ref|XM_589286.2| PREDICTED: Bos taurus similar to olfactory receptor, family 7,
            subfamily A, member 17 (LOC511866), mRNA
          Length = 2018

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 362  ccttctacaggggagccgactgctgc 387
            |||||||||||||||| |||||||||
Sbjct: 1479 ccttctacaggggagcagactgctgc 1504

---

>ref|XM_867247.1| PREDICTED: Bos taurus similar to Ras-related protein Rab-9B
           (Rab-9L) (RAB9-like protein) (LOC615445), mRNA
          Length = 537

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 362 ccttctacaggggagccgactgctgc 387
           |||||||||||||||| |||||||||
Sbjct: 155 ccttctacaggggagcagactgctgc 180

---

>ref|XM_870595.1| PREDICTED: Bos taurus similar to VPS10 domain-containing receptor
           SorCS2 precursor (LOC618264), mRNA
          Length = 1215

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 108 ccaccgccccgtccgcccggcc 129
           ||||||||||||||||||||||
Sbjct: 241 ccaccgccccgtccgcccggcc 220

---

>ref|NM_023635.2| Mus musculus RAB27A, member RAS oncogene family (Rab27a), mRNA
          Length = 2973

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||| ||||||| ||||| ||||||||||||||
Sbjct: 380 tgcagttatgggacacggcggggcaggagaggtt 413

---

>gb|BT013145.1| Lycopersicon esculentum clone 134140R, mRNA sequence
          Length = 1221

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 314 agatatgggatacggcagggcaggagaggt 343
           ||||||||||||| || |||||||||||||
Sbjct: 252 agatatgggatactgctgggcaggagaggt 281

---

>ref|NM_016370.1| Homo sapiens RAB9B, member RAS oncogene family (RAB9B), mRNA
          Length = 1049

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 362 ccttctacaggggagccgactgctgc 387
           |||||||||||||||| |||||||||
Sbjct: 509 ccttctacaggggagcagactgctgc 534

---

>gb|AY558420.1| Saccharomyces cerevisiae clone FLH111470.01X YNL093W gene, complete
           cds
          Length = 663

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 316 atatgggatacggcagggcaggagag 341
           ||||||||||||||||| ||||||||
Sbjct: 193 atatgggatacggcaggccaggagag 218

---

>emb|AL032621.1|CEY45F3A Caenorhabditis elegans YAC Y45F3A, complete sequence
          Length = 36654

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 319  tgggatacggcagggcaggagaggtt 344
            |||||||||||||| |||||||||||
Sbjct: 4084 tgggatacggcaggtcaggagaggtt 4109

---

>gb|BC098667.1| Rattus norvegicus RAB27A, member RAS oncogene family, mRNA (cDNA
           clone MGC:112618 IMAGE:7384913), complete cds
          Length = 2704

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||| ||||||| ||||| ||||||||||||||
Sbjct: 273 tgcagttatgggacacggcggggcaggagaggtt 306

---

>ref|XM_810366.1| Trypanosoma cruzi strain CL Brener ras-related protein rab-2a
           (Tc00.1047053506425.169) partial mRNA
          Length = 276

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 313 cagatatgggatacggcagggcaggagaggttcc 346
           ||||| ||||||||||| ||||||||||| ||||
Sbjct: 175 cagatttgggatacggcggggcaggagagtttcc 208

---

>gb|BC008173.1| Mus musculus RAB27A, member RAS oncogene family, mRNA (cDNA clone
           MGC:11677 IMAGE:3710213), complete cds
          Length = 1995

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 311 tgcagatatgggatacggcagggcaggagaggtt 344
           ||||| ||||||| ||||| ||||||||||||||
Sbjct: 539 tgcagttatgggacacggcggggcaggagaggtt 572


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,080,227
Number of Sequences: 3902068
Number of extensions: 4080227
Number of successful extensions: 92166
Number of sequences better than 10.0: 523
Number of HSP's better than 10.0 without gapping: 523
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 90325
Number of HSP's gapped (non-prelim): 1826
length of query: 540
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 517
effective length of database: 17,143,297,704
effective search space: 8863084912968
effective search space used: 8863084912968
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---